Published in the United States of America
2020 * VOLUME 14 « NUMBER 3
AMPHIBIAN & REPTILE
C SS ZaSh ION
==
IL RUE NW eatin FIP
es ;: a oi x4 ie ram F : Se " =F
% ‘he a Aha ig Z j
—_
~ A Tribute to Joseph C. Mitchell
(4948-2019)
amphibian-reptile-conservation.org
ISSN: 1083-446X eISSN: 1525-9153
Official journal website:
amphibian-reptile-conservation.org
Amphibian & Reptile Conservation
14(3) [Taxonomy Section]: 1-30 (e250).
urn:lsid:zoobank.org:pub:CDB4001E-16D3-421D-B68B-314A89BB0924
Some color in the desert: description of a new species of
Liolaemus (Iguania: Liolaemidae) from southern Peru, and its
conservation status
‘Ling Huamani-Valderrama, ‘Aaron J. Quiroz, Roberto C. Gutiérrez, °*Alvaro Aguilar-Kirigin,
5Wilson Huanca-Mamani, *Pablo Valladares-Fauindez, 7José Cerdena, ”**Juan C. Chaparro,
?Roy Santa Cruz, and *"°Cristian S. Abdala
'Universidad Nacional de San Agustin de Arequipa, Escuela Profesional de Biologia, Ay. Alcides Carrion s/n, Arequipa, PERU *Universidad
Nacional de San Agustin de Arequipa, Museo de Historia Natural, Av. Alcides Carrion s/n, Arequipa, PERU *Red de Investigadores en Herpetologia,
La Paz, Estado Plurinacional de Bolivia, BOLIVIA *Area de Herpetologia, Coleccion Boliviana de Fauna, La Paz, Estado Plurinacional de
BOLIVIA *Departamento de Produccioén Agricola, Facultad de Ciencias Agronomicas, Universidad de Tarapaca, Arica, CHILE °Departamento
de Biologia, Facultad de Ciencias, Universidad de Tarapacd. Velasquez 1775, Arica, CHILE ‘Museo de Biodiversidad del Peru, Urbanizacion
Mariscal Gamarra A-61, Zona 2, Cusco, PERU *Museo de Historia Natural de la Universidad Nacional de San Antonio Abad del Cusco, Paraninfo
Universitario (Plaza de Armas s/n), Cusco, PERU °Consejo Nacional de Investigaciones Cientificas y Técnicas (CONICET)—Unidad Ejecutora
Lillo (UEL), San Miguel de Tucuman, ARGENTINA '°Facultad de Ciencias Naturales e Instituto Miguel Lillo (IML), Universidad Nacional de
Tucuman, San Miguel de Tucuman, ARGENTINA
Abstract.—The desert of southern Peru and northern Chile is an area with a high degree of endemism
in squamate reptiles. In this work, an endemic new species is described in the genus Liolaemus with a
restricted geographical distribution on the western slopes of the La Caldera batholith in the Department of
Arequipa, southern Peru, that inhabits the Desert province of southern Peru, between 1,800 and 2,756 m
asl. The new species is characterized by a unique combination of morphological and molecular characters
that distinguish it from all other Liolaemus species, and it is included in the L. reichei clade within the L.
montanus group. Evidence presented shows that the category of threat corresponds to Endangered under
the IUCN Red List criteria.
Keywords. Arequipa, coastal desert, Endangered, La Caldera batholith, Liolaemus insolitus, lizard, Reptilia
Citation: Huamani-Valderrama L, Quiroz AJ, Gutiérrez RC, Aguilar-Kirigin A, Huanca-Mamani W, Valladares-Faundez P, Cerdefia J, Chaparro JC,
Santa Cruz R, Abdala CS. 2020. Some color in the desert: description of a new species of Liolaemus (Iguania: Liolaemidae) from southern Peru, and
its conservation status. Amphibian & Reptile Conservation 14(3) [Taxonomy Section]: 1-30 (e250).
Copyright: © 2020 Huamani-Valderrama et al. This is an open access article distributed under the terms of the Creative Commons Attribution License
[Attribution 4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction
in any medium, provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced,
are as follows: official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 15 July 2020; Published: 2 September 2020
Introduction
The Desert province of the South American Transition
Zone (sensu Morrone 2014), a biogeographic area that
corresponds to a narrow strip along the Pacific Ocean
coast from northern Peru to northern Chile (Fig. 1), is
located in southern Peru near the Chilean border. This
desert contains one of the most hyper-arid deserts in the
world, the La Joya desert, which includes areas with zero
annual rainfall (Valdivia-Silva et al. 2012) and soils with
characteristics like the surface of Mars (Valdivia-Silva
et al. 2011). The southern portion of the Desert province
harbors a distinctive biota characterized by many endemic
plants and animals (e.g., Gutiérrez et al. 2019; Malaga et
al. 2020). The knowledge of the amphibians and reptiles
in this area remains scarce compared to the desert areas
in Chile and Argentina (Escomel 1929; Dixon and Wright
1975; Péfaur et al. 1978a,b; Cei and Péfaur 1982; Frost
1992; Carrillo and Icochea 1995; Zeballos et al. 2002;
Gutiérrez et al. 2010; Abdala y Quinteros 2014); although
in recent years three species of Liolaemus lizards were
described from this region (Aguilar-Puntriano et al. 2019;
Villegas-Paredes et al. 2020).
The South American genus Liolaemus comprises
more than 270 formally described species (Abdala and
Quinteros 2014; Gutiérrez et al. 2018; Abdala et al. 2019;
Villegas-Paredes et al. 2020; Chaparro et al. 2020). These
lizards occupy habitats ranging from hot areas, such as
Amphib. Reptile Conserv.
September 2020 | Volume 14 | Number 3 | e250
A new species of Liolaemus from Peru
70°0'O"W
5°0'0"S
10°0'0"S
Rond6nia province
15°0'0"S
PACIFIC OCEAN
20°0'0"S
25°0'0"S
6,000 km /
J
i eS
Prepuna pra
80°0'O"W 75°0'O"W 70°0'O"W
65°0'0"W
65°0'0"W
Madeira province
10°0'0O"S
Legend
@ La Caldera batholith
Atacaman province
(| Cerrado province
(| Chacoan province
Desert province
(| Ecuadorian province
@ Madeira province
Monte province
(J Paramo province
(4 Prepuna province
[ Puna province
Rondénia province
(| Ucayali province
Gi Yungas province
72]
f=)
o
°
it)
me
20°0'0"S
25°0'0"S
60°0'0"W
Fig. 1. Biogeographic regionalization proposed by Morrone (2014), showing the limits of the Desert province and Atacama prov-
ince. The geoform La Caldera batholith, adapted from Ramos (2008), is also shown.
the Atlantic coast of southern Brazil and the continental
deserts in Chile, Peru, and Argentina, to very cold regions
such as Patagonia in Argentina or the high Central Andes
in Peru and Bolivia, and reaching elevations greater than
5,000 m asl (Abdala and Quinteros 2014; Gutiérrez et al.
2018; Abdala et al. 2020; Ruiz et al. 2019; Quinteros et
al. 2020).
The great diversity within Liolaemus includes a few
species with a wide distribution range, such as L. darwinii
(Abdala 2007), L. multicolor (Abdala et al. 2020), and L.
wiegmannii (Villamil et al. 2019), in addition to a large
number of species with very restricted distributions, e.g.,
L. halonastes (Lobo et al. 2010), L. rabinoi (Abdala et
al. 2017), and L. balagueri (Villegas-Paredes et al. 2020).
Liolaemus is divided into the subgenera Eulaemus and
Liolaemus sensu stricto (Laurent 1983, 1985; Schulte
et al. 2001). Within these subgenera, a large number of
monophyletic groups have been named (Etheridge 1995;
Lobo 2005; Avila et al. 2006; Abdala 2007; Quinteros
2013; Breitman et al. 2011; Abdala et al. 2020).
One of the large groups within Eulaemus is the L.
montanus group (Etheridge 1995; Abdala et al. 2020),
which is made up of more than 60 described species, and
several unnamed species (Abdala et al. 2020). In general,
the L. montanus group has been studied in recent years
from various branches of biology (Halloy et al. 2013;
Amphib. Reptile Conserv.
Troncoso-Yafiez 2013; Riveros-Riffo and Torres-Murua
2015; Ruiz de Gamboa and Ortiz-Zapara 2016; Aguilar-
Kirigin and Abdala 2016; Aguilar-Kirigin et al. 2016;
Quipildor et al. 2018), however the taxonomy (Abdala
et al. 2008, 2009, 2013; Lobo et al. 2010; Quinteros and
Abdala 2011; Gutiérrez et al. 2018; Ruiz de Gamboa et al.
2018; Aguilar et al. 2017; Aguilar-Puntriano et al. 2019;
Abdala et al. 2019), and the phylogenetic hypotheses
(Aguilar et al. 2017; Abdala et al. 2020; Chaparro et
al. 2020), are the areas that have been most developed,
providing essential information for understanding the
distribution and diversity of the group. However, essential
knowledge gaps remain, including sensitive and important
issues such as conservation and natural history. In total, 17
species of L. montanus group have been reported for Peru
(Chaparro et al. 2020), with six species recorded in the
last three years (Gutiérrez et al. 2018; Aguilar-Puntriano
et al. 2019; Chaparro et al. 2020; Villegas-Paredes et
al. 2020). Additionally, in recent integrative taxonomy
studies (Aguilar et al. 2017; Abdala et al. 2020), several
populations of unnamed species representing independent
lineages have been proposed.
While the Z. montanus species group largely inhabits
cold and high-altitude environments, the species of the L.
reichei clade (sensu Abdala et al. 2020) occupy coastal
habitats of northern Chile and southern Peru (e.g., Aguilar-
September 2020 | Volume 14 | Number 3 | e250
Huamani-Valderrama et al.
Table 1. Species list of Liolaemus reichei clade.
Species name Author(s)
Liolaemus audituvelatus
Villegas et al. 2020
Aguilar et al. 2019
Cei y Péfaur 1982
Aguilar et al. 2019
Valladares 2004
(Werner 1907)
(Steindachner 1891)
(Nufiez et al. 1891)
Liolaemus balagueri
Liolaemus chiribaya
Liolaemus insolitus
Liolaemus nazca
Liolaemus poconchilensis
Liolaemus reichei
Liolaemus stolzmanni
Liolaemus torresi
Puntriano et al. 2018; Villegas-Paredes et al. 2020). The
known diversity of the L. reichei clade (Table 1) has
increased considerably in recent years with the description
of L. balagueri (Villegas-Paredes et al. 2020), as well as
L. chiribaya and L. nazca (Aguilar-Puntriano et al. 2019).
Various taxonomic and phylogenetic hypotheses have
been proposed recently for the L. reichei group (Langstroth
2011; Aguilar-Puntriano et al. 2018; Ruiz de Gamboa et al.
2018; Valladares et al. 2018; Abdala et al. 2020; Villegas-
Paredes et al. 2020; Chaparro et al. 2020). Abdala et al.
(2020) recovered seven candidate species within their L.
reichei clade which are all very close phylogenetically to
L. insolitus, a species with a distribution restricted to its
type locality in the coastal desert of the Department of
Arequipa. In the present study, the taxonomic hypothesis
of one of these unnamed populations is evaluated using
the general or unified concept of species (De Queiroz
1998, 2007). This concept defines a species as an
entity that represents independent historical lineages or
divergent lineages of metapopulations. Our criteria to
determine the independence of this lineage is based on
Total Evidence, such as phylogenetics (molecular and
morphological), multivariate statistical analysis, and the
description of unique morphological characters; and the
results provide decisive evidence to describe it as a new
species of Liolaemus.
Materials and Methods
Images and maps. Photographs of live specimens were
taken using a digital camera Canon sx50 hs. Close-
up photographs of the holotype (preserved) were taken
with a digital camera Canon EOS Rebel T5. Maps were
elaborated using ArcMap 10.3, and use coordinates
previously cited by Aguilar et al. (2016), Gutiérrez et
al. (2018), and Chaparro et al. (2020). Type localities
were taken from the original manuscripts of the species
descriptions. Coordinates of the records reported here
were obtained with a GPS device (datum WGS84),
Garmin Etrex 30. The regionalization map was elaborated
using shape files design from Lowenberg-Neto, which
follows Morrone (2014).
Amphib. Reptile Conserv.
(Nufiez and Yafiez 1983)
Distribution
Chile: Antofagasta/ Atacama Regions
Peru: Arequipa Department
Peru: Moquegua Department
Peru: Arequipa Department
Peru: Arequipa Department
Peru: Tacna Department, Chile: Arica Region
Chile: Tarapaca Region
Chile: Antofagasta Region
Chile: Antofagasta Region
Material examined. Specimens of Liolaemus examined
were from the Museo de Historia Natural de la Universidad
Nacional de San Agustin de Arequipa, Pert (MUSA);
Museo de Biodiversidad del Pert, Cusco, Peru (MUBI);
Fundacion Miguel Lillo, Tucuman, Argentina (FML); and
Museo de Historia Natural de la Universidad Nacional
Mayor de San Marcos, Lima, Peru (MUSM). Collected
specimens of Lio/aemus were captured by hand within the
locality of La Caldera batholith, District of Uchumayo,
Province of Arequipa, Department of Arequipa, Peru.
Specimens were euthanized with a 1% Halatal solution,
fixed with 10% formaldehyde, and stored in 70% alcohol.
Prior to fixation, a sample of muscle was collected for
DNA extraction and fixed in 96% ethanol. Collected
specimens are deposited in the collections of MUSA and
MUBI. Appendix I details the specimens used for the first
time here, as well as those reanalyzed for the present work
but previously examined in Abdala and Quinteros (2008),
Abdala et al. (2008, 2009, 2013), Quinteros et al. (2008),
Quinteros and Abdala (2011), Gutiérrez et al. (2018), and
Abdala et al. (2020). Additional data were obtained from
the literature for L. erroneous (Nufiez and Yafiez 1984),
L. omorfi (Demangel et al. 2015), and L. stolzmanni
(Langstroth 2011).
Conservation status and endemism. The [UCN (2001,
2020) criteria were used to categorize the new species.
The extent of occurrence (EOO), and area of occupancy
(AOO), were obtained using the GeoCat tool (http://
geocat.kew.org/), which is a tool that follows IUCN
criteria. The endemic concept and restricted range of
distribution followed Bruchmann and Hobohm (2014),
IUCN (2016), Kier and Barthlott (2001), and Noguera-
Urbano (2017).
Morphological data. Morphological characters utilized
in taxonomic studies of Liolaemus were studied here,
mainly those described or cited by Laurent (1985),
Etheridge (1995, 2000), Abdala (2007), Abdala and
Juarez (2013), Gutiérrez et al. (2018), Aguilar-Puntriano
et al. (2018), Villegas-Paredes et al. (2020), and Abdala et
al. (2020). The coloration description was based on live
specimens and digital photographs taken in the field. Color
September 2020 | Volume 14 | Number 3 | e250
A new species of Liolaemus from Peru
pattern terminology follows Lobo and Espinoza (1999),
Abdala (2007), and Abdala et al. (2020). Examination of
scalation or pholidosis was performed using a binocular
stereoscope (10—40x), and morphometric measurements
were made with a Mitutoyo caliper with precision of
0.01 mm. The morphometric variables were measured
three times on the same individual, and the mean value
for each species was used in the statistical analyses.
Only adult males were used in the multivariate analysis
to avoid confounding effects of intraspecific allometric
variation, and to avoid confusion in the multivariate
analyses due to possible sexual dimorphism (Losos
1990; Abdala et al. 2019). All bilateral characters were
measured on the right side. The measured morphometric
traits and meristic characters counted follow Abdala et al.
(2019) [Appendix IT].
DNA _ extraction, amplification, and sequencing.
Total genomic DNA was extracted from samples
of muscle using the GenElute mammalian genomic
DNA miniprep kit (Sigma-Aldrich), according
to the manufacture’s instructions. A fragment of
approximately 1,174 base pairs of the mitochondrial
gene cytochrome b (cyt-b) was amplified by polymerase
chain reaction (PCR), using the primers IguaCytob_
F2 (5'-CCACCGTTGTTATTCAACTAC-3') and
IguaCytob_R2 (5'-GGTTTACAAGACCAATGCTTT-3')
[Corl et al. 2010]. Each reaction contained 1x PCR buffer
(KCI), 2.5 mM MgCl, 0.25 mM each dNTP, 0.1 uM
each primer, 1 unit of Taq DNA polymerase (Thermo
Scientific), and 1 uL DNA extract. PCR cycling consisted
of a 5 min initial denaturation at 94 °C, 35 cycles of 30
sec at 94 °C; 30 sec at 55 °C; 60 sec at 72 °C, anda
final elongation step of 2 min at 72 °C. The PCR product
was visualized on 1.5% agarose gel stained with Gel-Red
(Biotium, Inc.), and subsequently sent to Macrogen, Inc.
(Seoul, Republic of Korea) for purification and direct
sequencing. The nucleotide sequence was visualized
and edited using 4 Peaks software (http://nucleobytes.
com/4peaks/) and checked manually, and nucleotides
with ambiguous positions were clarified. The sequences
newly obtained in this study are publically available in
GenBank (see Table 2).
Statistical analysis. A Principal Component Analysis
(PCA) was employed to analyze morphological variation,
and discriminant function analyses (DFA) were used to
verify morphological variation between and within each
Liolaemus species employing a jackknife classification
matrix (Manly 2000; McCune and Grace 2002; Quinn
and Keough 2002; Zar 2010). Based on the existing
phylogenetic results (Abdala et al. 2020) and those
obtained, four species of L. reichei clade distributed
in Peru (L. balagueri, L. chiribaya, L. insolitus, and L.
nazca), and the new species proposed here were used as
comparative groups for building the PCA and the DFA.
Normal distributions of the morphometric data were
Amphib. Reptile Conserv.
examined using the Kolmogorov-Smirnov test (P < 0.05),
and homoscedasticity was evaluated with Levene’s test.
To reduce the effect of non-normal distributions of the
morphological data, all continuous variables were log,,
transformed and meristic variables were square root
transformed (Irschick and Losos 1996; Sokal and Rohlf
1998; Peres-Neto and Jackson 2001).
All operational taxonomic units were analyzed by two
distinct treatments. The PCA analysis was performed to
evaluate the distribution of individuals corresponding to
the five species (L. balagueri, L. chiribaya, L. insolitus, L.
nazca, and Liolaemus sp. nov.) in the multivariate space.
The PCA was based on the correlation matrices of the
morphological variables to reduce dimensionality of the
data (Quinn and Keough 2002; Lovett et al. 2000). The
PCA and DFA were evaluated separately for continuous
and meristic characters, following the recommendations of
certain authors not to join both matrices in the multivariate
analyses, although there is no mathematical consensus on
this approach (McGarigal et al. 2000). The PCA evaluates
relationships within a single group of interdependent
variables regardless of any relationships that they may
have outside of that group of variables. After the PCA was
performed, and the lineal combinations that explained the
highest variation were extracted, DFA was performed
independently for continuous and meristic morphological
characters, to identify the combination of morphological
characters that best differ between the groups identified
by the PCA. The DFA produces a linear combination
of variables that maximizes the probability of correctly
assigning observations to predetermined groups, and
simultaneously, new observations can be classified into
one of the groups, providing likelihood values of such
classification (McGarigal et al. 2000; Van den Brink et
al. 2003). All statistical analyses were performed using
Statistica software, version 7.0 (http://www.statsoft.com).
Phylogenetic analysis. Three matrices were constructed,
including: (1)morphological data; (2) molecular characters
(cyt-b); and (3) both morphological and molecular data.
Total Evidence and morphological phylogenetic analysis
were performed using the matrix of Abdala et al. (2020).
The morphological matrix includes 306 characters
and 105 terminals (with Crenoblepharys adspersa and
Phymaturus palluma as an “outgroup” and 96 terminals of
L. montanus group). The Total Evidence matrix included
105 terminals and 3,390 characters. Parsimony was used as
the optimality criterion, only selecting the shortest trees or
those with the fewest homoplasies. TNT version 1.5 (Tree
Analysis Using New Technology; Goloboff et al. 2003)
was employed to generate the phylogenetic hypotheses.
Continuous characters were analyzed following Goloboff
et al. (2006), and were standardized using the function
mkstandb.run. For this analysis, the value of two was
considered as the highest transformation cost. Heuristic
searching was used to find the shortest trees or those with
the smallest number of steps. The matrix was analyzed
September 2020 | Volume 14 | Number 3 | e250
Huamani-Valderrama et al.
Table 2. GenBank codes and voucher information of Liolaemus and outgroup specimens sequenced for this study.
Ctenoblepharys adspersa (outgroup)
Ls
i Bs
tS
L. poconchilensis
L. poconchilensis
L. poconchilensis
L. poconchilensis
Amphib. Reptile Conserv.
co
annectens
annectens
. annectens
. annectens “Lampa”
. balagueri
. balagueri
. chiribaya
. etheridgei
. etheridgei
. etheridgei
. etheridgei
. etheridgei
. etheridgei
. Stolzmanni
. Stolzmanni
torresi
torresi
torresi
. insolitus
. insolitus
. dorbignyi
. eleodori
. audituvelatus
. audituvelatus
. audituvelatus
. audituvelatus
. audituvelatus
. audituvelatus
.vallecurensis
. nazca (L. “Nazca’’)
. nazca (L. “Nazca’’)
nazca (L. “Nazca’”’)
. nazca (L. “Nazca’’)
nazca (L. “Nazca’’)
. ortiz
. ortiz
L. aff. poconchilensis
Species names
Voucher code
BYU 50502
BYU 50489
BYU 50486
BYU 50491
MUSM 31433
MUSA 5575
MUSA 5576
BYU 51568
BYU 50494
BYU 50495
BYU 50497
BYU 50493
BYU 50499
MUSM 31494
LNC 138
MR 213
LNC 146
LNC 134
LNC 133
MUSM 31490
BYU 50462
LJAMMCNP 5002
LJAMMCNP 2709
LNC 136
LNC 86
ERI
MUAP104
SSUC-Re760
LNC 135
LJAMMCNP 650
BYU 50472
BYU 50507
BYU 50508
MUSM 31523
MUSM 31524
MUSM 31513
MUSM 31514
MUSM 31545
MUSM 31543
MUSM 31544
MZUC43498
MZUC43497
cyt-b
MH981364
KX826616
KX826615
KX826617
KX826618
MK568539
MK568538
MH981365
KX826620
KX826621
KX826622
KX826619
KX826623
KX826625
MH184793
MH184794
MH184797
MH184795
MH184796
KX826627
KX826626
KF968848
KF968850
MH184785
MH184779
MH184780
MH184782
MH184783
MH184784
KF968960
KX826673
KX826674
KX826675
KX826676
KX826677
KX826633
KX826634
KX826637
KX826635
KX826636
MH184798
MH184799
September 2020 | Volume 14 | Number 3 | e250
Source
Aguilar-Puntriano et al. 2018
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Villegas-Paredes et al. 2020
Villegas-Paredes et al. 2020
Aguilar-Puntriano et al. 2018
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Ruiz De Gamboa et al. 2018
Ruiz De Gamboa et al. 2018
Ruiz De Gamboa et al. 2018
Ruiz De Gamboa et al. 2018
Ruiz De Gamboa et al. 2018
Aguilar et al. 2016
Aguilar et al. 2016
Olave et al. 2014
Olave et al. 2014
Ruiz De Gamboa et al. 2018
Ruiz De Gamboa et al. 2018
Ruiz De Gamboa et al. 2018
Ruiz De Gamboa et al. 2018
Ruiz De Gamboa et al. 2018
Ruiz De Gamboa et al. 2018
Olave et al. 2014
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Ruiz De Gamboa et al. 2018
Ruiz De Gamboa et al. 2018
Table 2 (continued). GenBank codes and voucher information of Liolaemus and outgroup specimens sequenced for this study.
L. polystictus
L. polystictus
Species names
E.
sik
i
co
qalaywa
qalaywa
“Apurimac”
. robustus
. robustus
. robustus
. robustus
thomasi
thomasi
thomasi
thomasi
thomasi
. signifer
. signifer
. signifer
. signifer
. signifer
. signifer
. signifer
. signifer
. signifer
melanogaster
melanogaster
melanogaster
. melanogaster
. victormoralesii (L.
. victormoralesii (L.
. victormoralesii (L.
. victormoralesii (L.
. victormoralesii (L.
. victormoralesii (L.
. victormoralesii (L.
. victormoralesii (L.
. victormoralesii (L.
. victormoralesii (L.
. victormoralesii (L.
. victormoralesii (L.
. williamsi
. Williamsi
. williamsi
“AbraToccto’)
“AbraToccto’)
“AbraToccto’)
“AbraToccto’)
“AbraToccto’)
“AbraToccto’”)
“AbraToccto’”)
“AbraToccto’)
“AbraToccto’)
“AbraToccto’”)
“AbraToccto’”)
“AbraToccto’)
Amphib. Reptile Conserv.
Voucher code
MUSM 31451
MUSM 31446
MUBI 12081
MUBI 12099
MUSM 27694
MUSM 31504
MUSM 31508
MUSM 31505
BYU 50483
BYU 50469
BYU 50466
MUSM 31516
BYU 50467
MUBI 5925
MUSM 31443
MUSM 31434
BYU 50444
BYU 50357
BYU 50350
MUSM 31437
BYU 50355
MUSM 31447
MUSM 29110
BYU 50151
MUSM 31472
MUSM 31475
BYU 50154
MUSM 31371
MUSM 31374
MUSM 31373
BYU 50426
MUSM 31461
BYU 50430
MUSM 31462
BYU 50431
BYU 50428
MUSM 31464
MUSM 31465
MUSM 31468
BYU 50463
MUSM 31485
BYU 50143
A new species of Liolaemus from Peru
cyt-b
KX826642
KX826641
MT366061
MT366062
MH98 1371
KX826646
KX826648
KX826647
KX826643
KX826680
KX826678
KX826681
KX826679
MT366060
KX826656
KX826654
KX826652
KX826651
KX826649
KX826655
KX826650
KX826657
KX826653
KX826628
KX826630
KX826631
KX826629
KX826665
KX826667
KX826666
KX826661
KX826668
KX826663
KX826669
KX826664
KX826662
KX826670
KX826671
KX826672
KX826684
KX826687
KX826682
September 2020 | Volume 14 | Number 3 | e250
Source
Aguilar et al. 2016
Aguilar et al. 2016
Chaparro et al. 2020
Chaparro et al. 2020
Aguilar-Puntriano et al. 2018
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Chaparro et al. 2020
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Aguilar et al. 2016
Table 2 (continued). GenBank codes and voucher information of Liolaemus and outgroup specimens sequenced for this study.
Huamani-Valderrama et al.
Species names Voucher code cyt-b Source
L. williamsi BYU 50464 KX826685 Aguilar et al. 2016
L. williamsi BYU 50144 KX826683 Aguilar et al. 2016
L. williamsi MUSM 31486 KX826688 Aguilar et al. 2016
L. williamsi BYU 50465 KX826686 Aguilar et al. 2016
L. “AbraApacheta” MUSM 31481 KX826660 Aguilar et al. 2016
L. “AbraApacheta” BYU 50145 KX826658 Aguilar et al. 2016
L. “AbraApacheta” BYU 50148 KX826659 Aguilar et al. 2016
L. polystictus “Castrovirreyna” MUSM 31454 KX826639 Aguilar et al. 2016
L. polystictus “Castrovirreyna” BYU 50630 KX826638 Aguilar et al. 2016
L. polystictus “Castrovirreyna” BYU 31455 KX826640 Aguilar et al. 2016
L. robustus “MinaMartha” BYU 50438 KX826644 Aguilar et al. 2016
L. robustus “MinaMartha” MUSM 31439 KX826645 Aguilar et al. 2016
L. annectens LDHV 73 MT773391 This study
L. aff. annectens LECG 078 MT773392 This study
L. “Cotahuasi” RGP 6031 MT773393 This study
L. “Cotahuasi” MDUM 006 MT773394 This study
L. “Cotahuasi” MDUM 005 MT773395 This study
L. “Cotahuasi” MDUM 004 MT773396 This study
L. aff. galaywal MDUM 001 MT773397 This study
L. aff. galaywal MDUM 002 MT773398 This study
L. aff. galaywa MDUM 017 MT773399 This study
L. aff. galaywa MDUM 014 MT773400 This study
L. aff. galaywa MDUM 007 MT773401 This study
L. aff. galaywa VOI 009 MT773402 This study
L. aff. galaywa VOI 006 MT773403 This study
L. chiribaya AQR 003 MT773404 This study
L. chiribaya AQR 004 MT773405 This study
L. aff. insolitus4 RGP 6249 MT773406 This study
L. sp. nov. (described herein) MUSA 1766 MT773407 This study
L. sp. nov. (described herein) MUBI 13522 MT773408 This study
L. sp. nov. (described herein) MUBI 14417 MT773409 This study
L. aff. insolitus6 MUSA 1769 MT773410 This study
L. aff. insolitus6 MUSA 1770 MT773411 This study
L. aff. insolitus6 MUSA 1771 MT773412 This study
L. insolitus AQR 001 MT1T773413 This study
L. insolitus AQR 002 MT1T773414 This study
L. aff balagueri LDHV 005 MT771288 This study
L. aff. insolitus2 RGP 6147 MT1T773415 This study
L. aff. insolitus8 RGP 6154 MT773416 This study
using the “implied weights” method (Goloboff 1993). The
value of the constants K = 14 (morphological analysis)
and K = 19 (Total Evidence analysis) were used as in the
analysis of Abdala et al. (2020). One thousand replications
Amphib. Reptile Conserv.
were performed for each search. Symmetric resampling
was used to obtain support values for the results obtained,
with 500 replications with a deletion probability of 0.33.
To construct the cyt-b tree, sequences from this study
September 2020 | Volume 14 | Number 3 | e250
A new species of Liolaemus from Peru
(13 species) were combined with a published dataset of
24 species, and five undescribed lineages of Liolaemus
(Aguilar et al. 2016; Aguilar-Puntriano et al. 2018, 2019;
Chaparro et al. 2020; De Gamboa et al. 2018; Olave et al.
2014; Villegas-Paredes et al. 2020) [Table 2]. A maximum
likelihood phylogenetic analysis was carried out with
MEGA X (Kumar et al. 2018). Heuristic tree searches
were performed with the GTR + G + I substitution model
(determined based on the Akaike information criterion),
and 1,000 bootstrap replications.
Results and Discussion
The independent taxonomic status of the population of
Liolaemus studied here was validated using morphological
and molecular evidence. The results of the phylogenetic
and statistical analyses described below suggest that
the population can be considered as distinctive from all
other described species of Liolaemus. In accordance with
best practices in zoological nomenclature, the results of
statistical, morphological, and molecular phylogenetic
analyses are provided following the formal presentation
of the new proposed species.
Taxonomy
Liolaemus anqapuka WHuamani-Valderrama, Quiroz,
Gutiérrez, Aguilar-Kirigin, Chaparro, Abdala sp. nov.
(Figs. 2—5).
urn:lsid:zoobank.org:act: EF6A BFF4-97 BC-4C8F-83 E7-79D2B3FE7171
1885 Ctenoblepharis adspersus—Boulenger, Catalogue
of the Lizards in the British Museum (Natural History).
Second Edition 2: 136-137.
1978b “Ctenoblepharus sp.” Péfaur et al. Bulletin de
l'Institut Francais d'Etudes Andines VII (1-2): 129-139.
1982 Liolaemus insolitus Cei and Péfaur, In Actas 8vo
Congreso Latinoamericano de Zoologia. Pp. 573-686.
1995 Ctenoblepharys adspersa—Etheridge, American
Museum Novitates 3142: 1-34.
2004 Phrynosaura [sp.| Nufiez, Noticiario Mensual
Museo de Historia Natural 353: 28-34.
2010 Liolaemus cf. insolitus, Gutierrez and Quiroz,
Herpetofauna del Sur del Pert, Available: http://
herpetofaunadelsurdelperu. blogspot.com [Accessed: 13
June 2020].
2011 Liolaemus species 2, Langstroth, Zootaxa 2809: 32.
2020 Liolaemus aff. insolitus7, Abdala et al., Zoological
Journal of the Linnean Society 189: 1-29.
Holotype. MUSA 5573, an adult male (Figs. 2-3), from
between Quebrada San Jose and Quebrada Tinajones,
District of Uchumayo, Province of Arequipa, Department
of Arequipa, Peru (16°31’47”S, 71°39°04’W) at 2,460 m
asl, collected on 10 November 2013, by C.S. Abdala, R.
Gutiérrez, A. Quiroz, L. Huamani, and J. Cerdefia.
Amphib. Reptile Conserv.
Paratypes. Six adult females: MUSA 5574-75,
same data as holotype. MUSA 1766, from Quebrada
Tinajones, 300 m southeast of holotype (16°31754.29’S,
71°38°57.547°W) at 2,492 m asl, collected on 9 October
2010, by A. Quiroz and J. Cerdefia. MUBI 13522, MUSA
1767, from Quebrada Tinajones, 600 m southeast of
holotype (16°31°54.207"S, 71°38’46.187°W) at 2,528
m asl, collected on 9 October 2010, by A. Quiroz and
J. Cerdefia. MUBI 14680, from Quebrada Tinajones
(16°31°22.705”S, 71°37°35.666"W) at 2,561 m asl,
collected on 27 July 2007, by R. Gutiérrez and A.
Quiroz. Two adult males: MUBI 13521, from Quebrada
Tinajones, 300 m southeast of holotype (16°317°54.29”S,
71°38°57.547°W) at 2,492 m asl, collected on 9 October
2010, by A. Quiroz and J. Cerdefia. MUBI 14417, from
Quebrada Tinajones (16°31’22.705”S, 71°37°35.666”W)
at 2,561 m asl, collected on 27 July 2007, by R. Gutiérrez
and A. Quiroz.
Diagnosis. We assign Liolaemus angapuka sp. nov. to
the L. montanus group because it presents a blade-like
process on the tibia, associated with the hypertrophy of
the tibial muscle tibialis anterior (Abdala et al. 2020;
Etheridge 1995) and its placement in the morphological
and molecular phylogenies (Fig. 11). Within the L.
montanus group, Liolaemus angapuka sp. nov. differs
from L. andinus, L. annectens, L. aymararum, L.
cazianiae, L. chlorostictus, L. dorbignyi, L. fabiani,
L, forsteri, L. foxi, L. gracielae, L. huayra, L. inti, L.
jamesi, L. melanogaster, L. multicolor, L. nigriceps, L.
orientalis, L. pachecoi, L. pantherinus, L. patriciaiturrae,
L. pleopholis, L. polystictus, L. puritamensis, L. qalaywa,
L. robustus, L. scrocchii, L. signifer, L. vallecurensis, L.
victormoralesii, L. vulcanus, and L. williamsi, for being
species of larger size (SVL greater than 75 mm) unlike
L. angapuka sp. nov., which has a maximum SVL of
73.5 mm. Liolaemus angapuka sp. nov., has between
58 and 72 (mean = 64.8) scales around the body, which
differentiates it from species of the group with more than
80 scales, such as L. cazianiae, L. duellmani, L. eleodori,
L. erguetae, L. forsteri, L. gracielae, L. molinai, L.
multicolor, L. nigriceps, L. patriciaiturrae, L. pleopholis,
L. poecilochromus, L. porosus, L. pulcherrimus, L.
robertoi, L. rosenmanni, L. ruibali, and L. vallecurensis;
and also from species with less than 55 scales, like L.
aymararum, L. jamesi, L. pachecoi, and L. thomasi.
Liolaemus angapuka sp. nov. have 60—72 dorsal scales
(mean = 65.5), and differs from L. andinus, L. cazianiae,
L. eleodori, L. erguetae, L. forsteri, L. foxi, L. gracielae,
L. halonastes, L. molinai, L. multicolor, L. nigriceps, L.
patriciaiturrae, L. pleophlolis, L. poecilochromus, L.
porosus, L. pulcherrimus, L. robertoi, L. rosenmanni,
L. ruibali, L. schmidti, and L. vallecurensis, which have
between 75-102 dorsal scales. The number of ventral
scales between 73-87 (mean = 81.3) differentiates it
from species with more than 90 ventral scales, such as L.
andinus, L. cazianiae, L. erguetae, L. eleodori, L. foxi, L.
September 2020 | Volume 14 | Number 3 | e250
Huamani-Valderrama et al.
Fig. 2. Details of the holotype of Liolaemus angapuka sp. nov. (MUSA 5573; SVL = 73.5 mm, Tail = 63.9 mm): (A) dorsal and (B)
ventral views of body; (C) ventral, (D) dorsal, and (E) lateral views of head; (F) ventral view of precloacal pores. Scale = 10 mm.
Amphib. Reptile Conserv. 9 September 2020 | Volume 14 | Number 3 | e250
A new species of Liolaemus from Peru
——_ Oe ee Xa Sie
Fig. 3. Adult male of the holotype, Liolaemus anqapuka sp. nov. (MUSA 5573; SVL =
ment of Arequipa, 2,460 m asl. Photos by C.S. Abdala.
gracielae, L. halonastes, L. hajeki, L. molinai, L. nigriceps,
L. patriciaiturrae, L. pleopholis, L. poecilochromus, L.
porosus, L. robertoi, L. rosenmanni, and L. vallecurensis.
Liolaemus anqapuka sp. nov. has juxtaposed or
subimbricate dorsal scales, without keel or mucron, this
differentiates it from species with conspicuous keel and
mucron, as L. aymararum, L. etheridgei, L. famatinae,
L. fittkaui, L. griseus, L. huacahuasicus, L. montanus, L.
orko, L. ortizi, L. polystictus, L. pulcherrimus, L. galaywa,
L. signifer, L. tajzara, L. thomasi, L. victormoralesii, and
L. williamsi. Females of L. angapuka sp. nov. present 14
(mean = 2.6) precloacal pores, this character differentiates
it from species like L. andinus, L. balagueri, L. fittkaui,
L. multicolor, L. ortizi, L. polystictus, L. puritamensis,
L. robertoi, L. robustus, L. rosenmanni, L. ruibali, L.
thomasi, and L. vallecurensis, because they do not present
precloacal pores in females.
Liolaemus angapuka sp. nov. belongs to the clade of
Liolaemus reichei sensu Abdala et al. (2020). The color
pattern of Liolaemus angapuka sp. nov. has a combination
of characteristics in males and females that distinguish it
from the rest of the Liolaemus of the group. The number of
scales around the body is between 58—72 (mean = 64.8),
which differentiates it from L. audituvelatus, L. balagueri,
L. insolitus, and L. reichei (Table 3). The number of dorsal
scales varies between 60—72 (mean = 65.5), which is
lower than the number in L. audituvelatus, higher than in
L. nazca, and has a variation in range of scales different
than L. chiribaya, L. reichei, and L. torresi (Table 3). The
numbers of ventral scales of Liolaemus angapuka sp.
Amphib. Reptile Conserv.
Se
73.5 mm, Tail = 63.9 mm), from the Depart-
nov. vary between 73—87 (mean = 81) which are different
from L. audituvelatus, L. nazca, and L. torresi (Table 3).
The presence of precloacal pores in females 1—4 (mean =
2.6), is different from L. audituvelatus, L. balagueri, and
L. reichei, whose females do not have precloacal pores
(Table 3). Coloration patterns on lateral sides have light
blue scales, which are different from L. audituvelatus, L.
balagueri, L. nazca, L. torresi, and L. reichei (Table 3). The
existence of dorsal body scales with a keel differentiate
it from L. nazca which have dorsal body scales without
keel. Ventral thigh scales with keel are present in 100%
of individuals of L. angapuka sp. nov. but they are less
evident than those present in L. chiribaya, where only
35% of individuals present this character (Table 3). The
maximum SVL is greater than in L. audituvelatus, L.
poconchilensis, L. reichei, L. stolzmanni, and L. torresi
(Table 3).
Description of the holotype (Figs. 2-3). Adult male
(MUSA 5573), SVL 73.53 mm. Head 1.20 times greater
in length (16.47 mm) than width (13.74 mm). Head
height 10.48 mm. Neck width 14.37 mm. Eye diameter
3.67 mm. Interorbital distance 10.96 mm. Orbit-auditory
meatus distance 6.55 mm. Auditory meatus 2.0 mm high,
0.97 mm wide. Orbit-commissure of mouth distance 5.77
mm. Internasal width 1.58 mm. Subocular scale length
4.09 mm. Trunk length 31.81 mm, width 24.37 mm. Tail
length 63.91 mm. Femur length 14.65 mm, tibia 14.47
mm, and foot 18.01 mm. Humerus length 11.01 mm.
Forearm length 9.31 mm. Hand length 10.82 mm. Pygal
September 2020 | Volume 14 | Number 3 | e250
Huamani-Valderrama et al.
ee ee
OS PT
the Liolaemus anqapuka
Fig. 4. Male specimens of
region length 5.95 mm, and cloacal region width 7.97
mm. Dorsal surface of head rough, with 17 scales, rostral
3.09 times longer (2.78 mm) than wide (0.9 mm). Mental
as long (2.78 mm) as rostral, trapezoidal, surrounded by
four scales. Nasal separated from rostral by one scale. Two
internasals slightly longer than wide. Nasal surrounded by
eight scales, separated from canthal by two scales. Nine
scales between frontal and rostral. Frontals divided into
three scales. Interparietal smaller than parietal, in contact
with six scales. Preocular separated from lorilabials by
one scale. Five superciliaries and 15 upper ciliaries scales.
Three differential scales at anterior margin of auditory
Amphib. Reptile Conserv.
ee Bee
sp. nov. Photos by A.
11
nd C.S. Abdala (E).
meatus. Ten temporary scales. Four lorilabials scales, in
contact with subocular. Seven supralabials, which are
not in contact with subocular. Five supraocular. Eight
lorilabials. Six infralabials. Five chin shields, 4" pair
separated by five scales. Seventy scales around half a
body.
Sixty-two rounded dorsal body scales, juxtaposed, and
without a keel or mucron; laminar anterior on members,
imbricate and slightly keeled; laminar on hind limbs,
imbricate and slightly keeled; tail with dorsal scales in
the first third juxtaposed, and the remaining two-thirds
imbricate, presence of some scales keeled. Eighty-six
& ‘Sete ee
Quiroz (A—D) a
September 2020 | Volume 14 | Number 3 | e250
A new species of Liolaemus from Peru
“ue . 4 ote . .
Fig. 5. Female specimens of the Liolaemus angapuka Sp. nov. Photos by A. Quiroz.
ventral scales, from the mental to the cloacal region,
following the ventral midline of the body, laminar,
imbricated. Thirty-two imbricate gulars, smooth. Neck
with longitudinal fold with 36 granular, not keeled
scales, ear fold and antehumeral fold present. Gular fold
incomplete. Forelimbs ventrally laminar, subimbricate to
imbricate, not keeled; hind legs laminar, imbricate, with
some keeled scales (Figs. 2-3). Seventeen subdigital
lamellae on the 4" finger of the hand. Twenty-one
subdigital lamellae of the 4" toe, with four keels, plantar
scales with keels and mucrons. Lamellar ventral scales
on tail, imbricate, not keeled. Five precloacal pores.
Supernumerary pores absent.
Color of holotype in life (Fig. 3). Dorsal and lateral color
of the neck is light gray with few light blue scales, with
dull orange scales, and spots on side. Dorsum, limbs,
and tail light gray. Vertebral region delimited, vertebral
line and spots absent, but dotted with sky blue scales.
Paravertebral and dorsolateral region of the body, large
orange spots of irregular shape and size stand out. These
orange spots are surrounded and dotted with numerous
sky-blue scales, with thin design or undulating edges. The
orange spots with light white irregular spots. There are no
dorsolateral bands, antehumeral arch, or scapular spots.
On the sides of the body the pattern of orange spots and
Amphib. Reptile Conserv.
12
light blue scales is repeated, but the gray color of the body
is darker. This design extends to the first third of the tail.
Tail with dark semi-complete rings with white back spots.
Midline of the body with orange scales and spots. Back
of the limbs with numerous light white spots unevenly
distributed. Hands and feet dorsally white. Ventrally
white from mental region to the tail. Gular and femoral
regions light yellow. Flanks of the body with a thin orange
border from the armpits to the groin.
Morphological variation. Twenty-two specimens (six
males and 16 females). Dorsal surface of head rough
with 14-21 scales (mean = 16.82; STD = 1.71). Nasal
surrounded by 6—9 scales (mean = 7.41; STD = 0.73).
Supralabials 7-10 scales (mean = 8.18; STD = 0.8),
lorilabials 8-11 scales (mean = 9.32; STD = 0.89). A line
of lorilabial scales. Supraoculars 4—6 (mean = 5.45; STD
= 0.6). Interparietals smaller than parietals, surrounded by
4-8 scales (mean = 6.32; STD = 1.09). Infralabials 6-9
(mean = 7.14; STD = 0.77). Gulars 28—39 (mean = 33.41;
STD = 2.99). Temporals smooth, 7-10 scales (mean =
9.09; STD = 0.97). Meatus auditory higher 1.37—2.47 mm
(mean = 2.05; STD = 0.26), than wide 0.20—1.20 (mean
= 0.81; STD = 0.25). Head longer 12.32—17.20 (mean =
14.91; STD = 1.31) than wide 9.15—15.92 (mean = 12.77;
STD = 2.03). Head height 6.84—10.48 (mean = 8.38; STD
September 2020 | Volume 14 | Number 3 | e250
Huamani-Valderrama et al.
%001
quasqe
posodeyxne
L8 (ZE'18) EL
ZL (65°59) 09
ZL (60'°S9) 8S
Ev (98'8E) ZTE
e(ss TI
II (ZE6) 8
EL Ly
(87 It) ZO'9€
ESTE
(1L'87Z) 89°SZ
%0
yuasoid
Sepeoliquiy
tl (LS 0L) $9
96 (PI PS) €S
09 (9S) €¢
ZE (98'0E) 8Z
7 (981) I
OL (rs) L
Z6 LE
(90°S€) SO'TE
16ST
(Ol €Z) T7761
Z6OST(OLTIVSIT6 tL II (ZL01) 668
TLI (06 V1) TE TI
601 (060) 9Z'0
91'L9
(€8°9S) LL Or
ES EL
(Z6'€9) SULTS
(7 =4)
“AOU
‘ds vyndobup °7
97 91
(SEI) 78 TI
09'°6L
(SS'0L) 97:09
ve 19
(S€'6S) IS ES
(L =U)
DIZDU "TJ
%SE
quasqe
posodeyxn{-qns
pue posodeyxne
LL(LT7L) L9
19 (WLS) ZS
99 (819) SS
ZE (h'8TZ) 8Z
1 (¢8'0) 0
9(g'¢)¢
89 TP
(6L'6€) EL 9€
L867
(1p'8Z) LI'SZ
tr II (67 O01) 768
€9'SI
(00'r1) 8I'ZI
L0'I (86'0) 68°0
68°89
(Lv'9S) ve OF
S789
(09'6S) 87 6r
(Ol =4)
DADQLAIYS *T
%0
quasqe
posodeyxne
L6 (9'06) 98
08 (rr) OL
ZL (9°99) +9
Lv (6S) br
6 (+8) 8
T Tr (1 Ob) 9'8E
¢ O€ (8'8Z) £97
LI@OIDE OI
Srl (9'€1) €I
bl (v'LS) 88S
79 (18S) 8'ES
(g = 4)
ISALL0}] "J
%0
quasqe
poyeoriquit
pue posoderxne
~8 (9°6L) LL
79 (Z'19) LS
79 (h'6S) LS
8E (S 9) SE
1 (S20) 0
€(Z) 1
ial
Z9'TE (Lv) ST TE
CLT (8 PTZ) 77
ES II (601) 196
Or (V€l) ve Il
S9'ES (TL) 99' TH
EVES(LIS)LULY
(p=4)
sisuaj1youosod *T
%0
quasqe
poreolquiy pue
posodeyxni-qns
8L (6 €L) OL
89 (6°79) 9S
gc (rss) Is
8E (L'9€) SE
E(S DI
OL (78) L
Ebr (Zr) LE
CTE (1672) 1:97
PTL(S 11) $6
61 (9E1 OI
86:0 (160) Z8'0
619 (L 1S) v'St
9°S9 (76S) €'05
(Ol =4)
Snjyosul °T
‘OPLID 1aYIIA/ SNWAVIOIT UY} JO SIdOeIeYS [ROISOTOYCIOU UI SOOUdIOTJIC| *¢€ IQR,
%0
quasqe
posodeyxne
88 (7°98) 08
vs (LIS) OS
Lv (Sb) €b
€€ (L'8TZ) 97
6(L'8) 8
pee (LIE) LOE
tT (9°77) FIZ
L6(S8)E8
CII (01) Ol
Ter (S68) LSE
80S (L'Lr) S Ir
(¢ = 4)
1aYI1ad "TJ
%0
yuosqe
posodeyxni-qns
6L (VEL) $9
89 (1'SS) OS
9¢ (O'S) ZS
SE (TE) 67
0
8 (69) ¢
6 SE (H'TZE) 1°67
1'SZ (6°77) 0'1Z
OEL(TIL) 86
LLLA +) vl
60'I (ZO'1) €6'0
0:08 (76S) L’8r
£99 (16S) 60S
(gl =4)
Mansvjyg *T
%0
quasqe
posodeyxn{-qns
pure posodeyxne
66 ($06) 98
L8 ($78) 8L
SL(S PL) L
Sr (Sh) Sr
1 ($00
7 (1) 0
0
6(8)L
9 0b (8°8E) TLE
L87 (9°87) T'LZ
€01(86)96
LIU@QIDYIL
10'I (86'0) $60
CLr(E€9r) € Sr
SLES Ly) TLY
(pF = 4)
SNVINJaAjIpnD *T
ysiyy
dy} JO 19]U99 dy} UI
SOTBOS [OY [CUDA
YJIM STeNprArpul
Jo o8e]U9010g
SQLS [OOY
Apoq
oy} JO JUSWIOSULLIE
gyeos yes1oq
sayeos yeNUsA,
sayeos [es1og
Apoqprut
punore sayeos
SOTBOS YOON
ayeos yee
OSI] [eUOSeIG
gyeos iva todd
safeos
snyeow AIO}IpNy
SOTBOS STeIgeIIIOT
yysue] quit] pulH
Yysusy] QuIT][o104
UYPIM peo
yysus] peoH
yysuay |e)
/yysud] WUdA-}]NOUS
yysugy [el
Yysusy] JUdA-jnNoUS
19)08.18y9
[varsopoyds0yy
September 2020 | Volume 14 | Number 3 | e250
13
Amphib. Reptile Conserv.
° nN on
= nD 4H as
G26. oe
3 3) = I
Ss > Ve OPCS
Q6 PSH eY
> n &
S Sex
, | SSS 5 ow
— £
3
& r=
S 0)
s S
: rs)
mm]
se
3 “a
> Sita e-pae
S Suv eS
= S075 &
ke MOapr
s B50 8S
moe
~~ as
hese
=
» e
5
2 wa}
z i)
mm]
a)
Pa 2
iS ~
~ ‘S
>
3 oo
~J oO ©
Ss moO
S
S s
Q js)
mj faa
°
. ————
= a ES Ss
3 3 Sr Po
oOo] & sass
: oo 3
dD 5 eS Og
= a. s 38
S) ™ op x
a1 N oeves
< moat
n =e
a [a0]
S
o
3S
AS) ae
NY = =
o = D
Ss 2 5
a : ee
is) ~]
N
=
0)
~~
5)
oo}
i
Sl]
) 3
a/ & S
3) 3 iA
L a}
On 3 2
° ss oe
gis
jor
il
jo)
El g
1 iS}
~N =
| 8 7
3) Sy 5
5| & Z
ras — 9
a) ~y
[om 8
=| :
Q ~
pane
7S
Ss
Els ‘sn
os N
=/2 2 Lv
© | & 5 8
o|S m =,
—-|Ss 2 Bo
foe) te on .S
Biloe Sug
Ta RRS Eos
aa =s toOg§k
Amphib. Reptile Conserv.
conspicuous spots
Sometimes light
Scales, next to
Arrangement of
blue lateral scales
absent absent paravertebral absent absent absent absent
absent
celestial scales in
females
on paravertebral
spots
spots
A new species of Liolaemus from Peru
present absent absent absent absent absent present absent
absent
Green side spots
3 (4.22) 5
1 (2)3
0 (1.3) 2 0(1.5)2 2(3)4
0 (1.3)3
Precloacal pores in
females
4 (5) 6
3 (4) 6
3 (4.14) 6
4 (4.6) 5
5 (6.2)7
3 (5.08) 7
Precloacal pores in
males
= 0.87). Underarm to groin length 21.61—32.8 (mean =
28.58; STD = 2.76). SVL males 56.23—73.53 mm (mean
= 65.05 mm; STD = 7.08) and females 52.15—71.10 mm
(mean =62.9mm; STD =4.61). Femur length 10.11—14.65
mm (mean = 12.31 mm; STD = 1.06). Humerus length
7.56—11.01 mm (mean = 8.86 mm; STD = 0.99). Forearm
length 7.65—11.56 mm (mean = 9.59 mm; STD = 1.06).
Hand length 8.03-11.25 (mean = 10.25; STD = 0.86).
Scales around midbody 58—72 (mean = 65.09; STD =3.7).
Dorsal 60—72 (mean = 65.59; STD = 3.5), juxtaposed to
sub-juxtaposed, and smooth scales. Infradigital lamellae
of the 4" finger of the hand 15—21 (mean = 17.73; STD
= 1.45) and of the 4" toe 20-26 (mean = 21.67; STD =
1.5). Ventral 73-87 (mean = 81.32; STD = 3.37) larger
than dorsal scales. Tail length 46.77-67.16 mm (n = 17,
mean = 56.83 mm; STD = 5.91). Males with 4-6 (mean
= 4.67; STD = 0.82) precloacal pores, and females with
3-5 (mean = 4.22; STD = 0.83) precloacal pores. Body
measurements, males (mean = 66.62 mm) slightly larger
than females (mean = 62.90 mm), tail length in males
slightly larger (mean = 61.74 mm) than females (mean =
54.80 mm) [Table 4].
Color variation in life (Figs. 4-5). Liolaemus angapuka
sp. nov. shows evident sexual dichromatism. In males,
head is darker than the gray body. In some specimens,
supralabial and infralabial scales are generally lighter
gray than the rest of the head. The subocular is generally
white with irregular dark spots. The dorsal color of the
neck is gray, varying in its hue, and may be dotted with
some light blue scales and orange spots. The body color
is always gray. The vertebral region in most males is well
delimited with some light blue scales. No vertebral line,
dorsolateral bands, antehumeral arch, or scapular spots.
Few specimens have diffuse gray paravertebral spots, and
rounded shape. As in the holotype, in the paravertebral,
dorsolateral, and lateral regions of the body, irregular
orange spots stand out, surrounded and dotted with
celestial scales. Orange spots can vary in intensity and
size, as light blue scales that can form thin irregular
lines or clump together to form more conspicuous spots.
In some specimens the amount of light blue scales is
so remarkable that they cover the orange spots. Orange
spots and light blue scales are distributed on the sides of
the tail. In some individuals, the celestial scales reach
the distal end of the tail. In some specimens, light blue
scales are replaced by dark, bluish-green scales. In some,
irregularly shaped white spots are distributed among the
orange spots. The fore and hind limbs, as well as the tail,
have the same design as the body. In the tail, incomplete
rings of dark spots with light edges are formed. Ventrally,
the majority of males are similar. The predominant color
is white, some have faint yellow and a yellow hue that
can vary in intensity, highlighted in the gular region and
the hind limbs. On the sides of the belly, a thin orange
longitudinal line protrudes from the armpit to the groin
(Fig. 4).
September 2020 | Volume 14 | Number 3 | e250
Huamani-Valderrama et al.
Table 4. Differences in morphological characters between males and females of Liolaemus anqapuka sp. nov.
Morphological characters te ied &
Snout-vent length 66.62 6.05
Tail length 61.74 3.74
Head length 15:9 0.85
Head width 13.94 1.46
Forelimb length 30.45 0.77
Hind limb length 44.03 2.33
Head length/snout-vent length 0.24 0.02
Head length/head width Ls 0.09
Trunk width/trunk length 0.7 0.06
Tympanum height/tympanum width 2.74 1.07
Auditory meatus scales 135 0.55
Neck scales 39.33 3.5
Scales around midbody 65.67 4.59
Dorsal scales 67.17 4.58
Ventral scales 83.5 251
Pygal scales 6.5 2.07
Precloacal pores 4.67 0.82
Females have a totally different coloring pattern
than males (Fig. 5). The color of the head varies from
brown to gray, with some dark red spots and scales. The
supralabial, infralabial, and lorilabial scales are lighter
in color than the dorsal surface of the head. The back
of the body can be light gray or brown; with small
paravertebral spots, gray or dark brown, and circular or
sub-quadrangular; with a small white spot on the back
which can be the same size as the paravertebral; and with
meager orange spots between the paravertebrals. A few
females have light blue scales on paravertebral spots.
On the sides of the body, there may be lateral spots of
the same design as the paravertebral ones. The tail and
hind limbs have the same design and color as the body,
without dorsolateral bands. Ventrally they are white or
faint yellow immaculate throughout the body. In some
females, the tail has more intense yellow throughout its
extension (Fig. 5).
Etymology. The specific name refers to the coloration
patterns of males. The word “anqapuka” is an original
word in the Quechua language (spoken currently in the
Peruvian Andes), corresponding to a complex word
between “anqa” assigned to the blue color, and “puka”
which means orange or red color.
Distribution and natural history. Liolaemus anqapuka
sp nov. is restricted to the western slopes of the La
Caldera batholith, Arequipa, Peru, between 1,800 and
2,756 m asl, which includes the upper altitude limit of
the La Joya desert (Fig. 6). The distribution is within
the Desert biogeographic province (sensu Morrone
2014). Liolaemus anqapuka sp. nov. inhabits arid
Amphib. Reptile Conserv.
Variation in Mean in STD Variation in
males females females females
(56.23—73.53) 62.91 4.61 (52.15—71.10)
(58.08-67.16) 54.78 5.49 (46.77-66.88)
(14.87-17.2) 14.53 1.27 (12.32-16.79)
(11.5-15.92) 12.33 2.08 (9.15—15.38)
(29.41—31.53) 28.05 1.58 (25.68—31.36)
(39.99-47.13) 40.25 29 (36.02-45.04)
(0.22—0.26) 0.23 0.01 (0.21-0.25)
(1.04—1.29) 12 0.13 (1.02-1.37)
(0.64—0.78) 0.69 0.1 (0.53—-0.97)
(2.06-4.9) 3.08 p> (1.57-10.7)
(1-2) 1.56 0.63 (1-3)
(34-42) 38.7 3.91 (32-43)
(60-72) 64.9 3.46 (58-72)
(61-72) 65 2.97 (60-72)
(81-87) 80.5 3.35 (73-84)
(5-10) 6.75 1.69 (5-10)
(4-6) 3.64 1.15 (2-5)
environments, characteristic of the desert of southern
Peru, with sandy-stony substrates and little slope,
seasonal herbaceous vegetation, and columnar and
prostrate cacti. This species also inhabits sectors
without vegetation (Fig. 7). It takes refuge mainly under
stones, and in burrows that surround the roots of small
bushes, prostrate cacti, and in cavities underground or in
hardened sand. Some specimens of Liolaemus anqapuka
sp. nov. were observed feeding on coleopteran larvae,
as well as larvae and notably adults of Lepidoptera
belonging to the Sphingidae family (Fig. 8). Feeding on
beetles is very similar to that reported for the closely-
related species Liolaemus insolitus, which is specialized
in feeding on so-called “flea beetles” of the subfamily
Halticinae (Coleoptera: Chrysomelidae) [Cei and Péfaur
1982]. The adults and larvae of the family Sphingidae are
most abundant in the summer months, when the local
rainfall is complemented by abundant ephemeral surface
watercourses whose flow is derived from rainfall on
the western slopes of the Andes, and these insects can
display unusual and explosive development. During years
when there is exceptionally high accumulated rainfall, a
biological phenomenon known as a “blooming desert”
can occur (Chavez et al. 2019), and some phytophagous
insects would be expected to be able to use the abundant
plant resources that suddenly become available in these
events, as reported for Sphingidae in northern Chile
(Vargas and Hundsdoerfer 2019). Liolaemus anqapuka
sp. nov. was found in syntopy with other reptile species,
such as Microlophus sp. and Phyllodactylus gerrhopygus.
Endemism, threats, and conservation status. Liolaemus
anqapuka sp. nov. is considered as an endemic species
September 2020 | Volume 14 | Number 3 | e250
A new species of Liolaemus from Peru
75°0'O"W 72°0'0"W
12°0'0"S
15°0'0"S
PACIFIC OCEAN
18°0'0"S
0 250 500 1,000 km
75°0'O"W 72°0'0"W
69°0'0"W
12°0'0"S
Legend
| w @ L. polystictus * L. signifer
LS @ L. robustus
ime fe L. th i
| = @ L. victormoralesii paar
@ L. "A. Apacheta" i) L. annectens
©) L. "Castrovirreina” cn L. evaristoi
@ L. "Minas Martha” op L. anqapuka sp. nov.
AL. balagueri (*) Type localities
A L. chiribaya /\ Type localities
2s Linsolitus xk Type localities
L.
A eae oa Type localities
L. poconchilensis
x . [__]o-1,000
L. williamsi
[I 1.001 - 2,000
8 * L. etheridgei 2.001 - 3,000
& : 4
* L. melanogaster | au ae
| | 4,001 - 5,000
* L. ortizi BBB 5.001 - 6,301
* L. qalaywa
69°0'0"W
Fig. 6. Geographic distribution of Liolaemus montanus group species from Peru. Symbols with a black dot in the middle represent
the type locality of each species. Species with quotation marks in the names belong to the candidate species listed in Aguilar et al.
(2016).
with a restricted-range of geographical distribution,
because the species occupancy is less than 10,000 km?
(Bruchmann and Hobohm 2014; IUCN 2016; Kier and
Barthlott 2001; Noguera-Urbano 2017). Using the Geocat
tool, and based on records of the species, we estimate the
extent of occurrence (EOO) at 147.2 km? and the area of
occupancy (AOO) at 80.0 km”. The restricted range might
be caused by their climatic tolerance, and the ecological
adaptation to extreme environmental conditions found
on the Desert biogeographic province. The main threats
are the loss of habitat, because of the large-scale mining
activities, urban expansion, and contamination by
chemicals and metals; and also because of the presence
of highways that cut through their natural habitat, and the
opening of new secondary roads. Following the IUCN
(2020) criteria, and using the actual knowledge of the
new species, we evaluated the conservation status of L.
anqapuka sp. nov. to be in the category of endangered
iv)|, based on the area of occupancy (AOO) < 500 km”,
the extent of occurrence (EOO) < 5,000 km?, the number
of localities are < 5; and we consider it as a species with
restricted range because L. angapuka sp. nov. has a global
range size less than or equal to 10,000 km? (IUCN 2016).
Amphib. Reptile Conserv.
Statistical analysis (Figs. 9-10). The summary statistics
for all the non-transformed, continuous, and meristic
characters taken from five species of Liolaemus are
shown in Appendix II. The homogeneity of variance was
not supported for either continuous or meristic characters
by the Levene’s test in some groups. Therefore, the results
of the Principal Component Analyses (PCA) should be
preferred for deriving linear combinations of the variables
that summarize the variation in the data set. The results
of the PCA for continuous and meristic characters are
presented separately (Tables 5-6).
The first four components of continuous characters
explained 55.51% of the variation, and a screen plot test
of the PCs indicated that only the first three components
contained nontrivial information. The first axis represents
body size, loading negatively for most variables, and
accounts for 23.46% of the variation, with strong loading
for width of the base of the tail. The second axis represents
morphological variation and accounts for most of the
remaining variation, with strong loadings for mental scale
width, length of the 4" supralabial scale, and upper width
of the pygal area. The next axes account for the remaining
variation.
The first four components of meristic characters
explained 54.59% of the variation, and a screen plot
September 2020 | Volume 14 | Number 3 | e250
Huamani-Valderrama et al.
Table 5. Principal component (PC) axes loadings of continuous characters for L. balagueri (n = 12), L. chiribaya (n = 10), L.
insolitus (n= 15), L. nazca (n=7), and Liolaemus angqapuka sp. nov. (n = 7). Eigenvectors, eigenvalues, and percentage of variance
explained for the first four principal components from transformed data in the five putative species of Liolaemus.
Loadings PCI PC2 PC3 PC4
Percentage variation accounted for 23.46 14.84 10.97 6.24
Eigenvalue D2 46 3.4 1.93
Snout-vent length —0.85 —0.06 0.09 0.16
Minimum distance between the nasal scales —0.13 0.48 0.67 —0.02
Snout width at the edge of the flake canthal —0.04 0.2 0.54 0.2
Distance from the nose to the back edge of the flake canthal —0.68 —0.08 —0.15 0.08
Distance between the posterior edge of the series superciliary —0.67 0.56 0.01 0.23
Length of the interparietal —0.48 0.08 —0.44 —0.29
Length of the parietal —0.51 0.43 —0.20 —0.27
Mental flake width 0.13 0.73 0.49 0.05
Length of the mental scale —0.50 —0,33 —0.68 —0.16
Distance from nostril to the mouth —0.55 —0.43 0.28 0.01
Rostral height —0.51 —0.19 0.16 0.05
Length of the subocular scale —0.41 —0.19 0.01 0.06
Ear height —0.16 —0.23 0.22 —0.49
Ear width 0.11 0.29 0.67 —0.32
Length of the preocular scales —0.11 —0.56 0.19 0.14
Preocular width —0.26 —0.46 G32 0
Length of the fourth supralabial flake —0.25 —0.71 0.17 —0.17
Length of the fourth lorilabial flake —0.50 —0.46 0.04 0.04
Length between orbits —0.61 0.37 —0.05 0.46
Length of the first finger of the forelimb, without the claw —0.54 0.41 —0.16 —0,29
Length of the claw of the fourth finger of the forelimb —0.15 0.32 —0.56 0.29
Length of the fifth finger of the forelimb, without the claw —0.19 0.17 0.23 —0.68
Humerus width —0.62 0.06 —0.03 0.24
Distance from the insertion of the forelimb in the body toward the elbow —0.67 0.17 0.29 0.12
Thigh width —0.66 —0.50 —0.01 —0.23
Length of the first finger of the hind limb, without the claw —0.24 0.35 —0.21 —0.38
Length of the claw of the fourth finger of the hind limb —0.54 Q-19 —0.15 —0.26
Body width —0.62 —0.12 0.53 —0.02
Width of the base of the tail —0.75 —0.12 0.22 0.19
Upper width of the pygal area —0.19 0.7 —0.11 —0.13
Length of the pygal area —0.62 0.4 —0.17 0.01
test of the PCs indicated that only those components
contain relevant information. The four axes represent
morphological variation, loading strongly for number
of paravertebral spots in the right side, number of scales
around midbody, number of ventral scales, and number
of gular scales. The four axes account for the remaining
variation, albeit with values below 0.70 for subdigital
lamellae of the 4" finger of the forelimb, number of
auricular scales, projecting scales on anterior edge of
auditory meatus, and number of organs in the postrostral
scales.
The positions of species based on their scores for the two
morphological principal components axes are illustrated
Amphib. Reptile Conserv.
in Figs. 9-10. The spatial distribution of the continuous
characters indicates that they are sufficient to virtually
separate the five Peruvian Liolaemus species of the L.
reichei group. These species can also be distinguished by
their position in the analysis of meristic characters only.
In both analyses, Liolaemus angapuka sp. nov. can be
differentiated from other phylogenetically related species
by its body size and morphological variation.
To further clarify the position of the Liolaemus species
in the morphospace of both continuous and meristic
characters, a DFA was carried out, where the group
membership was determined a priori. The result obtained
through the DFA for the five species of Liolaemus was
September 2020 | Volume 14 | Number 3 | e250
A new species of Liolaemus from Peru
Table 6. Principal component (PC) axes loadings of meristic characters for L. balagueri (n = 12), L. chiribaya (n= 10), L. insolitus
(n = 15), L. nazca (n = 7), and Liolaemus angapuka sp. nov. (n = 7). Eigenvectors, eigenvalues, and percentage of variance
explained for the first four principal components from transformed data in the putative species of Liolaemus.
Loadings
Percentage variation accounted for
Eigenvalue
Number of scales around the interparietal scale
Supralabials number on the right side
Supralabials number on the left side
Infralabials number on the right side
Infralabials number on the left side
Number of scales around mental scale
Number of scales around the rostral scale
Number of lorilabials
Hellmich index
Subdigital lamellae of the first finger of the forelimb
Subdigital lamellae of the second finger of the forelimb
Subdigital lamellae of the third finger of the forelimb
Subdigital lamellae of the fourth finger of the forelimb
Subdigital lamellae of the fifth finger of the forelimb
Subdigital lamellae of the first toe of the hind limb
Subdigital lamellae of the second toe of the hind limb
Subdigital lamellae of the third toe of the hind limb
Subdigital lamellae of the fourth toe of the hind limb
Subdigital lamellae of the fifth toe of the hind limb
Number of dorsal scales between the occiput and the level of the anterior
edge of the thigh
Precloacal number of pores
Number of scales between canthal and nasal
Number of scales around the nasal scale
Supraoculars number enlarged scale in the right side
Supraoculars number enlarged scale in the left side
Number of scales between canthal and nasal scales
Number of organs in the third lorilabial scale
Number of organs above the row of lorilabials scales and below the canthal
and preocular scales
Gular number of scales
Number of scales around the middle body
Number of ventral scales
Number of auricular scales
Number of paravertebral spots in the right side
not significant for continuous morphological characters
(Wilk’s Lambda = 0.85, F = 0.71, P = 0.60), and the
jackknife classification was 100% satisfactory. The DFA
of operational taxonomic units for meristic characters was
not significant either (Wilk’s Lambda = 0.69, F = 1.58, P
= 0.23); however, the jackknife satisfactory classification
was developed at a 100% rate. These results show L.
anqapuka sp. nov. can be reliably distinguished from
Amphib. Reptile Conserv.
PCI PC2 PC3 PC4
26.62 10.3 9.63 8.04
8.78 3.4 3.18 2.65
—0.06 —0.36 —0.03 0.05
—0.04 —0.52 —0.27 0.18
0.17 —0.51 —0.47 0.42
0.39 —0.30 —0.44 —0.01
0.25 —0.55 —0.47 —0.07
0.37 —0.09 0) —0.11
0.56 0.31 —0.26 —0.40
—0.16 —0.56 0.07 —0.45
0.32 —0.10 —0.39 0.4
—0.09 —0.59 0.48 —0.04
0.06 —0.35 0.47 0.44
—0.31 —0.07 0.55 0.2
—0.74 —0.12 —0.14 0.24
—0.61 0.12 0.38 —0.22
—0.43 —0.37 0.04 0.14
—0.56 —0.40 0.46 —0.16
—0.47 —0.26 0.14 —0.13
—0.08 —0.55 0.23 —0.48
—0.19 0.22 0.19 0.52
0.43 —0.51 —0.40 —0.18
0.29 —0.24 0.11 0.5
—0.60 —0.41 —0.15 0.36
—0.20 —0.12 —0.05 —0.09
0.67 —0.22 0.2 —0.27
0.48 —0.23 0.05 —0.48
0.7 —0.26 0.15 —0.09
—0.08 —0.18 0.58 0.2
0.66 0.02 0.34 —0.13
—0.88 0.01 0.27 —0.25
—0.92 0 —0.27 —0.09
—0.92 0.03 —0.26 —0.15
—0.73 0.04 —0.02 —0.31
—0.93 —0.02 —0.23 —0.10
the other species by a combination of morphological
characters.
Phylogenetic analysis (Fig. 11). The objective of the
phylogenetic analyses carried out (morphological,
molecular, and Total Evidence) is not to resolve the
relationships of the LZ. montanus group, which 1s far
beyond the scope of this study. The main objective of
September 2020 | Volume 14 | Number 3 | e250
Huamani-Valderrama et al.
these analyses is to obtain some approximation of the
phylogenetic relationships of L. angapuka sp. nov. and
the rest of the L. reichei group sensu Abdala et al. (2020).
The new taxon was recovered in three analyses, within
the L. montanus group. In the morphological and Total
Evidence analyses, under parsimony methodology, the L.
reichei group is monophyletic; within this, L. angapuka
sp. nov., through molecular analysis of ML, the L. reichei
group 1s paraphyletic.
Molecular analysis. The three DNA (cyt-b) obtained for
L. anqapuka sp. nov. fall within the same clade, supporting
the identification of the new species. The nearest terminal
is L. aff. insolitus4, a population innominate from
Department of Arequipa, and it is grouped in the same
clade with L. chiribaya, a species from Department of
Moquegua, with node support (BS = 99). The clade that
contains these three species is deeply separated from its
sister clade, (L. poconchilensis + L. aff. insolitus8). The
analysis does not recover the clade of L. reichei group
sensu Abdala et al. (2020) as monophyletic.
Morphological analysis. The result of the morphological
phylogenetic hypothesis shows that Liolaemus anqapuka
sp. nov. belongs to the group of L. montanus, within the
clade of L. reichei sensu Abdala et al. (2020), together
with L. audituvelatus, L. balagueri, L. chiribaya, L.
insolitus, L. nazca, L. poconchilensis, L. reichei, L.
torresi, and eight unnamed populations so far. Liolaemus
reichei sensu Abdala et al. (2020), is supported by 13
synapomorphies, of which four are continuous characters
(lower number of scales from rostral to occiput, lower
number of scales around midbody and lower ratio of
tail length/SVL) and eight are discrete (ventral scales
of the body equal to, or slightly larger than the dorsal;
sides of the body not conspicuously colored, with little
or no ventral sexual dichromatism; absence of white line
in the temporal region; diameter of the eye, larger than
the distance between the anterior margin of the eye, and
the rostral scale; isognathic profile, substrate where they
occur predominantly sandy).
Amphib. Reptile Conserv.
Fig. 7. Habitat of Liolaemus anqapuka sp. nov. in (A) dry season and (B) wet season. Photos by A. Quiroz (A), C.S. Abdala (B).
—_
This clade is divided into two large subclades, one
with unnamed species and populations from Chile
(L. audituvelatus, L. poconchilensis, L. reichei, and
L. torresi) and the other with species and populations
from central and southern Peru (L. balagueri, L.
chiribaya, L. insolitus, and L. nazca). This last subkey
is where the new species is recovered, supported by 19
synapomorphies, several of which stand out: ratio of
auditory meatus height/head height, number of pygals,
number of lorilabials contacting the subocular, number
of supraoculars, dorsal surface of head (rugouse), scales
on external edge of forelimbs (subimbricate), scales of
dorsal hind limbs (subimbricate), with notch in edge of
scales of gular fold, scales of pygal region (subimbricate),
with dark line through the eye; white posterior edge of
paravertebral spots in both sex (present), black dots
scattered on dorsal region of hind limbs in males (absent),
and dark line through the eye in females (present).
Liolaemus anqapuka sp. nov. have populations of close
relatives which also occur in Department of Arequipa,
Peru, with particular morphological characteristics,
and these are currently under description. Liolaemus
anqapuka sp. nov. is recovered as a sister species of L.
aff. insolitus4, a population related to L. insolitus near the
ss = ATR aire METS S TPT I 1 :
. " i Wi eco PR
Aa ; ¥ 7
§ Srey *
4 vin Ps
Fig. 8. Liolaemus anqapuka sp. nov. eating a moth of the
Sphingidae family. Photo by A. Quiroz.
September 2020 | Volume 14 | Number 3 | e250
A new species of Liolaemus from Peru
*
? +X
fons |
i
= t
: Pere “a aa“
= Vv ey A
5 0 Vv. @
S ree Ba A
& e es Vee
Bl Vy A
&
Principal Component 1
Fig. 9. Plot of principal component scores for continuous
characters for L. balagueri (yellow stars, n = 12), L. chiriba-
ya (purple circles, n = 10), L. insolitus (red triangles, n = 15),
L. nazca (sky blue triangle, n = 7), and L. angapuka sp. nov.
(green squares, n = 7). Eigenvectors, eigenvalues, and percent
of variation explained for the first two principal components are
summarized in Table 5.
coasts of the Department of Arequipa, which occupies
elevations of 1,000 m asl. This relationship is supported
by six synapomorphies. Liolaemus anqapuka sp. nov. is
supported by seven autopomorphies in the phylogenetic
tree (Fig. 11).
Total Evidence analysis (Fig. 11). The L. reichei clade
is recovered as monophyletic, and L. angapuka sp. nov.
belongs to this clade, as do the sister species of L. aff.
insolitus4, as well as in the morphological and molecular
phylogenetics analyses. This relationship is supported
by 14 synapomorphies, six of which are continuous
characters and the support of this relationship is high
(89%). This relationship is recovered within the clade
(L. aff. insolitus5 (L. aff. insolitus4 + L. anqapuka sp.
nov.)), and is supported by three morphological and 11
molecular synapomorphies. Likewise, a total of seven
autopomorphies support the new species of Liolaemus.
In this hypothesis, as in the morphological one, two sub
clades are recovered within the L. reichei clade—on the
one hand are the species that are distributed in northern
Chile, and on the other are those in southern Peru.
Taxonomic history. Boulenger (1885) identified a male
specimen (BMNH 65-—5-—3-3) from “Arequiba, 7,500 ft”
as Ctenoblepharis adspersus (an unjustified emendation
of Ctenoblepharys adspersa Tschudi 1845) in his
catalogue of the lizards in the British museum. Péfaur et
al. (1978b) mentioned the distribution and classification
of the reptiles from Department of Arequipa, noting that
the specimens collected by Duellman (1974) from the
“La Caldera batholith” located approximately 10 km
southwest of Uchumayo town would be “Crenoblepharus
sp.” (= Ctenoblepharys). But this was not the only
mistake. Years later, Cei and Péfaur (1982) wrote the
Amphib. Reptile Conserv.
20
Principal Component 3
Principal Component 2
Fig. 10. Plot of principal component scores for meristic char-
acters for L. balagueri (yellow stars, n = 12), L. chiribaya
(purple circles, n = 10), L. insolitus (red triangles, n = 15),
L. nazca (sky blue triangle, n = 7), and L. angapuka sp. nov.
(green squares, n = 7). Eigenvectors, eigenvalues, and percent
of variation explained for the first two principal components
are summarized in Table 6.
original description of Liolaemus insolitus, considered
to be a widely distributed coastal species which reached
altitudes above 2,000 m asl, including the populations of
the “La Caldera batholith” from Department of Arequipa.
Etheridge (1995), from the specimens considered by
Boulenger (1885), identified the possible existence
of a different species of Liolaemus from Department
of Arequipa, which shows the characteristics of the
specimens collected by Duellman (KU 163589, 3 km SW
Uchumayo, at 2,150 m asl). During the following years,
the regional museums of Peru considered the population
from “La Caldera batholith” as an undescribed form
associated with Liolaemus insolitus (Zeballos et al. 2002),
which they called Liolaemus cf. insolitus. Nufiez. (2004)
identified the specimen considered by Boulenger (1885)
as a new species of the genus Phrynosaura (synonym
of Liolaemus). Gutiérrez and Quiroz (2010), based on
photographic material, presumed that the population
belonged to L. cf. insolitus. Later, Langstroth (2011)
reviewed the field notes written by Duellman, Simmons,
and Pefaur (unpublished) and their specimens cataloged
as Phrynosaura stolzmanni from the University of Kansas
(KU 163589, KU 163592, and KU 163594; collected
from “10 km SE of the town of Uchumayo, in the La
Caldera batholith”), and indicated that these lizards are
not Liolaemus stolzmanni. Based on fieldnotes, which
indicate that these specimens are individuals found
in habitats of gray sand with granitic rocks and the
coloration is cryptic with the habitat, he also highlights
the mottled black, orange, and metallic blue back,
and the lateral sides of the belly are orange; and these
characters are corroborated with the photography of the
individual KU163589; citing this population in his work
as Liolaemus species 2 (KU 163589, KU 163592, and KU
163594). Finally, Abdala et al. (2020) corroborate through
September 2020 | Volume 14 | Number 3 | e250
Liolaemus
montanus
group
Liolaemus
montanus
group
Morphology
C
Total
Evidence
A
49
Liolaemus chlorostictus clade
Liolaemus dorbignyi clade
47
Liolaemus chlorostictus clade
Liolaemus andinus clade
Liolaemus dorbignyi clade
L.poconchilensis
Liolaemus reichei clade 89
Liolaemus reichei clade
Huamani-Valderrama et al.
L.reichei
L.torrestRioLoa
L.audituvelatus
L.afftorresi1
L.torrest
67
L. nazca
L.balagueri
L.aff.insolitus6
L.insolitus
L.aff.poconchilensis
L.aff.insolitus2
L.aff.insolitus3
L. chirtbaya
L.aff.insolitus5
L.angapuka sp. nov.
Laflinsolitued
50
Liolaemus andinus clade
L.poconchilensis
L.reichei
L.audituvelatus
L.torresi
L.torresikioLoa
L.aff.torresi1
92
L.balagueri
L. nazea
L. chiribaya
L.aff.insolitus2
L.aff.insolitus3
L.aff.poconchilensis
L.insolitus
L.aff.insolitus6
Le lier
an uUKA Sp. NOV.
Lat eolineA
69
40
78
Liolaemus victormoralestt
Liolaemus victormoralesti
Liolaemus victormoralesti
Liolaemus victormoralesii
Liolaemuts victormoralesit
Liolaemus victormoralesit
Liolaemus victormoralesii
Liolnemus victormoralesti
Liolaemus victormoralesit
Liolaenius victormoralestt
Liolaemus victormoralesit
AL jolaemus victormoralesii
Liolaentus melanogaster
Liolaemus melanogaster
Liolaemus melanogaster
Liolaemus melanogaster
Liolaemus williamsi
97) 86h Liolaemus williamst
38F Liolaemus williamsi
93
Liolaemus williamsi
Liolaemus williansi
Liolaemus willianst
Liolaemus williams
707 Liolaemus “ AbraApacheta”
$4" Liolaemus “AbraApacheta”
1} "Liolaemus “ AbraApacheta”’
Liolaemus palystictus
9 Liolaentus polystictus
52r Liolaemus polystictus
9 ET olaemus polystictus
Liolaenius polystictus
99 _fLiolaentus robustus
Liolaemus robustus
Liolaemus robustus
Liolaentus robustus
99 |Liolnenius robustus
99 "Liolaemus robustus
59 rLiolaentus signifer
Liolaentus signifer
87 JLiolnenus signifer
Liolaemus signifer
Liolaemus signifer
Liolacnits sigitifer
99 “Liolaemus signifer
Liolaemus stgnifer
Liolaemus ethertdget
‘Liolaemus etheridget
99 [Liolaemus etheridge
Liolaemus etheridger
Liolaemus ethertdget
Liolaemus etheridget
‘Liolaenius annectens
gq |Ltolnentus annectens
pif Liolnenius arnmecterns
6l Liolaemus annectens
Liolaemus aff.annectens
Liolaentus annectens
Liolaemus signifer
50 FLiolaemus “Cotahuasi”
Liolaemus “Cotahuasi”
Liolaemus “Cotahuasi”
Liolaemus “ Cotahuasi”
Ltolaentus qalaywa
$2
40
173° Liolaemus qalayewn
gop Lrolaentus att.qalaywal
Liolaemus aft.qalaywa
® FLiolaemus aff.qalaywa
Liolaemus aff.qalaywa
99 |Ltolaemus stolzmanna
Liolaemus stolzmanni
99 Liolaemus torresi
99 [ Liolaentius toriesi
65 ‘Liolaemus torrest
=| 33 Liolaemus tmsohi tus
87 IT iolaemus insolitus
* Liolnenus insolitus
Liolaemus insolitus
Liolnenius aft.insolitus6
Liolnentus aff.insolitus6
Liolaenius aff.ansolitus6
24)
Liolaemus dorbignyt
Liolaemus eleodori
Liolaemus audituvelatus
Liolaentus audituvelatus
Liolaemus audituvelatus
Liolaemus audituvelatus
Liolaemus audituvelatus
Molecular
B :
52
84' Liolaemus audituvelatus
Liolnemus nazea
86
Liolaemus nazea
2 Fhiolaenus nazca
Liolaemus nazca
82 ‘Liolaemus nazca
Liolaemus aft.balaguert
Liolaentus balaguert
99 “Liolaemus balaguert
Liolaemus aff.insolitus2
‘Liolaenuts att.poconchilensis
96 |Liolaentus poconclulensis
°8 1'Liolaentus poconclulensis
99 = s
Liolaemus poconchalensts
Liolaentus poconchilensts
Liolaeius aff.insoli tus
74 (Liolaemus cluribaya
22 Liolaemus chit tbaya
Liolaemus chiribaya
99 |F-Liolaenus aff.insolitus4
85
99
32
40 J5]]
29
Liolaemus
93, |[ Ltolaentus anqapuka sp. nov.
Montanus 93 [|p Liolaenius angapuka sp. nov.
group 97 !Liolnemus anqapuka sp. nov.
99 Liolaemus ortizi
Liolaentus ortizt
Liolaemus thonust
° | TLiolaemus thomasi
Liolaemus thomuasi
Liolaemus tonusi
Liolaemus thonust
Liolaemus vallecurensis
Fig. 11. Phylogenetic trees showing the relationships between Liolaemus anqapuka sp. nov. and species within the L. montanus
group by (A) Total Evidence analysis, (B) molecular phylogenetic analysis, and (C) morphological phylogenetic analysis. The
values correspond to the support measure with symmetric resampling.
Amphib. Reptile Conserv.
21
September 2020 | Volume 14 | Number 3 | e250
Ctenoblepharys adspersa
A new species of Liolaemus from Peru
analysis of Total Evidence of the L. montanus group
that the population from “La Caldera batholith” (Z. aff.
insolitus7) is an independent terminal, because it presents
morphological characteristics different from the rest of the
known species of Liolaemus. Therefore, we corroborate
the hypothesis presented by Abdala et al. (2020), based
in morphological and molecular phylogenetic evidence,
which they named as L. aff. insolitus’7.
Acknowledgments.—We are grateful to Evaristo Lopez
[Museo de Historia Natural, Universidad Nacional San
Agustin, Arequipa, Peru (MUSA)], the staff of the Museo
de Biodiversidad del Pert (MUBI, Cusco, Pert), Sonia
Kretzschmar and Esteban Lavilla [Fundacion Miguel Lillo,
Tucuman, Argentina (FML), César Aguilar-Puntriano
y Alejandro Mendoza (Museo de Historia Natural,
Universidad Nacional Mayor de San Marcos, Lima,
Peru (MUSM)], for allowing the review of specimens
from their museum collections and for facilitating
access to the collection under his care. Comments of
Roberto Langstroth, Emma Steigerwald, Matt King,
and one anonymous reviewer improved our manuscript
considerably. Collection permits for specimens were
issued by Ministerio de Agricultura, through Resolucion
Directoral N° 0399-2013—MINAGRI-DGFFS/DGEFFS
and Resolucion Directoral N°0112-2012-AG-DGFFS-
DGEFFES; and additionally, the Resolucion de Direccion
General N° 509-2018-MINAGRI-SERFOR-DGGSPFFS.
We are grateful to Yovana Mamani Ccasa, from Cusco,
for the support of the epithet in the original language of
the Incas. LHV thanks Luis Arapa and Jeitson Zegarra
for their help, in part, in obtaining morphological data;
Mg. Sandro Condori and Dr. Sebastian Quinteros for
their comments on the sequence alignment process; Dra.
Maria Valderrama for access to the environments of the
Genetics Laboratory of the National University of San
Agustin; and finally, he especially thanks the researchers
and others who help him during his stay on his trip to
Argentina: Romina Sehman, AnaLu Bulacios, Marco Paz,
the Abdala family in Mendoza, Lisseth Montes and family
in Tacna, Valladares family in Chile, Carlos Valderrama
and family in Lima. CSA thanks the Cerdefia family and
the Hotel Princess from Arequipa. Thanks to CONICET
and the Agencia y Técnica (PICT 2015- 1398, Argentina)
and “Convenio de Desempefio Regional UTA-1795.”
Literature Cited
Abdala CS. 2007. Phylogeny of the ZL. boulengeri
group (Iguania: Liolaemidae, Liolaemus) based on
morphological and molecular characters. Zootaxa
1538: 1-84.
Abdala CS, Quinteros S. 2008. Una nueva especie de
Liolaemus (Iguanidae: Liolemini) endémica de la
sierra de Fiambala, Catamarca, Argentina. Cuadernos
de Herpetologia 22: 35-47.
Abdala CS, Quinteros AS, Espinoza RE. 2008. Two new
Amphib. Reptile Conserv.
species of Liolaemus (Iguania: Liolaemidae) from the
Puna of northwestern Argentina. Herpetologica 64:
458-471.
Abdala CS, Acosta JC, Cabrera MR, Villavicencio HJ,
Marinero J. 2009. A new Andean Liolaemus of the L.
montanus series (Squamata: Iguania: Liolaemidae)
from Western Argentina. South American Journal of
Herpetology 4: 91-102.
Abdala CS, Juarez VI. 2013. Taxonomia y filogenia de un
grupo de lagartos amenazados: el grupo de Liolaemus
anomalus (Iguania: Liolaemidae). Cuadernos de
Herpetologia 27: 109-153.
Abdala CS, Paz MM, Semhan RV. 2013. Nuevo Liolaemus
(Iguania: Liolaemidae) con novedoso caracter
morfologico, de la frontera entre Argentina y Chile.
Revista de Biologia Tropical 61(4): 1,563—1,584.
Abdala CS, Quinteros AS. 2014. Los ultimos 30 afios
de estudios de la familia de lagartijas mas diversa de
Argentina: actualizacion taxonomica y sistematica de
Liolaemidae. Cuadernos de Herpetologia 28: 55-82.
Abdala CS, Semhan RV, Laspiur A, Acosta JL. 2017.
Rediscovery of Liolaemus rabinoi (Iguania:
Liolaemidae) after 35 years: redescription, biological
and phylogenetic information, and conservation
challenges. Salamandra 53(1): 114-125.
Abdala CS, Aguilar-Kirigin AJ, Semhan RV, Bulacios
L, Valdes J, Paz MM, Gutiérrez R, Valladares P,
Langstroth P, Aparicio J. 2019. Description and
phylogeny of a new species of Liolaemus (Iguania:
Liolaemidae) endemic to the south of the Plurinational
State of Bolivia. PLoS ONE 14: e0225815.
Abdala CS, Quinteros AS, Semhan RV, Bulacios AL,
Schulte J, Paz MM, Ruiz-Monachesi MR, Laspiur
A, Aguilar-Kirigin AJ, Gutiérrez R, et al. 2020.
Unravelling interspecific relationships among highland
lizards: first phylogenetic hypothesis using Total
Evidence of the Liolaemus montanus group (Iguania:
Liolaemidae). Zoological Journal of the Linnean
Society 189(1): 349-377.
Aguilar C, Wood PL Jr, Belk MC, Duff MH, Sites JW
Jr. 2017. Different roads lead to Rome: integrative
taxonomic approaches lead to the discovery of two
new lizard lineages in the Liolaemus montanus group
(Squamata: Liolaemidae). Biological Journal of the
Linnean Society 120: 448-467.
Aguilar-Puntriano C, Avila LJ, De la Riva I, Johnson L,
Morando M, Troncoso-Palacios J, Wood PL Jr, Sites
JW Jr. 2018. The shadow of the past: convergence
of young and old South American desert lizards as
measured by head shape traits. Ecology and Evolution
8: 11,399-11,409.
Aguilar-Puntriano C, Ramirez C, Castillo E, Mendoza A,
Vargas VJ, Sites JW. 2019. Three new lizard species
of the Liolaemus montanus group from Pert. Diversity
11: 161.
Aguilar-Kirigin A, Abdala CS. 2016. Primer registro de
Liolaemus puritamensis Nufiez and Fox, 1989 para
September 2020 | Volume 14 | Number 3 | e250
Huamani-Valderrama et al.
el sur de Bolivia (Reptilia, Squamata, Liolaemidae).
Cuadernos de Herpetologia 30: 45-47.
Aguilar-Kirigin AJ, Abdala CS, Aparicio J, Langstroth R.
2016. Primer registro de Liolaemus pleopholis Laurent,
1998 para Bolivia (Reptilia, Squamata, Liolaemidae).
Cuadernos de Herpetologia 30: 89-92.
Avila LJ, Morando M, Sites JW Jr. 2006. Congeneric
phylogeography: hypothesizing species limits and
evolutionary processes in Patagonian lizards of the
Liolaemus boulengeri group (Squamata: Liolaemini).
Biological Journal of the Linnean Society 89: 241-
DT,
Boulenger GA. 1885. Catalogue of the Lizards in the
British Museum (Natural History). Volume IT. Second
edition. Taylor and Francis, London, United Kingdom.
497 p.
Breitman MF, Avila LJ, Sites JW Jr, Morando M. 2011.
Lizards from the end of the world: phylogenetic
relationships of the Liolaemus lineomaculatus
section (Squamata: Iguania: Liolaemini). Molecular
Phylogenetics and Evolution 59: 364-376.
Bruchmann I, Hobohm C. 2014. Factors that create
and increase endemism. Pp. 51-68 In: Endemism
in Vascular Plants. Editor, Hobohm C. Springer,
Dordrecht, Germany. 348 p.
Carrillo N, Icochea J. 1995. Lista taxonomica preliminar
de los reptiles vivientes del Peru. Publicaciones del
Museo de Historia Natural Universidad Nacional
Mayor de San Marcos 49: 1-27.
Cei JM, Péfaur JE. 1982. Una especie nueva de Liolaemus
(Iguanidae: Squamta): su sistematica, ecologia y
distribucion. Pp. 573-586 In: Actas del VIII Congreso
Latinoamericano de Zoologia, Mérida, Venezuela,
Octubre 1980. Editor, Salinas PJ. Producciones Alfa,
Merida, Venezuela. 1,531 p.
Chaparro JC, Quiroz AJ, Mamani L, Gutiérrez RC,
Condori P, De la Riva I, Herrera-Juarez G, Cerdefia J,
Arapa LP, Abdala CS. 2020. An endemic new species
of Andean lizard of the genus Liolaemus from southern
Peru (Iguania: Liolaemidae) and its phylogenetic
position. Amphibian & Reptile Conservation 14(2)
[General Section]: 47-63 (e238).
Chavez RO, Moreira-Mufioz A, Galleguillos M, Olea
M, Aguayo J, Latin A, Aguilera-Betti I, Mufioz AA,
Manriquez H. 2019. GIMMS NDVI time series
reveal the extent, duration, and intensity of “blooming
desert” events in the hyper-arid Atacama Desert,
northern Chile. /nternational Journal of Applied Earth
Observation and Geoinformation 76: 193-203.
Corl A, Davis A, Kuchta S, Comendant T, Sinervo B.
2010. Alternative mating strategies and the evolution
of sexual size dimorphism in the Side-blotched Lizard,
Uta stansburiana: a population-level comparative
analysis. Evolution 64: 79-96.
De Queiroz K. 1998. The general concept of species,
Species criteria, and the process of speciation:
a conceptual unification and __ terminological
Amphib. Reptile Conserv.
recommendations. Pp. 57-75 In: Endless Forms:
Species and Speciation. Editors, Howard D, Berlocher
SH. Oxford University Press, New York, New York,
USA. 552 p.
De Queiroz K. 2007. Species concepts and species
delimitation. Systematic Biology 56: 879-886.
Demangel D, Sepulveda C, Jara M, Pincheira-Donoso D,
Nufiez H. 2015. Liolaemus omorfi, una nueva especie
de lagarto de los andes del norte de Chile (Sauria,
Liolaemidae). Boletin del Museo Nacional de Historia
Natural, Chile 64: 139-155.
Dixon J, Wright J. 1975. A review of the lizards of the
iguanid genus 7ropidurus in Peru. Contribution in
Science. The Natural History Museum of Los Angeles
271: 1-39.
Escomel E. 1929. Fauna de Arequipa. Obras Cientificas.
Lima. Boletin de la Sociedad Geografica de Lima 37—
38(1-4): 57-69.
Etheridge R. 1995. Redescription of Crtenoblepharis
adspersa Tschudi, 1845, and the taxonomy of
Liolaeminae (Reptilia: Squamata: Tropiduridae).
American Museum Novitates 3142: 1-34.
Etheridge RE. 2000. A review of the Liolaemus
wiegmannii group (Squamata, Iguania, Tropiduridae),
and a history of morphological change in the sand-
dwelling species. Herpetological Monographs 4:
293-352.
Frost D. 1992. Phylogenetic analysis and taxonomy of the
Tropidurus group of lizards (Iguania: Tropiduridae).
American Museum Novitates 3033: 1-68.
Goloboff P. 1993. Estimating character weights during
tree search. Cladistics 9: 83-91.
Goloboff P, Farris J, Nixon K. 2003. TNT: Tree analysis
using new technology, v. 1.0. Available: http://www.
zmuc.dk/public/phylogeny/TNT/ [Accessed: 3 May
2020].
Goloboff PA, Mattoni CI, Quinteros AS. 2006. Continuous
characters analyzed as such. Cladistics 22: 589-601.
Gutiérrez RC, Quiroz A. 2010. Herpetofauna del sur del
Peru. Available: http://herpetofaunadelsurdelperu.
blogspot.com [Accessed: 13 June 2020].
Gutiérrez RC, Chaparro JC, Vasquez MY, Quiroz AJ,
Aguilar-Kirigin A, Abdala CS. 2018. Descripcion
y relaciones filogenéticas de una nueva especie de
Liolaemus (Iguania: Liolaemidae) y notas sobre
el grupo de L. montanus de Pert. Cuadernos de
Herpetologia 32: 81-99.
Gutiérrez R, Villegas L, Lopez E, QuirozA. 2010. Anfibios
y reptiles de la Reserva Nacional de Salinas y Aguada
Blanca, Peru. Pp. 219-226 In: Diversidad Biolégica
de la Reserva Nacional de Salinas y Aguada Blanca.
Editors, Zeballos H, Ochoa J, Lopez E. DESCO,
INRENA, PROFONANPE, Lima, Peru. 313 p.
Gutiérrez H, Castafieda R, Quipuscoa V, Peterson PM.
2019 Aristida surperuanensis (Poaceae, Aristidoideae),
a new species from a desert valley in southern Peru.
Phytotaxa 419(2): 182-188.
September 2020 | Volume 14 | Number 3 | e250
A new species of Liolaemus from Peru
Halloy M, Robles C, Salica MJ, Semhan R, Juarez V,
Vicente N. 2013. Estudios de comportamiento y
ecologia de lagartijas de los géneros Liolaemus y
Phymaturus (Iguania: Liolaemini). Cuadernos de
Herpetologia 27(1): 15-26.
Irschick DJ, Losos JB. 1996. Morphology, ecology, and
behavior of the Twig Anole, Anolis angusticeps. Pp.
291-301 In: Contributions to West Indian Herpetology:
a Tribute to Albert Schwartz. Editors, Powell R,
Henderson RW. Society for the Study of Amphibians
and Reptiles, Ithaca, New York, USA. 457 p.
IUCN. 2020. The IUCN Red List of Threatened Species.
Version 2020-1. Available: https://www.iucnredlist.org
[ Accessed: 20 Jun 2020].
IUCN. 2016. A Global Standard for the Identification of
Key Biodiversity Areas, Version 1.0. 1* edition. IUCN,
Gland, Switzerland. 46 p.
IUCN. 2001. IUCN Red List Categories and Criteria:
Version 3.1. YUCN Species Survival Commission,
Gland, Switzerland and Cambridge, United Kingdom.
30 p.
Kier G, Barthlott W. 2001. Measuring and mapping
endemism and species richness: a new methodological
approach and its application on the flora of Africa.
Biodiversity and Conservation 10: 1,513—1,529.
Kumar S, Stecher G, Li M, Knyaz C, Tamura K. 2018.
MEGA X: Molecular Evolutionary Genetics Analysis
across computing platforms. Molecular Biology and
Evolution 35(6): 1,547—1,549.
Langstroth R. 2011. On the species identities of a complex
Liolaemus fauna from the Atiplano and Atacama
Desert: insights on Liolaemus stozmanni, L. reichei,
L. jamesi pechecoi, and L. poconchilensis (Squamata:
Liolaemidae). Zootaxa 2809: 20-32.
Laurent RF. 1983. Contribucién al conocimiento de
la estructura taxonodmica del género Liolaemus
Wiegmann (Iguanidae). Boletin de la Asociacion
Herpetologica |: 16-18.
Laurent RF. 1985. Segunda contribucion al conocimiento
de la estructura taxonomica del género Liolaemus
Wiegmann Iguanidae. Cuadernos de Herpetologia 1:
1-37.
Lobo F, Espinoza RE. 1999. Two new cryptic species of
Liolaemus ([guania: Tropiduridae) from northwestern
Argentina: resolution of the purported reproductive
bimodality of Liolaemus alticolor. Copeia 1999(1):
122-140.
Lobo F. 2005. Las relaciones filogenéticas dentro del
grupo chiliensis (Iguania: Liolaemidae: Liolaemus):
sumando nuevos caracteres y taxones. Acta Zoologica
Lilloana 49: 65-87.
Lobo F, Slodki D, Valdecantos S. 2010. Two new species
of lizards of the Liolaemus montanus group (Iguania:
Liolaemidae) from the northwestern uplands of
Argentina. Journal of Herpetology 44(2): 279-293.
Losos JB. 1990. Ecomorphology, performance capability,
and scalling of West Indian Anolis lizards and
Amphib. Reptile Conserv.
24
evolutionary analysis. Ecological Monographs 60:
369-388.
Lovett GM, Weathers KC, Sobczak WV. 2000. Nitrogen
saturation and retention in forested watersheds
of the Catskill Mountains, New York. Ecological
Applications 10: 73-84.
Lowenberg-Neto P. 2014. Neotropical region: a shapefile
of Morrone’s (2014) biogeographical regionalization.
Zootaxa 3802(2): 300.
Malaga B, Diaz RD, Arias S, Medina CE. 2020. Unaespecie
nueva de Lasiurus (Chiroptera: Vespertilionidae) del
suroeste de Peru. Revista Mexicana de Biodiversidad
91: e913096.
Manly BFL. 2000. Multivariate Statistical Methods.
Chapman and Hall/CRC, Boca Raton, Florida, USA.
215 p.
McCune B, Grace JB. 2002. Analysis of Ecological
Communities. MjM_ Software Design, Gleneden
Beach, Oregon, USA. 300 p.
McGarigal K, Cushman S, Stafford S. 2000. Multivariate
Statistics for Wildlife and Ecology Research. \* edition.
Springer, New York, New York, USA. 283 p.
Morrone JJ. 2014. Biogeographical regionalisation of the
Neotropical region. Zootaxa 3782(1): 1-110.
Noguera-Urbano EA. 2017. Elendemismo: diferenciacion
del término, métodos y aplicaciones. Acta Zoologica
Mexicana 33(1): 89-107.
Nufiez H. 2004. Cambios taxondmicos para la
herpetofauna de Argentina, Bolivia y Chile. Noticiario
Mensual Nacional de Historia Natural de Chile 353:
28-34.
Nufiez H, Yanez J. 1984. Ctenoblepharis erroneous sp.
nov. de Iguanidae para la zona norte de Chile. Museo
Nacional de Historia Natural Boletin 40: 91-95.
Olave M, Avila LJ, Sites Jr JW, Morando M. 2014.
Multilocus phylogeny of the widely distributed
South American lizard clade Eulaemus (Liolaemini,
Liolaemus). Zoologica Scripta 43: 323-337.
Péfaur J, Davila J, Lopez E, Nufiez A. 1978a. Distribucion
y clasificacién de los anfibios del departamento de
Arequipa. Bulletin de l'Institut Francais d'Etudes
Andines VI\(1—2): 119-127.
Pefaur JE, DavilaJ, Lopez E, NufiezA. 1978b. Distribucion
y clasificacién de los reptiles del Departamento de
Arequipa. Bulletin de l'Institut Francais d'Etudes
Andines VI\(1—2): 129-139.
Peres-Neto PR, Jackson DA. 2001. The importance of
scaling of multivariate analysis in ecological studies.
Ecoscience 8: 522-526.
Quinn GP, Keough MJ. 2002. Experimental Design and
Data Analysis for Biologists. 1* edition. Cambridge
University Press, New York, New York, USA. 537 p.
Quinteros AS, Abdala CS, Lobo FJ. 2008. Redescription
of Liolaemus dorbignyi Koslowsky, 1898 and
description of a new species of Liolaemus (Iguania:
Liolaemidae). Zootaxa 1717: 51-67.
Quinteros AS, Abdala CS. 2011. A new species of
September 2020 | Volume 14 | Number 3 | e250
Huamani-Valderrama et al.
Liolaemus of the Liolaemus montanus section
({guania: Liolaemidae) from northwestern Argentina.
Zootaxa 2789: 35-48.
Quinteros AS. 2013. A morphology-based phylogeny
of the Liolaemus alticolor-bibronii group (Iguania:
Liolaemidae). Zootaxa 3670: 1-32.
Quinteros AS, Ruiz Monachesi MR, Abdala C. 2020.
Solving the Liolaemus bibronii puzzle, an integrative
taxonomy approach: redescription of L. bibronii
and description of three new species (Iguania:
Liolaemidae). Zoological Journal of the Linnean
Society 189(1): 315-348.
Quipildor M, Abdala V, Santa Cruz Farfan R, Lobo F. 2018.
Evolution of the cloacal and genital musculature, and
the genitalia morphology in liolaemid lizards (Iguania:
Liolaemidae) with remarks on their phylogenetic
bearing. Amphibia-Reptilia 39: 101-111.
Ramos VA. 2008. The basement of the Central Andes: the
Arequipa and related terranes. Annual Review of Earth
and Planetary Sciences 36: 289-324.
Riveros-Riffo E, Torres-Mura JC. 2015. Distribucion de
Liolaemus torresi (Squamata: Liolaemidae), el lagarto
endémico del desierto de Chile. Gayana 79(2): 220-—
222.
Ruiz de Gamboa M, Ortiz-Zapata J. 2016. Los poros
precloacales como diferenciadores de sexo en
Liolaemus (Squamata: Liolaemidae): el caso de L.
Jamesi (Boulenger, 1891). Gayana 80(1): 125-128.
Ruiz de Gamboa M, Correa C, Marambio-Alfaro Y,
Riveros-Riffo E, Ortiz JC. 2018. Molecular evidence
for conspecificity of two desert Liolaemus lizards
(Iguania: Liolaemidae). Zootaxa 4438(2): 283-298.
Ruiz S, Ruiz-Monachesi M, AbdalaC. 2019. Revalidacion
de Liolaemus choique Abdala, Quinteros, Scrocchi y
Stazzonelli, 2010 ([guania: Liolaemidae). Cuadernos
de Herpetologia 33(1): 33-38.
Schulte JA, Macey JR, Espinoza RE, Larson A. 2001.
Phylogenetic relationships in the iguanid lizard genus
Liolaemus: multiple origins of viviparous reproduction
and evidence for recurring Andean vicariance and
dispersal. Biological Journal of the Linnean Society
69: 75-102.
Sokal RR, Rohlf FJ. 1998. Biometry. The Principle
and Practice of Statistics in Biological Research. 3"
edition. Freeman, New York, New York, USA. 887 p.
Troncoso-Palacios J, Ferri-Yafiez F. 2013. Liolaemus
Amphib. Reptile Conserv.
patriciaiturrae Navarro and Nufiez, 1993 (Squamata:
Liolaemidae): distribution extension in northern Chile
and geographic distribution map. Check List 9: 78-80.
Valdivia-Silva JE, Navarro-Gonzalez R, Ortega-Gutiérrez
F, Fletcher L, Perez-Montafio S, Condori-Apaza R,
McKay C. 2011. Multidisciplinary approach of the
hyperarid desert of Pampas de La Joya in southern
Peru as a new Mars-like soil analogue. Geochimica et
Cosmochimica Acta 75(7): 1,975—1,991.
Valdivia-Silva JE, Navarro-Gonzalez R, Fletcher L,
Pérez-Montafio S, Condori-Apaza R, Ortega-Gutiérrez
F, McKay C. 2012. Characteristics in the extreme
hyper-arid region of Pampas de La Joya, Peru.
Astrobiological approach in four years of observation:
2004-2008. International Journal of Astrobiology
11(1): 25-35.
Valladares P, Etheridge R, Abdala CS. 2018. Resurrection
and redescription of Liolaemus reichei, proposal of a
neotype to stabilize its taxonomy. Revista Mexicana de
Biodiversidad 89: 393-401.
Van den Brink PJ, Van den Brink NW, Ter Braak CJF.
2003. Multivariate analysis of ecotoxicological data
using ordination: demonstration of utility on the
basis of various examples. Australasian Journal
Ecotoxicology 9: 141-156.
Vargas HA, Hundsdoerfer AK. 2019. Two new native
larval host plants of Hyles annei (Guérin-Meéneville,
1839) (Lepidoptera, Sphingidae) in the Atacama
Desert of northern Chile following exceptional summer
rainfall. Nota Lepidopterologica 42(2): 151-156.
Villamil J, Avila LJ, Morando M, Sites JW Jr, Leaché
AD, Maneyro R, Camargo A. 2019. Coalescent-based
species delimitation in the sand lizards of the Liolaemus
wiegmannii complex (Squamata: Lioalemidae).
Molecular Phylogenetics and Evolution 138: 89-101.
Villegas-Paredes L, Huamani-Valderrama L, Luque-
Fernandez C, Gutiérrez RC, Quiréz AJ, Abdala CS.
2020. Una nueva especie de Liolaemus (Iguania:
Liolaemidae) perteneciente al grupo L. montanus en
las lomas costeras del sur de Pert. Revista de Biologia
Tropical 68(1): 69-86.
Zar JH. 2010. Biostatistical Analysis. 5“ edition. Prentice
Hall, Princeton, New Jersey, USA. 960 p.
Zeballos P, Lopez HE, Villegas L, Jiménez P, Gutiérrez R.
2002. Distribucion de los reptiles de Arequipa, sur del
Peru. Dilloniana 4: 27-34.
Ling Huamani-Valderrama is a Biologist from the Universidad Nacional San Agustin de Arequipa, Peru.
For her thesis degree (obtained in 2018), Ling studied the morphological and molecular characterization,
and establishment of an ecological niche of a species of the genus Liolaemus. Her interest is the systemat-
ics, taxonomy, ecology, and conservation of reptiles, focusing on lizards of coastal and highland areas.
Aaron J. Quiroz graduated in Biological Science, and is currently a Research Associate of the Museum of
Natural History, National University of San Agustin, Arequipa, Peru. Aaron is a co-author and collaborator
on publications which focus on the taxonomy and conservation of amphibians and reptiles in Peru. He is
currently developing a career as an independent professional in the direction and design of amphibian and
reptile research and conservation projects.
September 2020 | Volume 14 | Number 3 | e250
A new species of Liolaemus from Peru
Roberto C. Gutiérrez is a Biologist who graduated from the National University of San Agustin de Arequipa
of Peru. Roberto is currently the Curator and Principal Researcher of the Herpetological Collection, Museum
of Natural History, National University of San Augustin de Arequipa, Peru, and Vice President and Founding
Member of the Herpetological Association of Peru (AHP). He is interested in the herpetofauna of the tropical
=. Andes and the coastal desert, with a special focus on lizards of genus Liolaemus, and is developing studies in the
systematics of amphibians and reptiles, ecology, and conservation. Roberto has conducted several biodiversity
inventories, biological assessments, and biodiversity monitoring programs, and is currently working at the Natu-
ral Protected Areas Service of the Peruvian Ministry of Environment.
' Alvaro Aguilar-Kirigin is a Bolivian Biologist who graduated from the Universidad Mayor de San Andrés,
.A La Paz, has been a researcher at the Coleccion Boliviana de Fauna specializing in herpetology since 2002, and
= is a member of the Bolivian Network Researchers in Herpetology. He carried out two research internships in
“ Argentina and Uruguay, focusing on the systematics and phylogeny of Liolaemus and the latitudinal patterns of
seasonal changes in fat body size in 59 species of lizards. He has authored over 35 publications (18 of which were
peer-reviewed), 10 book chapters, and seven technical cards as part of book chapters, including the descriptions
_ of three species of Liolaemus. Alvaro is interested in integrative taxonomy, especially in the genus Liolaemus,
_ because of its phenotypic plasticity in the Andean region. As a line of research, he is making progress with linear
»- models in the study of classical comparative morphometry. Likewise, he is linked to the conservation of the
~~ £ wildlife that inhabit the Amazonian forest in the Department of Beni in Bolivia.
Wilson Huanca-Mamani is a Biologist from the Universidad de Concepcion (Concepcion, Chile), with a Doc-
torate in Plant Biotechnology from Centro de Investigacion y de Estudios Avanzados del IPN (CINVESTAV),
Unidad Irapuato, Mexico. Wilson is currently a researcher at the Universidad de Tarapaca (Arica, Chile). One of
his research interests focuses on the population genetics of desert plants.
Pablo Valladares-Fatndez is a Biologist who graduated from the Austral University of Chile and obtained
his Ph.D. from the University of Chile. Pablo is currently an academic in the Department of Biology, Science
Faculty, University of Tarapaca, in northern Chile. He is interested in the study of vertebrates from arid and high
* Andean ecosystems, particularly lizards of the genera Liolaemus and Microlophus, and is developing studies on
4 their taxonomy, systematics, ecology, and conservation. Pablo is also developing a herpetological collection of
| northern Chile.
José Cerdeiia is a Biologist who graduated from the Universidad Nacional de San Agustin de Arequipa (Peru),
and is a researcher at Museo de Historia Natural de la Universidad Nacional de San Agustin de Arequipa (MUSA)
in Peru. José’s research includes the systematics, taxonomy, and biogeography of Lepidoptera, but with a recent
' interest in the taxonomy and ecology of the genus Liolaemus in southern Peru.
Juan C. Chaparro is a Peruvian Biologist with extensive experience in studying the fauna of all the traditional
geographic regions of Peru. Juan graduated in Biological Sciences from Universidad Nacional Pedro Ruiz Gallo,
Lambayeque, Peru; received a Master’s degree in Biodiversity in Tropical Areas and Conservation in 2013, from
an institutional consortium of the International University of Menendez Pelayo (UIMP-Spain), Universidad Tec-
noldgica Indoamérica (UTI-Ecuador), and Consejo Superior de Investigaciones Cientificas (CSIC-Spain). He is
currently the president of the Herpetological Association of Peru (AHP), director and curator of the Herpetological
Collection of the Museo de Biodiversidad del Peru (MUBL, https://mubi-peru.org/herpetologia/p-mub1), and he also
works as a consultant in environmental studies. Juan has authored or co-authored 51 peer-reviewed scientific pa-
- pers, notes, book chapters, and books on various fauna (especially in herpetology and arachnology), on topics such
wey as their taxonomy, biodiversity, systematics, phylogeny, conservation, and biogeography in South America. He is
Ey interested in those topics, as well as life history, distributional patterns, and evolution using amphibian and reptiles
as biological models. Four species have been named in his honor: Phyllomedusa chaparroi (Amphibia), Phrynopus
chaparroi (Amphibia), Hadruroides juanchaparroi (Arachnida), and Chlorota chaparroi (Insecta).
Roy Santa Cruz is a Research Associate at Area de Herpetologia del Museo de Historia Natural (MUSA), Uni-
versidad Nacional de San Agustin de Arequipa, Peru. His current research interests include the taxonomy, natural
history, and conservation of amphibians and reptiles. He currently coordinates several research projects which
focus on threatened species of Andean frogs.
Cristian S. Abdala is an Argentinian Biologist, a researcher at CONICET, and a professor at the Universidad
Nacional de Tucuman (UNT) in Argentina. Cristian received his Ph.D. degree from UNT, and is a herpetologist
with extensive experience in the taxonomy, phylogeny, and conservation of Liolaemus lizards. He has authored
or co-authored over 70 peer-reviewed papers and books on herpetology, including the descriptions of 50 recog-
nized lizard species, mainly in genus Liolaemus. One species, Liolemus abdalai, has been named in his honor. He
has conducted several expeditions through Patagonia, the high Andes, Puna, and the salt flats of Argentina, Chile,
Bolivia, and Peru. Since 2016, Christian has been the president of the Argentine Herpetological Association.
Amphib. Reptile Conserv. 26 September 2020 | Volume 14 | Number 3 | e250
Huamani-Valderrama et al.
Appendix I. Specimens examined.
Liolaemus anqapuka sp. nov. (n = 22): PERU. Arequipa: Arequipa, Uchumayo: MUBI 13521—22, MUSA 4131, 4133-34;
Arequipa, Uchumayo, Quebrada Tinajones, MUSA 1766-67, MUSA 4546, 5207-12, 5214, MUBI 14417, MUBI 14680, LSF
001, LSF 002; Arequipa, Uchumayo, between Quebrada Tinajones and Quebrada San Jose, MUSA 5573-75.
Liolaemus balagueri (n= 18): PERU. Arequipa: Camana, Quilca, Lomas de Quilca, MUSA 1772-74, MUSA 5575-78,
MUBI 13206-09, MUBI 16483-84, MUSM 3919395; Camana, Camana, Lomas de La Chira, MUSM 39192, MUSA 5579.
Liolaemus chiribaya (n= 11): PERU. Moquegua: Mariscal Nieto, Torata, Jaguay Chico, MUSM 31548-50, MUSM 31553;
Mariscal Nieto, Torata, Cerro los Calatos, MUSM 31547, MUSM 31386, MUSM 31388-91; Mariscal Nieto, between
Moquegua and Torata, MUSM 31387.
Liolaemus etheridgei (n = 17): PERU. Arequipa: Cabrerias, Cayma, MUSA 501; Cerro Uyupampa, Sabandia, MUSA 549-
54; Monte Riberefio de la Quebrada de Tilumpaya Chiguata. Pocsi, MUSA 1113-14, 1116, 1264-68, 1353; Anexo de Yura
Viejo, Yura, MUSA 1229.
Liolaemus evaristoi (n= 16): PERU. Huancavelica: Los Libertadores, Pilpichaca, Huaytara, MUSA 2841 (holotype), 2781-
85, 2840, 2842-45, MUBI 10474—78 (paratypes).
Liolaemus insolitus (n = 10): PERU. Arequipa: Lomas de Mejia, Dean Valdivia, MUSA 346, MUSA 1741, MUSA 2187-90;
Alto Inclan, Mollendo MUSA 4787-88, MUSA 4812, MUSA 4815.
Liolaemus nazca (n= 7): PERU. Ica: Nazca, MUSM 31520—21, MUSM 31523, MUSM 31525—26, MUSM 31541, MUSM
16100.
Liolaemus poconchilensis (n = 2): PERU. Tacna: Morro Sama, Las Yaras, MUSA 1638-39.
Liolaemus polystictus (n = 13): PERU. Huancavelica: Mountain near Rumichaca, Pilpichaca, MUSA 1337-1338; Santa Inés,
Castrovirreyna, MUSA 2448-2457; Santa Inés, FML 1683 (paratype).
Liolaemus robustus (n= 11): PERU. Lima: Surroundings of Huancaya, Reserva Paisajistica Nor Yauyos Cochas, MUSA
1693-1702; Junin: Junin, FML 1682 (paratype).
Liolaemus signifer (n = 12): PERU. Puno: Titicaca Lake, 3,840 m, FML 1434; Titicaca Lake, road to Puno, FML 1557; near
Tirapata, MUSA 1415; Huancané, Comunidad Taurahuta, MUSA 1441-43; Huerta Huayara community, 3 km before Puno,
MUSA 1483-87.
Appendix II. Measured morphometric traits and meristic characters.
Morphological L. balagueri L. chiribaya L. insolitus L. nazca L. angapuka sp. nov.
characters n=12 n=10 n=15 n=7 n=7
SVL 51.08-64.96 49 28-68.25 47.35-65.77 53.51-64.34 52.15—73.53
58.82 + 4.68 59.60 + 6.59 56.79 +5.41 59.35+4.98 60.14+6.71
DN 1.03—2.04 1.96-3.00 0.91-1.96 0.63-1.81 0.96—-1.68
1.31+0.28 2.47 + 0.30 1.53 + 0.36 1.47+0.42 1.36 + 0.24
AH 3.59-5.61 3.71-5.67 3.21-5.06 1.96—4.85 4.16—-5.43
4.45+0.54 4.73+0.66 4.23 + 0.53 3.92 + 0.93 4.70 + 0.42
NC 1.65-2.91 1.07—2.57 1.52-2.85 2.10-3.14 2.10—2.73
2.09 + 0.36 2.09 + 0.52 2.09 + 0.33 2.49 + 0.38 2.47 +0.27
EO 6.11-8.96 7.01-9.26 7.12-8.88 6.16—8.25 7.00-9.62
7.49 + 0.74 8.244 0.72 7.90 + 0.49 7.11 £0.80 8.54 + 0.90
LEI 0.89-1.69 0.88-1.28 0.66-1.58 0.47—2.06 1.23—-1.76
1.28 + 0.26 1.09+0.14 1.12+0.26 1.31+0.48 1.54+40.21
PA 0.85—1.74 1.31-1.72 0.90-1.82 0.51-1.91 1.45-1.99
1.34+ 0.26 1.43+0.14 1.25 + 0.26 1.244 0.47 i eae Oe |
AM 1.05-1.76 2.00—2.86 1.32-2.41 0.46-1.31 1.06-1.49
1.28 + 0.20 2.46 + 0.28 1.94+ 0.47 1.06 + 0.30 1.26+ 0.18
Amphib. Reptile Conserv.
September 2020 | Volume 14 | Number 3 | e250
Appendix II (continued). Measured morphometric traits and meristic characters.
Morphological
characters
LM
NB
HR
ES
hTy
aly
LPO
LPOT
LCSP
LCLB
DEO
1D
G4D
5D
AHU
LEA1
AMU
IP
4U
AL
WTB
ASPI
Amphib. Reptile Conserv.
L. balagueri
n=12
2.05-3.13
2.53 + 0.34
1.11-1.92
1.41 40.23
0.40-1.04
0.80 + 0.17
2.83-4.58
3.72+0.49
1.69-2.63
2.16 + 0.26
0.47-1.54
0.97 + 0.26
0.91-1.67
1.20 + 0.23
0.43-0.85
0.61+0.13
1.01—2.00
1.52 + 0.34
0.68-1.56
1.15+0.25
6.80-8.83
7.83 + 0.67
1.86-3.21
2.51 40.39
1.10-1.59
1.304 0.16
2.89-3.84
3.29 + 0.33
1.98-3.63
2.81 40.51
6.94-11.83
8.89 + 1.40
3.76—-5.28
454+ 0.47
2.87-3.68
3.19+0.29
0.93—2.06
1.45 + 0.32
16.19—20.03
17.43 + 1.06
6.32-8.63
7.49 + 0.76
5.39-6.80
6.08 + 0.44
L. chiribaya
n=10
0.84—-1.55
1.20 + 0.22
1.19-1.63
1.42+0.12
0.64—1.22
0.86 + 0.19
3.20-4.06
3.57+£0.27
1.68—2.30
1.91+40.21
1.18-1.65
1.37+£0.17
0.57-1.54
102032
0.48-0.80
0.60+ 0.11
0.83-1.42
1.1440.19
0.86-1.28
0.99 + 0.12
7.31-9.32
8.26 + 0.68
1.84-3.12
2.52 + 0.44
0.74-1.38
1.01+0.21
2.41-4.41
3.31 40.56
1.99-4.58
3.03 0.78
8.65-10.81
9.75+0.71
3.33-4.98
4.18+0.60
1.66—-4.30
3.20 + 0.86
0.74-2.32
1.33 + 0.45
19.64—33.02
25.76 + 4.97
6.19-9.15
7.76 + 1.21
4.37-7.80
6.45+1.17
28
A new species of Liolaemus from Peru
L. insolitus
n=15
1.08—2.92
1.69 + 0.66
0.96-1.56
1.26+0.18
0.53-1.01
0.77+0.11
1.90-4.16
3.52 + 0.53
1.02—2.09
1.72 + 0.25
0.65-1.22
0.94 + 0.20
0.53-1.49
1.17+0.24
0.37-0.72
0.52+0.11
0.54-1.52
1.03 + 0.25
0.55-131
0.97 + 0.20
7.48-9.17
8.36 + 0.55
1.63-2.95
2.32 + 0.31
1.17—2.04
1.53 40.22
2.44—3.40
2.84 + 0.25
2.24—3.46
2.77 0.38
6.34-9.45
8.19 + 0.86
2.67-4.68
3.71 0.73
2.50-3.78
3.15+0.37
0.98-1.77
1.30 + 0.22
12.12-19.74
15.99 + 2.40
4.91-8.44
6.98 + 1.07
5.57—7 84
6.43 + 0.69
L. nazca
n=7
1.23-2.64
2.16+0.54
1.16—1.87
1.56 + 0.28
0.69-1.54
0.93 + 0.31
2.93-6.62
3.93 + 1.26
1.72—2.49
1.95 + 0.26
0.67-1.13
0.94+0.14
0.75—2.35
1.43 + 0.50
0.48-0.92
0.69 + 0.15
1.39-3.36
2.01 + 0.67
0.85-2.14
1.29 + 0.46
6.90-8.67
Pose OTA
1.61-2.82
2.13+0.41
0.67-1.35
1.00 + 0.23
2.33-3.93
2.93 + 0.52
2.01-3.93
3.06 + 0.54
7.01-8.95
8.17 + 0.80
4 82-7.19
5.96 + 0.79
1.73-4.08
2.92 + 0.72
0.75-1.72
1.33 + 0.36
19.61—27.88
24.85 + 2.70
6.249 20
7.46 + 0.88
2.70-7.20
4.55 + 1.35
L. angapuka sp. nov.
n=7
2.30-2.78
2.55+0.21
0.97-1.51
1.3140.17
0.55—1.04
0.82 + 0.15
3,244.73
3.81 £0.49
1.37—2.02
1.78 0.23
0.57—1.10
0.85+0.18
0.60—1.07
0.89 40.19
0.33-0.82
0.55+0.18
0.66—1.37
1.03+0.31
0.57—1.30
1.03 + 0.28
8.17-10.95
9.45 + 1.03
2.56-3.31
2.88 + 0.30
1.29-2.11
1.544 0.32
2.28-3.41
3.00 + 0.44
2.59-4.36
3.45 + 0.60
9.03-11.01
9.96 + 0.68
3.60—5.80
4.43 + 0.78
2.51-3.42
3.08 + 0.29
0.97-1.87
1.45 + 0.32
15.27-24.37
19.85 + 3.27
6.50—10.07
7.46 + 1.20
4.76-6.66
5.56 + 0.64
September 2020 | Volume 14 | Number 3 | e250
Appendix II (continued). Measured morphometric traits and meristic characters.
Morphological
characters
LPI
All
Al2
Al5
Al3
Al9
Al4
Al6
Al7-l
Al18
A20-1
A20-2
A20-3
A204
A20-5
A21-1
A21-2
A21-3
A214
A21-5
A22
A26
Amphib. Reptile Conserv.
L. balagueri
n=12
4.01-6.12
5.07 + 0.62
4-8
6.33 + 0.98
6-8
7.08 + 0.79
6-8
6.67 + 0.89
5-7
6.08 + 0.51
5-7
5.67 + 0.65
4
4.00 + 0.00
6-8
6.67 + 0.65
7-9
7.50 + 0.67
12-16
13375 1:29
7-8
7.33 £0.49
9-11
10.17 + 0.83
14-16
14.67 + 0.65
12-18
15.33 + 1.67
8-11
9.58 +0.79
5-10
8.17+ 1.53
10-13
11.83 + 0.94
9-18
15.00 + 2.37
19-24
20.33 + 1.50
10-14
11.58+ 1.16
52-56
53.50 + 1.62
0-7
3.00 + 2.80
Huamani-Valderrama et al.
L. chiribaya
n=10
4.71-6.75
5.75 + 0.76
5-7
6.20 + 0.63
7-9
7.60 + 0.70
7-10
8.60 + 0.97
5-7
6.10 + 0.57
5-7
6.10 + 0.57
46
4.20 + 0.63
6-7
6.10 + 0.32
5-8
6.40 + 1.07
14-18
15.90 + 1.20
7-8
7.30 + 0.48
11-13
12.60 + 0.84
14-16
15.30 + 0.67
17-19
18.20 + 0.92
8
8.00 + 0.00
9-10
9.20 + 0.42
11-12
1.200.423
14-16
15.40 + 0.70
18-21
19.50 + 0.85
11-13
12.50+0.71
52-63
57.40 + 3.50
2-5
3.80 + 1.03
L. insolitus
n=15
3.73-6.40
5.03 + 0.82
5-9
6.27 + 1.16
7-8
7.47 + 0.52
7-9
7.80 + 0.56
5-8
6.40 + 0.74
5-8
6.27 0.70
46
467+ 0.82
6-8
7.07 + 0.59
7-8
7.20 + 0.41
14-18
15.07 + 1.03
6-9
7.67+ 1.11
8-16
12.07 + 2.49
12-16
14.40 + 1.30
10-17
(2-73 2,02
6-10
FAISELAO
6-11
7.80 + 1.15
10-12
10.93 + 0.88
12-16
14.00 + 1.25
20-22
20.67 + 0.62
10-12
11.27+0.88
58-69
63.40 + 3.48
0-8
4.20 + 2.83
L. nazca
n=7
3.23-6.16
4.90 + 0.87
5-8
6.14 + 1.07
6-9
7.43 + 0.98
6-8
6.57 + 0.98
5-6
5.57 + 0.53
5-6
5.71+0.49
4—5
4.14+0.38
5-6
5.86 + 0.38
7-10
8.43 + 0.98
11-14
| ay a I ol
7-10
8.71+1.11
12-13
12.86 + 0.38
15-19
15.86 + 1.57
17-20
18.57 + 1.13
9-10
9.71 +0.49
8-10
8.86 + 0.90
12-13
12.71 + 0.49
15-18
16.14+ 1.21
20-23
21.57 + 0.98
10-13
| eo =e [i
53-56
54.144 1.35
1-6
3.43 + 1.51
L. angapuka sp. nov.
n=7
5.20-9.22
6.33 + 1.41
6-8
7.00 + 0.58
7-10
8.43 + 0.98
8-10
9.00 + 0.82
6-8
6.86 + 0.69
7-8
7.14+0.38
4—5
414+0.38
6-7
6.14+ 0.38
8-10
9.00 + 0.82
13-17
14.29 + 1.50
7-9
8.29 + 0.76
9-13
11.29 + 1.38
11-15
13.57+ 1.62
15-18
17.00 + 1.15
7-10
8.71+1.11
7-11
9.29 + 1.50
11-14
12.00 + 1.00
12-18
15.14+ 1.86
20-23
21.434 1.13
9-13
10.86 + 1.35
60-76
67.29 + 5.59
2-6
3.43 + 1.62
September 2020 | Volume 14 | Number 3 | e250
Appendix II (continued). Measured morphometric traits and meristic characters.
Morphological L. balagueri L. chiribaya L. insolitus L. nazca L. angapuka sp. nov.
characters n=12 n=10 n=15 n=7 n=7
M2 1-2 2 1 1-3 1-2
1.33 + 0.49 2.00 + 0.00 1.00 + 0.00 1.86 + 0.69 1.86 + 0.38
M3 6-9 7-8 5-9 6-9 7-8
7.50 + 0.80 7.20 + 0.42 7.07 + 1.28 7.57+1.13 7.43 £0.53
M5 3-5 3-5 4-8 46 5-6
4.25+0.62 4.00 + 0.47 6.73 + 0.96 4.71+0.76 5.29 + 0.49
M4 3-6 3-5 3-8 3-6 4—7
4.75 +0.87 3.80 + 0.63 6.47 + 1.30 486+ 1.07 5.71 £0.95
M13 1-6 2-6 5—16 4—]] 3-8
3.92 + 1.68 420+ 1.40 10.00 + 3.21 6.57 + 2.64 5.29 + 1.80
M14 2-6 3-7 2-8 3-11 1-6
3:75 1:29 440+ 1.07 4.27+1.71 7.86 £2.97 3.86 + 1.95
M15 1-6 1-8 5—24 1-12 1-4
3.50 + 1.51 460+ 2.67 12.53 + 5.05 5.86 + 3.72 2.29 + 1.25
M23 26-30 19-25 26-32 21-25 28-36
27.17 + 1.34 21.70 + 1.89 28.80 + 2.48 23.86 + 1.46 30.86 + 3.02
M26 52-60 55-66 52-60 54-59 63-72
56.50 + 2.28 61.80 + 3.68 55.80 + 2.27 56.86 + 1.95 67.29 + 3.15
M32 65-79 67-77 69-80 65-74 73-87
73.17 + 3.69 72.70 + 2.95 73.53 + 3.36 70.57 + 2.88 82.43 + 4.72
M34 | 1 2-4 1-2 1
1.00 + 0.00 1.00 + 0.00 2.87 + 0.52 1.86 + 0.38 1.00 + 0.00
D6 6-8 6-8 6-8 7-10 7-9
6.92 + 0.67 7.30 + 0.67 6.47 + 0.74 P71 SAM 8.14 +0.69
A new species of Liolaemus from Peru
Note: Range in the first line; mean + standard deviation (mm) for quantitative characters in the second line.
Legend: Snout-vent length (SVL); minimum distance between the nasal scales (DN); snout width at the edge of the canthal scale
(AH); distance from the nose to the back edge of the canthal scale (NC); distance between the posterior edge of the superciliary
series (EO); length of the interparietal (LEI); length of the parietal (PA); mental scale width (AM); length of the mental scale (LM);
distance from nostril to mouth (NB); rostral height (HR); length of the subocular scale (ES); auditory meatus height (hTy); auditory
meatus width (aTy); length of the preocular scale (LPO); preocular width (LPOT); length of the fourth supralabial scale (LCSP);
length of the fourth lorilabial scale (LCLB); length between orbits (DEO); length of the first finger of the forelimb, without claw
(1D); length of the claw of the fourth finger of the forelimb (G4D); length of the fifth finger of the forelimb without claw (5D);
humerus width (AHU); distance from the insertion of the forelimb in the body toward the elbow (LEA1); thigh width (AMU); length
of the first toe of the hind limb without claw (1P); length of the claw of the fourth toe of the hind limb (4U); length of the five dorsal
scales in a row in the middle of the body (ED); cloacal opening width, measured distance between the corners of the cloaca (PP);
body width (AL); width of the base of the tail (WTB); upper width of the pygal area (ASPI); length of the pygal area (LPI). Number
of scales around the interparietal scale (A11); number of supralabials on the right side (A12); number of supralabials on the left
side (A15); number of infralabials on the right side (A13); number of infralabials on the left side (A19); number of scales around
the mental scale (A14); number of scales around the rostral scale (A16); number of lorilabials (A17—1); Hellmich index (A18);
subdigital lamellae of the first finger of the forelimb (A20-1); subdigital lamellae of the second finger of the forelimb (A20—2);
subdigital lamellae of the third finger of the forelimb (A20-3); subdigital lamellae of the fourth finger of the forelimb (A20-4);
subdigital lamellae of the fifth finger of the forelimb (A20—5); subdigital lamellae of the first toe of the hind limb (A21—1); subdigital
lamellae of the second toe of the hind limb (A21—2); subdigital lamellae of the third toe of the hind limb (A21-—3); subdigital
lamellae of the fourth toe of the hind limb (A21-—4); subdigital lamellae of the fifth toe of the hind limb (A21—5); number of dorsal
scales between the occiput and the level of the anterior edge of the thigh (A22); number of precloacal pores (A26); number of scales
between canthal and nasal scales (M2); number of scales around the nasal scale (M3); number of supraocular enlarged scales in
the right side (M5); number of supraocular enlarged scales in the left side (M4); number of organs in the postrostral scales (M13);
number of organs in the third lorilabial scale (M14); number of organs in the scale above the row of the lorilabial scales and below
the canthal and preocular scales (M15); number of gular scales (M23); number of scales around midbody (M26); number of ventral
scales (M32); number of auricular scales, projecting scales on anterior edge of auditory meatus (M34); and number of paravertebral
spots in the right side (D6).
Amphib. Reptile Conserv. 30 September 2020 | Volume 14 | Number 3 | e250
Official journal website:
amphibian-reptile-conservation.org
Amphibian & Reptile Conservation
14(3) [Taxonomy Section]: 31-45 (e251).
urn:lsid:zoobank.org:pub:BC39D736-FFFC-481D-B5FA-6CB84EA4E7AA
A new cryptic species of Cnemaspis Strauch, 1887
(Squamata: Gekkonidae), in the C. /ittoralis complex,
from Anakkal, Palakkad, Kerala, India
‘*TAmit Sayyed, *'Vivek Philip Cyriac, and *Raveendan Dileepkumar
'Wildlife Protection and Research Society, Maharashtra, INDIA *IISER-TVM Centre for Research and Education in Ecology and Evolution
(ICREEE), School of Biology, Indian Institute of Science Education and Research, Thiruvananthapuram, Kerala 695551, INDIA *YIPB Department
of Biotechnology, University of Kerala, INDIA
Abstract.—A new cryptic species of the gekkonid genus Cnemaspis is described from the Central Western
Ghats of Kerala, India. Cnemaspis palakkadensis sp. nov. is a small-sized (snout-vent length less than 35
mm) Cnemaspis in the littoralis clade. Although the new species superficially resembles C. littoralis, it shows
moderate levels of genetic divergence in the 16S rRNA gene, and can be differentiated from all other Indian
congeners by a Suite of distinct morphological characters: dorsal scales homogenous, small, smooth; absence
of conical or spine-like tubercles on flanks; ventral scales smooth, imbricate; dorsal scales of limbs smooth; 15
or 16 femoral pores on each side separated by 14 poreless scales; lamellae under fourth digit of manus 12-15
and pes 14—17; absence of whorls of pointed tubercles on tail; median subcaudals enlarged, imbricate, smooth.
The species is found in an ignored low-lying forest habitat in parts of the Anakkal reserve forest in Kerala.
Keywords. Asia, description, dwarf gecko, mountains, Reptilia, southern Western Ghats
Citation: Sayyed A, Cyriac VP, Dileepkumar R. 2020. A new cryptic species of Cnemaspis Strauch, 1887 (Squamata: Gekkonidae), in the C. /ittoralis
complex, from Anakkal, Palakkad, Kerala, India. Amphibian & Reptile Conservation 14(3) [Taxonomy Section]: 31-45 (e251).
Copyright: © 2020 Sayyed et al. This is an open access article distributed under the terms of the Creative Commons Attribution License [Attribution
4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction in any
medium, provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced, are
as follows: official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 15 July 2020; Published: 8 September 2020
Introduction
The genus Cnemaspis Strauch, 1887 is among the most
speciose of the Old World gekkotan genera, with at
least 168 known species, ranking as the second most
diverse gecko genus in the world after Cyrtodactylus
(Uetz et al. 2020). Although large-scale molecular
phylogenetic analyses have recently shown the genus to
be polyphyletic (Gamble et al. 2012; Pyron et al. 2013;
Zhang and Wiens 2016), there has been limited effort to
resolve these issues, probably due to the lack of wide-
spread sampling, specifically in the Indian region. With
48 species in mainland India, Cnemaspis represents
the largest group of geckos in the country, with a large
majority of the species restricted to the Western Ghats.
The Western Ghats, a long north-south orientated
mountain chain extending from Gujarat in the north
(21.00°N) to the southern tip of peninsular India in Tamil
Nadu (08.25°N), is one of the 36 global biodiversity
hotspots (Myers et al. 2000). Its historical isolation from
neighboring regions, complex topography, and humid
tropical to subtropical climate have resulted in a high level
of generic endemism, which 1s specifically accentuated
in many amphibians and reptiles (Vijayakumar et al.
2014; Cyriac and Kodandaramaiah 2017). Widespread
exploration in the higher reaches of the Western
Ghats has rapidly increased the number of reptile and
amphibian species in India (e.g., Zacharyah et al. 2011;
Byu et al. 2014; Viyayakumar et al. 2014; Zacharyah
et al. 2016; Sayyed et al. 2018; Chaitanya et al. 2019).
However, recent surveys in the low-lying regions of the
Western Ghats and several isolated hillocks in peninsular
India are revealing a great amount of undocumented
lizard diversity, especially among members of the genus
Cnemaspis (Khandaker et al. 2019; Agarwal et al. 2020;
Cyriac et al. 2020). In light of this, field surveys were
conducted in the lowland forests bordering the Palghat
gap in Kerala and Tamil Nadu, the largest geographical
break in the long Western Ghats chain of mountains.
These explorations revealed a new undescribed species
equally to this work.
Amphib. Reptile Conserv.
September 2020 | Volume 14 | Number 3 | e251
Anew Cnemaspis species from India
which resembles the widespread C. J/ittoralis (Jerdon)
and 1s described here based on its genetic distinctiveness
and a suite of distinct morphological characters.
Materials and Methods
Field sampling and specimens. Field surveys were
conducted during May 2019, in parts of Anakkal, Palakkad
District, Kerala, India. Specific sampling locations
were chosen based on previous observations. All adult
specimens were collected by hand, photographed in life,
and then euthanized using halothane. Thigh muscles were
collected as tissue samples for further genetic analysis,
after which specimens were fixed in 4% formaldehyde
for ~24 hours, washed in water, and transferred to
70% ethanol for long-term storage. Scalation and other
morphological characters were recorded using a Lensel
stereo microscope. The materials referred to in this study
are deposited in the collection of the Bombay Natural
History Society (BNHS), Mumbai, and were collected
under the permits issued by the Kerala Forest and
Wildlife Department (permits to RD, numbers WL10-
41691/2014 and 94/2009).
Phylogenetic analysis. Total genomic DNA _ was
extracted from the tissue samples using protocols as per
Sayyed et al. (2016). The 16S rRNA mitochondrial gene
was amplified using the primers designed by Palumbi
et al. (1991) following standard 3-step PCR protocols
(Palumbi 1996). The amplicons were then Sanger
sequenced using the primers. The resulting sequences
were manually checked for sequencing artifacts, and then
added to the 16S rRNA sequence matrix generated by
Cyriac et al. (2020) for the Indian Cnemaspis. However,
C. nilagirica was removed from the matrix generated by
Cyriac et al. (2020), since we found that the sample used
was contaminated. The sequences were aligned using
the MAFFT algorithm (Katoh and Standley 2013). The
pair-wise uncorrected p-distances between and within
species for the 16S rRNA gene were then calculated after
removing all ambiguous positions for each sequence
pair using MEGAX (Kumar et al. 2018). For the
downstream phylogenetic analysis, multiple sequences
of the same species were removed, except for the two
sequences of C. /ittoralis. The best-fit substitution model
was determined using PartitionFinder 2 (Lanfear et al.
2016) on the final 596 bp dataset and then a Maximum
Likelihood analysis was performed using IQ-TREE
(Nguyen et al. 2015) under the GTR+I+G substitution
model with 1,000 standard bootstrap replicates. The
MAFFT alignment, Partition Finder analysis, and
Maximum Likelihood analysis were carried out using the
phylogenetic workflow implemented in the PhyloSuite
platform (Zhang et al. 2020). Following Cyriac et al.
(2020), the tree was rooted by including three species of
Lygodactylus and three species of Phelsuma as outgroups
for the phylogenetic reconstruction (see Appendix 1).
Amphib. Reptile Conserv.
32
Morphological and meristic data. For the specimens
listed in Appendix 2, the following measurements were
taken using a Yamayo digimatic calliper, a Mitutoyo
500, or a Tesacalip 64 (to the nearest 0.1 mm): snout-
vent length (SVL), from tip of snout to anterior edge
of cloacal opening; trunk length (TL), distance from
axilla to groin measured from posterior edge of the
forelimb insertion to the anterior edge of the hind limb
insertion; trunk width (TW), maximum width of body;
tail length (TAL), from vent to tip of tail; tail width
(TLW), measured at widest point of tail; head length
(HL), distance from tip of snout to posterior edge of
mandible; head width (HW), maximum width of head;
head depth (HD), maximum depth of head, from occiput
to underside of jaws; upper arm length (UAL), distance
from axilla to elbow; forearm length (FAL), from base
of palm to elbow; femur length (FEL), distance from
groin to the knee; tibia length (TBL), knee to tarsus; toe
length (TOL), distance from tip of toe to the nearest fork;
palm length (PAL), distance between posterior-most
margin of palm and tip of fourth digit; finger length (FL),
distance from the tip of the finger to the nearest fork;
eye to nares distance (E-N), distance between anterior-
most point of eye and nostril; eye to snout distance (E-S),
distance between anterior-most point of eye and tip of
snout; eye to ear distance (E-E), distance from anterior
edge of ear opening to posterior corner of eye; tympanum
diameter (EL), maximum distance end-to-end (height) of
ear opening; distance between nares (IN), right to left
nare; orbital diameter (OD), greatest diameter of orbit;
interorbital snout distance (IO), distance between orbit
and snout on frontal bone.
Meristic data recorded for all specimens were
number of supralabials (SupL) and infralabials (InfL)
on left (L) and right (R) sides; number of interorbital
scales (InO); number of postmentals (PoM); number of
posterior postmentals (PoP), scales that are surrounded
by the posterior-postmentals and between infralabials;
number of supranasals (SuN), excluding the smaller
scales between the larger supranasals; number of the
postnasals (PoN), all scales posterior to the naris; number
of supraciliaries (SuS); number of scales between eye
and tympanum (BeT), from posterior-most point of the
orbit to anterior-most point of the tympanum; number of
canthal scales (CaS), number of scales from posterior-
most point of naris to anterior-most point of the orbit;
number of dorsal paravertebral scales (PvS), between
pelvic and pectoral limb insertion points along a straight
line immediately left of the vertebral column; number of
mid-dorsal scales (MbS), from the center of mid-dorsal
row diagonally towards the ventral scales; number of
midventral scales (MvS), from the first scale posterior to
the mental to the last scale anterior to the vent; number
of mid-body scales (BIS), across the ventral between the
lowest rows of dorsal scales; femoral pores (FPores), the
number of femoral pores; lamellae under digits of manus
(MLam) and pes (PLam) on right (R) side, counted from
September 2020 | Volume 14 | Number 3 | e251
99
Sayyed et al.
BNHS 2458 Cnemaspis amboliensis
ZS] R 1049 Cnemaspis sp :
a4 ZSI R 1050 Cnemaspis sp goaensis clade
ZSI R 1045 Cnemaspis goaensis . :
, _ mysoriensis
22 - BNHS 2510 Cnemaspis peer daite
45 BNHS 2512 Cnemaspis otai
BNHS 2465 Cnemaspis adii
BNHS 2514 Cnemaspis gracilis
BNHS 2446 Cnemaspis girii
ZS! R 1053 Cnemaspis limayei
ZSI R 1048 Cnemaspis mahabali
ZSI R 1058 Cnemaspis ajijae
————- ZS] WRC 1043 Cnemaspis flaviventralis
BNHS 2516 Cnemaspis indica
BNHS 2517 Cnemaspis littoralis
400 BNHS 2518 Cnemaspis littoralis
Cnemaspis palakkadensis sp. nov.
= VPCGK 014 Cnemaspissp 1 pepara
95 VPCGK 021 Cnemaspis sp 2 vagamon
VPCGK 016 Cnemaspis anamudiensis
BNHS 2466 Cnemaspis cf heteropholis
VPCGK 050 Cnemaspis cf heteropholis
42 2
giri clade
87
southern WG
clade
32
26
BNHS 2520 Cnemaspis wynadensis
79 27
UP W 007 Cnemaspis chengodumalaensis
wynadensis clade
70 VPCGK 051 Cnemaspis kottiyoorensis
83 UP W 001 Cnemaspis zacharyi
BNHS 2448 Cnemaspis kolhapurensis
Fig. 1. 16S rRNA tree of the Indian Cnemaspis obtained from the Maximum Likelihood analysis in IQ-TREE. Node values indicate
bootstrap support with values < 70 indicating low support, values between 70—90 indicating moderate support, and values > 90
indicating strong support. The blue and yellow circles represent the branches leading to C. /ittoralis and C. palakkadensis sp. nov.,
respectively, along with representative images of the two species indicated by their blue (C. /ittoralis) and yellow (C. palakkadensis
sp. nov.) borders.
first proximal enlarged scansor greater than twice width
of the largest palm scale, to distal-most lamella at tip of
digits; and lamellae under fourth digit of pes (LampIV).
For the geographical coordinates, altitude, and
temperature readings, a Kestrel 4500 receiver was used.
Opportunistic observations on the ecology of the species
were also made during field work. Since the specimens
from Palakkad most closely resembled Cnemaspis
littoralis, specimens were compared with the neotype of
C. littoralis and other associated material deposited at
the Zoological Survey of India Western Ghats Regional
Center (ZSI-WGRC), Kozhikode, India.
Morphometric analysis. The morphometric analysis
was performed in R V. 3.5.2 (R Core Team 2016). A
multivariate analysis was carried out on 25 morphometric
variables. This analysis included only 25 variables for
the analysis out of the 29 variables collected because
some variables were unavailable for a few specimens
due to missing tails or digits (see Table 3). A Principal
Component Analysis (PCA) was performed on the 25
variables to identify the variables that contributed to
the observed variation in the data. Plots were generated
for the first and second, and the first and third principal
components to visually examine the morphospace of
Amphib. Reptile Conserv.
the new species and the morphologically similar C.
littoralis.
Results
Phylogenetic Relationships
The topology recovered by the Maximum Likelihood
analysis indicated well-supported deeper nodes but
showed low support for many shallower nodes (Fig. 1).
The topology was mostly consistent with the topology
recovered by Sayyed et al. (2018) and Cyriac et al.
(2010), except for the position of Cnemaspis indica where
C. indica was sister to members of the giri, gracilis,
mysoriensis, goaensis, and amboliensis clades. The new
species was recovered as being sister to C. /ittoralis with
very strong support (Fig. 1). The Jittoralis clade was
sister to the (indica + (giri + ((((adii + mysoriensis) +
gracilis) + goaensis) + amboliensis))) clade. Uncorrected
pairwise sequence divergence for the 16S rRNA gene
indicated that the /ittoralis clade was deeply divergent
from the rest of the species (Sequence divergence > 10).
However, there was only a moderate level of genetic
divergence between C. /ittoralis and C. palakkadensis
sp. nov., which ranged between 2.5—2.7%.
September 2020 | Volume 14 | Number 3 | e251
Anew Cnemaspis species from India
Table 1. Loadings obtained from the Principal Component Analysis of the 25 morphometric variables. Bold values indicate strong
loading with correlation > 0.5.
Character Description
SVL Snout-vent length
TL Axilla-groin distance
TW Trunk width
OD Eye diameter
E-N Eye-to-nasal distance
E-S Snout length
E-E Eye-to-ear distance
IN Inter-nasal distance
EL Horizontal diameter of ear opening
HL Head length
HW Head width
HD Head depth
IO Inter-orbital distance
UAL Upper arm length
FAL Lower arm length
PAL Palm length
FL1 Length of 1* finger
FL3 Length of 3" finger
FL4 Length of 4" finger
FL5 Length of 5" finger
FEL Femur length
TBL Tibia length
TOLI Length of 1* toe
TOL2 Length of 2" toe
TOL4 Length of 4" toe
Eigenvalue
Standard deviation
Proportion of variance
Cumulative proportion
Morphometric Analysis
Principal Component Analysis indicated that the
first three PCs explained 77.7% of the variation in
morphology. PC1 explained ca. 48.9% of the variation
and described a shorter, slender body form with a
shorter head, shorter snout, larger eyes, and short limbs
(Table 1). PC2 explained ca. 20.2% of the variation and
is described mostly by smaller eyes, shorter eye-to-ear
distance, smaller ear opening, and shorter forelimbs
(Table 1). PC3 explained ca. 8.1% of the variation
and described a less depressed head and narrower
interorbital region (Table 1). Plots of PC1 with PC2 and
PC1 with PC3 indicated considerable differences in the
morphospace between the new species and C. /ittoralis,
with the differences being along PC1 (Fig. 2A—B).
Amphib. Reptile Conserv.
34
PCI PC2 PC3
-0.8278 -0.3045 -0.2238
-0.8229 -0.2799 -0.2737
-0.7241 -0.4259 -0.3070
0.6453 -0.6311 -0.0557
-0.9000 0.2800 0.0950
-0.7350 -0.3478 -0.0852
-0.3239 -0.5513 0.4186
-0.9745 0.1924 -0.0163
0.4675 -0.7923 -0.1568
-0.6952 -0.5014 0.2935
-0.8603 -0.3320 0.2034
-0.3677 -0.2852 0.5858
-0.6162 -0.0902 -0.5711
-0.4407 -0.7307 0.1714
-0.6657 -0.4920 0.3509
-0.7949 0.2111 -0.2336
0.5045 -0.5947 0.0675
0.6421 -0.0028 0.3832
0.7575 -0.4670 0.0566
0.6749 -0.5265 -0.3075
-0.9383 -0.2243 0.0515
-0.6979 -0.1892 0.2162
0.7920 -0.5161 -0.0054
0.6670 -0.6226 -0.1914
-0.4037 -0.5158 -0.4972
12.2328 5.0454 2.0250
3.4976 2.2462 1.4230
0.4893 0.2018 0.0810
0.4893 0.6911 0.7721
Systematics
Cnemaspis palakkadensis sp. nov.
Figs. 3-7; Tables 2-4.
urn: lsid:zoobank.org:act:4A854A 91-206D-41E0-959 E-5761F3040380
Holotype. BNHS 2790, an adult male, 32.2 mm SVL,
from Anakkal (10°52’50”N, 76°39’23”E; ca. 140 m asl),
Palakkad District, Kerala, south-western India (Fig. 1),
collected by Amit Sayyed, 18 May 2019.
Paratype. BNHS 2791, an adult male, 31.5 mm SVL, and
BNHS 2792, an adult female, 34.1 mm SVL; collected
from same locality as holotype by Vivek Vaidyanathan
and Abhijit Nale, 19 May 2019.
September 2020 | Volume 14 | Number 3 | e251
Sayyed et al.
72.5°E
Species
(@|C. littoralis
Dim2 (20.2%)
Oo
Dim3 (8.1%)
oOo
!
\
\
\
'
1
\
\
-------- +
'
\
\
\
\
'
1
\
\
T
+
72.5°E
4 0
Dim1 (48.9%)
_75.0°E
77.5°E
77.5°E
Fig. 2. Results of the morphometric analysis comparing the morphospace occupied by Cnemaspis littoralis and C. palakkadensis
sp. nov. (A) Morphospace occupied by the two species as indicated by the first two dimensions (PC1 and PC2); (B) morphospace
occupied by the two species as indicated by the first and third dimensions (PC1 and PC3); and (C) map showing the distributions of
C. littoralis and C. palakkadensis sp. nov. The blue and yellow points in the morphospace and the map correspond to C. /ittoralis
and C. palakkadensis sp. nov., respectively.
Diagnosis and comparison with Indian congeners. A
small-sized Cnemaspis, SVL < 35 mm; dorsal pholidosis
homogenous with small, smooth, granular scales in the
vertebral and paravertebral regions; conical or spine-
like tubercles absent on flank; ventral scales smooth,
imbricate; males with 15-16 femoral pores on each
thigh and no pre-cloacal pores; supralabials to angle
of jaw 7-8, infralabials to angle of jaw 6—8; lamellae
under fourth digit of manus 12—15, and pes 14-17; tail
without whorls of enlarged tubercles; median subcaudals
enlarged, imbricate, smooth, post cloacal spur absent in
both sexes.
Cnemaspis palakkadensis sp. nov. can be
distinguished from all other Indian congeners on the
basis of the following differing or non-overlapping
characters: Spine-like tubercles absent on flanks [versus
spine-like tubercles present on flank in C. amboliensis
Sayyed, Pyron, and Dileepkumar, C. assamensis Das and
Sengupta, C. anandani Murthy, Nitesh, Sengupta, and
Deepak, C. flaviventralis Sayyed, Pyron, and Dahanukar,
C. goaensis Sharma, C. gracilis (Beddome), C. jerdonii
(Theobald), C. koynaensis Khandekar, Thackery, and
Agarwal, C. monticola Manamendra-Arachchi, Batuwita,
and Pethiyagoda, C. mysoriensis (Jerdon), C. monticola
Manamendra-Arachchi, Batuwita, and Pethiyagoda,
C. nilagirica Manamendra-Arachchi, Batuwita, and
Pethiyagoda, and C. otai Das and Bauer]. Dorsal
scales on midbody homogenous [versus heterogeneous
in C. aaronbaueri Sayyed, Grismer, Campbell, and
Amphib. Reptile Conserv.
35
Dileepkumar, C. agarwali Khandekar, C. ajijae Sayyed,
Pyron, and Dileepkumar, C. amba Khandekar, Thackery,
and Agarwal, C. amboliensis, C. anamudiensis Cyriac,
Johny, Umesh, and Palot, C. anandani, C. andersonii
(Annandale), C. australis Manamendra-Arachchi,
Batuwita, and Pethiyagoda, C. avasabinae Agarwal,
Bauer, and Khandekar, C. bangara Agarwal, Thackeray,
Pal, and Khandekar, C. beddomei (Theobald), C.
chengodumalaensis Cyriac, Palot, and Deutiand Umesh,
C. flaviventralis, C. girii Mirza, Pal, Bhosale, and
Sanap, C. goaensis, C. gracilis, C. graniticola Agarwal,
Thackeray, Pal, and Khandekar, C. heteropholis Bauer,
C. kottivoorensis Cyriac and Umesh, C. koynaensis, C.
limayei Sayyed, Pyron, and Dileepkumar, C. maculicollis
Cyriac, Johny, Umesh, and Palot, C. mahabali Sayyed,
Pyron, and Dileepkumar, C. monticola Manamendra-
Arachchi, Batuwita, and Pethiyagoda, C. nairi Inger,
Marx, and Koshy, 1984, C. ornata (Beddome), C.
shevaroyensis (Khandekar, Gaitonde and Agarwal,
C. sisparensis (Theobald), C. thackerayi Khandekar,
Gaitonde, and Agarwal, C. wicksii (Stoliczka), C.
yelagiriensis Agarwal, Thackeray, Pal, and Khandekar,
and C. yercaudensis Das and Bauer]. Presence of a
series of 15-16 femoral pores on each side and the
absence of pre-cloacal pores in males [versus absence
of femoral pores in C aaronbaueri, C. anamudiensis,
C. avasabinae, C. assamensis, C. beddomei, C. boiei
(Gray), C. maculicollis, C. nairi, and C. ornata; presence
of both pre-cloacal and femoral pores in C. adii, C.
September 2020 | Volume 14 | Number 3 | e251
Anew Cnemaspis species from India
Table 2. Measurements (to the nearest 0.1 mm) of the type series of Cnemaspis palakkadensis sp. nov. Measurement abbreviations
are defined in the text.
Measurement Holotype
BNHS 2790
Sex male
SVL 32.2
TL 15.6
TW 6.4
TAL a5
TLW 3.4
HL 8.9
HW 52
HD 3.3
UAL 4.5
FAL 5.5
FEL 5.8
TBL 5.9
PAL 3.7
E-N 4.0
E-S 4.1
E-E 2.5
EL 0.3
IN 1.6
OD 2
IO 3.3
agarwali, C. amboliensis, C. andersonii, C. australis,
C. bangara, C.gracilis, C. goaensis, C. graniticola, C.
mysoriensis, C. otai, C. shevaroyensis, C. thackerayi,
C. wicksii, C. yelagiriensis, and C. yercaudensis|; and
from the following species by presence large number of
femoral pores [versus < 10 femoral pores on each side in
C. ajijae, C. amba, C. anandani, C. chengodumalaensis,
C. flaviventralis, C. girti, C. heteropholis, C. indica, C.
Jerdonii, C. kottiyoorensis, C. koynaensis, C. limayei, C.
mahabali, C. nilagirica, C. sisparensis, C. wynadensis,
and C. zacharyi Cyriac, Palot, and Deutiand Umesh;
and a continuous series of precloacal-femoral pores in
C. kolhapurensis|. Median subcaudals enlarged [versus
small median subcaudals in C. adii, C. ajijae, C. amba,
C. andersonii, C. flaviventralis, C. girii, C. gracilis, C.
koynaensis, and C. limayei].
Cnemaspis palakkadensis sp. nov. could be confused
with the morphologically similar C. /ittoralis (Jerdon),
but can be distinguished by its longer trunk length
(AG 46-49% of SVL versus AG 37-46% of SVL in C.
littoralis), much smaller eyes (ED 13-14% of HL versus
ED 16-21% of SVL in C. Jittoralis),; absence of conical
or spine-like tubercles on flanks (versus small spine-like
tubercles present on flanks in C. /ittoralis), supralabials
to angle of jaw 7-8 (versus 9-10 supralabials in C.
littoralis),; number of scales between eye and tympanum
18-19 (versus 17); mid-dorsal scales 54—57 (versus 52);
Amphib. Reptile Conserv.
Paratypes
BNHS 2791 BNHS 2792
male female
31.5 34.0
14.6 16.7
52 6.8
32.6 33.3
27 2.8
8.7 9.1
S| 5.2
3.3 3.5
3.8 4.6
5.3 5.6
St 59
5.9 6.0
3.6 3.9
4.0 4.2
4] 43
pies: 25
0.2 0.3
1.6 1.6
1.2 be
322 3.4
midventral scales 130-134 (versus 122); number of
mid-body scales 32—38 (versus 26); absence of a small
post-cloacal spur on both sides of the tail and absence of
whorls of enlarged tubercles on the tail (versus a single
post-cloacal spur present on each side of the tail and
whorls of small but enlarged tubercles on the dorsal side
of the tail in C. Jittoralis).
Description of holotype. An adult male of SVL 32.2
mm (Fig. 3A—B); head moderately short (HL 17.6%
of SVL), narrow (HW 15.9% of SVL), flat CHD 59.4%
of HL), distinct from neck; snout short (E-S 78.6% of
HL), slightly curved laterally; scales on snout granular,
smooth, larger than those on the forehead and interorbital
region (Fig. 4A); eye small (OD 21.8% of HL); pupil
rounded; 13 supraciliaries; 30 interorbital scales; ear
opening small (EL 5.7% of HL), longer than broad; 18
scales between eye and tympanum. Rostral wider than
long, partially divided by a deep median groove; nostrils
small, bordered posteriorly by two small, granular,
postnasal scales; single enlarged supranasal on each side
separated by an elongated intermediate scale. Mental
large, triangular, not pointed posteriorly, broader than
long, bordered posteriorly by two postmentals and a
single intermediate chin shield broadly separated the
postmentals, eight scales surrounded posteriorly by
the posterior postmentals, infralabials, and the mental;
September 2020 | Volume 14 | Number 3 | e251
Sayyed et al.
Fig. 3. Holotype (BNHS 2790) of Cnemaspis palakkadensis sp.
nov. (A) Dorsal view and (B) ventral view of full-body. Photos
by Amit Sayyed.
three smooth, large scales posteriorly surrounded by
intermediate chin shield; gular scales granular, smooth,
larger than those on throat (Fig. 4B). Seven supralabials
to angle of jaw on each side, supralabial I largest,
decreasing in size posteriorly; six infralabials to angle of
jaw on each side, infralabial I largest, decreasing in size
posteriorly (Fig. 4C).
Fig. 4. Holotype (BNHS 2790) of Cnemaspis palakkadensis
sp. nov. (A) Dorsal, (B) ventral, and (C) lateral views of the
head. Photos by Amit Sayyed.
Amphib. Reptile Conserv.
37
Body slender, short (TL 40%) without conical or
spine-like tubercles on flanks (Fig. 5A, C). Dorsal scales
of the body and flank homogenous, small, granular,
smooth; scales on forehead, neck, and dorsal body equal
in size; paravertebral scales 112; number of mid-dorsal
scales 54; scales arranged in 33-35 longitudinal rows
at midbody, number of midventral scales 131, smooth,
imbricate, larger than dorsals (Fig. 5B). Fore and hind
limbs relatively long, slender (FL 16.8%; TBL 16.4%);
dorsal scales of brachium granular, smooth, larger
than forearm; dorsal scales of forearm small, granular;
ventral scales of brachium and forearm small, smooth;
dorsal scales on palm, foot and fingers granular, smooth;
scales on palmar and plantar surfaces smooth; subdigital
lamellae entire, few fragmented; series of unpaired
lamellae on basal portion of digits, separated from
fragmented distal lamellae by a single large scale at the
inflection; proximal lamellae series: 1-3-4-4-3 (right
manus), 1-4-5-6-3 (right pes); distal lamellae series:
9-11-14-14-12 (right manus), 9-13-15-17-11 (right pes).
Relative lengths of digits, fingers: IV (2.71 mm) > III
(2.53 mm) > II (2.42 mm) > V (1.87 mm) > I (1.18 mm);
toes: IV (3.68 mm) > III (3.16 mm) > II (1.99 mm) > V
(1.75 mm) > 1 (0.85 mm) [Fig. 6A—B]. Femoral pores 15;
14 poreless scales between right and left femoral pore
series; three rows of enlarged, roughly hexagonal scales
above the femoral pores, larger than those on precloacal
region; no precloacal pores; precloacal scales equal in
size to the belly scales (Fig. 6C).
Tail long (TAL 111%), cylindrical, base swollen;
post-cloacal spur absent on each side of lateral surface
of hemipenal bulges at base of tail; dorsal scales of tail
homogenous, smooth, granular, without enlarged, conical
tubercles forming whorls, ventral scales imbricate,
smooth; median subcaudals enlarged, smooth; those
at the base are moderately smaller and imbricate (Fig.
6D-F).
Coloration in life (Fig. 6A—C). Male and female of the
new species are the same in dorsal appearance. Dorsum
of head mottled with brown and yellow; ventral side of
head bright orange-yellow in males but white in females,
bordered by a dark brown line up to the throat; nape with
a small, black ocelli-like marking. Iris yellow with thin
dark yellow line bordering pupil; pupil circular, black;
supraciliaries yellow; supralabials and _ infralabials
yellow. Dorsum of the body and limbs dull grey with
brown and pale yellowish mottling; vertebral region
pale yellow with 6-7 dark-edged lighter markings. Tail
dull brown dorsally, with irregular faded yellow spots.
Ventral side of body and tail white.
Coloration in preservative. Dorsum of the body and
limbs with brown which turns into dark brown and pale
yellow mottling and into grey; ventral side of body and
tail greyish white; ventral side of head in males grey with
slight yellowish tinge.
September 2020 | Volume 14 | Number 3 | e251
Anew Cnemaspis species from India
Table 3. Meristic data for the type series of Cnemaspis palakkadensis sp. nov. The symbol “?” indicates a broken finger, and “—”
indicates pores not present.
Character Holotype (BNHS 2790) Paratype (BNHS 2791) Paratype (BNHS 2792)
Sex male male female
SupL R/L 7/7 8/8 8/8
InfL R/L 6/6 8/8 8/7
SuS 13 13 13
InO 30 32 31
BeT 18 18 19
PoN 2
PoM 2
PoP 10
SuN 1 1 1
CaS 14 15 14
PvS 112 109 113
MbS 54 54 57
MvS 131 130 134
BIS 33-35 32-34 35-38
FPores 15/15 16/16 —
MLam R 9-11-14-14-12 7-10-12-12-11 9-?-13-15-13
PLam R 9-13-15-17-11 7-12-9-14-13 9-14-16-17-15
Variation of the type series (Tables 1-3). The SVL
of adult specimens in the type series of Cnemaspis
palakkadensis sp. nov. (n = 3) ranges from 31.5 to
34.1 mm; number of posterior postmentals, 8—10;
scales between eye and tympanum,18—19; number of
interorbitals, 30-32; number of canthal scales, 14—15;
number of dorsal paravertebral scales, 109-113; number
of mid-dorsal scales, 54-57; number of midventral scales
from mental to cloaca, 130—134; number of mid-body
scales across belly, 32-38; lamellae under fourth digit
of manus (MLamIV) and pes (PLamIV), 12—15 and 14—
17, respectively. Male and female paratypes match the
holotype in overall coloration, except for the coloration
on the throat.
Etymology. The specific epithet palakkadensis refers
to the Palakkad district, from which the type series was
collected.
Suggested Common Name. Palakkad Dwarf Gecko.
Distribution. At present, the new species is only
known from the type locality in Anakkal reserve forest
(10°52’50”N 76°39’23”E) in Palakkad District of Kerala
state (Fig. 1C), which is a low-land moist deciduous to
riparian forest at an elevation of 84-170 m asl on the
northern border of the Palghat gap, a ca. 30-km gap
separating the central and southern Western Ghats.
However, it is possible that the range of this species may
extend to other low-land forests in the Palakkad region of
Kerala and Coimbatore of Tamil Nadu.
Amphib. Reptile Conserv.
Natural history. The species is found in low-land moist
deciduous to semi-evergreen forest habitat of Palakkad
hills of the Central Western Ghats. The climate of the
region 1s moist and humid, and the area is rich in natural
forest. All the specimens were found active during the
day on the trunks, branches, and exposed roots of large
trees around small streams (Fig. 8A—B), suggesting that
this species is arboreal and diurnal. Single eggs or pairs
of eggs were observed in several tree holes during the
field survey (Fig. 7D). Two eggs that were collected
measured 5.1 x 4.9mm and 5.2 x 5.0 mm. The types were
found sympatrically with Ophiophagus hannah (Cantor),
Trimeresurus gramineus (Shaw), Naja naja (Linnaeus),
Hypnale hypnale (Merrem), Ahaetulla nasuta Lacepede,
Amphiesma_ stolatum (Linnaeus), Lycodon aulicus
(Linnaeus), Dendrelaphis tristis (Daudin), Cnemaspis
gracilis, Cnemaspis sp., Psammophilus dorsalis (Gray),
and Psammophilus sp. (Stoliczka).
Discussion
The phylogenetic analysis recovered a topology mostly
concordant with previous studies employing the 16S
rRNA gene (Sayyed et al. 2018; Cyriac et al. 2020),
even after the removal of Cnemaspis nilagirica from
the sequence matrix. However, there was a difference in
the phylogenetic placement of Cnemaspis indica. While
this analysis recovered moderate support for a sister
relationship between C. indica and members of the giri,
gracilis, mysoriensis, goaensis, and amboliensis clades
(Fig. 1), Sayyed et al. (2018) and Cyriac et al. (2020)
September 2020 | Volume 14 | Number 3 | e251
Sayyed et al.
Fig. 5. Holotype (BNHS 2790) of Cnemaspis palakkadensis
sp. nov. (A) Dorsal pholidosis at midbody, (B) ventral scales
at midbody, (C) scales on lateral surface of trunk. Photos by
Amit Sayyed.
recovered a sister relationship between C. indica and
members of the gracilis, mysoriensis, goaensis, and
amboliensis clades, albeit with very low support. Such
discordance could be due to the removal of C. nilagirica
from the analysis or the differences in our analytical
approach. Nonetheless, our analysis indicates slightly
improved support values for deeper nodes compared to
earlier 16S rRNA trees.
The analysis clearly indicated that Cnemaspis
palakkadensis sp. nov. was sister to C. /ittoralis, and
showed moderate levels genetic divergence (2.5-
2.7%) from the latter. Although genetic divergences
of 24% are considered low for the 16S rRNA gene,
morphologically distinct species have been shown to
exhibit shallow genetic divergence (ca. 1%) for the
16S rRNA gene (Shanker et al. 2017). The specimens
described here as C. palakkadensis sp. nov. occupy a
distinct morphospace compared to C. Jittoralis, despite
the superficial morphological resemblance and shallow
genetic divergence with C. /ittoralis. Further, the genetic
divergence between C. palakkadensis sp. nov. and C.
littoralis was greater than the average intraspecific
genetic divergence estimated for 16 Cnemaspis species
based on the 16S rRNA gene of only 0.4 + 0.42%, with
the maximum intraspecific genetic divergence recorded
Amphib. Reptile Conserv.
A
Fig. 6. Holotype (BNHS 2790) of Cnemaspis palakkadensis sp.
nov. (A) Lamellae on manus, (B) lamellae on pes, (C) femoral
pores, (D) dorsal scalation of tail, (E) subcaudals, (F) lateral
side of tail. Photos by Amit Sayyed.
being 1.7% (see Appendix 3). The two species are also
morphologically distinct and can be distinguished based
on several non-overlapping diagnostic characters.
Interestingly, C. palakkadensis sp. nov. was found in
low-land moist deciduous to semi-evergreen forests in
the northern border of the Palghat gap. This gap forms
a major dispersal barrier and biogeographic divide to
many groups of animals which are distributed on the
higher reaches of the Western Ghats (Robin et al. 2010;
Van Bocxlaer et al. 2012; Vijayakumar et al. 2014).
However, our understanding of what biogeographic
barriers influence the distribution of low-land habitat-
Specialist species remains poor, mostly due to the lack
of systematic exploration of low-lying regions. The
discovery of C. palakkadensis sp. nov. from the low-land
forests in the Palghat gap further highlight the presence
of unknown diversity within the species C. Jittoralis,
which is thought to have a wide distribution in the littoral
regions of Kerala (Cyriac and Umesh 2013). However,
widespread systematic explorations in these low-land
forests will be necessary to determine the distributional
range of this species. Cyriac and Umesh (2013)
designated a neotype for C. /ittoralis based on specimens
September 2020 | Volume 14 | Number 3 | e251
A new Cnemaspis species from India
Fig. 7. Color in life of Cnemaspis palakkadensis sp. nov. (A) Holotype male (BNHS 2790), (B) paratype female (BNHS 2792), (C)
= Se. * Sr
holotype male (BNHS 2790) showing the coloration of throat, (D) egg. Photos by Amit Sayyed.
collected from Chaliyam coast in Kozhikode, Kerala,
and reported additional specimens from Narayamkulam
(= Chengodumala) in Kozhikode district, Nellikuth
in Malapuram district, and Kapprikkad in Ernakulam
district of Kerala. They also reported observations of C.
littoralis from Kannur, Thrissur, Palakkad, Ernakulam,
and Thiruvananthapuram in Kerala. However, given the
possibility of cryptic species within this group, the true
distribution of C. /ittoralis will need further evaluation.
Recent and current explorations in the high and
low mountains of the Western Ghats of India have led
to the discovery of several unique species of the genus
Cnemaspis. Although most of them are from isolated
humid forest (Giri et al. 2009b; Srinivasulu et al. 2015;
Cyriac et al. 2018; Khandekar et al. 2019a; Sayyed et
al. 2019), ongoing studies are showing that Cnemaspis
can also be found in drier regions. With the discovery
of C. palakkadensis sp. nov., the number of Cnemaspis
species in the Indian mainland increases to 43, yet the
true diversity within this group is clearly far from being
totally uncovered. Recent studies have also hinted at
the presence of cryptic diversity within the south Asian
Cnemaspis (Agarwal et al. 2017; Cyriac et al. 2020). The
current study further calls attention to cryptic diversity
within the Western Ghats and adjacent low-lying regions.
Thus, widespread fine-scale sampling will be critical for
uncovering species richness and distributional patterns
within the group.
Amphib. Reptile Conserv.
Fig. 8. Habitat of Cnemaspis palakkadensis sp. nov. Photos by
Amit Sayyed.
September 2020 | Volume 14 | Number 3 | e251
Sayyed et al.
Acknowledgments.—The authors are thankful to the
Forest Departments of Kerala for issuing collecting
permits, and for their support during field surveys.
Deepak Apte (Director) and Rahul Khot (museum
curator) of the Bombay Natural History Society, Mumbai,
provided access to specimens and registration of the type
specimens. We also thank Vithoba Hegde, Umesh P.K,
Vivek Vidyanathan, Abhiit Nale, Kiran Ahire, Vikas
Jagtap, Mahesh Bandgar, Ayaan Sayyed, and Masum
Sayyed for help during fieldwork and for their support.
Literature Cited
Bauer AM. 2002. Two new species of Cnemaspis
(Reptilia: Squamata: Gekkonidae) from Gund, Uttara
Kannada, India. Mitteilungen aus dem Hamburgischen
Zoologischen Museum und Institut 99: 155-167.
Byu SD, Garg S, Gururaja KV, ShoucheY, Walujkar
SA. 2014. DNA barcoding reveals unprecedented
diversity in Dancing Frogs of India (Micrixalidae,
Micrixalus): a taxonomic revision with description of
14 new species. Ceylon Journal of Science (Biological
Sciences) 43(1): 37-123.
Chaitanya R, Giri VB, Deepak V, Datta-Roy A, Murthy
BHCK, Karanth P. 2019. Diversification in the
mountains: a generic reappraisal of the Western Ghats
endemic gecko genus Dravidogecko Smith, 1933
(Squamata: Gekkonidae) with descriptions of six new
species. Zootaxa 4688: 1-56.
Cyriac VP, Umesh PK. 2013. Current status of Cnemaspis
littoralis (Jerdon, 1853) (Sauria: Gekkonidae) with
designation of a neotype. Zaprobanica: the Journal of
Asian Biodiversity 5: 36-43.
Cyriac VP, Umesh PK. 2014. Description of a new
ground-dwelling Cnemaspis Strauch, 1887 (Squamata:
Gekkonidae), from Kerala, allied to C. wynadensis
(Beddome, 1870). Russian Journal of Herpetology
21(3): 187-194.
Cyriac VP, Kodandaramaiah U. 2017. Paleoclimate
determines diversification patterns in the fossorial
snake family Uropeltidae Cuvier, 1829. Molecular
Phylogenetics and Evolution 116: 97-107.
Cyriac VP, Johny A, Umesh PK, Palot MJ. 2018.
Description of two new species of Cnemaspis Strauch,
1887 (Squamata: Gekkonidae) from the Western
Ghats of Kerala, India. Zootaxa 4459: 85-100.
Cyriac VP, Palot MJ, Deuti K, Umesh PK. 2020. A
preliminary 16S rRNA phylogeny of the Indian
Cnemaspis Strauch, 1887 (Squamata: Gekkonidae)
with the description of two new cryptic species from
the C. wynadensis clade. Vertebrate Zoology 70(2):
171-193.
Das I, Bauer AM. 2000. Two new species of Cnemaspis
(Sauria: Gekkonidae) from Tamil Nadu, southern
India. Russian Journal of Herpetology 7(1): 17-28.
Das I, Sengupta S. 2000. A new species of Cnemaspis
(Sauria: Gekkonidae) from Assam, northeastern India.
Amphib. Reptile Conserv.
41
Journal of South Asian Natural History 5(1): 17-23.
Gamble T, Greenbaum E, Jackman TR, Russell AP,
Bauer AM. 2012. Repeated origin and loss of adhesive
toepads in geckos. PLoS ONE 7(6): €39429.
Giri VB, Agarwal I, Bauer AM. 2009a. Designation of
a neotype for Cnemaspis mysoriensis (Jerdon 1853)
(Sauria: Gekkonidae), with a re-description and notes
on its distribution and habitat. Russian Journal of
Herpetology 16: 256-264.
Giri VB, Bauer AM, Gaikwad KS. 2009b. A new ground-
dwelling species of Cnemaspis Strauch (Squamata:
Gekkonidae) from the northern Western Ghats,
Maharashtra, India. Zootaxa 2164: 49-60.
Katoh K, Standley DM. 2013. MAFFT multiple sequence
alignment software version 7: improvements in
performance and usability. Molecular Biology and
Evolution 30(4): 772-780.
Khandekar A. 2019. A new species of rock-dwelling
Cnemaspis Strauch, 1887 (Squamata: Gekkonidae)
from Tamil Nadu, southern India. Zootaxa 4571:
383-397.
Khandekar A, Thackery T, Agarwal I. 2019a. Two more
new species of Cnemaspis Strauch, 1887 (Squamata:
Gekkonidae) from the northern Western Ghats,
Maharashtra, India. Zootaxa 4656: 43-70.
Khandekar A, Gaitonde N, Agarwal I. 2019b. Two new
Cnemaspis Strauch, 1887 (Squamata: Gekkonidae)
from the Shevaroy massif, Tamil Nadu, India, with
a preliminary ND2 phylogeny of Indian Cnemaspis.
Zootaxa 4609: 68-100.
Kumar S, Stecher G, Li M, Knyaz C, Tamura K. 2018.
MEGA X: molecular evolutionary genetics analysis
across computing platforms. Molecular Biology and
Evolution 35(6): 1,547-1,549.
Lanfear R, Frandsen PB, Wright AM, Senfeld T, Calcott
B. 2017. PartitionFinder 2: new methods for selecting
partitioned models of evolution for molecular and
morphological phylogenetic analyses. Molecular
Biology and Evolution 34(3): 772-773.
Manamendra-Arachchi K, Batuwita S, Pethiyagoda R.
2007. A taxonomic revision of the Sri Lankan day-
geckos (Reptilia: Gekkonidae: Cnemaspis), with
descriptions of new species from Sri Lanka and
southern India. Zeylanica 7: 9-122.
Mirza ZA. 2018. A new cryptic species of ground-
dwelling Hemidactylus (Squamata: Gekkonidae)
from southern India. Phyllomedusa 17: 169-180.
Mirza ZA, Pal S, Bhosale HS, Sanap RV. 2014. A new
species of gecko of the genus Cnemaspis Strauch,
1887 from the Western Ghats, India. Zootaxa 3815:
494-506.
Mukherjee D, Bhupathy S, Nixon AMA. 2005. A new
species of day gecko (Squamata, Gekkonidae,
Cnemaspis) from the Anaikatti Hills, Western Ghats,
Tamil Nadu, India. Current Science 89: 1,326—1,328.
Murthy BHC, Nitesh A, Sengupta S, Deepak P. 2019.
A new species of day gecko of the genus Cnemaspis
September 2020 | Volume 14 | Number 3 | e251
Anew Cnemaspis species from India
Strauch, 1887 (Squamata: Gekkonidae) from the
Nilgiri Hills, Tamil Nadu, India. Records of the
Zoological Survey of India 119(3): 211-226.
Myers N, Mittermeier RA, Mittermeier CG, Da
Fonseca GA, Kent J. 2000. Biodiversity hotspots for
conservation priorities. Nature 403: 853-858.
Nguyen LT, Schmidt HA, Von Haeseler A, Minh BQ.
2015. IQ-TREE: a fast and effective stochastic
algorithm for estimating maximum-likelihood
phylogenies. Molecular Biology and Evolution 32(1):
268-274.
Palumbi SR. 1996. PCR and molecular systematics.
Molecular Systematics 2: 205-247.
Palumbi SR, Martin A, Romano S, McMillan WO, Stice
L, Grabowski G. 1991. The Simple Fool's Guide to
PCR, Version 2.0. University of Hawai, Honolulu,
Hawaii, USA. 45 p.
Pyron RA, Burbrink FT, Wiens JJ. 2013. A phylogeny and
revised classification of Squamata, including 4,161
species of lizards and snakes. BMC Evolutionary
Biology 13(1): 1-54.
R Core Team. 2016. R: a language and environment for
statistical computing. R Foundation for Statistical
Computing, Vienna, Austria.
Robin VV, Sinha A, Ramakrishnan U. 2010. Ancient
geographical gaps and paleo-climate shape the
phylogeography of an endemic bird in the sky islands
of southern India. PLoS ONE 5(10): e13321.
Sayyed A, Pyron RA, Dahanukar N. 2016. Cnemaspis
flaviventralis, a new species of gecko (Squamata:
Gekkonidae) from the Western Ghats of Maharashtra,
India. Journal of Threatened Taxa 8: 9,619-9,629.
Sayyed A, Pyron RA, Dileepkumar R. 2018. Four new
species of the genus Cnemaspis Strauch, 1887 (Sauria:
Gekkonidae) from the northern Western Ghats, India.
Amphibian & Reptile Conservation 12(2) [General
Section]: 1-29 (e157).
Sayyed A, Grismer LL, Campbell PD, Dileepkumar
R. 2019. Description of a cryptic new species of
Cnemaspis Strauch, 1887 (Squamata: Gekkonidae)
from the Western Ghats of Kerala State of India.
Zootaxa 4656: 501-514.
Shanker K, Vijayakumar SP, Ganeshaiah KN. 2017.
Unpacking the species conundrum: philosophy,
Amphib. Reptile Conserv.
practice, and a way forward. Journal of Genetics
96(3): 413-430.
Srinivasulu C, Kumar GC, Srinivasulu B. 2015. A new
species of Cnemaspis (Sauria: Gekkonidae) from
Northern Karnataka, India. Zootaxa 3947: 85-98.
Uetz P, Hoek J. 2019. The Reptile Database. Available:
http://www. reptile-database.org [Accessed: 5 January
2020].
Van Bocxlaer I, Biryu SD, Willaert B, Giri VB, Shouche
YS, Bossuyt F. 2012. Mountain-associated clade
endemism in an ancient frog family (Nyctibatrachidae)
on the Indian subcontinent. Molecular Phylogenetics
and Evolution 62(3): 839-847.
Viyayakumar SP, Dinesh KP, Prabhu MV, Shanker K.
2014. Lineage delimitation and description of nine
new species of bush frogs (Anura: Raorchestes,
Rhacophoridae) from the Western Ghats Escarpment.
Zootaxa 3893(4): 451-488.
Vijayakumar SP, Menezes RC, Jayarajan A, Shanker K.
2016. Glaciations, gradients, and geography: multiple
drivers of diversification of bush frogs in the Western
Ghats Escarpment. Proceedings of the Royal Society
B: Biological Sciences 283(1836): 20161011.
Zachariah A, Dinesh KP, Kunhikrishnan E, Das S, Raju
DV, Radhakrishnan C, Palot MJ, Kalesh S. 2011.
Nine new species of frogs of the genus Raorchestes
(Amphibia: Anura: Rhacophoridae) from southern
Western Ghats, India. Biosystematica 5: 25-48.
Zachariah A, Cyriac VP, Chandramohan B, Ansil BR,
Mathew JK, Raju DV, Abraham RK. 2016. Two new
species of Raorchestes (Anura: Rhacophoridae) from
the Silent Valley National Park in the Nilgiri Hills of
the Western Ghats, India. Salamandra 52(2): 63-76.
Zhang D, Gao F, Jakovli¢ I, Zou H, Zhang J, Li WX,
Wang GT. 2020. PhyloSuite: an integrated and
scalable desktop platform for streamlined molecular
sequence data management and _ evolutionary
phylogenetics studies. Molecular Ecology Resources
20(1): 348-355.
Zheng Y, Wiens JJ. 2016. Combining phylogenomic
and supermatrix approaches, and a time-calibrated
phylogeny for squamate reptiles (lizards and snakes)
based on 52 genes and 4,162 species. Molecular
Phylogenetics and Evolution 94: 537-547.
September 2020 | Volume 14 | Number 3 | e251
Amphib. Reptile Conserv.
Sayyed et al.
Amit Sayyed is a herpetologist, and the founder and director of the Wildlife Protection and
Research Society, India. Amit is working on the faunal diversity and conservation of reptiles, and
his main interests have been in the taxonomy of snakes, geckos, and frogs. He has published several
papers on natural history and faunal diversity, and thus far he has described eight new species.
Amit is the author of three books: Amazing Creatures of the Earth (Snakes of Maharashtra,
Goa and Karnataka), Butterflies and Spiders of The Western Ghats, and Dangerous Bite and
First Aid. His Ph.D. focused on wildlife conservation, and he plans to pursue further studies on
the phylogenetic systematics, taxonomy, and natural history of the Indian species of the genus
Cnemaspis.
Vivek Cyriac is an evolutionary ecologist from India with broad interests in the ecological
and evolutionary mechanisms that generate biodiversity patterns. His work is centered around
understanding how environmental factors and biotic interactions influence species diversification
and create macro-evolutionary patterns. Vivek uses reptiles and amphibians as model systems
to explore diverse questions in ecology, evolution, and behavior. Thus far, he has predominantly
worked on fossorial uropeltid snakes and geckos of the genus Cnemaspis.
Raveendan Dileepkumar is currently a Principal Investigator under the Young Investigator’s
Program in Biotechnology in the Centre for Venom Informatics, University of Kerala, India. He
is also co-investigating projects in the area of venomics supported by KSCSTE, Government
of Kerala. His research broadly encompasses the venomics, venom gland transcriptomics, and
genomics of venomous snakes; with ongoing projects centered on understanding the venom
composition of venomous species in the animal kingdom. His publications, including book
chapters, have focused on snake taxonomy, venomics, and venom applications in medical
technologies.
43 September 2020 | Volume 14 | Number 3 | e251
Anew Cnemaspis species from India
Appendix 1. GenBank accession number and voucher information for Indian Cnemaspis and outgroups used in the phylogenetic
analysis. The line highlighted in bold indicates a new sequence generated for C. palakkadensis sp. nov. * indicates accession
number of C. kottivoorensis which was misprinted as MT217042 in Cyriac et al. (2020).
No Species Locality Voucher 16s rRNA
l Cnemaspis mahabali Pune, Maharashtra ZSI/R/1048 KX753643
2 Cnemaspis amboliensis Sindhudurg, Maharashtra BNHS 2458 MH174358
3 Cnemaspis ajijae Satara, Maharashtra ZSI WRC R/1058 KX753653
4 Cnemaspis limayei Sindhudurg, Maharashtra ZSI WRC R/1053 KX753647
5 Cnemaspis yercaudensis Salem, Tamil Nadu BNHS 2510 MH174360
6 Cnemaspis otai Vellore, Tamil Nadu BNHS 2512 MH174362
si Cnemaspis gracilis Palakkad, Kerala BNHS 2514 MH174370
8 Cnemaspis indica Nilgiris, Tamil Nadu BNHS 2516 MH174366
9 Cnemaspis littoralis Kozhikode, Kerala BNHS 2517 MH174367
10 Cnemaspis littoralis Kozhikode, Kerala BNHS 2518 MH174368
11 Cnemaspis kottiyoorensis Kannur, Kerala BNHS 2519 MH174363
12. = Cnemaspis wynadensis Wayanad, Kerala BNHS 2520 MH174364
13. Cnemaspis goaensis Goa ZSI WRC R/1045 KX269826
14. Cnemaspis flaviventralis Sindhudurg, Maharashtra ZSI WRC R/1043 KX269820
15 = Cnemaspis girii Satara, Maharashtra BNHS 2446 KX269824
16 Cnemaspis kolhapurensis Sindhudurg, Maharashtra BNHS 2448 KX269822
17. Cnemaspis heteropholis Shimoga, Karnataka BNHS 2466 KX753660
18 = Cnemaspis adii Ballari, Karnataka BNHS 2465 KX753655
19. Cnemaspis goaensis Goa ZSI WRC R/1044 KX269825
20 Cnemaspis zacharyi Lakkadi, Wayanad, Kerala BNHS 2735 MT217042
Chengodumala, Kozhikode,
21 Cnemaspis chengodumalaensis Kerala BNHS 2741 MT217043
22 Cnemaspis sp. (Pepara) Pepara WLS, Trivandrum, Kerala VPCGK_014 MT217033
23. =~ Cnemaspis anamudiensis Anamudi RF, Idukki, Kerala VPCGK_016 MT217034
24 Cnemaspis sp. (Vagamon) Vagamon, Kerala VPCGK_021 MT217035
Devarakolli, Madikeri,
25. Cnemaspis heteropholis Karnataka BNHS 2745 MT217039
Devarakolli, Madikeri,
26 Cnemaspis kottiyoorensis Karnataka BNHS 2747 MT217038
27 — Cnemaspis kottiyoorensis Paithalmala, Kannur, Kerala VPCGK_052 MT217037*
28 Cnemaspis palakkadensis sp. nov. Anakkal, Palakkad, Kerala BNHS 2790 MT762366
Outgroups
29 Phelsuma lineata Madagascar ZCMV_2029 KC438463
30 ~—- Phelsuma v-nigra Moheli, Comoros MH10 FJ829967
31 ~=Phelsuma ornata Reunion Sound _P7 DQ270577
32. ~— Lygodactylus picturatus Tanzania LYG 4 HQ872462
33. —- Lygodactylus miops Madagascar LUS8 LN998673
34. ~=— Lygodactylus madagascariensis Madagascar LMIA LN998665
Amphib. Reptile Conserv. 44 September 2020 | Volume 14 | Number 3 | e251
Sayyed et al.
Appendix 2. Specimens examined.
Cnemaspis aaronbaueri. BNHS 2607, BNHS 2608, and BNHS 2609 (females), from Thenmala, Kollam District, Kerala, India.
Cnemaspis beddomei: collection of the Natural History Museum, London (NHMUK), NHMUK 1946.9.4.83 (male), from South
Tinnevelly, Tirunelveli, southern Tamil Nadu State, India.
Cnemaspis gracilis: NHMUK 74.4.29.393 (male), from “Palghat Hills” (Kerala State, India), and BNHS 2513 and BNHS 2514,
collected from the Palakkad, Kerala, used for examination and genetic analysis.
Cnemaspis indica. NHMUK 46.11.22.22b (male), BNHS 1252-10 (male), Nilgiris, Tamil Nadu, India.
Cnemaspis kolhapurensis: BNHS 1855 (male), Dajipur, Kolhapur district, Maharashtra; and BNHS 2447 and BNHS 2448, from
Amboli, Sindhudurg district, Maharashtra, India.
Cnemaspis kottiyoorensis. BNHS 2519 from Kannur, Kerala state, India.
Cnemaspis littoralis: Neotype ZSI/WGRC/IR/V/2377 (male) from Chaliyam, Kozhikode, Kerala; ZSI/WGRC/IR/V/2378a and
ZSI/WGRC/IR/V/2378b (males) from Narayamkulam (= Chengodumala), Kozhikode, Kerala; ZSI/WGRC/IR/V/2379a (male)
and ZSI/WGRC/IR/V/2379b (female) from Kapprikad, Ernakulam, Kerala; ZSI/WGRC/IR/V/2380 (male) from Chaliyam,
Kozhikode, Kerala; ZSI/WGRC/IR/V/2381a and ZSI/WGRC/IR/V/2381b (males) from Nellikuth, Mallapuram, Kerala; BNHS
1150 (male), from Nilambur, Malabar, Kerala state, India. BNHS 2517 and BNHS 2518 from the Kozhikode, Kerala state, India.
Cnemaspis maculicollis: ZS1/WGRC/IR/V/2704 (male), from Pandimotta, Shendurney Wildlife Sanctuary, Kollam District,
Kerala, India.
Cnemaspis nilagirica. NHMUK 74.4.29.729 (female), Nilgiries, Nilgiri District, Tamil Nadu State, south-western India.
Cnemaspis ornata: Lectotype NHMUK 74.4.29.400 (male), paralectotype NHMUK 74.4.29.401 (male), NHMUK 74.4.29.404
(female), NHMUK 74.4.29.405 (female), NHMUK74.4.29.406 (female), NHMUK 74.4.29.407 (female), NHMUK 74.4.29.408
(female), and NHMUK 74.4.29.409 (female), from South Tinnevelly Hills, Tirunelveli, Tamil Nadu State, India.
Cnemaspis sisparensis: NHMUK 74.4.29.383 (male), from Sholakal, the foot of SisparaGhat, Kerala, India.
Cnemaspis wynadensis. BMNH 74.4.29.355 (male), from Wynaad, Kerala, and BNHS 1042, BNHS 1043 (male), Mannarghat,
Palghat, Kerala, India.
Amphib. Reptile Conserv. 45 September 2020 | Volume 14 | Number 3 | e251
Official journal website:
amphibian-reptile-conservation.org
Amphibian & Reptile Conservation
14(3) [General Section]: 46—56 (e252).
Amphibian diversity and conservation along an elevational
gradient on Mount Emei, southwestern China
12Xiaoyi Wang, '*Shengnan Yang, '?Chunpeng Guo, ‘Ke Tang, ‘*Jianping Jiang, and ‘**Junhua Hu
y
'Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu 610041, CHINA *University of Chinese Academy of Sciences, Beijing
100049, CHINA ?*Key Laboratory of Southwest China Wildlife Resource Conservation (China West Normal University), Ministry of Education,
Nanchong 637009, CHINA
Abstract.—Understanding the diversity, distribution, and threat status of species serves an important role in
biodiversity conservation, particularly in regions with high species richness. Being a well-known Natural and
Cultural World Heritage site, Mount Emei is seated on the transition zone between Qinghai-Tibetan Plateau
and Sichuan Basin in southwestern China, and is of special significance to conservation and science due to
its high biodiversity. Based on data from extensive field expeditions, the published literature, and museum
specimens, this study documented a total of 35 species, belonging to 22 genera and nine families, along a 2,600
m elevational gradient on Mount Emei. Almost one-third of these species are in IUCN threatened categories. A
majority of species occupied a narrower local elevation range size compared with their overall elevation range
size, especially those that are threatened. Along the elevational gradient, both the total and threatened species
richness showed hump-shaped patterns. These results provide insight into the species diversity, elevational
distribution, and threat status for the amphibians on Mount Emei. These findings highlight the significance and
urgent need to protect the amphibians in the focal region, provide support for further ecological studies, and
will contribute to the conservation of this biodiverse region in the future.
Keywords. Anura, biodiversity, Caudata, hump-shaped pattern, species richness, threatened species, World Heritage site
Citation: Wang X, Yang S, Guo C, Tang K, Jiang J, Hu J. 2020. Amphibian diversity and conservation along an elevational gradient on Mount Emei,
southwestern China. Amphibian & Reptile Conservation 14(3) [General Section]: 46-56 (e252).
Copyright: © 2020 Wang et al. This is an open access article distributed under the terms of the Creative Commons Attribution License [Attribution
4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction in any
medium, provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced, are
as follows: official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 4 April 2020; Published: 20 September 2020
Introduction
Elevational gradients provide one of the most powerful
natural experiments for exploring the ecological and
evolutionary responses of biota to the complex influences
of geophysical and climatic changes (Korner 2007). In
mountain regions, elevational gradients yield a large
amount of environmental variation (e.g., in temperature
and humidity) over a short spatial distance, and play a
prominent role in shaping vertical species distribution
(Korner 2007; Perrigo et al. 2019). Following in von
Humboldt’s footsteps, the importance of elevational
gradients to biodiversity has motivated growing
scientific interest in them over the last two centuries
(Aynekulu et al. 2012; Frishkoff et al. 2019; Lomolino
2001). Along elevational gradients, a multitude of
studies have focused on species diversity-elevation
relationships across many different taxa worldwide
(e.g., Frishkoff et al. 2019; Hu et al. 2011; Longino and
Branstetter 2019; Peters et al. 2016; Quintero and Jetz
2018), often revealing monotonic decreasing, hump-
Amphib. Reptile Conserv.
shaped patterns or plateaus (Rahbek 2005). While
varying degrees of evidence have supported different
patterns, understanding the elevational patterns in
biodiversity remains crucial for conservation in specific
key biodiversity areas and in some taxa which are not
well documented.
Among amphibians, the distribution range
of a species is highly related to its adaptation to
environmental variations and extinction risk (Chen et
al. 2019; Cooper et al. 2008). Amphibians with a small
geographic (e.g., latitudinal or elevational) range size
may face higher extinction risk, since they are relatively
less abundant, less mobile, and more easily influenced
by local environment changes, compared with those
with broad ranges (Botts et al. 2013; Chen et al. 2019;
Cooper et al. 2008). Since each species has a unique
ecological extension and environmental tolerance
(Wells 2007), range size and its shifts along elevational
gradients can be regarded as adaptive responses to
environmental changes (Chen et al. 2009; Kusrini et al.
2017). Consequently, determining elevational range size
September 2020 | Volume 14 | Number 3 | e252
Wang et al.
85°F 90°F
te
Elevation(m)
=
3300 7800
29°30'N
| s
103°20'E
103°15’E
103°2S’E
95°E
40°N
25°N
Fig. 1. (A) Geographic location of Mount Emei; (B) topographic overview of sample sites; and dominant vegetation types and
typical habitats along the elevational gradient at (C) 500 m, (D) 1,300 m, and (E) 3,050 m. Sampling sites are indicated with red
stars (see Appendix | for details).
under various environmental conditions is important for
contributing to the conservation of amphibians with a
narrow range (Chan et al. 2016).
Mount Emei (Omei Shan) is located tn the transitional
zone between the Sichuan Basin and Qinghai-Tibetan
Plateau in southwestern China (Fig. 1A). It possesses
various landscapes and a diversity of natural biological
zones with high biodiversity (Li and Shi 2007; Zhao and
Chen 1980). Mount Emei, together with the Leshan Giant
Amphib. Reptile Conserv.
Buddha Scenic Area, constitutes a Natural and Cultural
World Heritage site due to the striking scenic beauty,
and its exceptional spiritual and cultural significance in
Chinese Buddhism (http://whc.unesco.org/en/list/779).
In addition, the high biodiversity highlights its special
significance to conservation and science (Zhao and Chen
1980). For amphibians, increasing attention has been
paid to this region in the past several decades. Liu (1950)
had conducted field surveys since 1938, and Fei et al.
September 2020 | Volume 14 | Number 3 | e252
Amphibians on Mount Emei, China
(1976) roughly delineated the elevational distributions
for 32 species. However, there were no scientific reports
concerning amphibians on Mount Emei for nearly 40
years after these early studies, except for some scattered
sightings and samplings. By recording 24 species, Zhao
et al. (2018) recently documented the idiosyncratic
contributions of individual species to the taxonomic,
functional, and phylogenetic diversity on Mount Emel.
While these studies presented different facets of diversity,
efforts to provide acomprehensive inventory by integrating
amphibian species diversity, distribution, and threat status
on Mount Emei have remained severely limited.
This study aims to summarize and update data on
amphibian species richness on Mount Emei, and also to
delineate the distribution and threat status of each species
based on extensive field expeditions, supplemented with
data from the literature (Fei et al. 1976; Liu 1950; Zhao
et al. 2018) and specimen records in the Herpetological
Museum, Chengdu Institute of Biology (CIB), Chinese
Academy of Sciences (CAS). This study will be helpful
in the development of effective conservation strategies
for the amphibians on Mount Emei and the surrounding
areas.
Materials and Methods
Study Area
Mount Emei, a mountain in southwestern China which
is known worldwide, was formed on the southwestern
edge of Sichuan Basin, China, and dates from the late
Cretaceous Period around 70 million years ago (Zhao
and Chen 1980). From the base at about 500 m asl, the
mountain rises to an altitude of 3,099 m (Fig. 1B). It
is made up of deep canyons and narrow gorges (Tang
2006), which results in a variety of attractive landscapes
and complex environments to support exceptionally rich
flora and fauna (Li and Shi 2007; Zhao and Chen 1980).
Mount Emei is characterized by a subtropical monsoon
climate. The annual average temperature drops from 17
°C to 3 °C with the increasing elevation. The rainfall
is abundant and concentrated during May—September,
without a dry season (Tang 2006), and the highest rainfall
occurs in the middle and high mountain areas (L1 1990).
The parent rocks in this region mainly include shale,
dolomite, limestone, basalt, sandstone, and mudstone
(Zhao and Chen 1980); and the following natural vertical
soil zones have been described: yellow soil and mountain
yellow soil sandwich a purple soil zone (below 1,800
m), mountain yellow-brown soil zone (1,800—2,200 m),
mountain dark brown soil zone (2,200—2,600 m), and
podzolic soil and meadow soil zone (above 2,600 m) [Li
1990; Tang 2006]. Additionally, Mount Emei is situated
at the junction between the tropical and temperate
zonation types in eastern Asia (Tang and Ohsawa
1997). There are three major vegetation types along the
elevational gradient (from low to high): evergreen broad-
Amphib. Reptile Conserv.
leaved forest, evergreen deciduous broad-leaved mixed
forest, and coniferous forest (Li and Shi 2007; Tang and
Ohsawa 1997) [Fig. 1C—E].
Species Data
The field surveys included 23 line transects and three
sampling points along the elevational gradient to
comprehensively investigate the amphibian species
composition on Mount Emei during the breeding
seasons in 2017 and 2018 (Fig. 1B; Appendix 1). During
the field surveys, line transects and sampling points
were mainly placed near water resources according to
habitat conditions, and locations were recorded by a
global positioning system (GPS) app (Shenzhen 2bulu
Information Technology Company). Observers (at least
two persons) intensively searched for amphibians with an
electric torch and searched systematically at a relatively
steady pace (about 2.0 km h') at night (1900-2400 h),
with the locations of observed individuals being recorded
by the GPS.
Complementary information was also collected from
the literature (Fei et al. 1976; Liu 1950; Zhao et al. 2018),
with useful information extracted on the taxonomy,
Species composition, and elevational distribution of
amphibians. Species data were also supplemented with
records from museum specimens in the CIB/CAS. The
preserved specimen and recorded information were
carefully authenticated and crosschecked, and records
possibly representing missing species detections and/
or misidentifications during sampling or secondary
information compilation were removed. In total, there
were 35 amphibian species scientifically recorded, with
available elevation information for 34 of the species (all
except Amolops granulosus).
Data Compilation and Analysis
Species nomenclature followed Amphibian Species of the
World (Frost 2019). Referring to both the IUCN Red List
(IUCN 2018) and the China Biodiversity Red List (MEP
and CAS 2015), the threat status levels for each species
were compared at the global and national scales. A database
was generated with the species components, elevational
distribution data (minimal and maximal elevations of
occurrence), and threat status of each species.
The overall elevational range spanning 500-3,099
m was divided into 200 m band widths, and areas with
elevation ranges between 500—1,299 m were defined as
low elevations, ranges between 1,300—2,099 m as middle
elevations, and ranges between 2,100-3,099 m as high
elevations. For each species, the elevational distribution
was assumed to cover a continuous range between the
minimum and maximum documented elevations (Hu
et al. 2011; Rahbek 1997). For example, a species with
recorded elevation limits between 1,235 and 1,450 m can
be classified into both the 1,100-—1,299 m and 1,300—
September 2020 | Volume 14 | Number 3 | e252
Wang et al.
1,499 m bands. Species richness was calculated from
the total (cumulative) number in each band and each
species’ threat status was assessed for the different bands.
In addition, three polynomial regressions (richness as a
function of elevation, elevation’, and elevation*) were
used to investigate the richness-elevation relationships
for total species and threatened species (at both global
and national scales) based on the smallest corrected
Akaike information criterion (AICc) value.
Next, the overall range size (i.e., elevational range
covering the whole distribution range of a species) was
collected from the literature (Fei et al. 2006, 2009a,b,
2012) and the online database (Amphibian Species of
the World, Frost 2019). Local elevational range size
(maximal minus minimal elevation) observed on Mount
Emei was plotted and compared with the overall range
size for each species. The elevational range size values
below the median value (1.e., 1,300 m) were considered
“small,” and they were considered “large” for those that
were not less than the median.
Results
The 35 species belonged to 22 genera and nine families.
Of special note, Mount Emei was the type locality
of 14 species, including one endemic species (Rana
chevronta, Table 1). At the family level, Megophryidae
and Ranidae were the two most abundant families (each
with 11 species) and they contributed approximately
63% of all amphibian species on this mountain; followed
by Rhacophoridae (four species); Microhylidae,
Dicroglossidae, and Hynobiidae (each with two species):
and the other three families (Bufonidae, Hylidae, and
Cryptobranchidae) were each represented by a single
species (Table 1). According to the IUCN Red List, 13 of
the 35 species were categorized as threatened, including
two Critically Endangered (CR), five Endangered (EN),
three Vulnerable (VU), and three Near Threatened (NT)
species; while according to the China Biodiversity Red
List, 16 of the 35 species were categorized as threatened,
including one CR, three EN, nine VU, and three NT
species (Table 1).
Along the elevational gradients, a cubic relationship
was Statistically favored over either a quadratic or
linear relationship for the total species richness, while a
quadratic relationship was favored over cubic or linear
for the threatened species richness at the two scales (Fig.
2; Table 2). Both species richness and threatened species
richness showed mid-elevation peak patterns (Fig. 2).
Low and middle elevations (500—2,099 m) were found to
harbor a majority of species with a maximum richness at
the two elevational bands of 700-899 m and 1,500-1,699
m (Fig. 2). There was a sharp decrease between 1,900-—
2,099 m and 2,100—2,299 m, while species richness
changed only slightly for elevations above 2,100 m (Fig.
2). Similar patterns were found for the threatened species,
with a maximum in the band at 1,700—1,899 m (Fig. 2:
Amphib. Reptile Conserv.
49
A
204 DD
LC
“ ZZ NT
VU
164 faa) EN
Mg cr
wa
& i total species
= 124
2 threatend species
g
” “i
44 Yi, Y, |
0
B
20
wn 16
é
S
a
=
a 12
é
te)
vo
n
8
4
ial oo wo oo To oe
0 Geee} EE ESR eer
600 800 1,000 1,200 1,400 1,600 1,800 2,000 2,200 2,400 2,600 2,800 3,000
Elevation (m)
Fig. 2. The numbers of total and threatened species (bars) and
elevational patterns of species richness (curves). Regression
lines show total species richness (black) and threatened species
richness (red) based on the polynomial regression models, with
threatened status counts referring to the IUCN Red List (A) and
the China Biodiversity Red List (B).
Table 1). Referring to the IUCN Red List, 12 threatened
Species occurred in low and middle elevations, while
three threatened species occurred in high elevations (Fig.
2A; Table 1); referring to the China Biodiversity Red List,
14 threatened species were in low and middle elevations,
and four threatened species were in high elevations (Fig.
2B; Table 1).
Although the upper elevational limits of three species
(i.e., Scutiger chintingensis, Batrachuperus pinchonii,
and Rhacophorus dugritei) were higher than 3,000 m,
and four species (1.e., Xenophrys omeimontis, X. minor,
Oreolalax omeimontis, and O. major) were found to
exceed the overall range size, 26 of the species have a
small range size (<< 1,300 m) on Mount Emei (Fig. 3;
Table 1). In total, ten of the threatened species have a
small range size on Mount Emei (Table 1). Notably,
the Critically Endangered species (Andrias davidianus)
and the endemic (R. chevronta) were each restricted to
an extremely narrow range. The local range size was
relatively wider than the overall range size for some of the
threatened species (e.g., B. londongensis, R. chevronta,
O. omeimontis), but the range size of these species were
reasonably small (Fig. 3; Table 1).
Discussion
Knowing where the individual species occur and
identifying which ones are threatened and_ their
September 2020 | Volume 14 | Number 3 | e252
Amphibians on Mount Emei, China
Table 1. Amphibian species on Mount Emei, China, with their elevational distribution (minimal and maximal elevations of
occurrence) and threat status.
Lower limit Upper limit
Species IUCN Red List China Red List (m) (m)
I. Hynobiidae
Batrachuperus londongensis' EN VU 1,200 1,400
Batrachuperus pinchonii VU VU 1,400 3,050
II. Cryptobranchidae
Andrias davidianus CR CR — 500
III. Megophryidae
Oreolalax major' VU VU 1,500 2,000
Oreolalax schmidti' NT NT 1,580 2,340
Oreolalax multipunctatus' VU VU 1,800 1,920
Oreolalax omeimontis' EN VU 740 2,060
Oreolalax popei Le VU 950 2,010
Scutiger chintingensis' EN EN 2,890 3,050
Leptobrachium boringii' EN EN 650 1,650
Leptobrachella oshanensis' Le Le 760 1,810
Atympanophrys shapingensis 1S LC = 2,120
Xenophrys omeimontis' NT VU 610 1,920
Xenophrys minor LC LC 680 1,600
IV. Bufonidae
Bufo gargarizans LC Le 500 1,910
V. Hylidae
Hyla annectans LC LC 1,200 1,298
VI. Ranidae
Rana chevronta'* CR EN 1,750 1,850
Rana omeimontis' |i LC 500 2,080
Pelophylax nigromaculatus NT NT 500 1,300
Boulengerana guentheri LC LC — 500
Nidirana daunchina!' EC LC 750 1,660
Odorrana graminea DD Le 530 710
Odorrana schmackeri LC LG 530 790
Odorrana margaretae LC LC 500 1,810
Amolops chunganensis LE Le 720 1,600
Amolops granulosus 1S NT — —
Amolops mantzorum Le Le 800 1,660
VII. Dicroglossidae
Quasipaa boulengeri EN VU 500 1,900
Fejervarya multistriata DD EC 500 850
VUI. Rhacophoridae
Polypedates megacephalus LC LC 740 1,600
Rhacophorus chenfui' ne EC 800 1,660
Rhacophorus omeimontis' Le Le 680 1,810
Rhacophorus dugritei Le VU 1,520 3,050
IX. Microhylidae
Microhyla fissipes LC LC 500 530
Kaloula rugifera BS LC 700 900
'Species type locality is Mount Emei; "endemic species on Mount Emei. The threat status abbreviations refer to the [UCN Red List of Threatened
Species and the China Biodiversity Red List: Data Deficient (DD), Least Concern (LC), Near Threatened (NT), Vulnerable (VU), Endangered (EN),
and Critically Endangered (CR).
Amphib. Reptile Conserv. 50 September 2020 | Volume 14 | Number 3 | e252
Wang et al.
Table 2. Results of polynomial regression models for assessing the total species and threatened species patterns along the elevational
gradient.
Polynomial regressions Total species richness
First-order R? OOF
AICc 78.63
Second-order R? 0.81***
AICc 79.90
Third-order R? 0.95***
AICc 68.64
Threatened species (IUCN)
Threatened species (China)
0.22 0:39*
67.69 61.27
0.57* 0.62**
64.20 59.47
0.66* 0.70**
66.66 61.88
Tested effects were significant at: * P < 0.05; ** P< 0.01; *** P< 0.001. Bold numbers indicate the models which best accounted for variation in
the richness along the elevation gradient based on the smallest AICc value.
conservation status are critical for optimizing the
conservation of species and communities in a given
region. This study documented the species component,
distribution, and threat status of amphibians along a
2,600 m elevational gradient on Mount Emei in China.
Although Mount Emei is a Natural and Cultural World
Heritage site with high richness in amphibians, their
threat status is really severe overall, particularly since a
majority of the species possess relatively narrow local
range sizes. Taken together, these results can contribute
to a better understanding and more effective conservation
of the amphibian diversity on this mountain.
The higher amphibian diversity on Mount Emei
documented in this study, relative to the published
records in this region (Fei et al. 1976; Liu 1950; Zhao
et al. 2018) and the neighboring regions (e.g., Mount
Gongga and Mount Erlang; Xie et al. 2007), underlines its
great significance in conservation and scientific studies.
Megophryidae and Ranidae are the two most species-
rich families, accounting for 63% of all species in the
region (Table 1); and the extremely adaptable capacities
and enhanced environmental tolerances of some species
may contribute to the dominance of these two families
(Fei et al., 2009a,b; Wells 2007). At the species level, the
endemic species (R. chevronta) with a narrowly specified
range is actually rare and threatened, and it should be
urgently targeted for conservation (Hu et al. 2012).
Although the data in this study were obtained from
extensive field surveys combined with comprehensive
data collection, the results provided here may be missing
certain information. Anecdotal observations of Odorrana
hejiangensis on Mount Emei have been reported (K.
Jiang, pers. comm.), but they were not verified from
any scientific publication or field expedition. Therefore,
further surveys in the region are still necessary.
Elevation is often regarded as a surrogate for
temperature and moisture, and is widely used to
investigate distributional patterns of species richness in
mountainous regions (Khatiwada et al. 2019; Peters et
al. 2016; Rahbek 1995). Variations of climatic variables,
land surface area, and geography along elevational
gradients are among the hypothesized causal factors
influencing species composition and _ distribution
(Lomolino 2001). Amphibians, which tend to have
Amphib. Reptile Conserv.
51
complex life histories and relatively low mobility, are
strongly restricted by the external environment (Hof et
al. 2011; Wake and Vredenburg 2008). Climatic factors
(mainly temperature and precipitation) are widely
recognized as the key determinants that influence various
aspects of amphibian biology, such as physiology,
behavior, and ecological performance (Wells 2007). A
habitat with a lower temperature and higher elevation is
prone to support more species (Navas et al. 2013), and
more abundant precipitation can support higher species
richness and abundance (Rahbek 2005; Wells 2007).
Under the influences of climatic, edaphic, and vegetation
zones (Tang 2006; Tang and Ohsawa 1997), the vertical
distribution pattern of amphibians on Mount Emeti is
obvious (Fig. 2). Indeed, low and middle elevations
with higher temperatures (Tang 2006) and rainfall (Li
1990) are so suitable for amphibians that they support
more species (Fig. 2). Additionally, it is well known
that conserving a large number of species can provide
the opportunity to conserve rare species and other
undetected species (Aynekulu et al. 2012). That is, more
conservation investment in the areas below 2,100 m on
this mountain is needed because most of the amphibians
and threatened species are restricted to the elevations
below 2,100 m (Fig. 2). Even so, several species in
high elevations (2,100-—3,099 m) should also attract a
great deal of attention because they can be considered
as the indicators of environmental adaptation in the high
elevations.
Range size is a critical factor that reflects the local
assemblage structure (Gaston 1996) and a species’
environmental niche (Pearson et al. 2006). It is
recognized that species with different range sizes should
be conserved with different strategies (Chen et al. 2019;
Di Marco and Santini 2015). A small range size may be
one of the strongest predictors of extinction risk (Chen et
al. 2019; Rosenzweig 1995). In this study, some species
have a larger local range size compared with the overall
elevational range size but most species have a smaller
local range size, especially among the threatened species
(Fig. 3; Table 1). For instance, the range size is extremely
narrow for A. davidianus (CR). Therefore, conservation
priority should be given to these species with small range
sizes (Chen et al. 2019). Range size can be influenced
September 2020 | Volume 14 | Number 3 | e252
Amphibians on Mount Emei, China
Rhacophorus omeimontis
Rhacophorus dugritei
Rhacophorus chenfui
Polypedates megacephalus
Rana omeimontis
Rana chevronta
Pelophylax nigromaculatus
Odorrana schmackeri
Odorrana margaretae
Odorrana graminea
Boulengerana guentheri
Nidirana daunchina
Amolops mantzorum
Amolops chunganensis
Microhyla fissipes
Kaloula rugifera
Xenophrys omeimontis
Xenophrys minor
Scutiger chintingensis
Oreolalax schmidti
Oreolalax popei
Oreolalax omeimontis
Oreolalax multipunctatus
Oreolalax major
Leptobrachella oshanensis
Leptobrachium boringii
Atympanophrys shapingensis
Andrias davidianus
Batrachuperus pinchonii
Batrachuperus londongensis
Ayla annectans
Quasipaa boulengeri
Fejervarya multistriata
Bufo gargarizans
500
1,000
Re
sa
Re _
J
- = _]
iy
|Re=—______
|}————.__-
P|
=—_
HK—__+——__
——————
ooo
|I————_ ]
HK—_—_+—_———
+ =—
[—_™—_+
=
1,500 2,000 2,500 3,000 3,500 4,000
Elevation (m)
Fig. 3. Local and overall elevational ranges for each amphibian species. For each species, the local elevational range is the maximum
minus minimum elevation on Mount Emei (gray box or vertical line), and the overall elevational range size is the published
elevational range covering the whole distribution range (the horizontal line).
by environmental modification, as well as life-history
and evolutionary traits (Gaston 1996). For example,
increasing human activities and climate changes may
lead to a range shift along the elevation (Chen et al. 2009;
Kusrini et al. 2017). As a famous tourist attraction, the
tourist season on Mount Emei overlaps with the breeding
season of most amphibians, resulting in changes of the
species’ range size (Fei et al. 2009a,b; Liu and Yang
Amphib. Reptile Conserv.
52
2012). On the other hand, individual intrinsic traits, such
as dispersal abilities, habitat selection, and environmental
tolerance, may indirectly contribute to a range shift
under environmental changes (Fei et al. 2006, 2009a,b;
Gaston 1996). For example, tadpoles and some stream-
dwelling adults may be flushed downstream in running
water, leading to a lower minimal elevation. Of course,
one caveat must be applied to the results. Although
September 2020 | Volume 14 | Number 3 | e252
Wang et al.
this survey illustrated that a species’ range size may be
related to its threat status, it did not examine the extent of
that correlation based on any statistical support. There is
a need to further explore the influences of intrinsic traits
(e.g., range size, body size, and clutch size) on extinction
risk with more detailed data.
Amphibians are a major group that is currently at risk
globally (Jiang et al. 2016; Wake and Vredenburg 2008),
with declines which far exceed those of other vertebrate
taxa (Hoffmann et al. 2010). Accumulating evidence
indicates that amphibians are threatened by anthropogenic
land-use changes, fatal chytridiomycosis, climatic
changes, and over-exploitation (Blaustein and Kiesecker
2002; Hof et al. 2011). Mount Emei suffers from intense
human disturbance (e.g., cultivation and tourism), and
nearly one-third of the amphibian species are severely at
risk as indicated by their currently threatened status (Table
1). As such, urgent conservation actions are necessary
for amphibians. Although biodiversity conservation and
environmental management awareness among_ local
governments and the public have been strengthened,
the conflict between conservation and socioeconomic
development continues to make biodiversity conservation
exceptionally difficult to achieve. In this context,
understanding how species respond to human-disturbances
and survive in the human-dominated landscape 1s critical
to the conservation of amphibians in mountain systems.
This study can be helpful for scientifically-based policy
making and for implementing the regulatory measures to
mitigate the potential disturbances on biodiversity caused
by mass-tourism.
Conclusion
In summary, this study presents data on the species richness,
distribution, and threat status for 35 amphibian species in
a tourist attraction, Mount Emei in China, which 1s a site
of special significance to conservation and to science. The
results highlight the urgent need to manage and preserve
the amphibians, especially the threatened species, and
will be helpful in assisting with sustainable management
and the development of effective conservation strategies.
These findings can also provide a basis for further
ecological studies, such as exploring intraspecific and/or
interspecific responses to biotic and abiotic influences (Hu
et al. 2019; Huang et al. 2020; Wang et al. 2019), not only
for the focal mountain but also for other similar regions or
high-profile areas of concern.
Acknowledgements.—We would like to thank Liang Fei
and Changyuan Ye for their valuable suggestions and
guidance in the identification of species and obtaining
key information. We thank Tian Zhao, Chunlin Zhao,
Shengchao Shi, and Bin Wang for their help in the
fieldwork. Many thanks to the Herpetological Museum
of Chengdu Institute of Biology, Chinese Academy of
Sciences, for the support of specimens. This study was
Amphib. Reptile Conserv.
supported by National Key Research and Development
Plan (2016YFC0503303), the National Natural Science
Foundation of China (31770568, 31572290), the ‘Light
of West China’ Program of the Chinese Academy of
Sciences, and China Biodiversity Observation Networks
(Sino BON).
Literature Cited
Aynekulu E, Aerts R, Moonen P, Denich M, Gebrehiwot
K, Vagen T-G, Mekuria W, Boehmer HJ. 2012.
Altitudinal variation and conservation priorities of
vegetation along the Great Rift Valley escarpment,
northern Ethiopia. Biodiversity and Conservation
21(10): 2,691—2,707.
Blaustein AR, Kiesecker JM. 2002. Complexity in
conservation: lessons from the global decline of
amphibian populations. Ecology Letters 5(4): 597—
608.
Botts EA, Erasmus BFN, Alexander GJ. 2013. Small
range size and narrow niche breadth predict range
contractions in South African frogs. Global Ecology
and Biogeography 22(5): 567-576.
Chan WP, Chen IC, Colwell RK, Liu WC, Huang CY,
Shen SF. 2016. Seasonal and daily climate variation
have opposite effects on species elevational range
size. Science 351(6280): 1,437—1,439.
Chen C, Chen C, Wang Y, Liu X. 2019. Ecological
correlates of extinction risk in Chinese amphibians.
Diversity and Distributions 25(10): 1,586—1,598.
Chen IC, Shiu HJ, Benedick S, Holloway JD, Chey VK,
Barlow HS, Hill Jk, Thomas CD. 2009. Elevation
increases in moth assemblages over 42 years on a
tropical mountain. Proceedings of the National
Academy of Sciences of the United States of America
106(5): 1,479-1,483.
Cooper N, Bielby J, Thomas GH, Purvis A. 2008.
Macroecology and extinction risk correlates of frogs.
Global Ecology and Biogeography 17(2): 211-221.
Di Marco M, Santini L. 2015. Human pressures predict
species’ geographic range size better than biological
traits. Global Change Biology 21(6): 2,169—2,178.
Fei L, Ye C, Hu S, Tian W. 2006. Fauna Sinica.
Amphibia. Volume I. General Account of Amphibia,
Gymnophiona and Urodela. Science Press, Chinese
Academy of Sciences, Beijing, China. 471 p. [In
Chinese].
Fei L, Hu S, Ye C, Huang Y. 2009a. Fauna Sinica.
Amphibia. Volume 2. Anura. Science Press, Chinese
Academy of Sciences, Beijing, China. 957 p. [In
Chinese].
Fei L, Hu S, Ye C, Huang Y. 2009b. Fauna Sinica.
Amphibia. Volume 3. Anura. Ranidae. Science Press,
Chinese Academy of Sciences, Beijing, China. 920
p. [In Chinese].
Fei L, Ye C, Hu S, Liu C. 1976. Amphibian fauna of
Sichuan. Materials for Herpetological Research 3:
September 2020 | Volume 14 | Number 3 | e252
Amphibians on Mount Emei, China
1-17.
Fei L, Ye C, Jiang J. 2012. [Colored Atlas of Chinese
Amphibians and_ their Distributions]. Sichuan
Publishing House of Science and Technology,
Chengdu, China. 620 p. [In Chinese].
Frishkoff LO, Gabot E, Sandler G, Marte C, Mahler
DL. 2019. Elevation shapes the reassembly of
Anthropocene lizard communities. Nature Ecology
and Evolution 3(4): 638-646.
Frost DR. 2019. Amphibian Species of the World: an
Online Reference. Version 6.0. Available: http://
research.amnh.org/herpetology/amphibia/index.
html [Accessed: 3 January 2019].
Gaston KJ. 1996. Species range size distributions:
patterns, mechanisms, and implications. 7rends in
Ecology and Evolution 11(5): 197-201.
Hof C, Araujo MB, Jetz W, Rahbek C. 2011. Additive
threats from pathogens, climate, and land-use change
for global amphibian diversity. Nature 480(7378):
516-519.
Hoffmann M, Hilton-Taylor C, Angulo A, Bohm M,
Brooks TM, Butchart SH, Carpenter KE, Chanson
J, Collen B, Cox NA, et al. 2010. The impact of
conservation on the status of the world’s vertebrates.
Science 330(6010): 1,503—-1,509.
Hu J, Huang Y, Jiang J, Guisan A. 2019. Genetic
diversity in frogs linked to past and future climate
changes on the roof of the world. Journal of Animal
Ecology 88(6): 953-963.
Hu J, Li C, Xie F, Jiang J. 2012. Endemic amphibians
and their distribution in China. Asian Herpetological
Research 3(2): 163-171.
Hu J, Xie F, Li C, Jiang J. 2011. Elevational patterns
of species richness, range, and body size for spiny
frogs. PLoS ONE 6(5): e19817.
Huang Y, Wang X, Yang X, Jiang J, Hu J. 2020.
Unveiling the roles of interspecific competition and
local adaptation in phenotypic differentiation of
parapatric frogs. Current Zoology 66: 383-392.
IUCN. 2018. The IUCN Red List of Threatened
Species. Version 2018-2. IUCN: Gland, Switzerland.
Available: http://www.iucnredlist.org [Accessed: 3
January 2019].
Jiang J, Xie F, Zang C, Cai L, Li C, Wang B, Li J, Wang
J, Hu J, Wang Y, et al. 2016. Assessing the threat
status of amphibians in China. Biodiversity Science
24(5): 588-597.
Khatiwada JR, Zhao T, Chen Y, Wang B, Xie F,
Cannatella DC, Jiang J. 2019. Amphibian community
structure along elevation gradients in eastern Nepal
Himalaya. BMC Ecology 19(1): 19.
Korner C. 2007. The use of ‘altitude’ in ecological
research. Trends in Ecology and Evolution 22(11):
569-574.
Kusrini MD, Lubis MI, Endarwin W, Yazid M,
Darmawan B, Ul-Hasanah AU, Sholihat N, Tajalli
A, Lestari V, Utama H, et al. 2017. Elevation range
Amphib. Reptile Conserv.
shift after 40 years: the amphibians of Mount Gede
Pangrango National Park revisited. Biological
Conservation 206: 75-84.
Li C. 1990. The natural vertical zones on the east
slope of Mt. Emei in Sichuan province. Journal of
Mountain Research 8(1): 39-44.
Li Z, Shi L. 2007. Plants of Mount Emei. Beijing
Science and Technology Press, Beijing, China. 492
p.
Liu C. 1950. Amphibians of Western China. Chicago
Natural History Museum Press, Chicago, Illinois,
USA. 400 p.
Liu S, Yang M. 2012. The biodiversity monitoring and
sustainable tourism development of Mount Emeti.
Sichuan Environment 31(Suppl 1): 118-121.
Lomolino MV. 2001. Elevation gradients of species
density: historical and prospective views. Global
Ecology and Biogeography 10(1): 3-13.
Longino JT, Branstetter MG. 2019. The truncated bell:
an enigmatic but pervasive elevational diversity
pattern in Middle American ants. Ecography 42(2):
272-283.
MEP (Ministry of Environment Protection), CAS
(Chinese Academy of Sciences). 2015. Red List
of China’s Biodiversity. Amphibians. Available:
http://www. mee. gov.cn/gkml/hbb/bgg/201505/
W020150526581939212392 pdf [Accessed: 3 February
2020].
Navas CA, Carvajalino-Fernandez JM, Saboya-Acosta
LP, Rueda-Solano LA, Carvajalino-Fernandez MA,
Van Damme R. 2013. The body temperature of active
amphibians along a tropical elevation gradient:
patterns of mean and variance, and inference from
environmental data. Functional Ecology 27(5):
1,145-1,154.
Pearson RG, Thuiller W, Aratjo MB, Martinez-Meyer
E, Brotons L, McClean C, Miles L, Segurado P,
Dawson TP, Lees DC. 2006. Model-based uncertainty
in species range prediction. Journal of Biogeography
33(10): 1,704—1,711.
Perrigo A, Hoorn C, Antonelli A. 2019. Why mountains
matter for biodiversity. Journal of Biogeography
47(2): 315-325.
Peters MK, Hemp A, Appelhans T, Behler C, Classen
A, Detsch F, Ensslin A, Ferger SW, Frederiksen
SB, Gebert F, et al. 2016. Predictors of elevational
biodiversity gradients change from single taxa to the
multi-taxa community level. Nature Communications
7: 13,736.
Quintero I, Jetz W. 2018. Global elevational diversity
and diversification of birds. Nature 555: 246.
Rahbek C. 1995. The elevational gradient of species
richness: a uniform pattern? Ecography 18(2): 200-—
205:
Rahbek C. 1997. The relationship among area, elevation,
and regional species richness in neotropical birds.
American Naturalist 149(5): 875-902.
September 2020 | Volume 14 | Number 3 | e252
Wang et al.
Rahbek C. 2005. The role of spatial scale and the
perception of large-scale species-richness patterns.
Ecology Letters 8(2): 224-239.
Rosenzweig ML. 1995. Species Diversity in Space and
Time. Cambridge University Press, London, United
Kingdom. 460 p.
Tang CQ. 2006. Forest vegetation as related to climate
and soil conditions at varying altitudes on a humid
subtropical mountain, Mount Emei, Sichuan, China.
Ecological Research 21(2): 174-180.
Tang CQ, Ohsawa M. 1997. Zonal transition of
evergreen, deciduous, and coniferous forests along
the altitudinal gradient on a humid subtropical
mountain, Mt. Emei, Sichuan, China. Plant Ecology
133(1): 63-78.
Wake DB, Vredenburg VT. 2008. Are we in the midst of
the sixth mass extinction? A view from the world of
amphibians. Proceedings of the National Academy of
Sciences of the United States of America 105(Suppl
in countryside landscapes.
Park in China.
Amphib. Reptile Conserv.
1): 11,466-11,473.
Wang X, Huang Y, Zhong M, Yang S, Yang X, Jiang J,
Hu J. 2019. Environmental stress shapes life-history
variation in the Swelled-vented Frog (Feirana
quadranus). Evolutionary Ecology 33(3): 435-448.
Wells KD. 2007. The Ecology and Behavior of
Amphibians. The University of Chicago Press,
Chicago, Illinois, USA. 1,400 p.
Xie F, Jiang J, Zheng Z, Liu J. 2007. An analysis of
the species diversity and distribution patterns of
amphibians in Gongga Shan Mountain area. Acta
Herpetologica Sinica 11: 25-32.
Zhao B, Chen R. 1980. Mount Emei. Sichuan People’s
Press, Chendgu, China. 68 p.
Zhao T, Wang B, Shu G, Li C, Jiang J. 2018. Amphibian
Species contribute similarly to taxonomic, but not
functional and phylogenetic diversity: inferences
from amphibian biodiversity on Emei Mountain.
Asian Herpetological Research 9(2): 110-118.
Xiaoyi Wang is a Ph.D. candidate at Chengdu Institute of Biology, Chinese Academy of Sciences, whose
work focuses on species diversity and community assembly mechanisms along environmental gradients,
responses of traits to environmental changes, and the conservation of endangered species. Specifically,
she aims to link biodiversity conservation with multidimensional insights, such as species function in the
ecosystem, evolution and adaptation, to assess how biodiversity responds to environmental changes.
Shengnan Yang entered the laboratory at Chengdu Institute of Biology, Chinese Academy of Sciences and
began her amphibian and reptile studies during her undergraduate work. She is interested in the ecology
and conservation of amphibians and reptiles. Her current research topics include the impact of habitat
transformation on these groups and the potential adaptability and plasticity of species.
Chunpeng Guo is a postgraduate student at Chengdu Institute of Biology, Chinese Academy of Sciences.
His research interests include the road ecology, conservation biology, and natural history of reptiles and
amphibians. His current studies focus on assessing the impacts of roads on amphibian and reptile assemblages
Ke Tang is a postgraduate student at Chengdu Institute of Biology, Chinese Academy of Sciences. He
studies the population ecology of amphibians and reptiles, and his current research focuses on the effects of
environmental heterogeneity on amphibians and reptiles in the Three-River-Source (Sanjiangyuan) National
Jianping Jiang is a herpetologist at Chengdu Institute of Biology, Chinese Academy of Sciences, with more
than 25 years of professional wildlife and research experience. Currently, he is focusing on the taxonomy,
systematics, ecology, evolution, and conservation of reptiles and amphibians.
Junhua Hu is a full professor at Chengdu Institute of Biology, Chinese Academy of Sciences. His research
focuses on animal ecology and the conservation of endangered species in a changing world.
September 2020 | Volume 14 | Number 3 | e252
Amphibians on Mount Emei, China
Appendix. Locations of sampling sites and the numbers of line transects (N) at each site along the elevational gradient on Mount
Emei, China.
Sampling site Longitude (°E) Latitude (°N) Elevation (m) N
Line Huangwan Village 103.43 29.58 500 e
Hranisects Baoguo Temple 103.44 29,57 530 2
Lianghekou 103.41 29.59 650 l
Qingyin Pavilion 103.39 29.57 730 1
Shenshui Pavilion 103.41 29.56 800 2
Baiguo Village 103.34 29.43 860 1
Chadi Village 103.36 29.59 914 1
Weigan Village 103.31 29.60 1,100 1
Longdong Village 103.28 29.58 1,250 2
Qiliping 103.25 29,57 1,280 1
Linggongli 103.29 2958 1,340 2
Kuhaoping 103.27 29.45 1,470 2
Changshou Bridge 103.35 29.56 1,540 1
Jinchuan Village 103.24 29.44 1,560 2
Longqiaogou 103.35 29.55 1,900 1
Jingding 103.33 29.52 3,050 1
Sampling Shouxing Bridge 103.37 29.55 1,280
points Shuangshuijing 103.32 29.55 2,230
Leidongping 103.33 29.55 2,433
Amphib. Reptile Conserv. 56 September 2020 | Volume 14 | Number 3 | e252
Official journal website:
amphibian-reptile-conservation.org
Amphibian & Reptile Conservation
14(3) [General Section]: 57—61 (e253).
New record of Adelphicos daryi (Serpentes: Dipsadidae) after
19 years, and additional record of Ptychohyla euthysanota
(Anura: Hylidae) in Guatemala
12*J. Renato Morales-Mérida and *Fred Muller
‘Escuela de Biologia, Universidad de San Carlos de Guatemala, Ciudad Universitaria, zona 12, Guatemala, GUATEMALA *Red Mesoamericana
y del Caribe para la Conservacion de Anfibios y Reptiles (Red MesoHerp Network, https://redmesoherp.wixsite.com/red-mesoherp) *26 Avenida
32-56 Hacienda Real, Zona 16, Guatemala City, GUATEMALA
Abstract.—New records of the Endangered Adelphicos daryi (Serpentes: Dipsadidae) and Near Threatened
Ptychohyla euthysanota (Anura: Hylidae) are reported for the Department of Guatemala, Guatemala City. Brief
comments on local conservation concerns for these two species are presented.
Keywords. Amphibia; Central America; Endangered; new records; Reptilia
Citation: Morales-Mérida J, Muller F. 2020. New record of Adelphicos daryi (Serpentes: Dipsadidae) after 19 years, and additional record of Ptychohyla
euthysanota (Anura: Hylidae) in Guatemala. Amphibian & Reptile Conservation 14(3) [General Section]: 57-61 (e253).
Copyright: © 2020 Morales-Mérida and Muller. This is an open access article distributed under the terms of the Creative Commons Attribution License
[Attribution 4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction
in any medium, provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced,
are as follows: official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 12 February 2020; Published: 12 September 2020
Snakes of the genus Adelphicos are small (39-57 cm) and
secretive leaf litter inhabitants of rainforest, cloud forest,
and pine-oak and conifer forest habitats, and they range
from northern Mexico (Tamaulipas) to western Honduras
(Campbell and Ford 1982; Kholer 2008). Six species of
Adelphicos are registered for Guatemala. Within this
genus, Adelphicos daryi was described by Campbell and
Ford in 1982, based on 11 specimens reported from San
Jorge Muxbal, Department of Guatemala, Guatemala
(Campbell and Ford 1982).
The IUCN Red List classifies Adelphicos daryi
as Endangered due to its very restricted distribution
in the central Guatemalan highlands. The species is
terrestrial, fossorial, and mainly nocturnal (Acevedo
et al. 2014). Prior to the report made in this paper,
there were five known localities for this species
based on many records all within the Department of
Guatemala: San Jorge Muxbal (type locality), Villa
Canales and Las Joyas, Santa Catarina, Pinula; Km
14.5 carretera a El Salvador, Puerta Parada; Vista
Hermosa II, Universidad Rafael Landivar, Zona 15,
and San Rafael, carretera a El Salvador (Table 1) [J.
Campbell, pers. comm. 2019].
The genus Ptychohyla includes frogs that inhabit
broad-leaf and mixed pine forest, with six species
recognized in Central America (Faivovich et al. 2018).
There are six species vouchered for Guatemala, including
Ptyhochyla_ euthysanota (Kellog, 1928). The IUCN
Red List classifies Ptychohyla euthysanota as Near
Threatened because its distribution is not much greater
than 20,000 km? (Santos-Barrera et al. 2010).
Observations
During a nocturnal photography hike in the Rio Las
Monjas on 11 July 2017 at 2100 h, the junior author
observed a snake alongside a large rock. It was initially
believed to be Stenorrhina freminvillei. However,
following more careful examination of the living
specimen, it was photographed (Fig. 1), and the images
were forwarded to Jonathan Campbell of the University
of Texas at Arlington for identification purposes. Dr.
Campbell confirmed that the specimen was Adelphicos
daryi. This record represents a new location for the
Department of Guatemala: Guatemala City, zona 16,
Rio Las Monyjas; 14.6075°N -90.463055°W (WGS84),
1,530 m asl (Fig. 2). Although this site is not a great
distance from the previous reported localities (Table
1), it has been 19 years since the last confirmed report
of this species from Km 14.5 Carretera a El Salvador,
Puerta Parada.
The same night, the senior author observed a
male of Ptychohyla euthysanota calling from a small
shrub beside the Rio Las Monjas at 2244 h (Fig. 3).
This observation and photographic confirmation are
separated by 21.25 km airline from the nearest prior
record of this species in the Lago de Amatitlan (based
on IUCN Records) [Fig. 4].
Amphib. Reptile Conserv.
September 2020 | Volume 14 | Number 3 | e253
New records of Adelphicos daryi and Ptychohyla euthysanota
Conservation Concerns
Unfortunately, these new records for Adelphicos
daryi and Ptychohyla euthysanota both occur in an
unprotected area in Guatemala City. Access to the
new locality is restricted in some parts for urban
settlements, while for other parts the access is easy,
and some local people still extract firewood from this
area. The major threats that Ptychohyla euthysanota
currently faces are alteration or loss of original habitats
due to agricultural activity, logging (Santos-Barrera
et al. 2010), and the pollution of water bodies where
they breed (Fig. 5). Another threatened amphibian has
previously been recorded at this locality, Plectrohyla
guatemalensis, which is classified by the IUCN as
Critically Endangered. Conservation efforts need to
be improved in this area, in order to safeguard this
endemic snake and regionally endemic frog. These
efforts should work with the communities, to promote
the creation of a comprehensive national water law, and
reduce deforestation (Acevedo et al. 2014).
Acknowledgements——We thank Jay Vannini for
comments on the drafting of this document and Dr.
Jonathan Campbell for corroborating the identification
of the specimen. We thank the Universidad del Valle de
Guatemala for providing us with the collection data for
Adelphicos daryi.
Literature Cited
Acevedo M, Ariano-Sanchez D, Johnson J. 2014.
Adelphicos daryi. The IUCN Red List of Threatened
Species 2014: e.T521A3014000.
Campbell JA, Ford LS. 1982. Phylogenetic relationships
of the colubrid snakes of the genus Ade/phicos in the
highlands of Middle America. Occasional Papers of
the Museum of Natural History University of Kansas
100: 1-22.
Faivovich J, Pereyra MO, Luna MC, Hertz A, Blotto
BL, Vasquez-Almazan CR, Kohler G. 2018. On the
monophyly and relationships of several genera of
Hylini (Anura: Hylidae: Hylinae), with comments on
recent taxonomic changes in hylids. South American
Journal of Herpetology 13(1): 1-32.
Kohler G. 2008. Reptiles of Central America. 2"! Edition.
Herpeton-Verlag Elke Kohler, Offenbach, Germany.
400 p.
QGIS Development Team. 2020. QGIS Geographic
Information System. Open Source Geospatial
Foundation Project. Available: http://qgis.osgeo.org
[Accessed: 3 June 2019].
Santos-Barrera B, Acevedo M, Mufioz Alonso A. 2010.
Ptychohyla euthysanota. The IUCN Red List of
Threatened Species 2010: e.T55910A 11388786.
Fig. 1. Individual of Adelphicos daryi in life. (A) Ventral view and (B) dorsal pattern of the specimen; (C) comparison of the size
of the head with author’s thumb; (D) lateral view of the head. Photos by Fred Muller.
Amphib. Reptile Conserv.
58
September 2020 | Volume 14 | Number 3 | e253
Morales-Meérida and Muller
Distribution of Adelphicos daryi in Guatemala. Distribution of Ptychohyla euthysanota in Guatemala.
Bae Pie Ls i a
COE eee bpeicsh
2524
585
rotececece:
~
aR
\
eseatgtat
ectetgtetyt
SOS ECS
SRR EKS
xo
<>
oO
-.
anes
S585
0 7 14 21 28 35 42 km 0 7 14 a1 28 35 42 km
Legend Legend
NEW RECORD NEW RECORD
& Old records PS] Known Distribution
M8 Lakes MB Lakes
Protected Areas Proeced Areas
—— Rivers —— Rivers
GG Forest Cover
{__] Population Center
{) Guatemala Department
(5 Forest Cover
{__} Population Center
Guatemala Department
Elaborate by Renato Morales Elaborate by Renato Morales
Fig. 2. Map of the distribution of Ade/phicos daryi in Guatemala. Fig. 4. Map of the distribution of Ptychohyla euthysanota in
Yellow star: new record; black circles: previous records; brown Guatemala. Yellow star: new record; purple polygons: previous
area: Guatemala Department. The map was developed with records; brown area: Guatemala Department. The map was
QGIS software (QGIS Development Team 2020). developed with QGIS software (QGIS Development Team 2020).
Fig. 3. Male of Ptychohyla euthysanota in life. (A) Lateral, (B) frontal, (C) ventral, and (D) lateral views of the specimen. Photos
by Renato Morales (A—B) and Fred Muller (C-D).
Amphib. Reptile Conserv. 59 September 2020 | Volume 14 | Number 3 | e253
New records of Adelphicos daryi and Ptychohyla euthysanota
Table 1. Historical and new records of Adelphicos daryi for Guatemala. UTA: University of Texas Arlington; UVGR: Univerisdad
del Valle de Guatemala.
|| Voucher | Locality | atitude | Longitude | Capture date
Previous | UVGR 2575 _| Km 14.5 carretera a El Salvador, Puerta Parada 14.5575 -90.4611 1980
records
UVGR 1131 Km 14.5 carretera a El Salvador, Puerta Parada, 14.5575 90.4611 1984
frente a Iglesia Sn. Francisco
UVGR 1088 | Km 14.5 carretera a El Salvador, Puerta Parada 14.5575 -90.4611 1987
UVGR 1376 Km 14.5 carretera a El Salvador, Puerta Parada, 14.5575 90.4611 4 May 1975
frente a Iglesia Sn. Francisco
UVGR 1389 Km 14.5 carretera a El Salvador, Puerta Parada, 14.5575 90.4611 AMay 1975
frente a Iglesia Sn. Francisco
UVGR 1194 Km 14.5 carretera a El Salvador, frente a Iglesia 14.5575 90.4611 13 Aug 1984
San Francisco
UVGR 1197 Km 14.5 carretera a El Salvador, Puerta Parada, 14.5575 90.4611 27 Sep 1984
frente a Iglesia Sn. Francisco
UVGR 535 | Km 14.5 carretera a El Salvador, Puerta Parada 14.5575 -90.4611 10 Apr 1985
UVGR 1508 Km 14.5 carretera a El Salvador, Puerta Parada, 14.5575 90.4611 | Aug 1990
frente a Iglesia Sn. Francisco
UVGR 1844 | Km 14.5 carretera a El Salvador, Puerta Parada 14.5575 -90.4611 24 Apr 1991
UVGR 1845 | Km 14.5 carretera a El Salvador, Puerta Parada 14.5575 -90.4611 24 Jun 1991
UTA 32950 _| Villa Canales, Villa Tapacon, Quebrada Norte ———— 12 May 1992
UVGR 1991 ea ae Hermosa III, Universidad Rafael 14.6065 90.4901 27 Aug 1992
UTA 39216 Santa Catarina Pinula, San Miguel Buena Vista 11 Nov 1994
(Las Joyas)
Rio Las Monyas, Zona 16, Guatemala City 14.6075 -90.463055 11 Jul 2017
Amphib. Reptile Conserv. 60 September 2020 | Volume 14 | Number 3 | e253
Morales-Meérida and Muller
- 7
Fig. 5. Rio Las Monjas, Zona 16, Guatemala City. (A) Habitat for Adelphicos daryi and Ptychohyla euthysanota, (B) Pollution of
the waterbody by drainage.
Renato Morales is a Guatemalan biologist and herpetologist, and amateur wildlife
photographer. He has been learning about and working on amphibians and reptiles
in Guatemala since 2013. Renato served as a teaching assistant in evolution courses,
and director of geology and paleontology courses, at the Universidad de San Carlos
de Guatemala; and he belongs to the group of taxonomists of the National Council for
Protected Areas (CONAP). In 2019, he was invited to the IUCN Red List Workshop as
part of the Guatemalan amphibian specialist group, and he is currently working on the
genetics of lizards and the conservation of salamanders and frogs.
Fred Muller has had a lifelong interest in natural history and began his career as a
nature photographer, specializing in botany, with a post at the Lyon Botanical Garden
in France. He worked there as staff photographer from 2002 to mid-2007, when he
moved to Guatemala. Since then, Fred has worked as an ecotourism guide and nature
photographer specializing in Mesoamerican biodiversity. His current topics of interest
include the region’s most endangered flora and herpetofauna. Fred has accumulated a
substantial collection of unique portraits of plants and animals, and his photography has
been showcased in many scientific publications as well as in public showings. Recently,
his photographs have appeared on websites such as Exotica Esoterica (http://www.
exoticaesoterica.com) where he is an author and photographer. Many examples of his
work can be seen on his Flickr page (http://www.flickr.com/photos/fredmullerpix) as
well as at Aroid Pictures (http://www.aroidpictures. fr).
Amphib. Reptile Conserv. 61 September 2020 | Volume 14 | Number 3 | e253
Amphibian & Reptile Conservation
14(3) [General Section]: 62—69 (e254).
Official journal website:
amphibian-reptile-conservation.org
The need for transboundary faunistics and conservation:
first record of the Natterjack Toad (Epidalea calamita) in
Czech Silesia, northeastern Czech Republic
‘Petr Vicek, 2Vit Zavadil, and ***Vaclav Gvozdik
'Frydecka 193, 739 34 Senov u Ostravy, CZECH REPUBLIC ?ENKI, o.p.s., Dukelska 145, 379 01 Trebon, CZECH REPUBLIC ?Institute of
Vertebrate Biology of the Czech Academy of Sciences, 603 65 Brno, CZECH REPUBLIC +National Museum, Department of Zoology, 193 00
Prague, CZECH REPUBLIC
Abstract.—The Natterjack Toad (Epidalea calamita) has been severely declining in the northern and eastern
parts of its range in past decades. An immense population decline has been recorded in the Czech Republic,
the southeastern edge of the species range. Contrary to the majority of published distribution range maps of
the Natterjack Toad, it is present only in the western part of the Czech Republic (Bohemia), scattered among
mostly isolated populations. A new, relatively distant population was recently discovered in the northeastern
part of the country, in Czech Silesia. The genetic analysis presented here demonstrates that the new population
belongs to the evolutionary lineage that is widely distributed in the northeastern part of the species range.
Thus, this population is not a possible exotic introduction, but probably represents a natural extension of
Natterjack Toad populations from Poland to the south. We urge conservation actions to be taken immediately to
support this unique population, which is presently inhabiting a dump site. We further emphasize the necessity
of considering distribution records on both sides of state borderlines when faunistic research is conducted in
borderlands.
Keywords. Amphibians, anthropogenic habitat, Bufonidae, Central Europe, distribution, edge populations, geographic
range limit, phylogeography, range extension
Citation: Vicek P, Zavadil V, Gvozdik V. 2020. The need for transboundary faunistics and conservation: first record of the Natterjack Toad (Epidalea
calamita) in Czech Silesia, northeastern Czech Republic. Amphibian & Reptile Conservation 14(3) [General Section]: 62-69 (e254).
Copyright: © 2020 Vicek et al. This is an open access article distributed under the terms of the Creative Commons Attribution License [Attribution
4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction in any
medium, provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced, are
as follows: official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 30 April 2020; Published: 28 September 2020
Introduction In the Czech Republic (= Czechia), the Natterjack Toad
is one of three bufonids and the rarest and most threatened
The Natterjack Toad, Epidalea calamita (Laurenti, —anuran species, being registered as Critically Endangered
1768), Bufonidae, is native to southwestern through (Jefabkova et al. 2017, 2019; Sandera et al. 2017). It is
northern Europe, and parts of eastern Europe (from present only in Bohemia, the western part of the Czech
Portugal to southern Sweden, Estonia, Belarus, and Republic (Jefabkova and Zavadil 2020; Moravec 2019;
northwestern Ukraine), where it typically occupies Sinsch 2009; Vitaéek and Zavadil 1994; Zavadil 1994,
sunny open sandy areas and heathlands (Sillero et 1996), contrary to the majority of published species range
al. 2014; Sinsch 2009). The species also tolerates = maps in books and conservation/research resources (e.g.,
saline habitats to some extent, including sand dunes Beja et al. 2009; Sillero et al. 2014), which incorrectly
on sea shores, and a substantial part of its range — show the range across the whole Czech Republic. The
corresponds to the oceanic climate. However, within — distribution in Czechia represents the southeastern
the continental climate zone itis more commonly found __ edge of the species range (Beja et al. 2009; Sillero et al.
in anthropogenic habitats, such as agricultural areas like 2014; Sinsch 2009). The distribution in Czechia is very
vegetable crop fields (Zavadil et al. 2011) and quarries _ scattered, with most of the populations isolated from each
(Arnold 2002; Speybroeck et al. 2016), due to the lack — other (Fig. 1; AOPK CR 2019; Jerabkova and Zavadil
of natural habitats, such as floodplains. In the northern 2020; Ma’tera et al. 2015; Sandera et al. 2017), and on the
and eastern parts of the range, including Central Europe, _ edge of survival (Jefabkova et al. 2017, 2019; Sandera et
the abundance of the Natterjack Toads has drastically al. 2017). A relatively continuous distribution in Czechia
declined in past decades (Dufresnes 2019). is present only in the Cheb and Sokolov Basins (Jerabkova
Correspondence. *
[email protected]
Amphib. Reptile Conserv. 62 September 2020 | Volume 14 | Number 3 | e254
Vlicek et al.
Fig. 1. Distribution range of the Natterjack Toad (Epidalea calamita) according to the JUCN Red List of Threatened Species (Beja
et al. 2009), updated for the Czech Republic (inset). Red dots show all recent confirmed records (1997-2016; Sandera et al. 2017),
demonstrating the very scattered distribution in the Czech Republic. The question mark denotes the region where the Natterjack
Toad had occurred before 1990, but has since disappeared (AOPK CR 2019; Jetabkova and Zavadil 2020). The green star shows the
newly discovered population in Krnov, Czech Silesia.
and Zavadil 2020; Zavadil et al. 2011). The Natterjack
Toad has never been reported reliably from Moravia
or Czech Silesia, the eastern and northeastern parts of
the Czech Republic (Sandera et al. 2017; Zavadil 1994,
1996). However, the recently published distribution map
of the Natterjack Toad in Poland (Profus and Sura 2018)
documents its occurrence in Polish Silesia (southern
Poland), which indicates the possible presence of the
Natterjack Toad on the other side of the border in Czech
Silesia.
The presence of E. calamita in Czech Silesia was
recently confirmed in Krnov, in the borderlands with
Poland, highlighting the importance of transboundary
faunistic studies. The site is less than 10 km from the
nearest Polish locality. In this study, the genetic identity of
the newly discovered population was tested to determine
whether it was introduced from an exotic site. Specifically,
the test can determine if the population originated in
southwestern Europe, which hosts evolutionary lineages
that differ from the lineages located in Central Europe
(Rowe et al. 2006; Zeisset and Beebee 2014). The new
Amphib. Reptile Conserv.
locality is described, the historic and present threats are
discussed, and a baseline is proposed for the conservation
management of this newly discovered population.
Materials and Methods
Study Area
The newly discovered locality, Krnov-Cvilin (50.0703°N,
17.7192°E, 390 m asl; Figs. 1—2), lies in the borderlands
of the Czech Republic and Poland, in the foothills of the
Jeseniky Mountains (northeastern part of the Bohemian
Massif), and at the edge of the Silesian Lowlands. The
area 1S a mosaic of forested and agricultural landscapes,
which changes into a predominately agricultural
landscape in the Silesian Lowlands.
Genetic Methods
Genomic DNA was extracted from toe clips of five
Natterjack Toads using a spin column-based extraction
September 2020 | Volume 14 | Number 3 | e254
Epidalea calamita in Czech Silesia
Fig. 2. Newly discovered locality of the Natterjack Toad (Epidalea calamita) in Krnov, Czech Silesia, Czech Republic. The
distribution site is located within the Cvilin demolition waste dump, which used to be a sand quarry. (A) The site is now completely
filled-up by demolition waste, an unfavorable condition for several species of amphibians present at the site. (B) Puddles are formed
in small depressions after the movement of heavy-weight vehicles. However, the formation of such small puddles will probably
stop in the near future as the waste dump is now closed. This is another unfavorable condition for this population, together with the
surrounding grounds being overgrown by dense vegetation.
kit and following the manufacturer’s manual. One sample
was from a subadult specimen from the newly discovered
population (Fig. 3) in the northeast of the Czech Republic
(Krnov), while four samples for comparison were from
the western Czech Republic (Odrava-Obilna, sand quarry;
50.1030°N, 12.4732°E, 425 m asl). PCR amplification
and DNA sequencing targeted a fragment of 16S rRNA
using the primers and protocol reported by GvoZdik et
al. (2010). The nucleotide sequences obtained were
supplemented by available conspecific 16S rRNA data
from GenBank. The GenBank data were derived from
24 individuals from throughout the species distribution
range, including one additional sample from the western
Czech Republic (GenBank KF665137; Lomnice, Erika
sand quarry; 50.2117°N, 12.6064°E, 480 m asl) and two
outgroup taxa (Bufo bufo and Bufotes viridis, both from
Czechia). GenBank numbers and countries of origin are
given in Fig. 4, and the new sequences were deposited
in GenBank (MT396931—MT396935). Alignment of
the nucleotide sequences was prepared using the Mafft
algorithm (Katoh and Standley 2013), with default
settings as incorporated in Geneious R8.1 (Biomatters,
Auckland, New Zealand), and included 548 aligned
sites. The maximum-likelihood phylogenetic tree was
constructed by the RAxML algorithm (Stamatakis 2014)
using the general time-reversible model of substitution
evolution with rate heterogeneity, and 100 bootstrap
pseudoreplicates to assess the branching supports.
Results and Discussion
Discovery of the New Population and_ Site
Characteristics
In July 2019, an amateur naturalist found several
specimens of the Natterjack Toad in a demolition
waste dump in Krnoy-Cvilin. The toads were originally
erroneously identified as the Green Toad (Bufotes
Amphib. Reptile Conserv.
viridis), and later re-identified according to photographs
by the first author of this contribution. The finding was
popularized in internet media as a finding of “the rarest
Czech anuran in a dump” (Kuba 2019). On 8 August
2019 at 2110-2220 h, with an air temperature of 18-20
°C, six specimens (four adults, one older subadult, and
one younger subadult) of E. calamita were found at the
dump site in Krnov, Cvilin Quarter, which represented
the first confirmed record of the Natterjack Toad in
Czech Silesia (Fig. 3). Subsequent surveys in August
and September 2019 brought more findings of around
ten individuals of different ages, including both adults
and subadults. Together with the finding of the younger
subadult (Fig. 3D), the various ages of the individuals
suggest that the population was then — or until recently
had been — reproducing.
The distribution site in Krnoy-Cvilin (Fig. 1) is
approximately 2.3 km from the border with Poland,
which is formed by the Opava River. Climatically, the
site 1s in a warmer region of the Czech Republic (Quitt
1971), with an average temperature in January (coldest
month) of -2.6 °C and in July (warmest month) of 17.0
°C (https://en.climate-data.org/). Geomorphologically,
the site is within the Zlatohorska Highlands, a part of
the Jeseniky Mountains. According to the Kartierung
der Flora Mitteleuropas (KFME) mapping grid, a widely
used floristic and faunistic mapping system in the Czech
Republic, the Cvilin dump lies within grid cell #5972
(Pruner and Mika 1996).
Genetic Identity
The specimen from the Krnov population has the same
haplotype as the specimens from Western Bohemia
(Czechia), as well as specimens from northern France,
the Netherlands, and Denmark (Fig. 4). Closely related
haplotypes originated from Sweden. In the Western
Bohemian site (Odrava-Obilna), one additional haplotype
September 2020 | Volume 14 | Number 3 | e254
Vlicek et al.
a
+a ead ~ S om ci ‘ t= A watts : . Bini ee See :
Fig. 3. Individuals of the Natterjack Toad (Epidalea calamita) from the newly discovered population in Krnov, Czech Silesia, Czech
Republic, all found active at night in August 2019. (A) Adult female (SVL 74 mm), (B) genetically tested subadult specimen, (C)
adult male with an indistinct dorsal stripe, and (D) the smallest subadult (SVL 34 mm) that was found.
was found. All of these haplotypes form a well-supported — origin with biogeographic and evolutionary connections
clade, which corresponds to Clade A according to Rowe — to populations in the Silesian Lowlands in Poland.
et al. (2006). A comparison of the results of this study | However, the application of a population-genetic
with those of Rowe et al. (2006) and Zeisset and Beebee — approach is needed to more precisely elucidate the eco-
(2014), indicates that Clade A is distributed from northern — evolutionary relationships of the Krnov population to
Spain and western and northern France to Britain, Ireland, — the nearest neighboring populations both to the north in
the Netherlands, Denmark, Sweden, Estonia, and Central Poland and to the west in Bohemia. This will be a crucial
Europe, including Germany, Poland, and the Czech _ step for properly defining conservation units, which is
Republic. A higher genetic diversity in the Natterjack an essential step for the conservation management of the
Toad is found only in the Iberian Peninsula, southern Natterjack Toad in the Czech Republic.
France, and partially in Switzerland and southwestern
Germany (Fig. 4; Rowe et al. 2006). The remainder of — Recent History of the Locality
the range, including the Czech Republic, 1s occupied by
a genetically relatively uniform evolutionary lineage, — The site is presently a demolition waste dump that is in
which probably colonized this region during the post- the process of being closed because its capacity is now
glacial expansion (Rowe et al. 2006; Zeisset and Beebee _ full (Fig. 2). According to the town chronicle (F. Kuba,
2014). September 2019, pers. comm.) and long-time residents’
For effective conservation management, itis important | memories, the site was an active sand quarry before
to point out that the specimen from Krnov isa member World War II. A small pond was present when the quarry
of this widespread Central and Northern European was abandoned. At the end of the 1960s, ecological
lineage (Clade A sensu Rowe et al. 2006), which is also. —- degradation began when liquid toxic waste was first
native in Czechia. This means that the Krnov population deposited in the abandoned quarry, and this continued
is not a distant, exotic introduction, specifically from — until 1983. Since 1985, the site has been “recultivated”
southwestern Europe (e.g., southern Iberia or southern __ in Several serial attempts which were interrupted by the
France). The most probable hypothesis for this continuing usage ofthe site asadump. The “recultivation”
population’s occurrence in Krnov is an autochthonous __ landfilling was done mainly using demolition waste and
Amphib. Reptile Conserv. 65 September 2020 | Volume 14 | Number 3 | e254
Epidalea calamita in Czech Silesia
Epidalea calamita 100
0.01 substitution/site
“+1
MT396934 Czech Rep. NE (Krnov)
MT396931 Czech Rep. W (Odrava)
MT396932 Czech Rep. W (Odrava)
MT396933 Czech Rep. W (Odrava)
MT396935 Czech Rep. W (Odrava)
KF665137 Czech Rep. W (Lomnice)
MH105103 Denmark
MH105104 Denmark
KJ128949 Sweden
AF350433 Sweden
AF350434 Netherlands
FJ882809 France
Clade A | KX237596 France
100 | KX237598 France
KX237599 France
KX237601 France
KX237602 France
KX237603 France
KX237605 France
KX237606 France
AF350432 Spain
9g | EU938400 Spain
AF350431 Portugal
KX237600 France
99 KX237604 France
400| KX237595 France
KX237597 France
AF350430 Portugal
KY762040 Portugal
KF665464 Bufotes viridis Czech Rep.
KF665394 Bufo bufo
Czech Rep.
Fig. 4. Maximum-likelihood phylogenetic tree showing the position of an individual from Krnov (in red) within the Clade A (sensu
Rowe et al. 2006), indicating the non-exotic origin of the Krnov population. All other Czech samples (from Western Bohemia) are
in bold. Codes correspond to GenBank numbers, and numbers at nodes are bootstrap support values
soil. The last remains of the pond had been visible until
1997, when it was completely covered by the landfilling.
However, puddles (as potential breeding sites) were
probably formed after rains. The last, final phase of
landfilling began in 2007 and had been ongoing until
October 2019, when the dump was formally closed due
to its full capacity.
Present Situation and Threats
The present size of the Cvilin dump is approximately
100 x 250 m, and the main anthropogenic disturbance
is the frequent usage of the site by heavy-weight
vehicles, similar to the open-pit mines of Western
Bohemia (Sokolov Basin) where the Natterjack Toad is
still relatively common (Zavadil et al. 2011). The site
is filled with rubble, other demolition waste, and soil,
with the depth of the waste layer of about 5—10 m. Some
Amphib. Reptile Conserv.
pioneer vegetation is growing on the soil surface, and the
Natterjack Toads are commonly found active near the
Knotgrass (Polygonum arenastrum) growth, where they
hide when disturbed. The ridden, smooth soil surface
allows for the formation of small puddles after heavy
rains. Although highly probable, it is not clear whether
they are sufficient for the reproduction of the Natterjack
Toads. Within the site, there is presently a single small
artificial pond made from a black plastic waterproof
sheet (approximately 5 x 3.5 m, maximum depth ~0.3 m).
This pond was built by the local municipality to provide
a breeding habitat for the local amphibian population
(without the previous knowledge of the Natterjack
Toad’s presence). However, this single small artificial
pond is not large enough to provide a reproduction site
for all the local amphibians. Moreover, it is unclear
which species can utilize this pond for reproduction.
Tadpoles of Pelobates fuscus and small postmetamorphic
September 2020 | Volume 14 | Number 3 | e254
Vicek et al.
juveniles of Pelophylax k1. esculentus were found in the
pond in August 2019, suggesting that these two species
are able to breed in this sole artificial pond of limited
size and volume. In addition, Bombina variegata, Bufo
bufo, and Bufotes viridis were recorded within the Cvilin
dump site, but it is not clear whether they successfully
breed within the dump. [However, see the Note at the
end of this article for updated information.| Krnov-
Cvilin is thus one of the few sites in Czechia, where the
three bufonids occur syntopically. The other amphibians
known from the whole Krnov region are: Hyla arborea,
Pelophylax ridibundus, Rana arvalis, R. dalmatina, R.
temporaria, Salamandra_ salamandra, Ichthyosaura
alpestris, Lissotriton montandoni, L. vulgaris, and
Triturus cristatus (AOPK CR 2019; Jetébkova and
Zavadil 2020; Moravec 1994; Siffner 2011).
Recommendations for Conservation Management
Conservation actions for the Natterjack Toad in the
Cvilin dump are in preparation. Briefly, four initial
recommendations are: (1) conserve the present pedologic
conditions in the majority of the soil surface, but remove
the demolition waste to uncover the original substratum
in a part of the area; (2) retain water by building several
shallow water reservoirs of different sizes and depths for
reproduction, ideally on the original substratum (with up
to 50 cm depth and slightly gradually sloping banks); (3)
block secondary succession to avoid the overgrowth of
dense and/or high vegetation; and (4) eliminate potential
revegetation actions.
Importance of Transboundary Faunistics and
Conservation
The newly discovered locality extends the known
distribution area of E. calamita in the Czech Republic
by 110 km (by air) east of the nearest registered location,
which is a sand quarry near Plchovice-Smetana in Eastern
Bohemia (50.0526°N, 16.1869°E; grid cell #5963; AOPK
CR 2019). Thus, the Natterjack Toad is newly listed as a
species present in Czech Silesia. The newly discovered
locality in Krnov is the easternmost known distribution
site of the species in the Czech Republic, and forms
the southeastern margin of the distribution range of the
species in Central Europe. These individuals represent
a unique Natterjack Toad population within the Czech
Republic, geographically separated from the Bohemian
populations, and therefore of particular conservation
importance. However, it is possible that more populations
are present in Czech Silesia or Northern Moravia which
have yet to be discovered [see Note at the end of this
article]. The Krnov population has a biogeographic
affinity to the Polish Upper Silesian populations (see
maps in Profus and Sura 2018, and the online atlas at
http://www.iop.krakow.pl/PlazyGady). The nearest
presently known distribution site is approximately 8
Amphib. Reptile Conserv.
km to the northeast (behind the Opava River), in a sand
quarry near Zubrzyce, Poland (50.1274°N, 17.7787°E,
290 m asl; grid cell #5872), a locality discovered only
recently in 2018 (M. Pabijan, September 2019, pers.
comm.). However, other Upper Silesian localities in
Poland, in the borderlands with the Czech Republic, have
been reported (Profus and Sura 2018; Swierad 1998).
These earlier findings could serve as an indication of the
possible presence of the Natterjack Toad in Czech Silesia,
which would allow the discovery of the Krnov-Cvilin
locality in a more favorable condition, before the original
sand quarry was completely destroyed. Considering the
distance between the Krnov population and the nearest
previously known locality, we can assume that the two
populations (and possibly other nearby populations) are
probably genetically connected within a metapopulation
network (Sinsch 2017).
This case highlights the importance and need for
transboundary faunistics and conservation in general. All
too often, local or national faunistics and conservation
actions are conducted without proper knowledge of the
situation that is right on the other side of the country
borderline. Considering that species distributions
in neighboring countries can bring new important
discoveries (e.g., Najbar et al. 2011; Strachinis et al.
2019; Vléek et al. 2010), we urge all those involved to
consider the situations on both sides of borderlines when
faunistic research and conservation actions are conducted
in borderland areas.
Acknowledgements.—We would like to thank Franti8ek
Kuba (Denik.cz, Krnov) for attracting our attention to
the Cvilin dump and providing valuable information
about its history, Jiri Vicha (Opava) for photos from
his surveys, and Filip Siffner (Krnov) for additional
data. We also thank Jifi Moravec (National Museum,
Prague) and Ulrich Sinsch (University of Koblenz
and Landau, Koblenz, Germany) for their advice and
comments; Maciej Pabian (Jagiellonian University,
Krakow, Poland) for information about the distribution
of the Natterjack Toad in Polish Upper Silesia; Silke
Schweiger (Natural History Museum Vienna, Austria)
for the distribution data from Austria; Jana Tym¢ikova
(Senov) for help in the field; Véra Koutecka (Ostrava)
for botanical identifications; and Alexandra Hanova
(IVB CAS, Studenec) for help in the molecular lab. This
research was supported by the IVB CAS institutional
support (RVO: 68081766), and Ministry of Culture of the
Czech Republic (DKRVO 2019—2023/6.V.b, National
Museum, 00023272).
Literature Cited
Arnold EN. 2002. Reptiles and Amphibians of Europe.
Second Edition. Princeton University Press,
Princeton, New Jersey, USA and Oxford, United
September 2020 | Volume 14 | Number 3 | e254
Epidalea calamita in Czech Silesia
Kingdom. 288 p.
AOPK CR [Nature Conservation Agency of the Czech
Republic]. 2019. Nalezova databaze ochrany pfrirody
[On-line database of distribution records for nature
conservation]. Available: https://portal.nature.cz/nd
[Accessed: 1 October 2019].
Beja P, Kuzmin S, Beebee T, Denoel M, Schmidt B,
Tarkhnishvili D, Ananjeva NB, Orlov NL, Nystrom
P, Ogrodowczyk A, et al. 2009. Epidalea calamita
(erratum version published in 2016). The IUCN Red
List of Threatened Species 2009: e.T54598A 86640094.
Dufresnes C. 2019. Amphibians of Europe, North
Africa, and the Middle East. A Photographic Guide.
Bloomsbury Wildlife, London, United Kingdom. 547
p.
Gvozdik V, Moravec J, Kltitsch C, Kotlik P. 2010.
Phylogeography of the Middle Eastern tree frogs
(Hyla, Hylidae, Amphibia) as inferred from nuclear
and mitochondrial DNA variation, with a description
of a new species. Molecular Phylogenetics and
Evolution 55: 1,146—1,166.
Jefabkova L, Zavadil V. 2020. Atlas rozSireni
obojzivelnikii Ceské republiky [Distribution Atlas
of Amphibians in the Czech Republic]. Agentura
ochrany prirody a krajiny CR, Praha, Czech Republic.
104 p.
Jefabkova L, Krasa A, Zavadil V, Mikatova B, Rozinek
R. 2017. Cerveny seznam obojZivelnikii a plaza Ceské
republiky [Red list of amphibians and reptiles of the
Czech Republic]. Pp. 83-106 In: Cerveny seznam
ohrozenych druhit Ceské Republiky. Obratlovci [Red
List of Threatened Species of the Czech Republic.
Vertebrates|. Priroda 34. Editors, Chobot K, Némec
M. Agentura ochrany prirody a krajiny CR, Praha,
Czech Republic. 182 p.
Jetabkova L, Sandera M, Balaz V. 2019. Conservation
and decline of European amphibians: the Czech
Republic. Pp. 58-67 In: Status of Conservation and
Decline of Amphibians: Eastern Hemisphere, Part
5: Northern Europe. Amphibian Biology, Volume
11. Editors, Heatwole H, Wilkinson JW. Pelagic
Publishing, Exeter, United Kingdom. 108 p.
Katoh K, Standley DM. 2013. MAFFT multiple sequence
alignment software version 7: improvements in
performance and usability. Molecular Biology and
Evolution 30: 772-780.
Kuba F. 2019. [The rarest Czech anuran lives in the
dump in Krnov]. Available: https://www.denik.cz/
regiony/nejvzacnejsi-ceska-zaba-zije-v-krnove-na-
skladce-20190808.html [Accessed: 11 November
2019]. [In Czech].
Ma&sgtera J, Zavadil V, Dvorak J. 2015. Vajicka a larvy
obojzivelnikii Ceské republiky [Eggs and Larvae of
Amphibians of the Czech Republic]. Academia, Praha,
Czech Republic. 179 p.
Moravec J. 1994. Atlas rozsireni obojzivelnikit v Ceské
republice [Atlas of Czech Amphibians]. Narodni
Amphib. Reptile Conserv.
68
muzeum, Praha, Czech Republic. 136 p.
Moravec J. 2019. Obojzivelnici a Plazi Ceské Republiky
[Amphibians and Reptiles of the Czech Republic}.
Academia, Praha, Czech Republic. 461 p.
Najbar B, Vléek P, Suhaj J. 2011. New locality record for
the Agile Frog (Rana dalmatina) from an Odra River
meander in southern Poland. Herpetology Notes 4:
63-65.
Profus P, Sura P. 2018. Ropucha paskéwka Epidalea
calamita (Laurenti, 1768). Pp. 54—56 In: Atlas plazow
i gadow Polski. Status — Rozmieszczenie — Ochrona
[Atlas of the Amphibians and Reptiles of Poland.
Status — Distribution — Conservation]. Editors,
Glowacinski Z, Sura P. Wydawnictwo Naukowe
PWN, Warsaw, Poland. 233 p.
Pruner L, Mika P. 1996. Seznam obcia jejich éasti v Ceské
republice s Cisly mapovych poli pro sitové mapovani
fauny [List of settlements in the Czech Republic with
associated map field codes for faunistic grid mapping
system]. Klapalekiana 32(Suppl): 1-175.
Quitt E. 1971. Mapa klimatickych oblasti CSSR [Map
of Climatic Regions of Czechoslovakia]. Kartografie,
Prague, Czech Republic and Geograficky Ustav
CSAV, Brno, Czech Republic.
Rowe G, Harris DJ, Beebee TJC. 2006. Lusitania
revisited: a phylogeographic analysis of the Natterjack
Toad Bufo calamita across its entire biogeographical
range. Molecular Phylogenetics and Evolution 39:
335-346.
Sandera M, Maitera J, Macat Z, Vojar J. 2017. Zachranny
program pro ropuchu kratkonohou (Epidalea calamita)
v Ceské republice [The Natterjack Toad (Epidalea
calamita) action plan in the Czech Republic]. Herpeta,
Praha, Czech Republic. Available: http://www.
herpeta.cz/pages/serve.php?file=1575975907_0 zp_
ropucha-pdf. pdf [Accessed: 10 December 2019].
Siffner F. 2011. Obojzivelnici a plazi Krnovska
[Amphibians and reptiles of the Krnov region].
Herpetologické Informace (The Journal of the Czech
Herpetological Society) 10(2): 14-20.
Sillero N, Campos J, Bonardi A, Corti C, Creemers R,
Crochet P-A, Crnobrnja Isailovic J, Denoél M, Ficetola
GF, Goncalves J, et al. 2014. Updated distribution and
biogeography of amphibians and reptiles of Europe.
Amphibia-Reptilia 35: 1-31.
Sinsch U. 2009. Bufo calamita Laurenti, 1768 —
Kreuzkrote. Pp. 339-413 In: Handbuch der Reptilien
und Amphibien Europas. Band 5/II: Froschlurche
(Anura) II (Hylidae, Bufonidae). Editor, Grossenbacher
K. Aula-Verlag, Wiebelsheim, Germany. 503 p.
Sinsch U. 2017. Wie weit wandern Amphibien?
Verhaltensbiologische und genetische Schatzung
der Konnektivitat zwischen Lokalpopulationen.
Zeitschrift fiir Feldherpetologie 24: 1-18.
Speybroeck J, Beukema W, Bok B, Van Der Voort J.
2016. Field Guide to the Amphibians and Reptiles
of Britain and Europe. Bloomsbury Natural History,
September 2020 | Volume 14 | Number 3 | e254
Vlicek et al.
London, United Kingdom and New York, New York,
USA. 432 p.
Stamatakis A. 2014. RAxML version 8: a tool for
phylogenetic analysis and post-analysis of large
phylogenies. Bioinformatics 30: 1,312-1,313.
Strachinis I, Karagianni KM, Stanchev M, Stanchev N.
2019. No one ever noticed: first report of Zootoca
vivipara (Lichtenstein, 1823) in Greece. Herpetology
Notes 12: 53-56.
Swierad J. 1998. Herpetofauna na Gornym Slasku
[Herpetofauna of the Upper Silesia]. Przestrzen i
Wartosci. Studia i materialy waloryzacji przestrzeni
Gornego Slaska 2: 51-65.
Vitaéek Z, Zavadil V. 1994. Ropucha kratkonoha — Bufo
calamita Laurenti, 1768. Pp. 66-68 In: Atlas rozsifeni
obojzivelnikii v Ceské Republice [Atlas of Czech
Amphibians]. Editor, Moravec J. Narodni Museum,
Prague, Czech Republic. 136 p.
Viéek P, Najbar B, Jablonski D. 2010. First records of the
Dice Snake (Natrix tessellata) from the North-Eastern
photography is his hobby.
habitats by vertebrates.
part of the Czech Republic and Poland. Herpetology
Notes 3: 23—26.
Zavadil V. 1994. Die historische und aktuelle Verbreitung
der Kreuzkrote in der Tschechischen Republik mit
Bemerkungen tber ihre Biologie. Berichte Landesamt
Umweltschutz Sachsen-Anhalt 14: 39-40.
Zavadil V. 1996. Ropucha kratkonoha, Bufo calamita
Laurentil, 1768. Historické a aktualni rozSifeni
v Ceské republice, s poznamkami o jeji biologii
a ochrané [The Natterjack Toad, Bufo calamita
Laurent, 1768. Historical and present distribution
in the Czech Republic, with notes on its biology and
conservation]. Ochrana prirody 51: 135-138.
Zavadil V, Sadlo J, Vojar J. 2011. Biotopy nasSsich
obojzivelniku. a_ jejich management. Metodika
AOPK CR [Biotopes of Czech Amphibians and their
Management|. Agentura ochrany pfrirody a krajiny
CR, Prague, Czech Republic. 178 p.
Zeisset I, Beebee TJC. 2014. Drift rather than selection
dominates MHC class II allelic diversity patterns at
the biogeographical range scale in Natterjack Toads,
Bufo calamita. PLoS ONE 9(6): e100176.
Petr Vléek is a member of the Czech Herpetological Society. Petr is interested in the ecology
of amphibians and reptiles of Central Europe and the Balkans, including field herpetology and
conservation. In the long term, he has been monitoring a unique geographically isolated population
of the Dice Snake (Natrix tessellata) in the Karvina region, north-eastern Czech Republic. Nature
Vit Zavadil is a zoologist in ENKI (Tfebon, Czech Republic), a company focusing on environmental
protection, especially issues related to the water in landscapes and its biodiversity. Vit is the first
author of the action plan for the Aesculapian Snake (Zamenis longissimus) in the Czech Republic,
which he had been working on until 2018. He has also worked on proposals and the enforcement
actions of Special Areas of Conservation for amphibians in the Czech Republic, as defined by the
European Union's Habitats Directive. In the last 25 years, he has primarily been studying biotopes
after the mining of coal, minerals, and other construction materials, and the colonization of these
Vaclav Gvozdik is a herpetologist based at the Institute of Vertebrate Biology of the Czech Academy
of Sciences (Brno, Czech Republic) and the National Museum (Prague, Czech Republic). Vaclav is
interested in the phylogeography, diversity, and evolution of amphibians and reptiles of the Western
Palearctic and tropical Africa. In the Western Palearctic, he is particularly experienced with the
herpetofauna of Central and South-Eastern Europe, and the Middle East. He has special interests in
the evolutionary biology of tree frogs (Hy/a) and slow-worm lizards (Anguis).
Note: In 2020, after the acceptance of this article, another population of the Natterjack Toad (Epidalea calamita) was discovered by
the authors and Filip Siffner near Osoblaha in Czech Silesia (50.2624°N, 17.6922°E, 270 m asl), 21 km to the north from the Krnov-
Cvilin locality (by air). At the Krnov-Cvilin site, the Natterjeck Toad successfully bred in a naturally-formed puddle in June—July,
laying eggs after heavy rains, and larvae metamorphosed in approximately three weeks. The artificial pond served as a successful
breeding site for Bombina variegata, a Critically Endangered species in the Czech Republic.
Amphib. Reptile Conserv.
September 2020 | Volume 14 | Number 3 | e254
Official journal website:
amphibian-reptile-conservation.org
Amphibian & Reptile Conservation
14(3) [General Section]: 70—73 (e255).
Book Review
The Wildlife Techniques Manual, Eighth Edition
Howard O. Clark, Jr.
Colibri Ecological Consulting, LLC, 9493 North Fort Washington Road, Suite 108, Fresno, California 93730, USA
Keywords. Capture techniques, climate change, conservation genetics, experimental design, population estimation,
telemetry, unmanned aerial vehicle, urban wildlife management, vegetation analysis, wildlife damage management
Citation: Clark HO Jr. 2020. Book review—The Wildlife Techniques Manual, Eighth Edition. Amphibian & Reptile Conservation 14(3) [General
Section]: 70-73 (e255).
Copyright: © 2020 Clark. This is an open access article distributed under the terms of the Creative Commons Attribution License [Attribution 4.0
International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction in any medium,
provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced, are as follows:
Official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 15 September 2020; Published: 16 September 2020
The 8" edition of The Wildlife Techniques Manual (Fig. 1)
is a welcome sight in today’s information hungry world.
Since 1960, The Wildlife Society has produced several
editions of techniques manuals that started off fairly
modest, but now, 1n 2020, have grown into a monstrous,
two-volume set (Fig. 2).
The chapters in the new manual are divided into two
major categories: Research (Volume 1) and Management
(Volume 2). The research volume is sub-divided into
several sections, including Design and Analytical
Techniques (7 chapters), Identification and Marking
Techniques (4 chapters), Measuring Animal Abundance
(7 chapters), Measuring Wildlife Habitat (4 chapters),
and Research on Individual Animals (3 chapters). The
management volume is divided into three sections:
Management Perspectives (6 chapters), Managing
Landscapes for Wildlife (12 chapters), and Managing
Wildlife Populations (7 chapters). See the Appendix for
a complete list of chapter titles and authors.
The 7" edition, which I reviewed in 2012 (Clark 2012),
was the first time that the manual was published as a two
volume set. The 8" edition continues this trend, but adds
several new chapters; the 7 edition only had 37 chapters
and the new edition has now grown to 50 chapters. As I
predicted in 2012, the 8" edition reflects new challenges
and research frontiers as wildlife managers and biologists
invent new ways to study wildlife questions.
One of the most exciting and innovative approaches is
explored in chapter 17: Use of Unmanned Aerial Vehicles
in Wildlife Ecology (Rosario et al. 2020). The use of
unmanned “drones” has exploded on the wildlife scene
over the past few years. Drones are useful in capturing data
on research subjects difficult to access via foot or vehicle.
But one major caveat in using these drones is the Federal
Amphib. Reptile Conserv.
THE WILDLIFE
TECHNIQUES
MANUAL
Edited by Nova J. Silvy
Fig. 1. The Wildlife Techniques Manual, 2 Volumes. Editor,
Silvy NJ. The Johns Hopkins University Press, Baltimore,
Maryland, USA. 8" Edition, published 28 July 2020.
Trim Size: 8.5” x 11” | 1400 pages | Illustrations: 260 halftones,
165 line drawings | ISBN: 9781421436692 | Hardcover: US
$174.95. Photo by Howard Clark.
Aviation Administration’s (FAA) Unmanned Aerial
Vehicle (UAV) licensing and flight regulations. Safety is
paramount when using drones and it is imperative that
when using drones, wildlife managers and researchers
understand the latest laws, directives, and policies. With
a high level of FAA regulation understanding, better
conservation of biological resources will result as well
as an enriched research deliverable. The chapter covers
several other topics, including types of UAV platforms
and considerations, data management and analysis,
UAVs in wildlife ecological research, and UAV safety.
I was pleased to see a chapter on drones added to the 8"
September 2020 | Volume 14 | Number 3 | e255
Clark
bers
ESS
Ue
-a0
W
E
cE
VOLUME 2 MANAGEMENT
Fig. 2. The Wildlife Techniques Manual (8" edition, 2 volumes)
compared to the slender 1* edition published 60 years earlier
(Mosby 1960), which has 17 chapters. Photo by Howard Clark.
edition and I am sure as drone technology improves a
chapter on UAVs continue to appear in future editions.
The final chapter, Chapter 50, Managing Wildlife
in a Changing Climate (Inkley and Stein 2020), really
binds all the others together. Although climate change
(formerly known as “global warming”) has been on the
scientific radar for decades (e.g., Chamberlin 1899) only
now has a chapter in the manual been devoted to it. All
of the research techniques and management philosophies
discussed at length in The Wildlife Techniques Manual
will be conducted under the auspices of global climate
change. The trends of increased change in global
temperatures (Fig. 3) have a significant effect on the
global landscape and the wildlife species that occupy
it. Research conducted from now on will no doubt have
climate change as a factor, or at least something running
in the background driving evolution and environmental
adaptation. Chapter 50 provides an excellent overview
and summary of the effects of climate change on wildlife.
As the authors state on page 443, “The scientific record
conclusively demonstrates that impacts of climate
1.0
—= Annual Mean
0.8 =—— Lowess Smoothing
S)
= -O6
=
©
= 04
eo)
i
to 02
: a
a. ats .
= 0.2 N | enh \ M
. . b 1 fs ma in’
E | \
-0.4 vi
-0.6
1880 1900 1920 1940
change on wildlife are not just a concern for the distant
future, but already are happening.” Climate effects are
physically visible, such as the 17 of the 18 hottest years in
the 136-year record have all occurred since 2001. We are
witnessing catastrophic wildfires, hurricanes, droughts,
and other extreme (but increasingly frequent) weather
events. As noted in recent news media, the droughts in the
western USA have driven beetle-kills of trees in western
coniferous forests, which exacerbate the wildfire season.
The “cause and effect” and interconnectedness of global
climate change and landscape impacts are alarming.
In addition, Chapter 50 covers climate change basics,
such as climate versus weather, climate models, scenarios
of greenhouse gas concentrations, and best practices for
the use of climate projections. An important section of
the chapter covers abiotic and physical climate impacts,
with discussions on elevated carbon dioxide levels,
temperature changes, precipitation changes, intensified
hurricanes and storms, snow cover changes, permafrost
melting, declines in ice cover and glaciers, sea-level rise,
ocean temperature increases, and ocean acidification.
These sections paint a bleak picture, but subsequent
sections provide approaches to mitigate the pending
deleterious trends. The authors explore four overarching
principles for effective climate adaptation:
1. Act with intentionality; link actions to climate
impacts.
2. Manage for change, not just persistence.
3. Reconsider goals, not just strategies.
4. Integrate adaptation into existing work.
There are various things that we can do to respond
to climate change, such as developments in wind energy
and biofuel, changes in agricultural practices, shifting
human population centers and infrastructure, and coastal
armoring.
mY
ix
iN
Hid
i d YN Jad
cy
NASA GISS
1960 1980 2000 2020
Fig. 3. Global temperature trends 1880-2017. Global mean estimates based on land and ocean data. https://data.giss.nasa.gov/
gistemp/graphs/. Graphic in the Public Domain.
Amphib. Reptile Conserv. 71
September 2020 | Volume 14 | Number 3 | e255
Book Review: The Wildlife Techniques Manual
Chapter 50 is key in understanding global climate
change and how we, as a species, can address and mitigate
it. The authors state on page 468, “The future of our
wildlife depends on wildlife professionals incorporating
climate considerations into all aspects of their work.”
Overall, The Wildlife Techniques Manual is a
critically important tool in the continued management
and conservation of wildlife and landscape habitats. I
encourage biologists and wildlife managers to field test
the recommendations and guidance provided by the
many authors who contributed to these monumental
volumes. By working together, and using sound science,
we may be able to create a sustainable global community
on every level, launching us into a future of hope.
Acknowledgments.—I thank C.J. Randel and N.J. Silvy
for allowing me to be a voice and participate in this
extraordinary work. I am also incredibly grateful for
the Johns Hopkins University Press production team and
their collaboration effort with The Wildlife Society.
Literature Cited
Chamberlin TC. 1899. An attempt to frame a working
hypothesis of the cause of glacial periods on an
atmospheric basis. The Journal of Geology 7(6): 545—
584.
Clark HO Jr. 2012. Book review of The Wildlife
Techniques Manual. Amphibian & Reptile
Conservation 5(1): 105-107 (e47).
Inkley DB, Stein BA. 2020. Managing wildlife in a
changing climate. Pp. 443-470 In: The Wildlife
Techniques Manual. Volume 2. 8" Edition. Editor,
Silvy NJ. The Johns Hopkins University Press,
Baltimore, Maryland, USA. 614 p.
Mosby HS. (Editor). 1960. Manual of Game
Investigational Techniques. Edward Brothers, Inc.,
Ann Arbor, Michigan, USA. 364 p.
Rosario RG, Clayton MK, Gates IT. 2020. Use of
unmanned aerial vehicles in wildlife ecology. Pp.
387-394 In: The Wildlife Techniques Manual. Volume
1. 8" Edition. Editor, Silvy NJ. The Johns Hopkins
University Press, Baltimore, Maryland, USA. 759 p.
Appendix. Zhe Wildlife Techniques Manual (8" edition, 2 volumes) list of chapters and authors.
Volume 1. Research
List of Contributors
Preface
Acknowledgments
Design and Analytical Techniques
Chapter | Research and Experimental Design
Chapter 2 Management and Analysis of Wildlife Ecology Data
Capturing and Handling Techniques
Chapter 3 Capturing and Handling Wild Animals
Chapter 4 Chemical Immobilization of Wildlife
Chapter 5 Use of Dogs in Wildlife Research and Management
Chapter 6 Identifying and Handling Contaminant-Related Wildlife Mortality/
Morbidity
Chapter 7 Wildlife Health and Disease Surveillance, Investigation,
and Management
Identification and Marking Techniques
Chapter 8 Criteria for Sex and Age of Birds and Mammals
Chapter 9 Identification of Animals from Field Signs
Chapter 10 Techniques of Marking Wildlife
Chapter 11 Radiotelemetry, Remote Monitoring, and Data Analyses
Measuring Animal Abundance
Chapter 12 Estimating Animal Abundance
Chapter 13 Use of Remote Cameras in Wildlife Ecology
Chapter 14 Population Analysis in Wildlife Ecology
Chapter 15 Use of Bioacoustics Monitoring Systems in Wildlife Research
Chapter 16 Tracking Wildlife with Radar Techniques
Chapter 17 Use of Unmanned Aerial Vehicles in Wildlife Ecology
Chapter 18 Invertebrate Sampling Methods for Use in Wildlife Research
Amphib. Reptile Conserv.
72
EO Garton, JL Aycrigg, C Conway, and JS Horne
BA Collier and TW Schwertner
NJ Silvy, RR Lopez, and TA Catanach
ML Drew
DK Dahlgren, RD Elmore, DA (Smith) Woollett, A Hurt, JK
Young, D Kinka, EB Arnett, D Baines, and JW Connelly
SR Sheffield, JP Sullivan, and EF Hill
MJ Peterson and PJ Ferro
EK Lyons, MA Schroeder, and LA Robb
JM Tomeéek and J Evans
NJ Silvy, RR Lopez, and MJ Peterson
NJ Silvy and TA Catanach
BL Pierce, RR Lopez, and NJ Silvy
ID Parker, RR Lopez, and SL Locke
DH Johnson and SJ Dinsmore
JM Szewezak and ML Morrison
TA Catanach and NJ Silvy
RG Rosario, MK Clayton, and IT Gates
TA Catanach
September 2020 | Volume 14 | Number 3 | e255
Clark
Appendix (continued). Zhe Wildlife Techniques Manual (8" edition, 2 volumes) list of chapters and authors.
Measuring Wildlife Habitat
Chapter 19
Chapter 20
Chapter 21
Chapter 22
Vegetation Sampling and Measurement
Techniques for Wildlife Nutritional Ecology
Simulation Modeling in Wildlife Research
Using Geospatial Technologies in Wildlife Studies
Research on Individual Animals
Chapter 23
Chapter 24
Chapter 25
Animal Behavior
Reproduction and Hormones
Conservation Genetics and Molecular Ecology in
Wildlife Management
Common and Scientific Names of Animals and Plants
Literature Cited
Index
Volume 2. Management
List of Contributors
Acknowledgments
Management Perspectives
Chapter 26
Chapter 27
Chapter 28
Chapter 29
Chapter 30
Chapter 31
Strengthening Connections between Research and Management
Ethics in Wildlife Science and Conservation
Human Dimensions of Wildlife Management
Communications and Outreach
Conflict in Wildlife Science and Conservation
Adaptive Management in Wildlife Conservation
Managing Landscapes for Wildlife
Chapter 32
Chapter 33
Chapter 34
Chapter 35
Chapter 36
Chapter 37
Chapter 38
Chapter 39
Chapter 40
Chapter 41
Chapter 42
Chapter 43
Forest Management for Wildlife
Managing Rangelands for Wildlife
Managing Inland Wetlands for Wildlife
Management of Coastal Wetlands for Wildlife
Managing Farmlands for Wildlife
Management and Research of Wildlife in Urban Environments
Managing Surface Disturbed Lands for Wildlife
Managing Disturbances to Wildlife and Habitats
Managing State Lands for Wildlife
Managing Federal Lands for Wildlife
Managing North American Indigenous Peoples’ Wildlife Resources
The Role of Nongovernment Organizations in Wildlife Management
Managing Wildlife Populations
Chapter 44
Chapter 45
Chapter 46
Chapter 47
Chapter 48
Chapter 49
Chapter 50
Harvest Management
Identification and Management of Wildlife Damage
Managing Terrestrial Invasive Species
Ecology and Management of Small Populations
Captive Propagation and Translocation
Environmental Impact Assessment and Habitat
Conservation Plans
Managing Wildlife in a Changing Climate
Common and Scientific Names of Animals and Plants
Literature Cited
Index
Amphib. Reptile Conserv. 73
KF Higgins, KJ Jenkins, DW Uresk, LB Perkins, KC Jensen, JE
Norland, RW Klaver, and DE Naugle
LA Shipley, RC Cook, and DG Hewitt
H-H (Rose) Wang and WE Grant
HL Perotto-Baldivieso, S Tapaneeyakul, and ZJ Pearson
JR Young
HM Bryan and JD Harder
SJ Oyler-McCance, EK Latch, and PL Leberg
LA Brennan, SJ Demaso, JP Sands, and MJ Schnupp
MJ Peterson, MN Peterson, TR Peterson, and E von Essen
SL Rodriguez and MN Peterson
SK Jacobson, HO Brown, and BS Lowe
AM Feldpausch-Parker and TR Peterson
JF Organ, DJ Decker, SJ Riley, JE McDonald, Jr., and SP
Mahoney
SW Bigelow, CG Mahan, AD Rodewald, LM Conner, and LL
Smith
VC Bleich, MW Oehler, and JG Kie
MK Laubhan, SL King, and LH Fredrickson
JA Nyman, C Elphick, and G Shriver
RE Warner, JW Walk, and JR Herkert
RA McCleery, CE Moorman, MC Wallace, and D Drake
TA Catanach and NJ Silvy
CJ Parent, F Hernandez, and A Bruno
TJ Ryder and JF Organ
B Beard, RP Bixler, T Darden, B Huffaker, M Madison, and JG
Van Ness
H Stricker, PM Schmidt, J Gilbert, J Dau, DL Doan-Crider, S
Hoagland, MT Kohl, CA Perez, LJ Van Daele, MB Van Daele,
and D Dupont
HA Mathewson, JJ Giocomo, and SP Riley
JW Connelly, JH Gammonley, and TW Keegan
KC Vercauteren, RA Dolbeer, AB Shiels, and EM Gese
TE Fulbright and TA Campbell
JS Horne, LS Mills, JM Scott, KM Strickler, and SA Temple
D Drake and SA Temple
CJ Randel, III, HO Clark, Jr., DP Newman, and TP Dixon
DB Inkley and BA Stein
September 2020 | Volume 14 | Number 3 | e255
Official journal website:
amphibian-reptile-conservation.org
Amphibian & Reptile Conservation
14(3) [Taxonomy Section]: 74-83 (e256).
urn:lsid:zoobank.org:pub:F158FB37-5FE5-48EB-9E01-BDBAECC1DA9C
A new species of Lycodon (Serpentes: Colubridae) from
the Deccan Plateau of India, with notes on the range of
Lycodon travancoricus (Beddome, 1870) and a revised key
to peninsular Indian forms
1S.R. Ganesh, ?Kaushik Deuti, *K.G. Punith, 4N.S. Achyuthan, ‘Ashok Kumar Mallik,
5Omkar Adhikari, and **Gernot Vogel
‘Chennai Snake Park, Rajbhavan post, Chennai 600 022, Tamil Nadu, INDIA *Zoological Survey of India, Herpetology Division, No. 27 JL
Nehru Road, Kolkata 700016, West Bengal, INDIA *We Roar-Wild Animal Emancipation Reptile Oriented Awareness and Rescue, Tumkur 572102,
Karnataka, INDIA *Center for Ecological Sciences, Indian Institute of Science, Bangalore 560012, INDIA *Bombay Natural History Society,
Hornbill House, Opp. Lion Gate, S. B. S. Road, Fort, Mumbai - 400001, INDIA °Society for South East Asian Herpetology, Im Sand-3, Heidelberg,
GERMANY
Abstract.—A new species of wolf snake, Lycodon deccanensis sp. nov., is described from southern India, from
the hill ranges situated in the Deccan Plateau adjacent to the Southern Eastern Ghats and the Mysore uplands.
The new species somewhat resembles, and has previously been confused with, another predominantly wet-
zone taxon Lycodon travancoricus. The new species can be diagnosed by the following combination of
characters: dorsal scale rows 16—17:17:15; usually 9 supralabials; ventrals 181—201; subcaudals 68-74, divided;
an undivided anal scale; loreal in contact with internasal; nasal not in contact with prefrontal, separated by
loreal-internasal contact; supraocular usually contacting prefrontal; preocular usually not contacting frontal;
and a dorsum that is brownish in adults and blackish in juveniles, with white cross bars. Some previous
records of Lycodon travancoricus (sic) from outside the Western Ghats represented the new species, while
others were re-identified as L. aulicus and L. anamallensis, effectively restricting the range of L. tarvancoricus
to the Western Ghats and Southern Eastern Ghats.
Keywords. Coloration, Deccan plateau, Lycodon deccanensis sp. nov., Reptilia, scalation, South Arcot, Tumkur
Citation: Ganesh SR, Deuti K, Punith KG, Achyuthan NS, Mallik AK, Adhikari O, Vogel G. 2020. A new species of Lycodon (Serpentes: Colubridae)
from the Deccan Plateau of India, with notes on the range of Lycodon travancoricus (Beddome, 1870) and a revised key to peninsular Indian forms.
Amphibian & Reptile Conservation 14(3) [Taxonomy Section]: 74-83 (e256).
Copyright: © 2020 Ganesh et al. This is an open access article distributed under the terms of the Creative Commons Attribution License [Attribution
4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction in any
medium, provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced, are
as follows: official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 21 August 2020; Published: 21 September 2020
Introduction and Dinodon Dumeéril and Bibron, 1853. In the Indian
peninsula (the elevated, triangular peninsular shield south
The Colubrid snake genus, Lycodon H. Boie in Schlegel, — of Vindhyas, see Radhakrishna 1993), six species are
1826, is a diverse group of non-venomous, nocturnal — currently known (Whitaker and Captain 2008; Aengals
snakes inhabiting tropical Asia (Wallach et al. 2014; — et al. 2018), namely: Lycodon aulicus (Linnaeus, 1758),
Uetz et al. 2020). In several parts of its vast range, _—_L. striatus (Shaw, 1802), L. anamallensis Giinther, 1864,
which stretches from Trancaspia in the northwest to — L. travancoricus (Beddome, 1870), L. flavomaculatus
Sulawesi in the southeast (Wallach et al. 2014), many = Wall, 1908, and L. flavicollis Mukherjee and Bhupathy,
new species of Lycodon have been described in recent 2007 (Smith 1943; Daniel 2002; Das 2002; Whitaker and
years (Grismer et al. 2014; Wostl et al. 2017; Jassen et = Captain 2008; Ganesh and Vogel 2018).
al. 2019; Vogel and David 2019; Luu et al. 2019, 2020). The taxonomy and distribution of Lycodon species
The generic taxonomy of this group of snakes has been in South Asia still remain incompletely known. Based
in a state of flux, as some authors (Guo et al. 2013; Siler on a phylogenetic study, Pyron et al. (2013) clarified
et al. 2013) have included taxa traditionally (Smith 1943) the affinities and generic allocation of the Sri Lankan
classified under the genera Dryocalamus Ginther, 1858 — species L. carinatus (Kuhl, 1820), which was previously
Correspondence. *Gernot.
[email protected]
Amphib. Reptile Conserv. 74 September 2020 | Volume 14 | Number 3 | e256
Ganesh et al.
regarded as the sole member of the genus Cercaspis.
Ganesh and Vogel (2018) reassessed the taxonomy of
one of the most ‘well-known’ and ‘common’ species,
L. aulicus, and recognized L. anamallensis Ginther,
1864 as valid, with the purportedly Sri Lankan endemic
taxon L. osmanhilli Taylor, 1950 being its synonym. The
distribution of L. mackinnoni Wall, 1906 in Pakistan
was reported by Jablonski et al. (2019). Relating to
this work, L. travancoricus, a species endemic to the
hills of peninsular India, was recently redescribed and
some incorrect identifications that have caused dubious
extralimital localities in places such as Sindh, Pakistan,
were also revealed (Ganesh et al. 2020a).
Within the Indian peninsula, certain geographical
outlier records were known, such as those from near South
Arcot district (Tamil Nadu) and Vizagpatnam (Andhra
Pradesh) in the Eastern Ghats and from Jabbulpore, near
the Seoni Hills of Central India (Smith 1943). These
were in fact historical reports of specimens identified
as L. travancoricus in the collections of Zoological
Survey of India - ZSI (Sclater 1891) and Bombay
Natural History Society Museum - BNHS (Wall 1923).
Recently, there has also been a report of an unidentified
species of wolf snake, represented as Lycodon sp., from
the Southern Eastern Ghats (Ganesh et al. 2018). While
dealing with the catalogue of herpetological specimens
in Salim Ali Centre for Ornithology and Natural History
(SACON) [Ganesh et al. 2020b], a damaged specimen
(SACON/VR-93) of this species was listed as Lycodon
sp. Our examination of the specimens identified as L.
travancoricus from extralimital localities (1.e., outside the
Western Ghats) indicated that these were not conspecific
with ZL. travancoricus. While the specimens reported
from the Northern Eastern Ghats and Central India
represent L. aulicus and L. anamallensis (see below), the
South Arcot specimen represents the undescribed species
reported by Ganesh et al. (2018, 2020b) as Lycodon sp.
A fresh collection of a dead-on-road specimen from the
Bangalore uplands further indicates the conspecificity
of these specimens. This innominate form is herein
described as a new species.
Materials and Methods
A total of nine specimens representing this species,
both preserved and live, were examined for this study,
in addition to 95 specimens representing six regional
congeners (Appendix 1). Seven uncollected specimens
of the new species (four live and three dead), consisting
of three juveniles and four adults, were also considered
and included as referred non-type specimens. For this
study we follow the definitions of the genus Lycodon as
per Smith (1943) and Wickramasinghe et al. (2020), and
we retained standard morphological characters used for
Lycodon (also see Ganesh and Vogel 2018; Ganesh et al.
2020a). The pale bands on the body and tail were counted
on one side, usually the right side when not damaged.
Amphib. Reptile Conserv.
Minimally visible or incomplete bands were counted as one
band; bands that were fused (often forming an “X”’) were
counted as two. Ventral plate counting followed Dowling
(1951), and the subcaudals count exempted the terminal
scale. Measurements, except body and tail lengths, were
taken with a slide-caliper to the nearest 0.1 mm; all body
measurements were made to the nearest millimeter. The
dorsal scale rows were counted at one head length behind
the head, at midbody (1.e., at the level of the ventral plate
corresponding to one-half of the total number of ventrals),
and at one head length before the vent. Half-ventrals were
counted as one. The first scale under the tail meeting its
opposite was regarded as the first subcaudal. The collar
on the neck was not counted, and bands covering the
anal shield were added to the bands of the body. Sex of
preserved specimens was determined by dissection of
the ventral tail base, while that of live individuals was
examined to the extent possible by gentle anal palpation
(also see Ganesh and Vogel 2018). Geographic coordinates
were recorded in situ using a handheld GPS on a WGS-84
map datum, or were sourced from GoogleEarth software,
and are represented in decimal degrees rounded to three
decimal places.
Abbreviations. Avg.: average; SVL: snout to vent length:
Collections. - BMNH: The Natural History Museum,
London, United Kingdom. — BNHS: Bombay Natural
History Society Museum, Mumbai, India. — CAS:
California Academy of Sciences Museum, San Francisco,
California, USA. — CESS: Centre for Ecological Sciences
(Snakes), Bangalore, India. - CSPT/S: Chennai Snake
Park Museum, Chennai, India. - FMNH: Field Museum
of Natural History, Chicago, Illinois, USA. —- NMW:
Naturhistorisches Museum Wien, Vienna, Austria. —
MCZ: Museum of Comparative Zoology, Harvard,
Massachusetts, USA. — MHNG: Muséum d’Histoire
Naturelle, Geneva, Switzerland. - SACON: Salim Ali
Centre for Ornithology and Natural History, Coimbatore,
India. — SMF: Naturmuseum Senckenberg, Frankfurt
am Main, Germany. — UPZM: University of Peradeniya
Zoology Museum, Peradeniya, Sri Lanka. — ZFMK:
Zoologisches Forschungsmuseum Alexander Koenig,
Bonn, Germany. — ZMB: Zoologisches Museum Berlin,
Germany — ZSI: Zoological Survey of India, Kolkata,
India.
Taxonomy
Lycodon deccanensis sp. nov.
Lycodon travancoricus (nec Beddome, 1870) — Sclater
1891 part.
Lycodon sp. — Ganesh et al. (2018, 2020b).
urn:Isid:zoobank.org:act:79E6BFD8-DD3A-4604-A CB2-22BB71B81E76
Holotype: BNHS 3596, coll. K.G. Punith and Ashok
Kumar Mallik in June 2012.
September 2020 | Volume 14 | Number 3 | e256
New Lycodon species from southern India
—— sd >
Fig. 1. Lycodon deccanensis sp. nov. in life: (a) entire, dorsolateral view; (b—d) head profiles of a live uncollected specimen from
Devarayana Durga; (e-f) live uncollected adult and juvenile from Melagiri, showing ontogenic color shift. Photos by K.G. Punith,
MV. Shreeram, and S.R.Ganesh.
Type locality: Devarayana Durga (13.371°N, 77.210°E;
1,060 m asl) in Tumkur district, Karnataka, India.
Paratype: ZSI 13271 from South Arcot district, Tamil
Nadu, India; Mus. Coll. Jaffa (also see Sclater 1891).
Referred specimens (7 = 7): SACON/VR-93, a damaged
specimen from Anaikatti, Coimbatore district, Tamil
Nadu; two uncollected roadkill specimens sighted in
2011 in Bodha Malai, Salem-Namakkal districts, Tamil
Nadu; two live individuals sighted in 2016 in Guthirayan
hills, Krishnagiri district, Tamil Nadu, one live specimen
sighted in Snamavu R.F. Hosur, Tamil Nadu, and one
roadkill sighted in 2017 in Tirupati and Horsley Hills,
Chittoor district, Andhra Pradesh.
Amphib. Reptile Conserv.
Etymology: Toponym, named after its region of
occurrence — the Deccan plateau, a raised table land
of late Cretaceous origin, situated between the Eastern
Ghats and the Western Ghats of the Indian peninsula.
Diagnosis: A species of Lycodon inhabiting the Deccan
plateau of India, characterized by: small size (total
length < 470 mm); scales smooth, in 16—17:17:15 rows,
without apical pits; usually 9 supralabials (10, in one
case); ventrals 181—201 (nm = 9) angulate laterally; anal
plate undivided; subcaudals 68—78 (84; n = 8), paired;
loreal in contact with internasal, separate from eye;
nasal not in contact with prefrontal; anterior pair of
genials subequal to posterior pair; supraocular usually
contacting prefrontal; preocular usually not contacting
September 2020 | Volume 14 | Number 3 | e256
Ganesh et al.
SS i aes
Fig. 2. Lycodon deccanensis sp.
of SACON/VR-93. Photos by K. Deuti and S.R.Ganesh.
frontal (preocular separating frontal, prefrontal, and
supraocular in one case); dorsum brown in adults and
black in juveniles, with white cross bars.
Due to the slender body and smaller head, the
new species superficially resembles the genus
Dryocalamus, its higher midbody scale rows (17)
and lower ventral counts (181-201; avg. 190; n = 9)
[vs. rows 13-15; ventrals 200+ in Dryocalamus, see
Smith 1943] clearly indicate this species belongs to
the genus Lycodon, even if Dryocalamus is regarded
as a valid genus.
Description of the Holotype
Measurements (all in mm): Snout-vent length 212; tail
length: 31+? (tail cut); head length: 8.2; head width: 5.8;
Amphib. Reptile Conserv.
7
= v7 6
sao? y
o>
‘o
7 e Tg
ve
¥.
Cw
e i 7
7
; Se Ma ae ce Eee, SMR Zea ne Fh in a
nov. in preservative: (a—b) entire and head closeup (inset) of Paratype ZSI 13271; (c) entire view
eye-snout distance: 2.6; eye diameter: 1.9; internarial
distance: 2.4; interocular distance: 3.5; mandible-eye
distance: 6.2.
Habitus: Body rather slender and elongate; head slightly
distinct from neck; tail fairly long and tapered; head flat
and depressed, not quite spatulate; posterior temporal
regions not distinctly bulbous and enlarged; ventrolateral
region with a grooved margin; canthus rostralis not well-
defined; snout oblong to rounded in lateral view.
Scalation: Scales smooth, without apical pits; dorsal scale
rows: 16, 17, 15 rostral visible from above, contacting
nasals; supralabials: 9 (3—5 touching eye); infralabials:
9 (1-5 touching anterior genial); ventrals 198 (angulate
laterally); anal plate entire; paired subcaudals 28+? (tail cut).
September 2020 | Volume 14 | Number 3 | e256
New Lycodon species from southern India
Fig. 3. Map showing the type locality and distribution records of Lycodon deccanensis sp. nov. Type locality (Devarayana Durga)
marked with a red dot.
Coloration in life: Dorsum deep brown with 48 white
cross bars on body; cross bars present vertebrally,
not extending to full circumference of body along the
flanks, wider anteriorly and narrower posteriorly, much
thinner and well-spaced anteriorly, thicker and close-
set posteriorly; lateral sides of body with white squared
spots either between two or subsequent to vertebral cross
bars, giving it an overall white-mottled appearance; a
distinctive white wash covering the whole posterior part
of head from postocular, temporal regions encapsulating
until parietal and occipital regions; almost all scales on
head presenting a distinctive white outline, except the
frontal and prefrontal parts that may have white flecks
inside.
Coloration in preservation: After preservation in
alcohol for eight years, dark brownish ground color much
faded in intensity to light creamy brown; contrasting
white barred pattern less evident; eyes cloudy white.
Variation: In agreement with the holotype in most
respects, and showing the following intraspecific
variation (paratype): ventrals 181, subcaudals 72 pairs;
52 white cross bars on body; preocular separating frontal,
prefrontal, and supraocular; measurements in mm: snout-
vent length: 168; tail length: 42.50; head length: 7.18:
head width: 5.19; eye-snout distance: 2.79; eye diameter:
1.55; internarial distance: 2.04; interocular distance:
Amphib. Reptile Conserv.
3.10; inferior eye margin to upper lip margin distance:
0.74; the damaged specimen SACON/VR-93 has parts
of head missing, 188 ventrals, 64 paired subcaudals,
49 white cross bars on body and measurements (mm):
snout-vent length: 280; tail length: 60; body width: 6.35.
The live individuals were very similar to the holotype
in morphology, and show the following variation:
infralabials 10 or 11 on either side; body scales in
17:17:15 rows, all smooth and glossy; ventrals 181-201,
notched laterally; anal plate undivided; subcaudals 68—
78 (84 outlier value) pairs. Adults (total length 360-450
mm) much more brownish; whereas juveniles (< 200
mm) dark coffee-brown to pitch black ground color, on
which the white cross bars appear as usual.
Distribution and natural history. Based on the specimens
observed in situ during fieldwork, this species appears to
inhabit mid- to higher elevations (> 600 m asl), and hilly
forest tracts in the Deccan plateau, such as the taller isolated
peaks in the Eastern Ghats and the Mysore uplands. The
two examined specimens in museum collections (ZSI
and SACON), come from near South Arcot (ca. 11.77°N,
78.75°E; 850 m asl) and Anaikatti (11.092°N, 76.778°E;
670 m asl), respectively. Though the exact place names
given on the jar labels of these specimens furnish coarse-
level geographic data, the places are always associated
with the presence of hills nearby (see Ganesh et al. 2018),
attesting to its affinity for the hills.
September 2020 | Volume 14 | Number 3 | e256
Ganesh et al.
Like most members of the genus, this species is usually
nocturnal, as the four active individuals were sighted at
night during fieldwork. At least the juveniles are semi-
arboreal, and have been seen twice climbing trees and
building walls, similar to the habits of some Lycodon
species and especially Dryocalamus species (Smith 1943).
Potential prey species (pers. obs. in other Lycodon species)
recorded in the vicinity of these snakes are: Cnemaspis
graniticola in Horsley Hills that were sleeping on the same
building wall; and Hemiphyllodactylus jnana in Melagiri
Hills, that were seen on plants near roadsides (also see
Agarwal et al. 2019, 2020).
Regarding the observations on uncollected specimens
seen in situ in August 2011, two juvenile roadkills were
seen 1n Bodha Malai (11.543°N, 78.184°E; 920 m asl),
in the Eastern Ghats (Namakkal district, Tamil Nadu).
The surrounding area was dry evergreen forest, with a
pliable tar road on which the dead snakes were noticed.
Sympatric snakes noted were Rhinophis goweri, Uropeltis
rajendrani, and Naja naja. In June 2016, at 2050 h,
a juvenile was sighted at 1.3 m crawling over tree bark
atop a dry evergreen forest patch in Guthirayan Hills
(12.290°N, 77.837°E; 1,400 m asl) of Melagiris, in the
Amphib. Reptile Conserv.
at)
Fig. 4. Extralimital records re-identified as (a—b) Lycodon anamallensis (BNHS 1602a and b) and (c—e) Lycodon cf. aulicus (BNH
1603 and 1604). Photos by A. Omkar.
Eastern Ghats (Krishnagiri district, Tamil Nadu). After
two days, at 2210 h, an adult was seen on bare ground
bordering a road in the same forest area. This area was
covered with semi-evergreen forests. Sympatric snakes
sighted were Uropeltis cf. ellioti, Trimeresurus gramineus,
Dendrelaphis tristis, Boiga trigonata, B. flaviviridis, and
B. nuchalis (also see Ganesh et al. 2018). In July 2016,
an adult individual was found on the road near Sanamavu
RF (12.665°N, 77.874°E; 800 m asl), Hosur, with a
surrounding habitat similar to the type locality, dominated
by dry forests and eucalyptus plantations. In June 2017, a
juvenile was sighted at 1945 h, crawling at a height of 1.5
m on the walls of an old, abandoned building in Horsley
Hills (13.650°N, 78.393°E; 1,200 m asl), a part of the
Mysore plateau (Chittoor district, Andhra Pradesh). The
vegetation in the vicinity was rather anthropogenically-
modified, with dry evergreen forests intermixed with
eucalyptus plantations. Sympatric snakes sighted were
Lycodon flavicollis, Oligodon taeniolatus, Coelognathus
cf. helena complex, and Bungarus caeruleus (the latter as
roadkill). In September 2017, an adult roadkill Lycodon
deccanensis sp. nov. was found in the Tirupati hills
(13.683°N, 79.357°E; 900 m asl). The surrounding habitat
September 2020 | Volume 14 | Number 3 | e256
New Lycodon species from southern India
Table 1. Identities and morphological features of specimens erroneously reported in the literature as Lycodon travancoricus (sic)
from outside the Western Ghats (Cocanada or Kakinada, Vizagapatnam and Jabbulpore) apart from the paratype of Lycodon
deccanensis Sp. nov.
(here edna Patties Bien ie coma CE auiicus ah Guu Cl
inscotn ee teaton BNHS 1062A BNHS 1062B BNHS 1063 BNHS 1064
Number
Locality Cocanada Cocanada Vizagapatnam, Madras J abbulpore, Central
(=Kakinada) (=Kakinada) Presidency India
Scale rows LSA iS 16:17:15 16:17:16 16:17:16
Supralabials 9/9 9/9 9/10 9/9
Infralabials 10/10 10/11 11/11 11/11
Temporals 10 1] 10 10
Anal scale Divided Divided Divided Divided
Ventrals 195+3 197+3 195+3 194
Subcaudals 67 pairs 59 pairs 66 pairs 58 pairs
Loreal-internasal Contacting Contacting Not contacting Not contacting
Nasal-Prefrontal
Not contacting
Not contacting
Contacting
Contacting
Supraocular-prefrontal Barely touching Barely touching Not contacting Not contacting
Preocular-Frontal Barely touching Barely touching Contacting Contacting
Snout-vent length 402 mm 357 mm 449 mm 310 mm
Tail length 102 mm 74mm 96 mm 62 mm
was dominated by dry and mixed deciduous forests, with
active road traffic.
Comparisons: Here, Lycodon deccanensis sp. nov. 1S
compared with all the known South Asian congeners
(with only the opposing suite of character states listed).
Lycodon aulicus (Linnaeus, 1758): anal plate undivided;
supraocular not contacting prefrontal; preocular usually
not contacting frontal. Lycodon striatus (Shaw, 1802):
anal plate undivided; head not short and rounded; neck
not indistinct; supralabials usually 9; higher ventral count
(154-166 vs. 181—201 in new species); absence of yellow
vertebral spots. Lycodon anamallensis Gunther, 1864:
anal plate undivided; white outlines in scales on top of
posterior head, across parietals; dorsal cross bars white,
never quite yellow; supralabials not distinctly creamy
spotted with brown. Lycodon travancoricus (Beddome,
1870): subcaudals often undivided; loreal in contact with
internasal; nasal not in contact with prefrontal; anterior
genials subequal to posterior pair; supraocular usually
contacting prefrontal; preocular usually not contacting
frontal; Lycodon flavomaculatus Wall, 1908: anal plate
undivided; higher ventral count (165-183 vs. 181—201 in
new species); presence of distinct yellow vertebral spots.
Lycodon flavicollis Mukherjee and Bhupathy, 2007: anal
plate undivided; no distinct yellow collar mark; presence
of white cross bars on dorsum, even in adults.
Identities of Lycodon travancoricus (sic) Records from
Outside the Western Ghats
At least one report of L. travancoricus (sic), from ‘South
Arcot’ (Sclater 1891) is relevant in the description of this
Amphib. Reptile Conserv.
new species, Lycodon deccanensis sp. nov. Therefore,
we also re-examined the specimens that are the basis of
other such reports in the literature (Vizagapatnam and
Jabbulpore: Wall 1923; Cocanada: Underwood 1947).
Based on our re-examination (Fig. 4; Table 1), these
records nowrepresent Lycodoncf. aulicus (Vizagapatnam,
Jabbulpore) and L. anamallensis (Cocanada). Our finding
in turn restricts the distribution range of L. travancoricus
to the Western Ghats (Ashambu to Surat Dangs) and the
Southern Eastern Ghats (Sirumalai, Shevaroys, Kolli,
and Bilgiri Hills).
Discussion
The finding of a new species of Lycodon from the semi-
evergreen belts of the hill ranges constituting the Eastern
Ghats and the Mysore uplands is not that surprising. In a
regional sense, it is in keeping with other recent findings
of new snakes from this region, e.g., Lycodon flavicollis
by Mukherjee and Bhupathy (2007); Boiga flaviviridis by
Vogel and Ganesh (2013); Rhinophis goweri by Aengals
and Ganesh (2013); and Uropeltis rajendrani by Ganesh
and Achyuthan (2020). As had already been highlighted
(Agarwal et al. 2019, 2020; Ganesh et al. 2018), these
hill ranges and elevated plateaus have not yet been
systematically surveyed by herpetologists, especially for
snakes.
This work is essentially an extension of Ganesh et
al. (2020a), in that it further clarifies the supposedly
extralimital records of “LZ. travancoricus” (sic), such
as those for South Arcot (Sclater 1891), Cocanada
(Underwood 1947), and Vizagapatnam and Jabbulpore
(Wall 1923). Apart from this new species representing the
September 2020 | Volume 14 | Number 3 | e256
Ganesh et al.
record of South Arcot, two more species L. anamallensis
and Lycodon cf. aulicus were involved in the records
of Cocanada as well as Vizagaptnam and Jabbulpore,
respectively (see Table 2). The fact that L. anamallensis
represented incorrect records of L. travancoricus (sic),
again supports a similar finding (Ganesh et al. 2020a)
in the Museum of Comparative Zoology, USA. Thus,
based on the outcomes of these studies, the distribution
range of Lycodon travancoricus is here restricted to the
Western Ghats and the Southern Eastern Ghats.
This new species Lycodon deccanensis sp. nov. has
been known to the herpetological community for at least
the past 125 years, since the time of Sclater (1891). That
it was lurking under the wrong name (L. travancoricus)
once again underscores the necessity of ensuring
accurate taxonomy, as well as in reporting geographical
(or morphological) outliers. Further research is
recommended to document the total distribution range,
as well as the natural history and basic biology, of this
new species.
Acknowledgements.—We are grateful to our respective
organizations for encouraging our research activities. We
thank the Karnataka Forest Department for issuing study
permit D/WL/CR-141/2009-10 to Dr. Kartik Shanker’s
Lab (Centre for Ecological Sciences, Indian Institute of
Science, Bangalore, India). This paper is an outcome
of the Open Taxonomy Initiative by Kartik Shanker’s
Lab. The following museum curators are thanked for
access to material under their care: Patrick Campbell
(BMNH), Rahul Khot (BNHS), Robert C. Drewes and
Jens V. Vidum (CAS), Alan Resetar (FMNH), Alain
Dubois and Annemarie Ohler (MNHN), Jose Rosado
and James Hanken (MCZ, USA), Silke Schweiger and
Georg Gassner (NMW), Esther Dondorp, Pim Arntzen,
and Ronald de Ruiter (RMNH), K. Sankar and S. Babu
(SACON), Gunther Kohler and Linda Acker (SMP),
Rupika Rajakaruna (UPZM), George Zug, Kenneth
Tighe, and Ronald Heyer (USNM), Dennis Rédder
and Wolfgang Bohme (ZFMK), Mark-Oliver Rodel
and Frank Tillack (ZMB), and Kailash Chandra (ZSI).
We thank Dr. Ivan Ineich (MNHN, Paris) for his lucid
comments on the submitted manuscript.
Literature Cited
Aengals R, Ganesh SR. 2013. Rhinophis goweri, a new
species of Shieldtail Snake from the southern Eastern
Ghats, India. Russian Journal of Herpetology 20(1):
61-65.
Aengals R, Kumar VMS, Palot MJ, Ganesh SR. 2018. A
Checklist of Reptiles of India. Version 3.0. Zoological
Survey of India, Kolkata, India. 35 p.
Agarwal I, Khandekar A, Giri VB, Ramakrishnan U,
Karanth KP. 2019. The hills are alive with geckos!
A radiation of a dozen species on sky islands
across peninsular India (Squamata: Gekkonidae,
Hemiphyllodactylus) with the description of three
new species. Organisms, Diversity, and Evolution
19(2): 341-361.
Agarwal I, Thackeray T, Pal S, Khandekar A. 2020.
Granite boulders act as deep-time climate refugia: a
Miocene divergent clade of rupicolous Cnemaspis
Strauch, 1887 (Squamata: Gekkonidae) from the
Mysore Plateau, India, with descriptions of three
new species. Journal of Zoological Systematics
and Evolutionary Research. {In press]. https://doi.
org/10.1111/jzs.12391
Daniel JC. 2002. The Book of Indian Reptiles and
Amphibians. Oxford Books, Oxford, United Kingdom
and Bombay Natural History Society, Mumbai, India.
238 p.
Das I. 2002. A Photographic Guide to Snakes and other
Reptiles of India. New Holland, London, United
Kingdom. 144 p.
Dowling HG. 1951. A proposed standard system of
counting ventrals in snakes. British Journal of
Herpetology 1: 97-99.
Ganesh SR, Vogel G. 2018. Taxonomic reassessment of
the Common Indian Wolf Snakes Lycodon aulicus
(Linnaeus, 1758) complex (Squamata: Serpentes:
Colubridae). Bonn Zoological Bulletin 67(1): 25-36.
Revised key to South Asian Lycodon species (modified from Ganesh and Vogel 2018)
lamisodyesc ales=StrOnelyakce leat Rie Mens Mal Orr i Ae OU re ices ab el eit Me ten Rl APE We, ae rn L. carinatus
PPLBOGY. SCALES: NOLSILONS IYER ES ICG oxo 2 22 IS sald aR ns Sa sh RE gM MONS dec RNa LS sats Da ee ee I UNE 2
Da PX TiC DLAC CMU eyes tes «sce inl SA Fa VS got wes RN RIN A 2 sc Neel A eS 2 INCOM SI Gh sem Mage ON 8 coca hn 3
DD eNMale Ales CIVICS te Mt cna. na sahe aeetey eines. Ll A cima ie neat le San A cine cms ty hakade Mine Seen AN culate 4
3a. Loreal not contacting internasal; nasal contacting prefrontal... 0000000000 ccc eeeceee ees L. travancoricus
3b. Loreal contacting internasal; nasal not contacting prefrontal.........0000000 eee L. deccanensis sp. nov.
4a, “Ventrals-< 22005 ibody-amore:. black than: Drowiti sa: sc'.0k WZ ol seul al Ween th enn gs he wee SURE as toile eae elas a en arateiae 5
ap AVeitial ses "200" body more: blow Chal DAC 4.3% 05h 27, ee Sey, ee Se 9a RET, STAD a AGT, Se ce ea 6
5a. Usually 8 supralabials, reticulations white or with yellow mid-spots........0000.0.000ccccccececeeeeeeeeeees L. striatus
5b. Usually 9 supralabials, reticulations always yellOW..........00000ccccc cece cc cccceecesectseeteceseteeeenees L. flavomaculatus
6a. Yellow collar always present, no other pattern, ventrals not angulate laterally... L. flavicollis
6b. Collar present or absent, body uniform or banded, ventrals angulate laterally......00000000 eee 7
7a. Collar present, touching the parietals, converging towards snout tip... ccc eeeeees L. aulicus
7b. Collar absent, first band far away from parietals, converging towards tail..........000000000.. L. anamallensis
Amphib. Reptile Conserv. 81 September 2020 | Volume 14 | Number 3 | e256
New Lycodon species from southern India
Ganesh SR, Kalaimani A, Karthik P, Baskaran N,
Nagarajan R, Chandramouli SR. 2018. Herpetofauna
of Southern Eastern Ghats, India—II; from Western
Ghats to Coromandel Coast. Asian Journal of
Conservation Biology 7(1): 28-45.
Ganesh SR, Amarasinghe AAT, Vogel G. 2020a.
Redescription of Lycodon travancoricus (Beddome,
1870) (Reptilia: Colubridae), an Indian endemic snake,
with a review of its geographic range. Zaprobanica
9(1): 50-58.
Ganesh SR, Bhupathy S, Karthik P, Rao GB, Babu S. 2020b.
Catalogue of herpetological specimens at the Salim
Ali Centre for Ornithology and Natural History, India.
Journal of Threatened Taxa 12(9): 16,123—16,135.
Ganesh SR, Achyuthan NS. 2020. A new species of
Shieldtail Snake (Reptilia: Squamata: Uropeltidae)
from Kolli Hill complex, southern Eastern Ghats,
peninsular India. Journal of Threatened Taxa 12(4):
15,436-15,442.
Grismer LL, Quah ES, Anuar S, Muin MA, Wood Jr
PL, Nor S. 2014. A diminutive new species of cave-
dwelling Wolf Snake (Colubridae: Lycodon Boie,
1826) from Peninsular Malaysia. Zootaxa 3815(1):
51-67.
Guo P, Zhang L, Liu Q, Li C, Pyron RA, Jiang K,
Burbrink FT. 2013. Lycodon and Dinodon: one genus
or two? Evidence from molecular phylogenetics and
morphological comparisons. Molecular Phylogenetics
and Evolution 68(1): 144-149.
Jablonski D, Masroor R, Khan MA, Altaf M. 2019.
Addition to the snake fauna of Pakistan: Mackinnon’s
Wolf Snake, Lycodon mackinnoni Wall, 1906.
Herpetological Bulletin 147. 21-23.
Janssen HY, Pham CT, Ngo HT, Le MD, Nguyen TQ,
Ziegler T. 2019. A new species of Lycodon Boie,
1826 (Serpentes, Colubridae) from northern Vietnam.
ZooKeys 875: 1-29.
Luu VQ, Ziegler T, Ha NV, Le MD, Hoang TT. 2019.
A new species of Lycodon Boie, 1826 (Serpentes:
Colubridae) from Thanh Hoa Province, Vietnam.
Zootaxa 4586(2): 261-277.
Luu VQ, Bonkowski M, Nguyen TQ, Le MD, Calame T,
Ziegler T. 2020. A new species of Lycodon Boie, 1826
Megophrys, and Uperodon.
Amphib. Reptile Conserv.
(Serpentes: Colubridae) from central Laos. Revue
Suisse de Zoologie 125(2): 263-276.
Radhakrishna BP. 1993. Neogene uplift and geomorphic
rejuvenation of the Indian Peninsula. Current Science
64: 787-793.
Sclater WL. 1891. List of Snakes in the Indian Museum.
Printed by the order of the Trustees of the Indian
Museum, Calcutta, British India. 79 p.
Siler CD, Oliveros CH, Santanen A, Brown RM.
2013. Multilocus phylogeny reveals unexpected
diversification patterns in Asian Wolf Snakes (genus
Lycodon). Zoologica Scripta 42(3): 262-277.
Vogel G, David P. 2019. A new species of the Lycodon
fasciatus complex from the Khorat Plateau, eastern
Thailand (Reptiles, Squamata, Colubridae). Zootaxa
4577(3): 515-528.
Vogel G, Ganesh SR. 2013. A new species of Cat Snake
(Reptilia: Serpentes: Colubridae: Boiga) from dry
forests of eastern Peninsular India. Zootaxa 3637(2):
158-168.
Uetz P, Hallermann J, Hosek J. (Editors). 2020. The
Reptile Database. Available: http://reptile-database.
reptarium.cz/ [Accessed: | June 2020].
Underwood G. 1947. Reptiles of Cocanada. Journal of
the Bombay Natural History Society 46: 613-628.
Wall F. 1923. A hand-list of the snakes of the Indian
Empire. Journal of the Bombay Natural History
Society 29(2): 345-361.
Wallach V, Williams KL, Boundy J. 2014. Snakes of the
World: a Catalogue of Living and Extinct Species.
CRC Press, Boca Raton, Florida, USA. 1,237 p.
Whitaker R, Captain A. 2008. Snakes of India — the Field
Guide. Draco Books, Chengalpat, India. 387 p.
Wickramasinghe LM, Vidanapathirana DR, Pushpamal
V, Wickramasinghe N. 2020. A new species of
Dryocalamus (Serpentes: Colubridae) endemic to
the rainforests of southwestern Sri Lanka. Zootaxa
4748(2): 248-260.
Wostl E, Hamidy A, Kurniawa N, Smith EN. 2017. A new
species of Wolf Snake of the genus Lycodon H. Boie
in Fitzinger (Squamata: Colubridae) from the Aceh
Province of northern Sumatra, Indonesia. Zootaxa
4276(4): 539-553.
S.R. Ganesh earned a doctorate specializing in wildlife biology from the University of Madras, in India, and is
now working as Deputy Director and Scientist at the Chennai Snake Park, conducting research on the reptiles
and amphibians of southern India. His research themes include documenting the diversity of under-explored
ecoregions, updating and refining species characterizations, and elucidating modern-day distribution patterns
with respect to southern India’s herpetofauna.
Kaushik Deuti is a scientist in the Herpetology Division of the Zoological Survey of India, Kolkata, India.
He has been working on morpho-taxonomy, ecology, biogeography, and altitudinal distribution of Indian
skinks, agamids, snakes, and frogs for the past 20 years. He has participated in describing two new species
of Cnemaspis and one new species of Eutropis in addition to new frog species of the genera Minervarya,
September 2020 | Volume 14 | Number 3 | e256
Ganesh et al.
K.G. Punith is a business management student who runs the non-governmental organization WEROAR
(Wild Animal Emancipation Reptile Oriented Awareness and Rescue). The organization is creating awareness
about nature conservation among the Tumkuru (Karnataka, India) public and is also working towards the
mitigation of human-wild animal conflicts in the same area.
N.S. Achyuthan is a research associate and curator of the collections of reptiles at Dr. Kartik Shanker’s Lab
in the Centre for Ecological Sciences, Indian Institute of Sciences, Bengaluru, India. He works on squamate
scale evolution, and the systematics and taxonomy of Indian snakes and lizards.
Ashok Kumar Mallik received his doctorate degree in 2018 from the Centre for Ecological Sciences, India
Institute of Science, Bangalore, India. His research interests include the systematics, taxonomy, hybrid zones
and speciation, population genomics, and evolutionary ecology of reptiles and amphibians. Ashok is now
working on the systematics and biogeography of a few genera of colubrid and viperine snakes in Peninsular
India.
Omkar Adhikari is a herpetologist who earned his B.Sc. and M.Sc. degrees in Zoology from the University
of Mumbai, India. Omkar is highly fascinated by the herpetological specimens housed in the Bombay Natural
History Society (BNHS) Museum, Mumbai, and research articles published in the BNHS journal, especially
those linked to herpetology. He is interested in the systematics, taxonomy, life history evolution, diversity,
ecology, and biogeography of the reptiles and amphibians found in India and Southeast Asia. At present,
he works as a Junior Research Fellow at the BNHS museum, where he is involved in the digitization and
maintenance of the natural history collections.
Gernot Vogel was born in Heidelberg, Germany, obtained his Ph.D. in Chemistry, and is now working as a
chemist. Beginning as a reptile keeper, Gernot developed a great interest in the snake fauna of the Orient. His
special interest lies in the systematics of snake genera with large distribution areas, such as 7rimeresurus,
Boiga, Oligodon, Lycodon, Pareas, Dendrelaphis, and others, with a primary geographical emphasis on
China, India, and Indonesia.
Appendix 1. List of comparative material examined.
Lycodon travancoricus: INDIA: BMNH 1946.1.13.75 (Syntype) Travancore, Attraymallay; CAS 15967, Ernakulam, Cochin
State; ZSI 13695, ZSI 13696, Piermed (3,500 ft), Travancore, South India; ZSI 13396, Coonoor, Nilgiris; ZSI 17693, ‘India,’ no
locality, FMNH 217705, Ponmudi, Trevandrum district, Kerala; ZSI 13694 and ZSI 13698; ZSI 13531, Koppa, Mysore; SACON/
VR-97 Meghamalai, Theni district, Tamil Nadu; BNHS 1061 Tinnevelly [= Tirunelveli district], Tamil Nadu; BNHS 1067, 1068,
1069, 1070 all from Matheran, Bombay Presidency; BNHS 1071 Mahabaleshwar, Western Ghats; BNHS 1072 Paralai, Valparai,
Anamalai Hills; BNHS 2738 Shevaroy Hills, Madras Presidency; BNHS 2739 Khanapur, Belgaum district, Mysore State; BNHS
2740 Gersoppa Falls, Mysore State.
Lycodon anamallensis: INDIA: BMNH 1946.1.14.92 (Holotype), Anamallays; BMNH 1904.10.18.2, Cannanore, Malabar, south
India; BMNH 1904.10.18.4, Cannanore, Malabar, South India; CSPT/ S-28b, Madras; BMNH 1904.10.18.3 Cannanore, Malabar,
Kerala; BMNH no number, Madras; BMNH 1924.10.13.7, Mundakayan, Trawancore, Kerala; CSPT/S-28a, Madras; NMW 21707
Malabar; MCZ R2232 Pondicheri; SRI LANKA: FMNH 25927, from Colombo; MHNG 1198.70 Sri Lanka, no locality; ZFMK
32253, Sri Lanka, no locality, UPZM-17a and b, Peradeniya Kandy; MHNG 744.7, Ceylon [= Sri Lanka], no locality, NMW
21689.4, Ceylon [= Sri Lanka].
Lycodon striatus: INDIA: BNHS 1083 Nilambur, Malabar; BNHS 1084, 1085 Madras; BNHS 1086 Secunderabad, Hyderabad;
SACON/VR-96 Chinnamannur, Theni district, Tamil Nadu; SRI LANKA: ZFMK 52511, Kitulgala; ZFMK 52137, Kitulgala;
ZFMK 52510, ‘Sri Lanka,’ no locality.
Lycodon aulicus. MYANMAR: NMW 21699.1, Bhamo; CAS 215387, Sagaing; CAS 205000, DNA tested, Rakhin; CAS
245960, Tanintharyi; CAS 219800, Ayeyarwadi; NMW 14483, no locality; ZMB 11625, no locality, NMW 21702.2, Pegu; ZMB
10258, Minhla; BMNH 1928.1.4.1, Rangun; NEPAL: FMNH 62427, Tansing; BMNH 1936.7.2.2, Mae District, Doons; BMNH
80.11.10.138, ‘Nepal’ no locality; BMNH 1984.1216, Royal Chitwan; FMNH 83090, Kathmandu; PAKISTAN: SMF 64484,
Lahore, W-Pakistan; INDIA: BMNH 1908.5.23.15, Diburgash, Assam; FMNH 165108, Junganathpur, West Bengal; FMNH
8650, Central province near Chanda; FMNH 60647, Central province, Balaghat dist; BMNH 82.8.26.22, Kinelly (~Kimdey) hills,
[Andhra Pradesh]; BMNH 74.4.29.958, Wynads, [Kerala]; ZMB 1790, Bengal; BMNH 1904.10.18.5, Cannannore, Malabar; NMW
37406:1, Ahmednagar, Maharashtra, NMW 37406:2, Ahmednagar, Maharashtra; CAS-SU 12263 Bisrampur, Madhya Pradesh;
FMNH 165107 West Bengal, Howrah Dist.; FMNH 161469 West Bengal, Barnijunoh; NMW 14487.1 ‘Alakan;’ ZMB 1791 Bengal;
ZMB 9956 Ajmere, Rhajasthan; ZMB 1806 Calcutta, NMVW 14488 Kolkata; BMNH 1921.6.15.3 Bangalore, Karnataka; SMF
32463 Agra; ZMB 1791 Bengal; BMNH 1955.1.3.11 Mysore, 3,500 ft, Karnataka; BMNH 1936.1.3.4 Namakal, Tamil Nadu;
BMNH 1924.10.13.9 Punakanaat, 700 ft, Travancore, Kerala; BMNH 69.8.28.94 Matheran, Maharashtra, MCZ R3877, R4783
Madras; SRI LANKA: FMNH 123906, Ceylon, no locality; ZFMK 52137, Kitulgala; ZFMK 52511, Kitulgala; NMUW 21689:5-7,
no locality, NMW 14487:2-3, no locality, FMNH 123907 Ceylon, Trincomalee; ZFMK 52510 Sri Lanka, no locality, NMW
21689:1—3 Sri Lanka, no locality, NMW 14487:1 Sri Lanka; INDIAN OCEAN ISLANDS: ZFMK 29976, Mauritius; ZMB 8158
Ile Bourbon [=La Réunion]; ZFMK 21766 Mascarenes, Reunion, Manapany; ZFMK 29977 Mauritius.
Amphib. Reptile Conserv. 83 September 2020 | Volume 14 | Number 3 | e256
Official journal website:
amphibian-reptile-conservation.org
Amphibian & Reptile Conservation
14(3) [General Section]: 84-85 (e257).
Book Review
The Dangerous Snakes of Africa
Howard O. Clark, Jr.
Colibri Ecological Consulting, LLC, 9493 North Fort Washington Road, Suite 108, Fresno, California 93730, USA
Keywords. Adder, antivenom, asp, boomslang, cobra, colubrid, elapid, mamba, python, snakebite, venom, viper
Citation: Clark HO Jr. 2020. Book review—The Dangerous Snakes of Africa. Amphibian & Reptile Conservation 14(3) [General Section]: 84-85
(e257).
Copyright: © 2020 Clark. This is an open access article distributed under the terms of the Creative Commons Attribution License [Attribution 4.0
International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction in any medium,
provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced, are as follows:
Official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 21 September 2020; Published: 22 September 2020
Authors Stephen Spawls and the late Bill Branch
(1946-2018; see Conradie et al. 2019) have produced a
pivotal book, The Dangerous Snakes of Africa (Fig. 1).
Worldwide, snakebite affects an estimated 4.5 million
people annually, claiming 125,000 human lives. In Africa
alone, it is estimated that between 80,000 and 420,000
people are bitten each year, resulting in anywhere
between 3,500 and 30,000 fatalities. Impacts from snake
bites are significant medical issues that need attention.
The Dangerous Snakes of Africa is a step forward in
addressing the need.
Following a field guide format, the book covers 137
dangerous snakes (both venomous and nonvenomous) as
well as another 70 species that can be mistaken as dangerous
(see Clark 2012). The Introduction is a must read; it
provides the background information needed to fully
appreciate the book. The Introduction is divided into five
sections: (1) Africa’s snakes: which ones are dangerous?,
(2) Where are the dangerous snakes in Africa?, (3) Using
the maps in this book, (4) A note on conservation, and
(5) Identifying a snake. Section 5 is particularly pertinent
because it provides the reader with the tools needed to
distinguish snakes from other reptiles. Included are
diagrams showing head scales from various views, how
to tell keeled and unkeeled scales apart, how to tell snake
tail cloacal and subcaudal scales apart, and how to count
the dorsal scale rows of a snake. Another important part
of the introduction is identification strategies for living
snakes that may quickly disappear. Often, observers only
have a few seconds to view a snake and identification may
be difficult. Key points to record include an estimate of
the snake’s size, shape, and appearance; take careful note
of the color and distinctive markings or patterns; note its
thickness (pencil vs. broomstick, or larger); and behavior
—was it on the ground, in a tree, did it move quickly or
slowly, hiss or strike? If a dead snake is encountered, then
Amphib. Reptile Conserv.
84
THE DANGEROUS
SNAKES
wae
Fig. 1. The Dangerous Snakes of Africa. Authors: Stephen
Spawls and Bill Branch. Princeton University Press, Princeton,
New Jersey, USA. Published 4 August 2020.
Paperback | Price:US $35.00 / £30.00 | ISBN:978069 1207926
Pages: 336 | Size: 5.25 x 8.5 in. | Illus: 650+ color photographs
and maps.
identification may be easier—but make sure the snake
is actually dead before handling it, as some dangerous
snakes may feign death defensively! For example, turn
the snake on its back—f it flips back over, it’s not dead.
Look for rhythmic waves along the body or if the tail coils
and uncoils. If any of these movements are observed,
then the snake may be fatally injured but it is not safe
to handle. After making sure the snake is dead, various
measurements and diagnostics can be taken to aid in
identification.
September 2020 | Volume 14 | Number 3 | e257
Clark
The bulk of the book consists of the species
accounts. The accounts are separated into two groups:
(1) dangerous front-fanged snakes (130+ species) and
(2) dangerous rear-ranged and fangless snakes (17
species). Each account contains four to five sections:
Identification, Habitat and Distribution, Natural History,
Medical Significance, and sometimes Taxonomic Notes.
Each account is accompanied by several color photos
of the snake and a range map. The accounts are 1—2
pages long, written without technical jargon, and easy to
read. Scattered throughout the accounts are keys to help
identify various species within one genus, especially if a
particular genus has several species that are difficult to
tell apart. Special care was taken to make the Medical
Significance section as complete and as up to date as
possible. Information covered includes the type of
venom (cytotoxic, haemorrhagic, neurotoxic, etc.),
if antivenom is needed (or if even available), bite and
venom symptoms, bite behavior (frequent “dry” bites,
aggressiveness, etc.), and other important information
that may help when treating bite victims.
The 17 species covered in the “dangerous rear-ranged
and fangless snakes” section fall within a few groups
based on the dangers they pose, rather than taxonomic
groups. These include the pythons which are powerful
enough to kill humans, rear-fanged snakes that have
been known to kill people (mainly snake handlers), and
fangless snakes whose bites are dangerous due to their
toxic saliva. The accounts follow the same format as in
the “dangerous front-fanged snakes” section.
Following the two dangerous snake sections is a
“look-alikes and common species” section. The 70 or
so species featured in this section do not have species
accounts, rather, a brief description is provided along
with a list of similar-looking dangerous species and a few
photos. These short write-ups also include distinctive
characteristics that the look-alike species have that the
dangerous species may lack (but not always, hence the
confusion).
Following the look-alike and common species section
is an essay entitled, “Snakebite in Africa: the big picture.”
Here, the authors discuss various public health issues
related to snakebite, such as pharmaceutical companies
and their decisions on whether to make antivenom or not,
African healthcare, and the apparent randomness of snake
bites. In addition, the authors compare Australia with Africa
in regard to snake bites. Australia has more species of
venomous snakes than harmless ones, and yet the number of
snake bites is relatively small. Most Australians are affluent
and medically snake aware. They are able to adequately
seal their houses against snakes, wear strong footwear when
entering wild areas, and farming practices are mechanized.
The situation in Africa is much different—the population is
poorer, not as well informed, and measures for protection
from snakes are not as great. The authors explore some
solutions to address the situation, such as improving living
standards, increasing snake bite awareness, creating a
network of clinics, and increasing regional cooperation.
Amphib. Reptile Conserv.
85
Much work still needs to be done on these fronts.
Additional sections in the book include tips for
avoiding snakebite (both in the home and outside in the
field), who is at risk (when and where), what happens
when a snake bites and how bad will it be, an incredibly
important section on snakebite first aid (do’s and don’ts),
and treatment of snakebite at medical centers. There is
also a brief section on eye and face first aid for spitting
snakes. The authors go into great detail about antivenom,
such as syndromes of envenoming, when antivenom
should be used, administration of antivenom, and use of
antivenom by a lay person.
The book concludes with several valuable appendices:
current producers of snakebite antivenoms useful for
Africa; important references, forums, and websites; and
a checklist of dangerous snakes from the regions and
countries of Africa. A list of medical and snakebite terms,
a glossary, and an index are also included.
Although snakes are often feared, and a first response
when seeing a snake—dangerous or not—is to kill it,
snakes have benefits. Their venoms are pharmaceutically
important for drug research and advancements. Snakes
benefit humans indirectly as important members of the
global fauna and have their place in food webs and
landscape ecology. The authors argue that snake threats
must be taken in context. A cobra on school grounds may
obviously need to be dealt with, but a snake crossing a road
in a wildlife refuge can be appreciated without the need
to interact. To determine if an African snake is potentially
dangerous—use this book! Use your best judgement and
don’t unnecessarily handle or otherwise disturb snakes.
Snakes tend to avoid humans and make efforts to avoid
detection. In conservation terms, snakes are not actually
threatened by direct killing or by commercial collection.
The biggest threats are habitat destruction and conversion
to large-scale farms and logging operations. Many of
the African snakes covered in this book occur in small
patches of habitat and these remaining refuges are being
threatened daily by human encroachment. If Africa’s
herpetofauna is to survive, habitat conservation needs
to be a mainstream goal and local human populations
need to understand that these reserves are beneficial in
a practical or aesthetic way. We have a long way to go
in achieving a balance between human appreciation of
nature and recognizing when herpetofauna actually pose
a real threat. The Dangerous Snakes of Africa is a first
step toward approaching this balance.
Literature Cited
Clark HO Jr. 2012. Rattlesnake mimicry in the Pacific
Gopher Snake (Pituophis catenifer catenifer).
Sonoran Herpetologist 25(8): 78.
Conradie W, Grieneisen ML, Hassapakis CL (Editors).
2019. Compilation of personal tributes to William Roy
Branch (1946-2018): a loving husband and father,
a good friend, and a mentor. Amphibian & Reptile
Conservation 13(2) [Special Section]: 1-xxix (e186).
September 2020 | Volume 14 | Number 3 | e257
Official journal website:
amphibian-reptile-conservation.org
Amphibian & Reptile Conservation
14(3) [Taxonomy Section]: 86-102 (e258).
urn:lsid:zoobank.org:pub:614BD845-B778-42C8-A291-3E87B19B1224
A new species of /antilla of the taeniata group (Squamata:
Colubridae) from Refugio de Vida Silvestre Barras de Cuero y
Salado in Caribbean coastal Honduras
'4Cristopher A. Antunez-Fonseca, ‘Jocelyn A. Castro, 7Farlem G. Espana,
34Josiah H. Townsend, and ***Larry D. Wilson
‘Departamento de Biologia, Universidad Nacional Autonoma de Honduras en el Valle de Sula, San Pedro Sula, Cortés, HONDURAS ?Mesoamerican
Development Institute, University of Massachusetts, 1 University Avenue, Lowell, Massachusetts 01854, USA and Yoro, HONDURAS *Department
of Biology, Indiana University of Pennsylvania, Indiana, Pennsylvania 15705 USA *Centro Zamorano de Biodiversidad, Escuela Agricola
Panamericana Zamorano, Francisco Morazan, HONDURAS °1350 Pelican Court, Homestead, Florida 33035-1031 USA
Abstract.—A new species of Tantilla is described from the Refugio de Vida Silvestre Barras de Cuero y Salado
(RVSBCS), on the Caribbean coast of Honduras. Assigned to the Tantilla taeniata group, this species differs
from others in this group in color pattern, numbers of scales, measurements, and habitat. An incomplete pale
nuchal collar and a pale mediodorsal stripe extending to the proximal edge of the paravertebral rows on the
anterior third of the body are present. The lateral extension of the head cap does not completely separate the
postocular pale spot from the pale nuchal collar. A pale lateral stripe is present on the adjacent halves of dorsal
scale rows 3 and 4. The ventrolateral ground color is much darker than that of the dorsolateral ground color.
The ventral + subcaudal number of 244 is the highest figure for the males of species in the group. The RVSBCS
is an important coastal protected area in Mesoamerica, due to its significant coastal diversity, including iconic
species, in addition to harboring this centipede snake.
Keywords. Centipede snake, Departamento de Atlantida, protected area, Reptilia, Rio Salado, taxonomy
Resumen.—Describimos una nueva especie de Tantilla del Refugio de Vida Silvestre Barras de Cuero y Salado
(RVSBCS), en la costa caribena de Honduras. Asignada al grupo Tantilla taeniata, esta especie difiere de
otras en este grupo en cuanto a patron de color, numero de escamas, medidas y habitat. Estan presentes un
collar nucal palido incompleto y una franja mediodorsal palida que se extiende hasta el borde proximal de las
filas paravertebrales en el tercio anterior del cuerpo. La extension lateral de la tapa de la cabeza no separa
completamente la mancha palida postocular del collar nucal palido. Una franja lateral palida esta presente en
las mitades adyacentes de las filas de escamas dorsales 3 y 4. El color de fondo ventrolateral es mucho mas
oscuro que el color de fondo dorsolateral. El numero ventral + subcaudal de 244 es la cifra mas alta para los
machos de las especies del grupo. El RVSBCS es una importante area costera protegida en Mesoamerica, ya
que tiene una importante diversidad costera, incluidas especies iconicas, ademas de albergar a esta serpiente
tragaciempieés.
Palabras Claves. Area protegida, Departamento de Atlantida, Reptilia, Rio Salado, serpiente ciempiés, taxonomia
Citation: Antunez-Fonseca CA, Castro JA, Espafia FG, Townsend JH, Wilson LD. 2020. A new species of Tantilla of the taeniata group (Squamata:
Colubridae) from Refugio de Vida Silvestre Barras de Cuero y Salado in Caribbean coastal Honduras. Amphibian & Reptile Conservation 14(3)
[Taxonomy Section]: 86—102 (e258).
Copyright: © 2020 Antunez-Fonseca et al. This is an open access article distributed under the terms of the Creative Commons Attribution License
[Attribution 4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction
in any medium, provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced,
are as follows: official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 26 August 2020; Published: 28 September 2020
Introduction Collectively, members of this genus are distributed from
portions of many US states (Virginia, Indiana, Illinois,
The colubrid genus Zantilla currently consists of 66 Missouri, Nebraska, Kansas, Colorado, Utah, Nevada,
species (Wilson 1982; Wilson and Mata-Silva 2015; and California), southward through the peninsula of
Batista et al. 2016; Koch and Venegas 2016; Hofmann — Baja California, most of mainland Mexico, throughout
et al. 2017; McCranie and Smith 2017; Uetz et al. 2020). Central America, and into South America (as far south
Correspondence.
[email protected] and
[email protected] (CAAF),
[email protected] and jocelynlainez29@
gmail.com (JAC), fespana@mesoamerican. org and
[email protected] (FGE),
[email protected] (JHT), *
[email protected] (LDW)
Amphib. Reptile Conserv. 86 September 2020 | Volume 14 | Number 3 | e258
Antunez-Fonseca et al.
as southern Peru, Bolivia, northern Argentina, and
Uruguay). This genus also occurs on Isla del Carmen in
the Gulf of California, the Tres Marias Islands off the
Pacific coast of mainland Mexico, Isla Cozumel off the
coast of the Yucatan Peninsula, the Bay Islands off the
northern coast of Honduras, and Trinidad and Tobago in
the British West Indies (Wilson 1999: 26). Due in part
to their cyptozoic nature, relatively few specimens of
many of the 66 described species have been collected,
and 13 are known thus far only from their respective
holotypes (Wilson and Mata-Silva 2015; Batista et al.
2016; Hofmann et al. 2017; McCranie and Smith 2017).
Wilson (1999) divided the genus JZantilla into
five phenetic groups: 7. calamarina, T. coronata, T:
melanocephala, T: planiceps, and T: taeniata. These
groups collectively contained 37 of the 53 species
(69.8%) included in the genus at the time that paper was
written. As noted by Wilson and Mata-Silva (2015: 451),
“Wilson and Mata-Silva (2014) suggested that [7antilla
rubra| could be one of three (including 7 bocourti and
7! cucullata...) that might comprise a so-called rubra
group” and that “Dixon et al. (2000) provided partial
support for this hypothesis, by indicating that 7’ cucullata
presumably is the sister taxon of [7 rubra].” Eleven of
the 13 species described or resurrected from synonymy
subsequent to Wilson (1999) have been allocated to
the calamarina group (T. ceboruca, T. sertula), the
melanocephala group (T. armillata, T. boipiranga, T.
ruficeps), or the taeniata group (7: excelsa, T: gottei, T.
hendersoni, T: olympia, T. psittaca, T. stenigrammi). Two
additional species described after Wilson (1999) have
not been allocated to a phenetic group, 1.e., 7’ robusta
(Canseco-Marquez et al. 2002) and 7. Giasmantoi (Koch
and Venegas 2016); the latter species, however, appears
to resemble 7. semicincta (Wilson 1976), in that both
species have a pattern of dark transverse bands. Holm
(2008) allocated 7: alticola, T: bairdi, T: moesta, T.
schistosa, and T: semicincta to the taeniata group and 7:
petersi to the melanocephala group. However, that work
remains unpublished; therefore, its conclusions have not
been subjected to peer review so they are considered
as unsubstantiated and not followed here. Holm (2008)
also noted that 7’ albiceps, T: nigra, T. shawi, and T.
supracincta have many unique character states making
them difficult to allocate to a species group; and we
agree with this statement for the reasons indicated. This
statement also seems applicable to 7’ robusta, although
Canseco-Marquez et al. (2002) remarked that this species
resembles 7 schistosa in color pattern. This species also
can be noted to resemble 7: a/ticola in the same way.
Initially, Wilson and Meyer (1971) divided the Tantilla
taeniata group into six species, distributed geographically
from Oaxaca in Mexico to northwestern Colombia. This
is currently the largest group in the genus, including 25
described species (Smith and Williams 1966; Wilson
1983; McCranie 2011b; Townsend et al. 2013; Batista et
al. 2016; McCranie and Smith 2017), which comprises
Amphib. Reptile Conserv.
37.9% of the 66 species now recognized (The Reptile
Database, accessed 13 May 2020). As noted in the
recent revision of McCranie and Smith (2017: 338), “the
Tantilla taeniata group members are characterized by the
possession of dark dorsal surfaces with pale middorsal
and lateral stripes, and by having a pale nuchal collar.
Those stripes are occasionally reduced to dashes or
dots in a few species, and the nuchal collar is complete,
incomplete, or reduced in a few species.”
In May 2018, a distinctively patterned 7antilla was
collected from a coastal locality within the boundaries
of Refugio de Vida Silvestre Barras de Cuero y Salado
(RVSBCS) in Honduras. The specimen exhibits the
general characteristics of coloration used to define
members of the Zantilla taeniata group, but it also
exhibits clear diagnostic differences from all nominal
Species in terms of coloration, features of scutellation,
measurements, and habitat. Efforts to collect additional
specimens of 7antilla from RVSBCS (in September 2018,
November 2018, and May 2019) were unsuccessful, but
we consider the characteristics of the single specimen
to be sufficiently distinctive to warrant recognition as a
distinct species, which is described herein.
Materials and Methods
The description of the holotype follows those in
Campbell (1998), McCranie (2011b), Townsend et al.
(2013), and McCranie and Smith (2017). Morphological
measurements were made with an analogue caliper
Mitutoyo +0.02 mm series (No. 51490093) and an
LW Scientific DM Series Stereoscopic Microscope. A
considerable amount of time was spent examining the
shapes, sizes, and proportions of the scales of the head
following Savage (1973), and determining the numbers of
ventral, dorsal, and subcaudal scales following Dowling
(1951). The following measurements were recorded:
total length (TOL); snout-vent length (SVL), taken from
the tip of the rostral to the posterior edge of the cloacal
scute; tail length (TAL), taken from the posterior edge of
the cloacal scute to the tip of the tail; head length (HL),
taken from the tip of the rostral to the posterior end of the
upper jaw; and head width (HW), taken at the widest part
of the head. The lengths and widths of some head scales
were measured to provide a more detailed description of
the specimen.
The color pattern of the holotype in life is described
based on digital photographs taken with a Canon Rebel
T3 Camera, as well as the pattern after the specimen was
preserved in alcohol, following Campbell (1998). The
letter codes of the colors in parentheses below are based
on Kohler (2012). The patterns and types of colors and
morphological measurements (including numbers and
shapes of the scales), are compared between the specimen
collected and all known species of the Zantilla taeniata
group, based on the data in Townsend et al. (2013),
Batista et al. (2016), and McCranie and Smith (2017).
September 2020 | Volume 14 | Number 3 | e258
A new species of Jantil/la from Honduras
Fig. 1. Dorsolateral view of the holotype of Zantilla lydia sp. nov. (UVS-V 1189) in life. Photo by Cristopher Antunez-Fonseca.
The description of the hemipenis follows the descriptions
of T. psittaca (McCranie 2011b), 7. olympia (Townsend
et al. 2013), and 7? hendersoni (Hofmann et al. 2017).
Following the morphological species limits within the
Tantilla taeniata group by Campbell and Smith (1997),
Campbell (1998), and McCranie and Smith (2017), the
definition of this new species is based on characteristic
features of color pattern, such as the middorsal and lateral
stripes; the nuchal collar; the coloration of the head,
dorsum, and venter; the numbers of ventral, subcaudal,
dorsal, and head scales; and the total length, snout-vent
length, and tail length. This new species is described
based only on the holotype, following the procedures in
Campbell and Smith (1997), Stafford (2004), Townsend
et al. (2013), and Batista et al. (2016).
Results
Tantilla lydia sp. nov.
Figs. 1-2.
Suggested common name. Lydia’s Little Snake.
urn: Isid:zoobank.org: act: B37 BD98E-336B-4436-A37 B-707036196A6E
Holotype. An adult male, Universidad Nacional
Autonoma de Honduras en Valle de Sula ([UVS-V]
1189), from Comunidad Salado Barra in Refugio de
Vida Silvestre Barras de Cuero y Salado (15.7633°N,
86.9948°W), elevation 7 m asl, Municipio de El Porvenir,
Departamento de Atlantida, Honduras, collected 21 May
2018 by Cristopher Antunez-Fonseca, Farlem Espafia,
Jocelyn Castro, Emmanuel Orellana, José Paz, and
Lourdes Alvarado. Original field number CS 15.
Amphib. Reptile Conserv.
Diagnosis. Zantilla lydia sp. nov. is a member of the
Tantilla taeniata species group, but distinguished
from all other congeners by possessing the following
combination of characteristics: (1) pale middorsal
stripe dark-edged, occupying middorsal scale row and
adjacent third of paravertebral rows on anterior third
of body, reducing to median half of vertebral row on
remainder of body, beginning approximately on tenth
middorsal scale past parietals, posterior to more or
less circular pale spot just posterior to dark nape band
located behind pale nuchal collar; (2) pale nuchal
collar incomplete dorsally, divided by dark coloration
on vertebral scales and connecting to dark posterior
border of dark head cap and dark nape band; (3) lateral
extension of dark head cap incomplete, not completely
separating postocular pale spot from pale nuchal band;
(4) subocular dark spot present, not extending to lip;
(5) ventrolateral region of body a much darker shade
of brown than dorsolateral region; (6) pale lateral stripe
well defined, dark edged, located on adjacent halves of
dorsal scales 3 and 4; (7) paraventral scale completely
pale on anterior portion, gradually darkening dorsally,
until becoming completely dark at the beginning of tail:
(8) postnasal and preocular narrowly separated; (9) 169
ventrals, 75 subcaudals, and 244 ventrals + subcaudals
in the single male holotype.
Tantilla lydia can be differentiated from the other
members of the 7: taeniata group (Tables 1-2) by
having (scutellation data for males only): 169 ventrals
(vs. 152 in T. berguidoi, 139-152 in T: brevicauda, 172
in 7: briggsi, 139-145 in T. cuniculator, 154—166 in T.
flavilineata, 142—158 in T: gottei, 157 in T: hendersoni,
162—165 in T. impensa, 144—147 in T: jani, 144-159 in
September 2020 | Volume 14 | Number 3 | e258
Antunez-Fonseca et al.
Fig. 2. Dorsal (A), lateral (B), and ventral (C) views of the head and nape of the holotype of Zantilla lydia sp. nov. (UVS-V 1189).
Photos by Cristopher Antunez-Fonseca.
T. johnsoni, 151-158 in T: oaxacae, 148 in T: olympia,
153-163 in 7. psittaca, 158-159 in T: reticulata, 164
in T. stenigrammi, 146-161 in T. striata, 141-152 in T-
taeniata, 140-144 in T. tayrae, 157 in T. tritaeniata,
and 136-146 in 7. vulcani); 75 subcaudals (vs. 65
in T. berguidoi, 22—26 in T. brevicauda, 68 in T.
briggsi, 53-58 in T. cuniculator, 70 in T. excelsa,
51-56 in T. flavilineata, 62-67 in T: gottei, 70 in T.
hendersoni, 68—72 in T. impensa, 44—47 in T: jani, 62
in T. johnsoni, 46—52 in T. oaxacae, 49 in T: olympia,
63-73 in T. psittaca, 60-67 in T! reticulata, 33—42 in
T. striata, 60-70 in T: taeniata, 46-49 in T: tayrae,
and 39-50 in 7: vulcani); pale nuchal band narrowly
divided middorsally (vs. obscure but complete in
T. berguidoi, complete dorsally in T. brevicauda,
T. cuniculator, T. excelsa, T. flavilineata, T. gottei,
T. johnsoni, T: stenigrammi, T: taeniata, T. tecta, T:
trilineata, and T. triseriata, and reduced to two nuchal
spots in 7. striata); by having nuchal band extending
Amphib. Reptile Conserv.
89
onto parietals (vs. nuchal band confined to scales
posterior to parietals in 7. hendersoni, T: slavensi, and
T. tayrae);, pale middorsal stripe occupying middorsal
scale row and adjacent portions of paravertebral rows
on anterior third of body, narrowing to median portion
of middorsal scale row on remainder of body (vs.
confined to median portion of middorsal scale row
length of body in 7. berguidoi, restricted to spots on
vertebral row in T. brevicauda, T: jani, T. olympia,
and 7: vulcani, absent in 7. briggsi, T: cuniculator,
and 7: johnsoni, absent or barely indicated, consisting
of series of disjunct paler spots on anterior portion of
middorsal scales length of trunk or some portion of
anterior end thereof in 7: tayrae, present on middorsal
scale row and some portion of paravertebral scale
rows length of body in 7! excelsa, T: flavilineata, T.
gottei, T: oaxacae, T: psittaca, T: reticulata, T: striata,
T. taeniata, and T: tritaeniata, confined to middorsal
scale row length of body in 7: hendersoni, T: impensa,
September 2020 | Volume 14 | Number 3 | e258
A new species of Jantilla from Honduras
Table 1. Selected features of measurements, proportion, and scutellation of the members of the Zantilla taeniata group. Modified
from Townsend et al. (2013).
Species acct aaa Ventrals () Subcaudals (3) Ventrals (2) Subcaudals (2) ota Saal
T. lydia sp. nov. 344 169 75 — — 23.8
T. berguidoi 408 152 65 — —_ 25:2
T. brevicauda 171 139-152 22-26 148-160 21-22 9.9-12.9
T. briggsi 301 172 68 -- — 22.6
T. cuniculator 220 139-145 53-58 140-154 48-53 19.7-22.9
T. excelsa 400 169 70 161-178 61 23.0—-24.0
T. flavilineata 293 154-166 51-56 152-168 43-49 17.7-20.6
T. gottei 391 142-158 62-67 147 61-70 23.0—26.0
T. hendersoni 358 157 70 151-153 64 23.9-24.9
T. impensa ca. 725 162-165 68-72 164-172 65-72 21.0-25.0
T. jani 242 144-147 44-47 144 47 15.7-20.7
T. johnsoni 353+ 144-159 62 a — 22.5
T. oaxacae 284 151-158 46-52 145 45-48 19.9-21.2
T. olympia 338 148 49 — = 20.7
T. psittaca 413 153-163 63-73 154-161 — 24.1-25.2
T. reticulata 312 158-159 60-67 162-173 59-70 21.7-24.1
T. slavensi 346 ~- — 158-159 52-56 19.9-24.6
T. stenigrammi 73+ 164 — 159 — —
T. striata eX Bi 146-161 33-42 145-163 31-34 13.0-17.0
T. taeniata 415 141-152 60-70 150 59 23.0-27.0
T. tayrae 360 140-144 46-49 146-154 44-5] 18.5—20.3
T. tecta 222 — — 148 54 23.0
T. trilineata Tail incomplete = = 149 4\+ —
T. triseriata 375 — — 159-167 58-63 19.7-22.2
T. tritaeniata 273 157 _— 155-161 59-65 22.7-23.6
T. vulcani 247 136-146 39-50 141-154 38-47 15.4-22.0
T. tecta, and T: trilineata, confined to middorsal scale
row, becoming increasingly obscured and fragmented
posteriorly in 7! slavensi, and confined to middorsal
scale row anteriorly and extending onto adjacent edges
of paravertebral scale rows posteriorly on body in 7.
stenigrammi, T: tecta, and T. triseriata), pale lateral
stripe well-defined, occupying adjacent portions of
dorsal scale rows 3 and 4 (vs. occupying dorsal scale
4 and adjacent halves of rows 3 and 5 in 7! berguidoi,
T. excelsa, T. flavilineata, T. oaxacae, T. reticulata, and
1) stenigrammi, poorly defined, occupying all of row 4,
upper half of row 3, and sometimes lower portion of row
5 in T. brevicauda, interrupted on adjacent portion of
scale rows 3 and 4 in 7. briggsi, barely discernible on
adjacent portions of scale rows 3 and 4 in 7. cuniculator,
absent or occupying portion of adjacent portions of scale
rows 3 and 4, most clearly or barely evident on anterior
portion of trunk in 7 johnsoni and T. tayrae, well-
defned, consisting of spots on scale row 4 in T: olympia);
paraventral scale pale anteriorly, gradually darkening
until reaching tail (vs. uniformly tan, brown, or dark
brown length of body in 7? berguidoi, T. brevicauda, T.
cuniculator, T: jani, T. johnsoni, T: oaxacae, T: reticulata,
T: striata, T. tayrae, T: tecta, and T. vulcani, lower portion
Amphib. Reptile Conserv. 90
pale, distinctly set off from dark upper half length of body
in 7. briggsi, T. gottei, T: hendersoni, and T: impensa,
lower two-thirds anteriorly and about lower one-third
posteriorly white similar to color of ventrals in 7’ excelsa,
dark streak on posterior portion of otherwise pale colored
scale in 7: flavilineata, with pale center, edged with dark
pigment in 7: olympia, lower two-thirds pale, area with
pale pigment slightly decreasing posteriorly on body in
T. psittaca, lower half pale, distinctly set off from dark
brown upper half in 7: s/avensi and T. taeniata, lower
half to two-thirds of scale row | colored similarly to
ventrals in 7: stenigrammi, unpigmented on anterior half
or more of body, upper half darkly pigmented thereafter
in 7: triseriata, lower tip pale, decreasing in amount of
coverage posteriorly in 7) tritaeniata); and by venter
immaculate white (vs. increasingly involved with ventral
edge of ventrolateral dark stripe proceeding toward
tail tip in 7? berguidoi, sometimes lightly pigmented
in 7. brevicauda, immaculate cream anteriorly to pale
pink posteriorly in 7? briggsi, immaculate reddish-
orange in 7? cuniculator, white with little or no dark
spotting in 7. excelsa, scattering of brown pigment in 7:
flavilineata, edged with dark brown spotting in 7! jani,
with slight extension of tan coloration of first scale row
September 2020 | Volume 14 | Number 3 | e258
Antunez-Fonseca et al.
MOT[OA
0} OUIYM oyeTNOBUWIW]
quouisid
UMOIQG JO SULIOeIS
sulyjods yep
OU JO OTT] YIM OHM
o3uUvIO
-YSIPpol oye [NOBUIW]
Ajio119}s0d
({dJ1] Ul 9duUeIO-pol)
yurd oyed 0} Ajrorsoyue
WIedIO O}B[NOVUIWT
poyuoursid
ATYSI] SOUTOWIOS
diy [rey
pJemo} surpsso0id
adis yep [e1oyeyO.NUSA
JO O9pPd [eQUSA YIM
POA[OAUI A[SUISeOIOUT
OUIYM oye [NSW]
SI[VIS [BAJUIA
JO SdSpo [B.19}UT
STPIJUDA 0}
A[JE]IWIS POIOJOD SOBs |
MOI JO SPITY}-OMJ TOMO'T
Q[eds po1ojoo
ayed osIMiayjo Jo uoTod
Jo1I9}sod uo yeass yeq
STBNUDA JO IOJOS 0}
JETIWIS STYM | MOI OTIS
Jo ATIOLIO}SOd p.1IYy} JAMO]
ynoge pue Aj1O1I9}Ue
SPIIY}-OM} JOMOT
uMOIg A[WWOJIUA)
jyey Joddn yep
WO} JJO JOS AOUTSIP
‘oped Jey IOMOT
UMOIqG
yiep 0} uMoIg ATUOsIUA,
UMOIG Yep ATUWWOFJIUA)
[rey
SUIYORAI [JUN SuIUDyIep
Ajjenpeis “Aj1o19jue oye
J[BIS [BIQUIABIEG
p pue ¢ SMOI
ayeos JO sioyenb-s014}
0} parry} JusseIpy
¢ pue ¢ SMOI
Jo soajey jusoelpe pue
p MOI UO pouyep [Ja
py pue ¢ SMOI
JO SoArey yusoelpe
UO pouysp [TSM
p pue ¢ SMOI OTROS
JO saayey yusov[pe uO
d[qIuIsOSIp AjoIeg
y pue € SMOI OTROS
JO Soarey yusoelpe
uo poydn9qUy
¢ MOJ Jo uoTLIOd
JAMO] SOWTJOWOS pue
“y MOI JO []e@ “€ MOI JO
jrey stoddn sur Adnss0
‘pouyap A]100g
¢ pue ¢ SMOI OTROS JO
soayey yusovlpe pure p
gjeos [esiop sordnd9Q
p puree
SMOJ [BOS JO SOATCY
qusoe[pe sardns99
dds [B.19}R] Vd
(€1OZ) Je 39 PUdSUMO]T, WO payIpoypy ‘dnoss HYyw1Uavy] YjJNUYI, 3Y} JO SIOQUIDW UT UJO}ed JO[OS dU} JO SOTSIIOJOVICYS P9IDI]9S °*Z Iu
SMOI [eIQoLIOAeIed
JO plly} Judoelpe pue MOI
[BIQoLIOA UO {Ie} JO sow pue
Apog 9y} JO YysUd] Spud}xy
SMOJ TOS [eIGoLIOARvIed
JO soayey Jusoe[pe pue
[esiopprur sardnd9Q
SMOJ [BIGOWOARIEd JO pIIY}
qusoelpe puke MOI [PIQaVIOA
OY} UO ‘TIe} JO S[PprU 0} JSedT
ye Apo dy} Suoye spud}xy
juasqy
juasqyv
SOTCOS [BIQOUA
uo sjods 0} psonpsy
MOI QOS [eSIOPpPTUr JO
uonJod ueipsw 0} pouyuod
Jopureulas uo
MOI [eSIOPpIU 0} SuToNpal
‘Apoq JO pJIY} JOLINyUe UO
SMOI [eIQOWOARIEd JO PITY}
qusoelpe puke MOI oTeOS
esiopprur surAdns0Q
Jerqeyeidns yse] Sossoso pue
sjejoted 0JU0 spud}xo ‘AT[eSIOp aJaTdwI0D
[eiqeyeidns se] Sassolo pue syejored 0jU0
pud}X9 JOU Soop JO saop ‘AT[eSIOp a}a,dWIOD
[erqeyesdns jsv] sassoio pue
sjejoted 0JU0 spudj}xa “AT[esIOp ajayduI0D
jerqeyesdns jsv] sassoio pue
sjejoted 0JU0 spud}xa ‘AT[esIOp ajaydwi0g
jerqeyesdns jsv] sassoio pue
sjejored 0JU0 spud}xo ‘AT[esIop poydns19qUyT
[erqeyesdns jse] SSO JOU SBOP JO Soop pue
syejored 0JU0 spud}xa ‘AT[esIOp aja;dwi0g
geos
[er1oduia} Jo11a}sod pure jerqeyeidns jsey 0}
Jolia}sod ayeos jeyonu pure jerqeyeidns jsey]
Jo uoliod Jo11a}sod uo yuowisid oyed oyur
SUIPeIs AT[eID}e] “OINyns yeyored UeIPOU
puryog A[o}eIPSWUUT Teds [eSIOPPIU 0JUO
A]IOLIN}SOd SUIPUD}X9 puke syejorsed Jo
suoiod 1011a}sod uo suruursaq ‘aindsqaQ
[etqeyeidns se] sassoso “seyorred
0JU0 spud}xo ‘AT[eSIOp poydns9qUyT
poms
pom
DS19IXA |],
AOJDINIIUN) |T
ISBS1Q |]
DPNVIIAAAG |],
lopins.laq |]
‘aou “ds DIpA] ‘],
September 2020 | Volume 14 | Number 3 | e258
91
Amphib. Reptile Conserv.
A new species of Jantilla from Honduras
dSULIO JIB[NOVUIW]
poyuouisid Ayyseq
Apog Jo sparyy
-OM} JOLIN}Ssod UO pol
0} SuIpeis A]IOLIOVUe
yuid oyeynoewiwy
poyuowisid Ayyseq
MOI
g[eos ISI JO UOTIVIO[OS
UL} JO UOISUD}X9 JYSITS
Weslo oyeNoeuu]
sulyjods
UMOJIG Yep YIM pospy
Weald oye;NOeUUW]
oUIYM oye[NOeUIW]
SI[VIS [BAJUIA
JO SdSpo [B.19}8'T
jyey Joddn umoig yep
WO} JJO JOS APOUNSIP
‘oyed Jey Jomo]
uMOIg oyed ATUIOFIUL)
Apoq uo A]JO1I9}s0d
SuIseoloop ApYsIys
quouisid ayed yyIM vole
‘oyed sps1y} OM} JOMO'T
quouisid yep
YIM pospo “Ia}Ud9 o[eg
ue} ATWWOFIUA)
ue} yep 0} Ue} ATWOFIUA)
UMOIq
ysep Ayuosiun ATWeUwlig
UMOIq
ysep Jey toddn ‘moyjad
0} WIRdID J[PY IOMO'T
jyey stoddn yep
WO} JJO JOS AOUTNSIP
‘oyed Jey JOMO'T
J[BIS [BIQUIABIEG
p pue
€ SMOJI 99S JO SpITy}
qusoelpe sardns99
¢ pue ¢ SMO]
Jo soajey jusoelpe pue
~ MOI UO pouyep [Ja
p puree
SMOJ 9[VOS JO SOATCY
qusoe[pe sardns99
MOI J[BIS wh
uo sjods Jo Sulsisuos
‘Pouysp TSM.
¢ pue ¢ SMOI
JO Saayey juooelpe pure
f MOI UO pouyep [2A
yun
Jo uor}od Jo1ajue uo
A[Jeo]9 JSOU “p pue ¢
SMOJ 9[VOS JO SOATCY
qusoelpe Jo uorjod
sulAdno90 Jo yuasqy
p pue € SMOI OTROS
JO Spiry} yusoe[pe
SuIAdnd90 ‘MOLIeN
p puree
SMOJ [BOS JO SOATCY
qusoelpe sardns99
p pue
€ SMOI 9TBOS JO SPIIYY
qusoelpe sardns99
dIdLYS [B19}R] Vd
AjJO1I9}so0d
poyusuisely puke pomnosqo
A[SUISBOIOUI SUIUIODOQ “MOI
Q[eos [esIOppru 0} pouyuoD
SMOJ TOS [eIGoVIOAvIed
JO soayey jusoe[pe pue
[esiopprur sardnd9Q
SMOI Q[BOS [eIgoWoAvIed Jo
Jjey uo 0} psy} duo yusoelpe
pure jesioppru sardns9Q
(ayeos
Jod U0) MOI [VIS [BIGOLOA
UO S}Ods JO SdIIOS 0} poonpoy,
SMOJ OTS [eIGoLIOAvIed
JO soayey jusoe[pe pue
[essopprur sordnd9Q
quasqyv
MOI 9TBIS [PIGOVI9A UO s}ods
[[BUIS JO SdlJas 0} psonpay
MOI 9TBIS [eSIOPPTU JO
SPJIY]-OM} [eIpour sardns0Q
MOI
aes [esIOpprul 0} pouyuod
dds [VSIOPPIU B[vq
jerqeyeidns
JSP] SOSSOID “spejoLed 0} JOLIN\sod
SoTeOS 0} pouyUod ‘AT[esJOop poydns9}UT
[erqeyeidns yse] Sossoid pue
sjejored 0jU0 spud}xo ‘AT[esIOp poydnss9qUyT
[eiqeyeidns se] Sossoid pue syeyorred
0]U0 Spud}x9 ‘Jou JO AT[esIOp aJadwI0D
[erqeyeidns \se] Sosso1d pue
sjejored 01U0 spud}xo “AT[esIOp poydns9}U]
jerqeyeidns
JSB] SSOID JOU SaOp jNq ‘sfe}ated oO}UO
spud}xo “‘A][esiop paydnssayur Ayyens)
[erqeyesdns \sv] sassoio pue
syejoted 01U0 spud}xo “AT[esIOp a}0;dWI0D
[eiqeyeidns se] SuIsso1s uoTIOd
[eae] pue syejoried 0]U0 spud}x9 uoTI0d
[elpow ‘ATTe1oye] pue AT[esiop paydnsz19yUy
jerqeyeidns
JSR] SOSSOID puv JOU JO syejorIed ONO
spud}xo “Aesop poydnsu9yUl 10 ayay;dwi0g
jerqeyeidns
JSP] SSOID Sop 3Nq ‘syejatIed 0}UO pudyxa
jou saop ‘A[[esiop 930;dWI09 JO paydns9yUy
pueg [eqonn
ISUIADIS |
DIDINIYOA °F,
vavyisd *,
pidwajo ‘|,
IDIDXDO (J
1uosuyol ‘J.
tpl *7,
psuaduil ‘J,
1uOosA4apuay ‘T,
so1eds
September 2020 | Volume 14 | Number 3 | e258
G2
(€10Z) Te 19 pussUMOT, WO poylpoyy ‘dnois Yyo1UaH] HjJUYNT SY} JO SIOQUIDU UI UId}ed IO[OS dy} JO SOI|SLIQ}OVILYO Pa}d9]9S *(panuyUod) 7 Iquy
Amphib. Reptile Conserv.
Antunez-Fonseca et al.
ou
JOUDA JO JOpUTeUIdI
‘MOI [eIWUdAPIEd JO
ye} 0} IV[IUIS OJOS
YUM pospo Aped
Weald oye[NOeUW]
MOTISA Oyed ayeyNIeUIWT
Weald oye[NOeUUW]
MOI
[euoavied Jo yey} se
SUIeS IO[OO YJIM pospy
jenuda yore
Jo uor}IOd [e19}e[O19]Ue
dUI9X9 UO J0OdS YIeEq
sjods yrep [[eus
MO}j & Y}IM SOUTTOUIOS
nq ‘Ajs1orso}sod
MOJ[SA 0} SUIPRIS
A[JOLIO}Ue WUedID
oyeynovurunt ATyensy)
Weald oye[NOVUW]
OUIYM oye [NICU]
SI[VIS [BAPUIA
JO SdSpo [B.19}8'T
uMOIg A[WWOJIUA
AJIOLIOSOd 9BVIOAOD
Jo JUNOW UI SUISeoIOOp
‘oped diy 1aMo'T
Joyyeoioy) poyuoursid
Ayysep oyeos Jo yey soddn
‘yund} JO SIOW JO Jyey
Jolajue uo payuswsiduy)
UMOUYU/)
UuMOIg A[WOFIUA
UMOIG YJep ATWWOFIU)
jyey soddn yep
WO} JJO Jos APOUNSIP
‘oyed Jey IOMO'T
uMOIg oyed ATUIOFIUE)
S]eIIUDA 0} ATE] TUUTS
POIO[OS | MOI 9[BIS JO
SPJIY}-OM} 0} JTLY IOMO'T
J[VIS [VIQUIABIEG
(€TOT) Te 19 pudssuMO] Wo poyIpoyy ‘dnois yyv1uay) HjJYUYI IYA JO SIOQUIDU UT UIOYed IO[OS dy} JO SOT}STIDJOVICYD Pd}d9[9S
p puree
SMOJ 9[VOS JO SOATCY
qusoelpe sardns99
p pue ¢ SMOI
Q[Bds JO SpITYy}-OM}
qusoelpe sardns99
p pue ¢
SMOJI [COS JO SAATeY
qusoelpe sardns99
p pue¢
SMOJ 9[BOS JO SOATCY
qusoelpe sardns99
p pue¢
SMOJ [BOS JO SOATCY
qusoelpe sardns99
yun
Jo uorjiod Jo1ayue uo
y pue ¢€ SMOI OTeOS
JO soarey yusoelpe
UO dU0 JO UOT}BOIpUI
ysoreq Jo yUOsSqVy
p puree
SMOJ 9[VOS JO SOATCY
qusoelpe sardns99
p puee
SMOJI O[VOS JO SOATCY
qusoelpe sardns99
y pue € SMOI JO SaATeY
qusoelpe sardns99
ILS [B19}R] Vd
(a[eos Jad auo0)
MOI dTBOS [RIQSUSA UO sjods
][BUIS JO Salas 0} poonpoy
SMOI [eIQoLIOAeIed
JO SPJIY}-0M} 0} PITY] dUO
pue yesropprur sardns9Q
Ajio1193s0d
SMO [eIQoWoOAvIEd Jo soATey
qusoe[pe 0} suripuedxa
‘AJJOLIOJUL MOI OOS
[esIOppru 0} pouyuosd
MOI
aes [eSIOpprul 0} pouyuod
Apog Jo yysud]
Q]eos [esIOpprul 0} pouyuod
JOoI9Y} pud JOLIAJUe JO
uoriod wos 10 yUuNI) dy} Jo
YSU] OY} SoTeOS [eSIOpprul
JO uoT}IOd Jo1IN}Ue UO sjods
Joyed Apystiys younlstp
JO SOIIOS JO SUTSISUOD
poyeorpur Ayoreg Jo Juasqy
(4
SMOJ OTS [eIGoLIOAvIed
JO soayey jusoe[pe pue
[esiopprur sardns9Q
SMOJ OTS [eIGoVIOAeIEd
JO soayey Jusoe[pe pue
[esloppru sardns99
Apog uo Aj10110}so0d SMO1
Q[vos [eIqoyoAvied Jo saspo
qusoe[pe 0]U0 SUIpUd}x9 pue
Jyey JO119}uv UO sed] Je ‘MOI
Q[eos [esIOppru 0} pouyuoD
Id1.1S [BSIOPPIU 9[vq
[erqeyeidns yse] Sasso1o pue syejored
0]U0 Spud}xo ‘AT[eSIOp djo;duI09 ATTens~)
jerqeyesdns ysey sassoso
pure ‘sjejored 01U0 spud}xo “AT[eI9}L|
Osye sased OWS Ul “AT[eSIOp poydns9}U]
jerqeyesdns jsv] sassoio pue
sjejotied 01U0 spud}xo “AT[esIOp a}0;dWI0D
jerqeyeidns
JSP] SOSSOID ‘poyuUsUNdOp JOU syejorIed
0} SATJE[OI UOTIISOd “AT[esIop ajo;dWI0D
[eiqeyeidns jse] sossoid pue
sjejored 0JU0 spud}xo “AT[esIOp ajo;dWI0D
jerqeyeidns
JSB] SOSSOID ‘sTe}alIed 0} JO1IN}SOd saTeos
0} pouyuod ‘A][v19}e] pue AT[eSIOpP IO
Ajjesiop poydnsiaqur ‘poyeorput Aj100g
[erqeyeidns se] Sasso1o pue syejored
0]U0 Spud}xo ‘AT[eSIOP d}o;duI09 ATens~)
jou 10 [eIqeyeidns
JS] SUISSOIO pUe JOU JO sye}ored 0UO
SUIPUD}X9 “sjods [eyoNU OM} 0} PIoNpoy
jerqeyeidns
JSP] SY} SOSSOID puv sye}orIed oY} JO Saspo
dY} 0JUO spudsyxa “ATTeSIOp aJaTdwI0D
pueg [eqonny
UDINA |
DIDUAV{LA] °],
DIVIAASIA] “T,
DIDAUIIA] “T,
DIIaq 'T,
DANDY 'T,
DIDMav] |
DIDS |
UUDASIUAIS |],
so1ods
(penuuod) Z 3quy
September 2020 | Volume 14 | Number 3 | e258
93
Amphib. Reptile Conserv.
A new species of Jantilla from Honduras
in 7’ oaxacae, darkly pigmented in T. olympia and T.
reticulata, immaculate pink anteriorly grading to red on
posterior two-thirds of body in 7? psittaca, immaculate
orange in 7. s/avensi, usually immaculate, but sometimes
with a few small dark spots in 7: taeniata, dark spot on
extreme anterolateral portion of each ventral in 7° tayrae,
and edged with same color as that of paraventral row in
T) tecta, and darkly edged with color similar to that of
paraventral row, remainder of venter white in 7: vulcani).
Description of holotype (Figs. 1-2). An adult male,
with partially everted hemipenes, measuring 262 mm
SVL and 82 mm TL (TOL = 344 mm; 23.9% of TOL).
The head is slightly broader than the attenuate body; HL
8.5 mm; HW 5.1 mm; ED 1.4 mm, about 16.5% of HL;
snout length 4.8 mm, about 56.4% of HL; snout rounded
in dorsal and lateral views; pupil circular; rostral in the
shape of an inverted triangle (2.1 mm in length by 1.1 mm
in width), 1.9 times wider than long; internasal (0.9 mm
in length by 1.7 mm in width), 1.9 times wider than long,
contacting anterior and posterior nasal, and relatively
large nostril; short suture between pre- and postnasals,
below nostril; prefrontal more or less quadrangular (1.7
mm in length by 1.9 mm in width), anterior portion
wider than the posterior portion prefrontal, 1.5 times
longer than intersuture length; parietal (4.0 mm in length
by 2.1 mm in width), about 1.9 times longer than wide;
prefrontal suture 1.2 mm in length; frontal (2.5 mm
in length by 1.9 mm in width), pentagonal in shape,
approximately 1.3 times longer than wide, approximately
as long as the distance from its anterior edge to tip of
snout; supraocular (1.9 mm in length by 0.9 mm in
width) approximately 2.1 times longer than wide; central
portion of parietal 1.9 times longer than wide; parietals
in contact with five nuchal scales; border of orbit in
contact with parietal, upper postocular, supraocular, and
frontal; rostral in contact with anterior nasal, internodal,
and supralabial 1; anterior nasal in contact with the
rostral, nostril, and first supralabial; posterior nasal in
contact with nostril, prefrontal, and supralabials 1 and
2; relatively large nasal fossa located between anterior
nasal and posterior nasal; loreal absent; preocular single,
of inverted pentagonal shape (0.7 x 0.9 mm), lower
margin contacting supralabials 2 and 3; postoculars 2/2,
upper scale of roughly pentagonal shape (0.8 x 0.6 mm);
temporals 1+1, anterior temporal (1.9 x 0.9 mm) longer
than wide, posterior temporal (2.0 x 1.0 mm) longer
than wide; supralabials 7/7, supralabial 1 in contact
with supralabial 2 and nasals, supralabial 2 in contact
with supralabial 1 and 3, preocular, and prefrontal, 3
and 4 bordering the eye, 4 and 5 contacting the lower
postocular, 5, 6, and 7 bounding the ventral border of the
anterior temporal, 7 contacting the anterior and posterior
temporal, and the scales of the pale collar; a pair of chin
shields present, anterior ones 1.7 times longer than wide,
in contact with infralabials 1, 2, 3 and 4, infralabial 6/6,
first four in contact with chin shields; and four preventral
Amphib. Reptile Conserv.
scales present between the posterior chin shields and
first ventral. Dorsal scales in 15-15-15 smooth rows
throughout the body, without apical pits or supra-cloacal
tubercles; dorsal scales 6 at the 10 subcaudal; ventral
169; cloacal shield divided; subcaudals 75, paired;
ventrals plus subcaudals 244. Hemipenes slightly
everted, bilobed, well-differentiated, pedicel naked and
smooth, apical region with large spines.
Coloration of holotype in life (Figs. 1-2). Dark
dorsolateral region of body Prout’s Brown (47);
pale middorsal stripe Clay Color (18) present on the
middorsal scales and one-fourth of the adjacent portion
of the paravertebral scales on anterior portion of body
up to ventral 38, thence narrowing to cover only the
median two-thirds of middorsal scale on remainder of
body, edged with Sepia (286); pale lateral stripe located
on adjacent halves of dorsal scale rows 3 and 4 Chamois
(84) in color, grading to Tawny Olive (17) on posterior
portion of body, bordered on upper half of row 4 with
Sepia (286), ventrolateral portion of body from ventral
half of row 3 to dorsal portion of row 1 Sepia (286);
ventral portion of scale row 1 Smoky White (261); dorsal
surface of head from rostral to anterior two-thirds of
parietals Buff (15), with Sepia (286) edging on some
scale edges; posterior portion of head cap edged with
Sepia (286) margin on lateral edges of parietals, upper
postocular, upper edge of anterior temporal, upper half of
posterior temporal, and anterior half of adjacent nuchal
scale; this dark head cap margin confluent with Sepia
(286) subocular spot on anterior edge of lower postocular,
upper portions of supralabials 3 and 4, and posterodorsal
corner of supralabial 2, not touching lip; iris Jet Black
(300); lateral portion of head Pale Buff (1), except for
Sepia (286) spot on adjacent portions of supralabials 6
and 7, representing isolated segment of lateral extension
of head cap, completely separated from dorsal portion of
head cap; pale preocular and postocular spots confluent
below dark subocular spot; pale nuchal band Light Buff
(2) grading to Pale Buff (1) laterally, extending onto
posterior tips of parietals where color is Yellow Ocher
(14), narrowly divided by middorsal connection between
posterior edge of head cap and a Sepia (486) nape band
three middorsal scales long, which abuts and edges
posteriorly a Yellow Ocher (14) spot covering most of
four dorsal scales and is separated from pale middorsal
stripe, which begins about one scale posterior to that
point; venter of head Pale Buff (1), with Sepia (286) spot
on mental and similarly-colored spots on medial portion
of each infralabial 4; venter of body and tail Pale Buff (1).
Coloration of holotype in preservative. After seven
months of preservation, the holotype exhibited the
following coloration: dark dorsolateral region of body
Drab (19), located between two pale stripes; Smoky
White (261) stripe with Sepia (286) edges covering the
vertebral scales and one-fourth of the adjacent potion
September 2020 | Volume 14 | Number 3 | e258
Antunez-Fonseca et al.
88°0.00'0 87°0.00'O 86°0.00'O
85°0.00'0 84°0.00'O 83°0.00'0
89°0.00'O
16°0.00'N
15°0.00'N
Z
o
5
oOo
5
t+
_
13°0.00'N
89°0.00'O 88°0.00'O 87°0.00'O 86°0.00'0
Holotypes localities
% Tantilla lydia sp. nov.
@ Tantilla exceisa
@ Tantilla gottei
V Tantilla impensa
© wh Tantilla olympia
- @ Tantilla psittaca
A Tantilla stenigrammi
B Tantilla tritaeniata
© Other localities
} Tantilla excelsa
© Tantilla gottei
V = Tantilla impensa
© Tantilla psittaca
A, Tantilla stenigrammi
s O Tantilla tritaeniata
Elevations (m)
[] Sea Level
[| 1-500
|__| 501-1,000
Mi 1,001-1,500
Gl 1,501-2,000
MM 2001+
N.00°0.1
85°0.00'O 84°0.00'O
Fig. 3. Distribution of the species of the 7Zantilla taeniata group in Honduras. The star indicates the type locality of Zantilla lydia sp.
nov. The most northwestern location of Zantilla gottei was recently published by Orellana Murillo et al. (2020).
of the paravertebrals, to a point 38 ventral scales along
the body, after which this stripe narrows to occupy only
middorsal scale row for remainder of body; adjacent
portions of dorsal scales 3 and 4 Pale Buff (1), edged
by Sepia (286) above, area below lateral pale stripe
Hair Brown (276); paraventral portion of dorsal scale
row 1 immaculate Pale Buff (1), as are the ventral
scales. Dorsal head cap is Hair Brown (276), rimmed
on posterior portion by Sepia (286); pale nuchal color 1s
Pale Buff (1), divided narrowly middorsally by a Sepia
(286) line connecting posteriorly to the Sepia (286) nape
band; side of head is Pale Buff (1), with a Sepia (286)
subocular spot not touching lip and a Sepia (286) spot on
posterior portion of supralabial six and anterior portion
of supralabial seven; chin Pale Buff (1) colored with
Sepia (286) spots on mental and fourth infralabials.
Etymology. We are privileged to name this new species
of snake in honor of Dr. Lydia Allison Fucsko who
resides in Melbourne, Australia, and is an amphibian
conservationist and environmental activist. As an
internationally published photographer, she has taken
countless pictures of amphibians, including photo
galleries of mostly southeastern Australian frogs. Dr.
Fucsko has a Bachelor of Arts in Humanities from
La Trobe University (Bundoora, Victoria, Australia),
and a Diploma in Education from The University
of Melbourne (Parkville, Victoria, Australia). She has
postgraduate diplomas in computer education and in
vocational education and training from The University
of Melbourne (Parkville). Additionally, Dr. Fucsko
holds a Master’s Degree in Counseling from Monash
University (Clayton, Victoria, Australia). She received
Amphib. Reptile Conserv.
95
her Ph.D. on environmental education, which promoted
habitat conservation, species perpetuation, and global
sustainable management, from Swinburne University
of Technology (Hawthorn, Victoria, Australia),
while being mentored by the late world-renowned
Australian herpetologist and academic Dr. Michael
James Tyler (Order of Australia recipient). Dr. Fucsko,
an educational consultant, was responsible for major
enhancements in the quality of the images provided
herein and is also a research collaborator with the fifth
author (LDW). Dr. Fucsko’s academic interests include:
clinical psychology, focusing on psychopathology;
neuroscience and empathy; environmental education for
sustainable development; sentient ecology; academic
writing; and creative writing, including poetry and
creative nonfiction books for children and young
adults. We use Dr. Fucsko’s given name as a noun in
apposition, with the spelling of the Latin transliteration
from the Ancient Greek Avodia (Ludia), meaning
“beauty, beautiful, noble one.” Thus, the snake named
here as Zantilla lydia sp. nov. can be envisioned as the
“beautiful one.”
Distribution and habitat (Figs. 3—4). Tantilla lydia
sp. nov. is known only from a narrow strip of disturbed
Coastal Scrub habitat in the Lowland Wet Forest (LWF;
Holdridge 1967). In the vicinity of the holotype collection
location, the predominant plant families and species
are: Myrtaceae (Syzygium cumini, Indian Blackberry
or Malabar Plum); Arecaceae (Elaeis guianensis and
Cocos nucifera, African Oil Palm and Coconut Palm,
respectively); Melastomataceae (Conostegia xalapensis,
Canelito); Fabaceae (Abrus precatorius, Rosary Pea);
September 2020 | Volume 14 | Number 3 | e258
A new species of Jantilla from Honduras
Table 3. Selected features of distribution and conservation status of the members of the 7antilla taeniata group. Country distribution
abbreviations as follows: Belize = B; Colombia = C; Costa Rica = CR; El Salvador = ES; Guatemala = G; Honduras = H; Mexico = M;
Nicaragua = N; Panama = P. Ecological formations are abbreviated as follows: LAF = Lowland Arid Forest, LDF = Lowland Dry Forest,
LMF = Lowland Moist Forest, LWF = Lowland Wet Forest, PDF = Premontane Dry Forest, PMF = Premontane Moist Forest, PWF =
Premontane Wet Forest, LMDF = Lower Montane Dry Forest, LMMF = Lower Montane Moist Forest, LMWF = Lower Montane West
Forest. EVS = Environmental Vulnerability Scores (explained in text). EVS categorization as follows: M = medium; H = high. IUCN
categorization as follows: CR = Critically Endangered; EN = Endangered; VU = Vulnerable; LC = Least Concern; DD = Data Deficient;
and NE = Not evaluated. Conservation priority levels are explained in the text.
oect ae Country Ecological Elevational Versant EVS EVS IUCN Conservation
P distribution distribution distribution distribution category category priority level
T: lydia sp. nov. H LMF 7m Atlantic 16 H NE One
T. berguidoi P PWF 1,376 m Pacific 16 H NE One
PME, PWF,
T. brevicauda G, ES LMWE 1,200-1,510 m Pacific 13 M LC Eight
T. briggsi M LMF 95m Atlantic 16 H DD One
T. cuniculator B,M LAE, LDF pe ne Atlantic 13 M Le Seven
level—100 m
T. excelsa H saa EB 30-700 m Atlantic 13 M NE Eight
T. flavilineata M LMDF, LMMF 1,800—2,300 m Atlantic 14 H EN One
T. gottei H LDF, PDF, PMF 500—1,280 m Pacific 14 H NE One
T: hendersoni B PMF 194-580 m Atlantic 16 H DD One
. LME, PMF, near sea : :
T. impensa G, H, M PWE, LMWE level—1,600 m Atlantic 10 M LC Eight
T. jani G PWF 1,050 m Pacific 14 H VU Two
T. johnsoni M LEDE 450m Pacific 16 H DD One
T. oaxacae M PMF, LMMF 600-—1,600 m Pacific IRs) H DD One
T: olympia H PWF 1,150 m Atlantic 16 H NE One
T. psittaca H LMF 5—420 m Atlantic 15 H VU One
T. reticulata C,CR,N,P LMF, PWE 10-1,345 m “eee M LC Nine
T. slavensi M LMF, PWF 50-800 m Atlantic 14 H DD One
T. stenigrammi H PMF 895—1,180 m Atlantic 15 H NE One
T. striata M LDF, PMF 0-1,500 m Pacific 14 H DD Two
T: taeniata G PMF 1,020-1,550 m Pacific 14 H LC Two
T. tayrae M LMF, PWF 500—1,000 m Pacific 15 H DD One
T. tecta G LDF 220m Atlantic 16 H DD One
T. trilineata Unknown Unknown Unknown Unknown — — — —
ages LDF, PMF, Atlantic and
T. triseriata M PWFE 500—1,200 m Paging 13 M DD Eight
T. tritaeniata H LWF near sea level Canbbean 16 H CR One
insular
T. vulcani G,M ger 500-700 m Pacific 12 M NE Seven
and Marantaceae (Thalia geniculata, Fire-flag). The male
holotype of this snake was found active on 21 May 2018
during a night with clear skies at 2230 h, between the
rails of the old Standard Fruit Company railroad track,
566 m southwest in a straight line from the center of the
Comunidad de Salado Barra, approximately 450 m from
the Rio Salado, 590 m from the community beach, and
5,900 m from the Comunidad de La Union. An association
of mangrove forest species predominates to the west of
the type locality on the banks of the aforementioned
river, and includes Rhizophora mangle (Red Mangrove),
Conocarpus erectus (Buttonwood), Avicennia germinans
(Black Mangrove), and Laguncularia racemosa
(White Mangrove). Zantilla lydia sp. nov. shares its
microhabitat with other amphibians and reptiles, such as
Dendropsophus microcephalus, Scinax staufferi, Smilica
baudinii, Basiliscus vittatus, Coniophanes imperialis,
and Bothrops asper.
Amphib. Reptile Conserv. 96
Conservation status. Applying the IUCN Red List criteria
(IUCN 2012; IUCN Standards and Petitions Committee
2019) to Tantilla lydia, indicates that this species should
be considered Critically Endangered (Blabf[iii]) due to
the known distribution being limited to a single highly-
intervened, threat-defined area of lowland Coastal Strand
habitat of < 10 km/ in total extent, which has undergone
extensive loss of remaining habitat due to deforestation and
development. Efforts are underway to restore this habitat,
and it is likely that further survey work in nearby coastal
areas could uncover additional habitat and/or populations.
Given the single known locality of Zantilla lydia sp. nov.,
its unknown population size, unknown extent of geographic
and ecological distribution, and significant and continuing
degradation of habitat in the vicinity of the type locality, we
propose an Environmental Vulnerability Score (EVS) of 16
(6+8+2) within the “High Vulnerability” category (Wilson
and McCranie 2003; Johnson et al. 2015).
September 2020 | Volume 14 | Number 3 | e258
Antunez-Fonseca et al.
a ee
Fig. 4. Type locality and surrounding habitat for Zantilla lydia
sp. nov. showing the train tracks where the holotype was
collected, Comunidad de Salado Barra, La Union, Departamento
de Atlantida, Honduras. Photo by Cristopher Antiunez-F onseca.
Discussion
This species represents an addition to the genus Zantilla
(Baird and Girard 1853) and is assigned to the 7’ taeniata
group on the basis of features of color pattern. As noted
above, the 7’ taeniata group was considered to comprise
25 species until now, with the description of 7° lydia sp.
nov. bringing the number to 26. Wilson (1999) listed
18 species for this group: 7. brevicauda, T. briggsi,
T. cuniculator, T: flavilineata, T: impensa, T: jani, T:
jJohnsoni, T. oaxacae, T. reticulata, T: slavensi, T: striata,
T: taeniata, T. tayrae, T. tecta, T: trilineata, T. triseriata, T:
tritaeniata, and T: vulcani. Since the summary provided
by Wilson (1999), an additional seven species have been
described: 7’ berguidoi (Batista et al. 2016), 7: excelsa
(McCranie and Smith 2017), 7? gottei (McCranie and
Smith 2017), 7) hendersoni (Stafford 2004), 7? olympia
(Townsend et al. 2013), 7. psittaca (McCranie 2011), and
T. stenigrammi (McCranie and Smith 2017).
Members of the 7? taeniata group are distributed
in all Mesoamerican countries and the northwestern-
most country of South America, i.e., Colombia (Table
3), as follows: Mexico (11 species), Belize (two),
Guatemala (six), El Salvador (one), Honduras (eight),
Nicaragua (one), Costa Rica (one), Panama (two),
and Colombia (one). Most of this group’s species are
limited in distribution to single countries (1.e., endemic),
amounting to 20 of the 26 species (Table 3). Thus, only
five of the species are found in more than one country: 7°
brevicauda (Guatemala and El Salvador), 7? cuniculator
(Mexico and Belize), 7. impensa (Mexico, Guatemala,
and Honduras), 7: reticulata (Nicaragua, Costa Rica,
Panama, and Colombia), and 7. vulcani (Mexico and
Guatemala).
Members of the 7. taeniata group are found in most of
the forest formations which occur throughout the group’s
range (Table 3) at low, moderate, and intermediate
elevations (ranging from near sea level to 2,300 m).
Seventeen species are distributed at low elevations (sea
level to 600 m), sixteen at moderate elevations (601-
Amphib. Reptile Conserv.
1,500 m), and five at intermediate elevations (1,501-
2,300 m). More specifically, the numbers of species
found in particular forest formations are as follows (Table
3): Lowland Moist Forest (nine species), Lowland Dry
Forest (eight), Lowland Arid Forest (one), Premontane
Wet Forest (11), Premontane Moist Forest (nine), Lower
Montane Wet Forest (two), Lower Montane Moist Forest
(two), and Lower Montane Dry Forest (one). Thirteen
of the 26 species (50.0%) occupy more than one forest
formation; the remainder are found in only a single
formation.
Most of the species in the 7’ taeniata group (22 of 26
species; 84.6%) are limited to occurrence on only one
versant. Of the 22 single-versant species, 10 are limited
to the Pacific versant and 12 to the Atlantic versant.
Only two species (T° reticulata and T. triseriata) occupy
both versants, and one other species (7° tritaeniata) is of
insular distribution (on the Bay Islands of Honduras).
The conservation status of the members of the 7°
taeniata group were examined using the IUCN and
EVS systems. The IUCN system is the more broadly
used of the two systems, but proves to be less useful for
comprehensive conservation assessment than the EVS
system (Table 3). For example, the largest number of
Species (nine) is allocated to the Data Deficient category
of IUCN and the next largest (seven) to the Not Evaluated
category. These two categories, which divulge no useful
information about the conservation status of the species
involved, are applied to 16 species, or 61.5% of the 25
species in the taeniata group that can be categorized.
(Note that 7: trilineata is too poorly known to allow
for categorization, because it is known only from the
holotype from an unknown locality). Five species are
allocated to the Least Concern category (7! brevicauda,
T. cuniculator, T: impensa, T. reticulata, and T: taeniata).
With the exception of 7! taeniata, the remaining four
are the most broadly distributed geographically and
ecologically, and are allocated to the threatened categories
of Critically Endangered (7° tritaeniata), Endangered (T.
flavilineata), and Vulnerable (7! jani and T: psittaca).
The EVS system (Wilson et al. 2013a,b; Johnson et
al. 2015) is of greater utility, as all species, other than 7.
trilineata, can be categorized (Table 3). The EVS range
from 10 to 16, with an average score of 14.4. Eighteen
of the 25 species that can be categorized (72.0%) are
allocated to the high vulnerability category (with scores
ranging from 14 to 16); the remaining seven (28.0%) are
placed in the medium vulnerability category (with scores
ranging from 10 to 13). Thus, none of the species are
allocated to the low category of vulnerability. Typically,
Mesoamerican species of TZantilla are restricted in
distribution and this phenomenon is reflected in their
generally high EVS.
Johnson et al. (2017) and Mata-Silva et al. (2019)
introduced the concept of conservation priority levels
by combining patterns of physiographic distribution
with environmental vulnerability scores. These levels
September 2020 | Volume 14 | Number 3 | e258
A new species of Jantilla from Honduras
can theoretically range from one to 24 in Mesoamerica,
but practically range from one to 18. For the species of
the 7. taeniata group these levels (Table 3) range from
one to nine, as follows: one (15 species), two (three),
seven (two), eight (four), and nine (one). Fifteen of the
25 species (60.0%) for which the priority levels can be
determined are allocated to conservation priority level
one and, thus, merit the greatest degree of conservation
attention among the species in the 7’ faeniata group
(Table 3).
The holotype of ZYantilla lydia was found in a strip
of forest in the “regeneration” stage in the middle of a
cultivation of Cocos nucifera adjoining a mangrove
forest almost 0.5 km from the Rio Salado. Although in
some respects, the known ecology of 7: /ydia is similar
to that of other species within the 7: taeniata group in
Honduras; specifically, all of these species occur in leaf
litter, although 7 /ydia occurs at lower elevations than the
other species and, unlike the other species in this group,
it was found in Lowland Wet Forest (Holdridge 1967).
In contrast, 7. exce/sa occurs mainly at higher elevations
and almost exclusively in Premontane Moist Forest and
Lowland Dry Forest, but also in Lowland Wet Forest and
typically in proximity to rivers; 7’ gottei also occurs at
higher elevations than 7! /ydia and is found in pine forests
within the Premontane Moist Forest and Lowland Dry
Forest zones in the middle basin of the Choluteca River
in south-central Honduras; 7’ impensa occurs in Tropical
and Subtropical Humid Forests, mainly in primary
forests and is known to use rotting logs for refuge, as
well as leaf litter; 77 olympia is known from Premontane
Moist Forest; 7! psittaca occurs at similar elevation but
in Broadleaf Primary Rain Forest and Pine Savanna,
and also occurs in rotting logs; 7. stenigrammi occurs at
higher elevations in disturbed pine-oak forest and Lower
Montane Wet Forest adjacent to the Sico Tinto River; and
T. tritaeniata occurs at similar low elevations as T: lydia,
but only on Isla Guanaja (Ariano-Sanchez and Sunyer
2013; Campbell 1998; McCranie 2011la; McCranie and
Smith 2017; Smith and Williams 1966; Townsend et al.
2013). Thus, 7 /ydia is distinct from other species within
the Tantilla taeniata group in Honduras in terms of its
distribution and ecology, as well as its morphology.
This discovery highlights the fauna of the Refugio
de Vida Silvestre Barras de Cuero y Salado (RVSBCS),
and the importance of establishing and maintaining a
network of protected areas to ensure the conservation
of representative communities throughout the country
of Honduras. Human activities in the landscape
surrounding the RVSBCS involve the maintenance of
agricultural systems (i.e., banana, coconut, and African
oil palm), livestock production, and human settlements.
These activities have reduced significantly the area of the
ecosystem within which 7: lydia evolved. Additionally,
existing patches of potential habitat are threatened by
continued intensification of these human activities,
which results in further reduction in available habitat or
Amphib. Reptile Conserv.
98
fragmentation that interrupts the connectivity of existing
forest patches (Ferran 1992). As such, the long-term
conservation of 7! /ydia is likely at risk. While no attempts
are underway to quantify the species’ population status, it
is likely to be decreasing, as 1s the case with many of the
other species of flora and fauna restricted to this region
One final note regarding the taxonomy of the 7:
taeniata group needs to be mentioned. As indicated by
McCranie and Smith (2017: 346), “problems remain
with the taxonomy of the El Salvadoran and Nicaraguan
specimens identified in the literature as 7’ ftaeniata.
Kohler (2003, 2008) and Sunyer and Kohler (2007)
provided photographs of recently collected Nicaraguan
specimens, and Kohler et al. (2005) included a
photograph of a recently collected El Salvador specimen.
These specimens also need to be addressed in light of
the new taxonomic change[s].” This work remains to be
completed.
Acknowledgments —The authors especially thank
José Paz, Sunilda Hernandez, David Jiménez, and Irma
Caceces of the community of Salado Barra for their
cordial attention during our stays, with them, this work
in the field was much more comfortable and enjoyable:
Glenda Castillo, Stefani Jiménez, and Lourdes Alvarado
for assisting us in the field work; and Ivany Argueta of
Fundacion Cuero y Salado (FUCSA) for allowing us to
carry out research inside the refuge and providing us
transport to sampling points. Thanks also go to David
King, José Mario Solis, Jeffrey Larkin Sr., and Vicente
Mata-Silva for their valuable comments, and Josue
Ramos for his ideas about enriching this manuscript.
Special thanks to Emmanuel Orellana Murillo for
his help with confirming the pattern and scale data
on the holotype. Thanks also to Tania Lopez for the
identification of plants found at the type locality from
the photographs, and Carlos Andino of UNAH-VS for
supporting us with the logistics of the field trips. The new
species holotype (UVS-V 1189) was collected under the
permission of collection Resolucion DE-MP-067-2018
and Dictamen DVS-008-2018 of Instituto Nacional de
Conservacion y Desarrollo Forestal, Areas Protegidas
y Vida Silvestre (ICF). CAAF would like to thank
Lorely Molinares for her many expressions of support,
patience, and affection, especially in connection
with this paper. Work by JHT on this manuscript was
completed while on sabbatical as a Fulbright Scholar
and Visiting Professor at the Centro Zamorano de
Biodiversidad, and JHT would like to thank Timothy
Moerland, Deanne Snavely, N. Bharathan, Erika
Tenorio, Oliver Komar, and Eric Van De Berghe for
their support. We are indebted also to Louis W. Porras
for his extensive, incisive, and insightful comments on
this paper. Lastly, we wish to thank the two reviewers
of this paper, Vicente Mata-Silva and Javier Sunyer
MacLennan, for their superb work, which significantly
improved the manuscript.
September 2020 | Volume 14 | Number 3 | e258
Antunez-Fonseca et al.
Revised Key to Members of Tantilla taeniata Group
Townsend et al. (2013) published the most recent key to the members of the 7antilla taeniata group. Since that paper appeared,
several new species have been described and placed in this group (Batista et al. 2016; McCranie et al. 2017; and herein), so this is
an opportune time to revise the key for the identification of 25 of the 26 species now recognized (the information available on 7°
trilineata remains insufficient to include this poorly known taxon in the key; see Tables 1 and 2).
I Palenuddonrsdlesthipesasen..Aal (AOR srr Sie: Sun, fle Lee. Fe MSY re Als Lee Ws SY Bean 2 0 Oe My 2
Pale middorsal stripes presents -vaniouslys- developed oc. ede .ts ees. gina dasasieatunwtetibtede medals cxttyina Ady bEtet as Bute dcasate 6
26 Pale slateral "stripessprosent: -al@iee Vem et li vote OO E ce ccreg eer ek oiou: eras spl ths Mn Rl Bi Sep RCE Geo lore « Ge, cheers SAR 3
Pale lateral stripe interrupted along middle of body, present only on anterior portion of body, or absent...4
3. Pale nuchal band divided middorsally and laterally, pale lateral stripe well developed... 7) jani (in part)
Pale nuchal band complete; pale lateral stripe barely discernible....................0000..000...04. T. cuniculator
4. Pale lateral stripe present but interrupted along middle of body..............0000000000000.c cee T. briggsi
Pale+ lateral. stripe... if, present) .contined” (0. anterior. portion, Ol, DOU. ~. 25:5 sy hee dia Bs Ga Sh a pel le pets 5
5. Pale nuchal band poorly developed, confined to scale posterior to parietals; subcaudals fewer than 60 (known
Ree: ASN) ey eens mus Lit Oeste ak wena ens UATE oe 0 RO ot Uae ee ee T. tayrae (in part)
Pale nuchal band well developed, extending onto parietals; subcaudals more than 60 (single
Janke ha yield Melos Nepal Mowry Reine DEL Rabe terry) OnE a rr h® tA yie Miami ser sri hemes te eee be kr SN 11h). Miran Ib fl tt: T. johnsoni
6. Subcaudals fewer than 30 (known range, 21-26)........0000000coc ccc cece e nce een eects T. brevicauda
SU DEA al SatiOtS LAT OF see Ca inte UT. os, Ae WE oe eS ey TON, oA OB Ae eR. eee Meee, Dae 7
7. Pale lateral stripe occupies rows 4 and adjacent halves of rows 3 and 5............0...00ccccc cece eee 8
Pale lateral stripe occupies adjacent halves of rows 3 and 4 or restricted to row 4............00...000. ccc ceeeeee. 1]
S$". Pale:-nuchalscollan=does snot, cross:—last suptalabials Ant. ABP tease Alcea Be BO ee hl occ ee T! oaxacae
Palesmuchal collamcrossesslastasupralcibial’: ie stances chess soenieh a caer Aneesh ua pyle Made Feata Pande kee tool 25 samlnst So Ast 9
9. Pale nuchal collar divided medially; well-developed dark stripe present on lateral edges of
VSNL et ee Me eas ene ea Te ey Ok Oe, ee ROT) ose CAO Berne er ee AO ee .T reticulata
Pale=nuchall “collar scomplete aventer. essentially. = immaculate: nc sis Mo Sand foe ee Bhat WE 10
10. Pale middorsal stripe confined to middorsal scale row; subcaudals 65 (single known
MALU ee heb tetin ty OR, Le ee eaten Le Oe Ee Ee SL ote ME ng PE ME, hoe Cet hI IN sent Re ee: T. berguidoi
Pale middorsal stripe occupies middorsal scale row and adjacent halves of paravertebral rows; subcaudals 56
Of LEWwenr (KNOW, gLaANeC: ato DO), coh LAS oer eo) ee We leh A Bly, el ata EY ae oly T. flavilineata
IL, -Pale-nuchal? band “rédticed’ to hwou nuchal Spots) Ms" aetna 1 Paced te Mahle ietthy Monel Lue voit: T. striata
Pale nuchal band complete, divided medially, or divided both medially and laterally........0.0 000.00 12
12. Pale middorsal stripe on middorsal scale row and some portion of paravertebral rows at least on posterior portion
UA CL e(Ck ete sad Ronee aR pee AU Rnd Alera Es ot dd oe elie Eh pehetle ds bake ad A thee arth A nian coo pk nD wen 13
Pale middorsal stripe confined to middorsal scale row, or on middorsal scale row and some portion of
paravertebral rows on anterior portion of body, continuing on or reducing to middorsal row on posterior portion
OF COON as, were enh aseresy mone Pee moprsliny, sau OO aL Ea Wey doa eae) ae pen tn eee aa MN a awa, ae eiee, ONO
13. Pale middorsal stripe confined to middorsal scale row anteriorly, expanding to some portion of paravertebral
LOM SA POSUCMI OR IVS din hae as tial not so emerge, urd seas Nb hd OR Sohoidia mitten Auch t ete pthebssh att ooo beans d nel ank Athy Been aS Malt oaths Mba 14
Pale middorsal stripe on middorsal scale row and some portion of paravertebral rows along length
ORIDOY te | er ees Lear ee ee, Cee Se OL We Rg er Stn A. eT ONL DM SES ete 15
14. Lower half to two-thirds of paraventral scale row colored similarly to ventrals..........7). stenigrammi
Paraventral scale row pigmented on anterior half or more of trunk, upper half of scale darkly pigmented
WN ALEAG Stan U1 Dee hae Sete oe MAL 2 ee PL ED WOU Se ge A Re ate lee EAR oe mee OE ne Pate | T. triseriata
TS Ventral Suptace: SOMme shades Ol pedis! £: Bh. nL eR eGR Sf, SOMITE A ag 1824. AP Semen, Bose BS. oR RE af DATS OR GBS 2 Oe Ee 16
Venitalsuitace yellow Or Sy Mite 8m i, «ces edir tr aieer, Sea ME WE Unease re yee Bee Wale ae ole bl ee toe Ba) 17
forVenitraluscales=li53-Or more aneve sl SOS), scare ht Mage nel Je ces Pt te, eo lcs I se el oly T! psittaca
Ventral-seales lS z-omtewer (range al S152) eta aie EO eee | ON wee, ogee eee T. taeniata
7 Palesnuchal collar divided. oh. intern. ty tee rh ee wir eile op owe MON rele APL Yn ba T. tritaeniata
Pale -auchalecollarsComplete. a,..,.6. sient Mat te LAS Re Oe OS Bin te ee Mela, hla ee he Oe SS 18
18: Venittals: 142-158" am DGThesexXeS= COM DIN 2.8 0P. th + mpbcngs ses wralets er of notte oh ple ae Aettow wagocnge ate Reraiahaore let plaeta neh T. gottei
Vout Sw Lokal oe Tite DOU SEXES COMMING fe cec sds cur a aotoen sear teat cee lmoupde. ne coined tse sence oe teethoe tha ee aaa 1. excelsa
19. Pale middorsal stripe on middorsal scale row and adjacent one-third of paravertebral rows on
anterior portion of body, reducing to middorsal row on posterior portion of body............... T. lydia
Pale middorsal stripe confined to middorsal scale row, either as continuous stripe or as fragmented series
(GUE S| BLU LES eek nly ea Ed een Os A tee ORR Oe, ee a Ma a I ay gh a et Re OR a De PR 20
Amphib. Reptile Conserv. 99 September 2020 | Volume 14 | Number 3 | e258
A new species of Jantilla from Honduras
20. Pale middorsal stripe fragmented, consisting of series of isolated spots...........00...00 0.0. cc cece cee cece eee 21
Pale middorsal stripe complete, but confined to middorsal row............0.00 0.0 c ccc cetce cece cee eee e scene et en beeen ens 24
21. Pale lateral stripe consisting of series of spots on dorsal scale row 4.0.0.0... cece cece ence ees T. olympia
Pale lateral stripe absent or present on some portion of dorsal scale rows 3 and 4........0.......000...0 00.0000. 22
22. Pale lateral stripe absent or barely evident on adjacent halves of dorsal scale rows 3 and 4 on anterior portion
GL DOs. yet Ae nS. eek ea eee ne ee Pe ee ee ee ee De T! tayrae (in part)
Pale lateral stripe present on adjacent portions of dorsal scale rows 3 and 4 length of body......................... 23
23. Pale nuchal band interrupted both dorsally and laterally...... 000000000000 e nent nents T. jani
Ralésnuchalebarid usually. *complete. 2) 8 eB Ra a Ore. en 8 ne Me neta WS iM ea a meee, A T. vulcani
ZA.“ PALAVEMtral eSGale wuld TOTTI ys UOLO MTS 2 ares ete ccc uy eBook Ne sta Dts epee ad covers op nde os eee etal T! tecta
Paraventral scale divided into dark upper half and pale lower half... 2.000.000.0000. coco cnc cece cece ens 25
25¢-Subcaudal' SCales: 56-0 lower Wanee 3256). oo) ke. os 2, el, ee as ee at, T. slavensi
Subcdudalsseales-64-.or more «(combined ange G4 72 ye eee cn, gases ibaa ey ons eRe ond Meta Ra AR ne oe RSA 26
26-eVenttalescales” 1 5d= Ok he Wel “(Cale lop og). te einen Meet lst Meo Mn, ean, hor ee et lee T. hendersoni
Weilttdlascales, 62° Or mores (Tange: LOD IES Meg A Re Sh Ne ee alld ooh T! impensa
Literature Cited
Ariano-Sanchez D, Sunyer J. 2013. Tantilla taeniata. La
Lista Roja de Especies Amenazadas de la UICN 2013:
e.T203329A2764084.
Baird SF, Girard C. 1853. Catalogue of North
American Reptiles in the Museum of the Smithsonian
Institution. Part I. Serpentes. Smithsonian Institution,
Washington, DC, USA. 172 p.
Batista A, Mebert K, Lotzkat S, Wilson LD. 2016. A
new species of centipede snake of the genus Zantilla
(Squamata: Colubridae) from an isolated premontane
forest in eastern Panama. Mesoamerican Herpetology
3: 949-960.
Campbell JA. 1998. Comments on the identities of certain
Tantilla (Squamata: Colubridae) from Guatemala,
with the description of two new species. Scientific
Papers, Natural History Museum, University of
Kansas 7: \-14.
Campbell JA, Smith EN. 1997. A new species of Tantilla
(Serpentes: Colubridae) from northeastern Guatemala.
Proceedings of the Biological Society of Washington
110: 332-337.
Canseco-Marquez L, Mendelson II JR, Gutiérrez-Mayén
G. 2002. A new species of large Tantilla (Squamata:
Colubridae) from the Sierra Madre Oriental of Puebla,
Mexico. Herpetologica 58: 492-497.
Dixon JR, Vaughan RK, Wilson LD. 2000. The
taxonomy of Tantilla rubra and allied taxa (Serpentes:
Colubridae). Southwestern Naturalist 45: 141-153.
Dowling HG. 1951. A proposed system for counting
ventrals in snakes. British Journal of Herpetology |:
97-99.
Ferran FI. 1992. Los Restos de la Opulencia: Estudio
Socio-ambiental del Refugio de Vida Silvestre Barras
de Cuero y Salado. Centro Agrondémico Tropical de
Investigacion Ensefianza (CATIE), Programa Manejo
Integrado de Recursos Naturales, Proyecto Rearm/
Cuencas, Turrialba, Costa Rica. 89 p.
Hofmann EP, Gray RJ, Wilson LD, Townsend JH. 2017.
Discovery of the first male specimen of Tantilla
Amphib. Reptile Conserv.
hendersoni Stafford, 2004 (Squamata: Colubridae),
from a new locality in central Belize. Herpetology
Notes 10: 53-57.
Holdridge LR. 1967. Life Zone Ecology. 2™ edition.
Tropical Science Center, San José, Costa Rica. 206 p.
Holm PA. 2008. Phylogenetic biology of the burrowing
snake tribe Sonorini (Colubridae). Ph.D. Dissertation,
University of Arizona, Tucson, Arizona, USA. 242 p.
IUCN. 2012. IUCN Red List Categories and Criteria:
Version 3.1. 2" edition. IUCN, Gland, Switzerland
and Cambridge, United Kingdom. 32 p.
IUCN Standards and Petitions Committee. 2019.
Guidelines for using the IUCN Red List Categories
and Criteria. Version 14. Prepared by the Standards
and Petitions Committee. Available: http://www.
iucnredlist.org/documents/RedListGuidelines. pdf
[Accessed: 23 February 2020].
Johnson JD, Mata-Silva V, Wilson LD. 2015. A
conservation reassessment of the Central American
herpetofauna based on the EVS measure. Amphibian
& Reptile Conservation 9(2) [General Section]: 1-94
(e100).
Johnson JD, Wilson LD, Mata-Silva V, Garcia-Padilla
E, DeSantis DL. 2017. The endemic herpetofauna of
Mexico: organisms of global significance in severe
peril. Mesoamerican Herpetology 4: 544-620.
Koch C, Venegas PJ. 2016. A large and unusually colored
new snake species of the genus Zantilla (Squamata:
Colubridae) from the Peruvian Andes. PeerJ 4: e2767.
Kohler G. 2003. Reptiles of Central America. Herpeton-
Verlag Elke Kohler, Offenbach, Germany. 367 p.
Kohler G. 2008. Reptiles of Central America. 2" edition.
Herpeton-Verlag Elke Kohler, Offenbach, Germany.
400 p.
Kohler G. 2012. Color Catalogue for Field Biologists.
Herpeton-Verlag Elke Kohler, Offenbach, Germany.
49 p.
Kohler G, Vesley M, Greenbaum E. 2005 [dated 2006].
The Amphibians and Reptiles of El Salvador. Krieger,
Malabar, Florida, USA. 238 p.
Mata-Silva V, DeSantis DL, Garcia-Padilla E, Johnson
September 2020 | Volume 14 | Number 3 | e258
Antunez-Fonseca et al.
JD, Wilson LD. 2019. The endemic herpetofauna of
Central America: a casualty of anthropocentrism.
Amphibian & Reptile Conservation 13(1) [General
Section]: 1-64 (e168).
McCranie JR. 201lla. The Snakes of Honduras:
Systematics, Distribution, and Conservation.
Contributions to Herpetology, Volume 19. Society for
the Study of Amphibians and Reptiles, Ithaca, New
York, USA. 714 p.
McCranie JR. 2011b. A new species of Tantilla of
the taeniata species group (Reptilia, Squamata,
Colubridae, Colubrinae) from northeastern Honduras.
Zootaxa 3037: 37-44.
McCranie JR, Smith EN. 2017. A review of the
Tantilla taeniata species group (Reptilia: Squamata:
Colubridae: Colubrinae) in Honduras, with the
description of three new species. Herpetologica 73:
338-348.
Orellana Murillo E, Antunez-Fonseca CA, Townsend JH.
2020. Geographic distribution. 7Zantilla gottei (Gotte’s
Centipede Snake). Herpetological Review 51: 549.
Savage JM. 1973. A revised terminology for plates in the
loreal region of snakes. British Journal of Herpetology
5: 360-362.
Smith HM, Williams KL. 1966. A new snake (Zantilla)
from Las Islas de la Bahia, Honduras. The
Southwestern Naturalist 11: 483-487.
Stafford PJ. 2004. A new species of Zantilla (Serpentes:
Colubridae) of the taeniata group from southern
Belize. Journal of Herpetology 38: 43-52.
Sunyer J, Kohler G. 2007. New country and departmental
records of herpetofauna in Nicaragua. Salamandra
43: 57-62.
Townsend JH, Wilson LD, Medina-Flores M, Herrera-B
LA. 2013. A new species of centipede snake in the
Tantilla taeniata group (Squamata: Colubridae) from
premontane rainforest in Refugio De Vida Silvestre
Texiguat, Honduras. Journal of Herpetology 47: 191—
200.
Uetz P, Freed P, HoSek J. 2020. Tantilla. The Reptile
Database. Available: http://www.reptile-database. org
[Accessed: 13 May 2020].
Amphib. Reptile Conserv.
Wilson LD. 1976. Variation in the South American
colubrid snake Zantilla semicincta (Dumeéril, Bibron,
and Dumeril), with comments on pattern dimorphism.
Bulletin of the Southern California Academy of
Sciences 75: 42-48.
Wilson LD. 1982. A review of the colubrid snakes of the
genus Zantilla of Central America. Milwaukee Public
Museum Contributions in Biology and Geology 52:
1-77.
Wilson LD. 1983. A new species of Zantilla of the
taeniata group from Chiapas, Mexico. Journal of
Herpetology 17: 54-59.
Wilson LD. 1985. TYantilla reticulata. Catalogue of
American Amphibians and Reptiles 370.1. 1 p.
Wilson LD. 1999. Checklist and key to the species of
the genus Tantilla (Serpentes: Colubridae), with
some distributional commentary. Smithsonian
Herpetological Information Service 122: 1-34.
Wilson LD, McCranie JR. 2003. The conservation
status of the herpetofauna of Honduras. Amphibian &
Reptile Conservation 3(1): 6-33 (e12).
Wilson LD, Johnson JD, Mata-Silva V. 2013a. A
conservation reassessment of the amphibians of
Mexico based on the EVS measure. Contribution
to Special Mexico Issue. Amphibian & Reptile
Conservation 7(1): 97-127 (e69).
Wilson LD, Mata-Silva V, Johnson JD. 2013b. A
conservation reassessment of the reptiles of Mexico
based on the EVS measure. Contribution to Special
Mexico Issue. Amphibian & Reptile Conservation
7(1): 1-47.
Wilson LD, Mata-Silva V. 2014. Snakes of the genus
Tantilla (Squamata: Colubridae) in Mexico: taxonomy,
distribution, and conservation. Mesoamerican
Herpetology 1: 5-95.
Wilson LD, Mata-Silva V. 2015. A checklist to the
snakes of the Zantilla clade (Squamata: Colubridae),
with comments on taxonomy, distribution, and
conservation. Mesoamerican Herpetology 2: 418—
498.
Wilson LD, Meyer JR. 1971. A revision of the
taeniata group of the colubrid snake genus Tantilla.
Herpetologica 27: 11-40.
Cristopher A. Antunez-Fonseca is a herpetologist from Tegucigalpa, Francisco Morazan, Honduras.
His focus 1s on the diversity, distribution, systematics, ecology, natural history, and venomics of the
Honduran herpetofauna. Christopher obtained his B.Sc. in Biology from the Universidad Nacional
Autonoma de Honduras, has worked as a Technical Assistant in herpetology at the Universidad
Nacional Autonoma de Honduras of Valle de Sula (UNAH-VS), and is currently a Research
Associate in herpetology at the Escuela Agricola Panamericana Zamorano (EAP). Cristopher is the
author or co-author of four peer-reviewed articles primarily on herpetology, including recent papers
on new records for two species of the genus Zanitilla.
September 2020 | Volume 14 | Number 3 | e258
Amphib. Reptile Conserv.
A new species of Jantil/la from Honduras
Jocelyn A. Castro is a student of biology at the Universidad Nacional Autonoma de Honduras. She is
a co-author of a recent scientific publication which includes the description of the first known juvenile
specimen of Diploglossus scansorius from a new locality in north-central Honduras. Jocelyn has research
interests in snake venoms, and the behavior, ecology, systematics, and taxonomy of the Honduran
herpetofauna.
Farlem G. Espajia has a B.Sc. in Biology from the Universidad Nacional Autonoma de Honduras,
and is a Researcher at the Mesoamerican Development Institute, Lowell, Massachusetts, USA. Farlem’s
major research interests are in the zoology and ecology of organisms, and he is dedicated to investigating
diverse fauna in protected natural areas and in intervened systems with a greater focus on mammals and
their interactions, as well as the geographic dispersion of organisms in different habitats.
Josiah H. Townsend is an Associate Professor in the Department of Biology at Indiana University
of Pennsylvania, and a Research Associate of the Carnegie Museum of Natural History (Pittsburgh,
Pennsylvania, USA) and Centro Zamorano de Biodiversidad (Francisco Morazan, Honduras). He
received his Bachelor’s degree in Wildlife Ecology and Conservation, Master’s degree in Latin American
Studies, and Doctoral degree in Interdisciplinary Ecology from the University of Florida (Gainesville,
Florida, USA), and has been a faculty member at Indiana University of Pennsylvania since 2012. Josiah
spent the 2019-2020 academic year as a Fulbright Scholar in the Centro Zamorano de Biodiversidad and
the Departamento de Ambiente y Desarrollo at Escuela Agricola Panamericana Zamorano, Honduras,
and is continuing there as a Visiting Professor during the COVID-19 quarantine. His research focuses on
the systematics, evolution, and conservation of the northern Central American herpetofauna, and he has
co-authored 129 scientific papers and notes to date, including the descriptions of 24 recognized species
of amphibians and reptiles, as well as two books. In addition, he co-edited the book Conservation of
Mesoamerican Amphibians and Reptiles.
Larry David Wilson is a herpetologist with lengthy experience in Mesoamerica. He was born in
Taylorville, Illinois, USA, and received his university education at Millikin University in Decatur, Illinois,
the University of Illinois at Champaign-Urbana (B.S. degree), and at Louisiana State University in Baton
Rouge (MS. and Ph.D. degrees). He has authored or co-authored 430 peer-reviewed papers and books
on herpetology, including many recent papers on the EVS system and assessments of the herpetofauna
of several individual states (and regions) of Mexico. Larry is the Senior Editor of Conservation of
Mesoamerican Amphibians and Reptiles and a co-author of eight of its chapters. His other books include
The Snakes of Honduras, Middle American Herpetology, The Amphibians of Honduras, Amphibians &
Reptiles of the Bay Islands and Cayos Cochinos, Honduras, The Amphibians and Reptiles of the Honduran
Mosquitia, and Guide to the Amphibians & Reptiles of Cusuco National Park, Honduras. To date, he has
authored or co-authored the descriptions of 74 currently recognized herpetofaunal species, and seven
species have been named in his honor, including the anuran Craugastor lauraster, the lizard Norops
wilsoni, and the snakes Oxybelis wilsoni, Myriopholis wilsoni, and Cerrophidion wilsoni. Currently,
Larry is Co-chair of the Taxonomic Board for the journal Mesoamerican Herpetology.
102 September 2020 | Volume 14 | Number 3 | e258
Amphibian & Reptile Conservation
14(3) [Taxonomy Section]: 103-126 (e259).
Official journal website:
amphibian-reptile-conservation.org
urn:lsid:zoobank.org:pub:CBE74FDA-A9D0-4957-A2E5-6F29ADD40578
A new species of the genus Ceratophora Gray, 1835
(Reptilia: Agamidae) from a lowland rainforest in Sri Lanka,
with insights on rostral appendage evolution in Sri Lankan
agamid lizards
‘*Suranjan Karunarathna, 2**Nikolay A. Poyarkov, ‘Chamara Amarasinghe, ‘Thilina Surasinghe,
23Andrey V. Bushuev, *Majintha Madawala, *Vladislav A. Gorin, and °Anslem De Silva
'Nature Explorations and Education Team, No. B-1 / G-6, De Soysapura Flats, Moratuwa 10400, SRI LANKA *Department of Vertebrate Zoology,
Lomonosov Moscow State University, Leninskiye Gory, GSP—1I, Moscow 119991, RUSSIA ?*Joint Russian-Vietnamese Tropical Research and
Technological Center, 63 Nguyen Van Huyen Road, Nghia Do, Cau Giay, Hanoi, VIETNAM ‘Department of Biological Sciences, Bridgewater State
University, Bridgewater, Massachusetts, USA °Victorian Herpetological Society, PO Box 4208, Ringwood, Victoria 3134, AUSTRALIA °Amphibia
and Reptile Research Organization of Sri Lanka, 15/1, Dolosbage Road, Gampola, SRI LANKA
Abstract.—The genus Ceratophora (horn-lizards) comprises six species, all of which are endemic to Sri Lanka.
Herein, a new species of Ceratophora is described based on morphological and molecular evidence. The new
species is restricted to the Salgala Forest (~300 m asl elevation) in the Kegalle District of Sri Lanka, which
is in the northern part of the wet bioclimatic zone. The new species most closely resembles Ceratophora
aspera Ginther, 1864, but can be distinguished from it by body proportions, number of paravertebral and
ventral scales, and ND2 mtDNA data. Complete morphological description of two syntypes of C. aspera are
also provided, in addition to a key to the species of genus Ceratophora. The phylogenetic relationships and
evolution of rostral appendages in Sri Lankan agamid lizards are discussed in light of new data. According
to IUCN Red List criteria, the new species is categorized as Critically Endangered due to its range-restricted
habitat. The major threats for this species are habitat loss due to expansion of commercial-scale agriculture
and monoculture plantations, as well as illicit forest encroachments.
Keywords. Cophotis, Lyriocephalus, mtDNA, ND2, syntype, systematics, taxonomy
Citation: Karunarathna S, Poyarkov NA, Amarasinghe C, Surasinghe T, Bushuev AV, Madawala M, Gorin VA, De Silva A. 2020. A new species of the
genus Ceratophora Gray, 1835 (Reptilia: Agamidae) from a lowland rainforest in Sri Lanka, with insights on rostral appendage evolution in Sri Lankan
agamid lizards. Amphibian & Reptile Conservation 14(3) [Taxonomy Section]: 103-126 (e259).
Copyright: © 2020 Karunarathna et al. This is an open access article distributed under the terms of the Creative Commons Attribution License
[Attribution 4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction
in any medium, provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced,
are as follows: official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 14 September 2020; Published: 2 October 2020
Introduction
Sri Lanka and the Western Ghats of India are collectively
recognized as a biodiversity hotspot, rich in both diversity
and endemism among the herpetofaunal assemblages
(Bossuyt et al. 2004; Gunawardene et al. 2007). However,
this area supports the highest human population density
among the world’s biodiversity hotspots (Cincotta et al.
2000; Helgen and Groves 2005). The evolutionary and
phylogenetic uniqueness of Sri Lanka’s herpetofauna has
been well established (Bossuyt et al. 2004, 2005). Despite
its small land area, Sri Lanka is geographically diverse as
evidenced by the three peneplains of lowland (< 300 m
asl), midland (300-900 m asl), and highland (> 900 m asl),
that result in an elevation gradient (Cooray 1967). This
geographic variation, in conjunction with variability in
annual average precipitation, has resulted in three major
bioclimatic zones in Sri Lanka: the dry zone (< 1,000
mm), the wet zone (> 2,500 mm), and the intermediate
zone (> 1,500 mm) [Greller and Balasubramaniam 1980].
Further contributing to Sri Lanka’s geoclimatic diversity,
three distinct mountain ranges of the Central Highland,
Rakwana Hills, and the Knuckles Massif, also occur in Sri
Lanka (Gunatileke and Gunatileke 1990; MoE-SL 2012).
These geo-climatic variations have generated an array
of environmental gradients, creating niche filters that
promote speciation, which has led to the great diversity
of the herpetofauna in Sri Lanka. The great richness of
Sri Lankan herpetofauna can be attributed to insular
radiation, reproductive isolation, and high island-wide
Amphib. Reptile Conserv.
October 2020 | Volume 14 | Number 3 | e259
A new species of the genus Ceratophora
habitat heterogeneity and environmental complexity
(de Silva 2006; Meegaskumbura et al. 2019). Owing
to these drivers of diversity, there is a growing interest
in herpetological research in Sri Lanka, particularly in
taxonomy, phylogenetics, and ecology (Meegaskumbura
et al. 2002, 2019; Pyron et al. 2013; Grismer et al. 2016;
Karunarathna et al. 2019).
Among Sri Lanka’s herpetofaunal assemblages, the
agamid lizards warrant scientific attention. Agamids are
widespread in the Old World, particularly throughout
the Paleotropics, Palearctic, and Australasia. The 21
species of agamid lizards in Sri Lanka belong to six
genera, and include 19 (90.5%) species endemic to the
island (Somaweera and Somaweera 2009; de Silva and
Ukuwela 2020). The agamid genus Ceratophora Gray,
1835 1s endemic to Sri Lanka and currently comprises five
species (Pethiyagoda and Manamendra-Arachchi 1998)
with patchy distributions in the tropical montane and
lowland humid forests: C. aspera Gunther, 1864 (CITES
Appendix II, and EN), C. erdeleni Pethtyagoda and
Manamendra-Arachchi, 1998 (CR), C. karu Pethiyagoda
and Manamendra-Arachchi, 1998 (CITES Appendix I,
and CR), C. stoddartii Gray, 1834 (CITES Appendix
II, and EN), and C. tennentii Gunther, 1861 (CITES
Appendix II, and EN) [Gibson et al. 2020]. Ceratophora
is a genus of special interest to evolutionary biologists
since three of the five species (C. aspera, C. stoddartii,
and C. tennentii) possess a prominent rostral appendage,
which is absent in the other two (C. karu and C. erdeleni)
[Pethiyagoda and Manamendra-Arachchi 1998].
Rostral appendages (RA) represent tantalizing
organs which have evolved independently in a small
number of species across a wide range of taxa, and are
rarely observed in lizards (Johnston et al. 2012). They
have been recorded in the members of the families
Dactyloidae and Chamaeleonidae, and in three genera
of the agamid subfamily Draconinae (Williams 1979;
Macey et al. 2000a; Schulte et al. 2002). RA morphology
is profoundly different among different species of
Ceratophora suggesting the possibility of independent
evolution (Johnston et al. 2012). An earlier molecular
phylogeny for the group resulted in three equally
parsimonious hypotheses for RA evolution in this genus
(Macey et al. 2000b; Schulte et al. 2002), suggesting
either (1) independent evolution of RA in three lineages
of Ceratophora, (2) independent evolution of RA in
C. aspera and in the common ancestor of C. stoddartii
and C. tennentii, and C. erdeleni, with subsequent
reduction in C. erdeleni; or (3) evolution of RA in the
common ancestor of all Ceratophora, with subsequent
independent loss in C. karu and C. erdeleni (Johnston
et al. 2012; Whiting et al. 2015). Further morphological
and allometric analyses suggested that RA likely evolved
rapidly and independently in the three lineages of
Ceratophora as a result of sexual selection (in C. aspera
and C. stoddartii) or as a result of natural selection for
crypsis (in C. tennentii) [Johnston et al. 2012].
Amphib. Reptile Conserv.
Thus far, C. aspera has been considered to be the most
widely distributed species of the genus, occurring in
lowland rainforests and a few submontane forests in the
south-western part of Sri Lanka (Bahir and Surasinghe
2005). This species was described from two syntypes
(BMNH 1946.8.30.51—52) by Gunther (1864) with the
locality stated as “Ceylon” (historical name of Sri Lanka)
without a precise location. A closer examination of the
C. aspera type specimens, along with morphological
comparisons with additional museum materials and
live specimens from several localities in the wet zone
of Sri Lanka, revealed differences in morphological
and morphometric characters between the northern
and southern populations of C. aspera. Concordant
molecular divergence in the ND2 mitochondrial DNA
gene suggested that the population in the Salgala Forest
(northern part of the wet bioclimatic zone; Fig. 1) likely
represents a distinct species of Ceratophora, which is
described herein.
Materials and Methods
Field sampling and specimens. Field surveys were
conducted across different locations in Sri Lanka
covering several bioclimatic areas (e.g., dry zone,
intermediate zone, and wet zone). At each location, the
agamid species found were documented. On average,
10 man-hours were spent per location for the survey.
During these surveys, behavioral and other aspects of
natural history of the focal species were recorded. The
ambient temperature and the substrate temperature were
measured using a standard thermometer and a N19
Q1370 infrared thermometer (Dick Smith Electronics,
Shanghai, China), respectively. The relative humidity
and light intensity were measured with a QM 1594
multifunction environment meter (Digitek Instruments
Co., Ltd., Hong Kong, China). An eTrex® 10 GPS
(Garmin) was used to record elevation and georeference
specimen locations. Sex was determined by the presence
in males (M) or absence in females (F) of hemipenal
bulges and the rostral horn. The conservation status of
the species was evaluated using the 2007 IUCN Red List
Categories and Criteria Version 3.1 (IUCN Standards
and Petitions Subcommittee 2016).
Museum acronyms follow Uetz et al. (2019). The
type material discussed in this paper is deposited in
the National Museum of Sri Lanka (NMSL), Colombo.
Specimens were caught by hand and photographed in
life. They were euthanized using halothane and fixed in
10% formaldehyde for two days, washed in water, and
transferred to 70% ethanol for long-term storage. Tail
tip muscle tissues were sampled before fixation and
subsequently stored in 95% ethanol. For comparison, we
examined 33 specimens of Ceratophora, representing
all recognized species of the genus and including type
specimens, 12 additional specimens of two Cophotis
species, and four specimens of Lyriocepahlus. Specimens
October 2020 | Volume 14 | Number 3 | e259
Karunarathna et al.
[9 Dry zone
|) Intermediate zone
Wet zone
Ceratophora ukuwelai sp. nov.
*
@ Ceratophora aspera
@ Ceratophora stoddartii
© Ceratophora erdeleni
@ Ceratophora tennentii
@ Ceratophora karu
40 80
km
Fig. 1. Currently known distribution of Ceratophora ukuwelai sp. nov. and other localities for Ceratophora species examined in the
present study. For locality numbers see Table 1. Colors of icons correspond to those in Fig. 2. Star denotes the type locality of the
new species (Salgala Forest, Kegalle District, Sri Lanka).
that formerly belonged to the Wildlife Heritage Trust
(WHT) collection and bearing WHT numbers are
currently deposited in the NMSL, catalogued under
their original numbers. The full list of comparative
materials examined in this study is given in Appendix
1. Specimens in this study were collected during
a survey of the lizards of Sri Lanka under permit
numbers WL/3/2/42/18 (a, 2018 and b, 2019) issued
by the Department of Wildlife Conservation, and
permit numbers R&E/RES/NFSRCM/Extended/2019,
and R& E/RES/NFSRCM/2019-04 issued by the Forest
Department of Sri Lanka.
Morphometric characters. Thirty morphometric
measurements were taken using a Mitutoyo digital Vernier
calliper (to the nearest 0.1 mm), and detailed observations
of scales and other structures were made through Leica
Wild M3Z and Leica EZ4 dissecting microscopes. The
following symmetrical morphometric characters were
taken on the left side of the body: RAL, rostral appendage
length (distance between tip of snout and tip of horn);
Amphib. Reptile Conserv.
DLM, digit length manus (fork to digit tip, excluding the
claw); DLP, digit length pes (fork to digit tip, excluding
the claw); EN, eye to nostril length (distance between
anteriormost point of bony orbit and middle of nostril);
ES, snout length (distance between anteriormost point
of bony orbit and tip of snout, excluding appendage);
FEL, femur length (distance between groin and knee);
HD, head depth (maximum height of head, across eyes);
HEL, heel length (from wrist to tip of fourth finger);
HL, head length (distance between posterior edge of
mandible and tip of snout); HW, head width (maximum
width of head); IO, interorbital width (narrowest width
across frontal bone); JL, jaw length (from tip of snout
to end of mouth corner); LAL, forearm length (distance
from elbow to wrist with both upper arm and palm flexed
at 90°): OD, orbital diameter (greatest diameter of orbit);
PAL, palm length (from ankle to tip of fourth toe); SA,
snout to axilla (distance between axilla and tip of snout);
SN, snout to nostril (distance between tip of snout and
middle of nostril); SVL, snout-vent length (distance
between tip of snout and anterior margin of vent); TAL,
October 2020 | Volume 14 | Number 3 | e259
A new species of the genus Ceratophora
tail length (distance between anterior margin of vent and
tail tip); TBL, tibia length (distance between knee and
heel, with both tibia and tarsus flexed at 90°); TRL, trunk
length (distance between axilla and groin); UAL, upper-
arm length (distance between axilla and angle of elbow
at 90°).
Meristic characters. Twenty discrete characters
were recorded using Leica Wild M3Z and Leica EZ4
dissecting microscopes on both the left (L) and the
right (R) sides of the body (reported in the form L/R):
number of canthal scales (CAS), number of scales from
posteriormost point of naris to anterior most point of the
orbit; number of enlarged scales on the flanks (FLSP), in
between axilla and groin; number of supralabials (SUP)
and infralabials (INF) between the first labial scale and
the corner of the mouth; number of interorbital scales
(INOS), between the left and right supraciliary scale
rows; number of midbody scales (MBS) from the center
of mid-dorsal row diagonally towards the ventral scales
to mid-dorsal; number of midventral scales (MVS) from
the first scale posterior to the mental to last scale anterior
to the vent; number of dorsal paravertebral scales (PS)
between pelvic and pectoral limb insertion points along
a Straight line immediately left of the vertebral column;
number of postmentals (PM) bounded by chin scales, 1*
infralabial on the left and right and the mental; number of
supraciliary scales (SUS) above the eye; total lamellae on
manus I—V (SLM) counted from first proximal enlarged
scansor greater than twice width of the largest palm scale
to distalmost lamella at tip of digits; total lamellae on pes
I—-V (SLP), counted from first proximal enlarged scansor
greater than twice the width of the largest heel scale to
distalmost lamella at tip of digits.
DNA isolation, PCR, and sequencing. To determine
the genetic distinctiveness of the new species and its
phylogenetic position, a 1,065 bp fragment of ND2
mitochondrial DNA (mtDNA) gene and adjacent tRNAs
were amplified. The ND2 gene has been widely applied
in biodiversity surveys and phylogenetic studies on
Sri Lankan agamids, including members of the genus
Ceratophora (e.g., Macey et al. 2000a; Schulte et al.
2002; Grismer et al. 2016 and references therein). Total
genomic DNA was extracted from ethanol-preserved
femoral muscle tissue using standard phenol-chloroform-
proteinase K extraction procedures with consequent
isopropanol precipitation (protocols followed Hillis et
al. 1996). The concentration of total DNA was measured
in | ul using NanoDrop 2000 (Thermo Scientific, USA),
and consequently adjusted to ca. 100 ng DNA/ul.
Polymerase Chain Reaction (PCR) amplifications
were performed in 20 pl reactions using ca. 50 ng genomic
DNA, 10 nM of each primer, 15 nM of each dNTP, 50 nM
additional MgCl, Taq PCR buffer (10 mM Tris-HCl, pH
8.3, 50 mM KCI, 1.1 mM MgCl, and 0.01% gelatin) and
1 U of Taq DNA polymerase. The primers used in PCR
Amphib. Reptile Conserv.
and sequencing included two forward primers: Metfl
(5'-AAGCTTTCGGGCCCATACC-3'; Macey et. al.
1997) and ND2f17 (5'-TGACAAAAAATTGCNCC-3';
Macey et al. 2000b), and two reverse primers: COIR1
(5'-AGRGTGCCAATGTCTTTGTGRTT-3';
Macey et al. 1997) and ND2r102
(5'-CAGCCTAGGTGGGCGATTG-3'; Greenbaum
et al. 2007). The PCR conditions followed Agarwal et
al. (2017). PCR products were loaded onto 1% agarose
gels and visualized in agarose electrophoresis in the
presence of ethidium bromide. PCR products were
purified using 2 wl of a 1:4 dilution of ExoSAP-IT
(Amersham, United Kingdom) per 5 pl of PCR product
prior to cycle sequencing. Purified PCR products were
sequenced bidirectionally at Genetech Sri Lanka Pvt.
Ltd., Colombo, Sri Lanka. The obtained sequences were
deposited in GenBank under the accession numbers
MT992241—MT992242 (Table 1).
Phylogenetic analyses. The ND2 sequences of all
Ceratophora species and the representatives of all other
Draconinae genera for which the homologous sequences
were available from GenBank, with the addition of the
newly obtained sequences, were used to examine the
genealogical relationships within the genus Ceratophora
(summarized in Table 1). In total, VD2 sequence data were
analyzed for 29 specimens of Draconinae, including nine
samples of Ceratophora, and the sequence of Mantheyus
Phuwuanensis (Manthey and Nabhitabhata, 1991) was
used to root the tree according to its phylogenetic position
as the sister lineage to all remaining Draconinae (Grismer
et al. 2016). Nucleotide sequences were aligned in
MAFFT v.6 (Katoh et al. 2002) with default parameters,
and subsequently checked visually in BioEdit v.7.0.5.2
(Hall 1999) and slightly adjusted. Mean uncorrected
genetic distances (p-distances) were calculated in MEGA
v.6.0 (Tamura et al. 2013).
The matrilineal genealogy of Draconinae was inferred
using Bayesian inference (BI) and Maximum Likelihood
(ML) approaches. The optimal evolutionary models for
the data set analysis were estimated in MODELTEST
v.3.6 (Posada and Crandall 1998). The best-fitting model
of DNA evolution for both BI and ML analyses was the
HK Y+G model for all three codon partitions of the ND2
gene, as suggested by the Akaike Information Criterion
(AIC). BI analysis was conducted in MrBayes v.3.1.2
(Ronquist and Huelsenbeck 2003); Metropolis-coupled
Markov chain Monte Carlo (MCMCMC) analyses were
performed with one cold chain and three heated chains
for 20 million generations and sampled every 2,000
generations. Five independent MCMCMC iterations
were performed and the first 1,000 trees were discarded as
burn-in. The convergence of the iterations was diagnosed
by examining the likelihood plots in TRACER v.1.6
(Rambaut et al. 2014), and the effective sample sizes
(ESS) were all above 200. Confidence in nodal topology
was estimated by calculating posterior probabilities (BI
October 2020 | Volume 14 | Number 3 | e259
Karunarathna et al.
Table 1. ND2 mtDNA gene sequences and voucher specimens of Agamidae taxa included in the phylogenetic analyses in this
study. For sampling localities of Ceratophora species in Sri Lanka see Fig. 1. Sequences generated in this study are marked with an
asterisk (*); n-dash (—) denotes no data available.
No. Species Locality Museum ID GenBank A.N.
i Ceratophora stoddartii Sri Lanka: Sita Eliya (6) WHT1682 AF364053
2 Ceratophora stoddartii Sri Lanka: Namunukula (8) WHT1511 AF364054
3 Ceratophora stoddartii Sri Lanka: Tangamalai (7) WHT1512 AF 128492
4 Ceratophora erdeleni Sri Lanka: Rakwana (3) WHT 1808 AF128522
5 Ceratophora tennentii Sri Lanka: Knuckles (5) WHT 1633 AF128521
6 Ceratophora karu Sri Lanka: Rakwana (4) WHT 2259 AF128520
7 Ceratophora aspera Sri Lanka: Kottawa (2) WHT1825 AF128491
8 Ceratophora ukuwelai sp. nov.* Sri Lanka: Kegalle District: Salgala (1) NMSL 2020.05.01 MT992241
9 Ceratophora ukuwelai sp. nov.* Sri Lanka: Kegalle District: Salgala (1) NMSL 2020.05.02 MT992242
10 Cophotis ceylanica Sri Lanka: Nagrak Division WHT2061 AF 128493
11 Cophotis dumbara Sri Lanka: Knuckles = GQ502785
12 Lyriocephalus scutatus Sri Lanka: Puwakpitiya WHT2196 AF 128494
13 Aphaniotis fusca Malaysia: Selangor: Ulu Gombak TNHC57943 AF128497
14 Harpesaurus borneensis Malaysia: Sarawak: Kubah N_P. KUHE 59801 LC469915
15 Cristidorsa otai Myanmar: Kachin CAS234833 MKO001401
16 Salea kakhienensis China: Baoshan: Qushi CAS207492 GQ502784
17 Pseudocalotes brevipes Vietnam: Vinh Phuc: Tam Dao MVZ224106 AF 128502
18 Diploderma splendida China: Sichuan: Ya'an CAS194476 AF128501
19 Acanthosaura lepidogaster Vietnam: Vinh Phuc: Tam Dao MVZ224090 AF 128499
20 Bronchocela cristatella Malaysia: Selangor: Ulu Gombak TNHC57874 AF 128495
21 Gonocephalus grandis Malaysia: Selangor: Ulu Gombak TNHC56500 AF 128496
22 Malayodracon robinsonii Malaysia: Pahang: Cameron Highlands LSUHC5873 MK001399
23 Calotes versicolor Myanmar: Yangon CAS208157 DQ289478
24 Draco indochinensis Vietnam: Gia Lai: Ankhe MVZ222156 AF 128477
25 Ptyctolaemus gularis Myanmar: Kachin: Putao CAS221515 AY555838
26 Japalura variegata India: Sikkim: Gangtok ZISP20922 AF128479
27 Otocryptis wiegmanni Sri Lanka: Yodaganawa WHT2262 AF128480
28 Sitana ponticeriana Sri Lanka: Hambantota WHT2060 AF 128481
29 Mantheyus phuwuanensis Laos: Bolikhamxay: Thaphabat FMNH255495 AY555836
PP). ML analysis was conducted using the RAxML
web server (https://raxml-ng.vital-it.ch/; Kozlov et al.
2018). Nodal support was assessed by non-parametric
bootstrapping (ML BS) with 1,000 pseudoreplicates
(Felsenstein 1985). The nodes with BI PP values > 0.95
and LM BS values > 75% were a priori regarded as
strongly supported; while BI PP values between 0.95-
0.90 and ML BS values between 75-50% were regarded
as tendencies. Lower values were regarded as indicating
not significantly supported (Huelsenbeck and Hillis
1993).
Divergence time estimations. Molecular divergence
dating was performed in BEAST v.1.8.4 (Drummond et
al. 2012). An uncorrelated lognormal relaxed clock was
set for our data. Substitution models and partitioning
Amphib. Reptile Conserv.
schemes consistently remained the same as those used
in the BI and ML phylogeny reconstructions. The Yule
model was set as the tree prior and a constant population
size and default priors were assumed for all other
parameters. Two runs were conducted of 40 million
generations, sampling every 4,000 generations, to obtain
10,000 trees for the analysis. We also assumed parameter
convergence in Tracer v.1.6 and discarded the first 10%
of generations as burn-in. Since no Ceratophora fossils
are known, we relied on three calibration priors for the
subfamily Draconinae obtained from a recent large,
phylogenomically-wide revision of agamids (Grismer
et al. 2016). Calibration points were as follows: (1) the
most recent common ancestor (tWRCA) of the genus
Ceratophora (18.3 + 1.8 million years ago [Ma]); (2)
tMRCA of the genera Ceratophora, Lyriocephalus, and
October 2020 | Volume 14 | Number 3 | e259
A new species of the genus Ceratophora
Cophotis (28.1 + 2.8 Ma); and (3) tMRCA of the genera
Ceratophora, Lyriocephalus, Cophotis, Bronchocela,
Gonocephalus, Aphaniotis, and Harpesaurus (50.8 + 5.1
Ma).
Rostral appendage evolution analysis. BEAST v.1.8.4
was used to generate a trimmed ultrametric chronogram
for the Sri Lankan Draconinae with one specimen
per species included in the analysis to investigate the
evolutionary history of RA in Ceratophora and the
closely related genera Lyriocephalus and Cophotis. The
full dataset consisted of all six species of Ceratophora,
including the newly discovered population of
Ceratophora sp. from Salgala Forest, two species of
Cophotis, and a single species of Lyriocephalus. Data
were added for the newly discovered population of
Ceratophora sp. from Salgala Forest to the Johnston
et al. (2012) morphometric dataset, including data on
maximum snout-vent length (SVL), jaw length (JL),
head depth (HD), rostral appendage length (RAL),
maximal rostral appendage depth (RAD), and relative
rostral appendage length (RAL/SVL) and depth (RAD/
SVL). The characters were recorded separately for males
and females, and measurements followed Johnston et al.
(2012). For each species, data were recorded for lifestyle
(arboreal or terrestrial), the presence of green colors in
the body coloration (yes or no), sexual dimorphism in
SVL (yes or no), sexual dimorphism in coloration (yes
or no), and sexual dimorphism in rostral appendage
morphology (yes or no) [see Table 2]. For Ceratophora
sp. from Salgala Forest, since no male specimens were
collected, measurements were taken in life from a single
male, which was subsequently released.
Phylogenetic signal is the tendency for related
species to resemble each other more than they resemble
species drawn at random from the tree (Blomberg and
Garland 2002). The analysis of phylogenetic signal
and ancestral state reconstructions were performed
in R v.3.6.1 (R Core Team 2020). The phylogenetic
signal in phenotypic traits was estimated with Pagel’s
dX (Pagel 1999) using the ‘phylosig’ function from the
package ‘phytools’ (Revell 2012). Among several
existing tests of phylogenetic signal, Pagel’s i was
chosen because it is one of the most reliable tests, and
it is robust to the errors in tree topology and branch
lengths (Minkemiller et al. 2012; Molina- Venegas and
Rodriguez 2017). Pagel’s 1 was estimated in residual
errors of phylogenetic regressions (PGLS) following
Revell (2010). PGLS regressions were fit using function
‘pels’ from the package ‘caper’ (Orme et al. 2018). The
ancestral state reconstruction was performed using the
‘contMap’ function from the the package ‘phytools’
(Revell 2013). The aforementioned analyses were
performed in R (R Core Team 2020) using RStudio
integrated development environment (RStudio Team
2018).
Amphib. Reptile Conserv.
Results
Sequences and statistics. The final alignment of the
ND2 gene sequences contained 1,032 aligned characters.
Of these, 265 sites were conserved and 767 sites
were variable, and 675 of the latter were found to be
parsimony-informative. The transition—transversion bias
(R) was estimated as 2.16. Nucleotide frequencies (all
data given for ingroup only) were 34.91% (A), 23.11%
(T), 30.83% (C), and 11.15% (G).
MtDNA genealogy. Both BI and ML analyses resulted
in essentially similar topologies, with genealogical
relationships varying only in two poorly supported nodes
(corresponding to the phylogenetic position of Cristidorsa
otai (Mahony 2009), and to the position of the clade
including genera Otocryptis and Sitana), all other nodes
in the tree were well-resolved and strongly supported
(Fig. 2). The BI genealogy inferred the following set of
phylogenetic relationships. All Draconinae genera, with
the exception of Mantheyus, formed two reciprocally
monophyletic groups. One of them included the genera
Draco, Ptyctolaemus, and Japalura (1.0/97; hereafter
node support values are given for BI PP/ML BS,
respectively), and another encompassed all the remaining
genera of Draconinae (1.0/84). Within the latter clade,
the Sri Lankan Draconinae genera were grouped in two
subclades: Otocryptis + Sitana (1.0/100), and the group
including Ceratophora, Lyriocephalus, and Cophotis
(1.0/99), with the two latter genera forming a well-
supported clade (1.0/88); the genus Cophotis, including
two species C. ceylanica and C. dumbara, was recovered
as monophyletic (1.0/100) [Fig. 2]. Monophyly of the
genus Ceratophora was strongly supported (1.0/99)
and the genealogical relationships within it were well-
resolved and strongly supported. Species of Ceratophora
were grouped into two major reciprocally monophyletic
clades: C. aspera + Ceratophora sp. from Salgala
Forest (1.0/100), and the clade joining all the remaining
species (1.0/88). Within the latter clade, C. karu
occupied the most basal position, C. stoddarti (1.0/99)
was recovered as a sister species of C. erdeleni with
shallow differentiation between them (1.0/100); while
C. tennentii formed the sister lineage to (C. stoddarti +
C. erdeleni) (1.0/99) [Fig. 2].
Sequence divergence. The interspecific uncorrected
p-distances for the ND2 gene fragment within the
genus Ceratophora varied from p = 3.8% (between C.
stoddartii and C. erdeleni) to p = 23.0% (between C.
karu and Ceratophora sp. from Salgala Forest) [Table 3].
The newly discovered lineage of Ceratophora sp. from
Salgala Forest was highly divergent from other congeners
and differed from its sister species C. aspera by p = 9.6%
of substitutions in the ND2 gene. This value significantly
exceeded the minimal interspecific divergence between
Ceratophora species (3.8%), as well as the distance
October 2020 | Volume 14 | Number 3 | e259
Karunarathna et al.
%LO6 0
%8E TC
%00 0
%00°0
%VTEV
%LT S
%00°0
%LO CT
%00°0
%CIV
%9IS I
%S0 TV
IES
%69 L
%00°0
%00°0
%00°0
%00°0
TAS/GVa
%SET
%08°6
%00°0
%00°0
%CVL
%89 8
%00 0
%16€
%00 0
%9IT IT
%81'T
%ET LI
%I18S
%CS 8
%00 0
%00 0
%00 0
%00 0
‘TAS/TVu
‘ou :u ‘Sad :A “SUOUUTDOdS JO JOQUINU :Nj ‘SJUSWIOINSVOU JOJ UDATS Ie SON|LA ULOU ‘SpOyJofA, PUL S[BIAIIJBIA] OOS SUOTILIADIQAK Ja}OBIeYD 1O4 ‘snpoydaso14AT pue ‘sijoydoD
(ZIOT ‘Je 39 UOJSUYOL Wo ATTeNIed eyep) V1oYdoJHsJa_D vIDUDS dy} JO sodads prwurese uvyURT LIS dUTU JO SUdUTIDOdS (JF) dTeUIOJ pue (WI) dTeUT }[Npe JO SONsTIQOvIeYS [eoIsO;OYdIOW *Z 9[quL
L0
ra |
8C
VE
60
cl
£0
cl
eb
cll
davu
Lil
LY
9S
cl
Tv
L0
Is
C8
Vl
‘Tva
Tel
8Ccl
IT
E¢l
CCl
cll
9
es
cs
VS
(oh ge
9ST
€ Ol
éCl
LOL
a)
dH
CC
(es
CLI
CET
[0c
381
BL
v6
CL
VL
v8
c8
T0€
90E
wal
Lel
Vv Ol
el
ath
€CL
VIL
Iss
T9L
99
oO
V LT
LOE
6 LE
V9E
Tce
9°6T
Cc Iri
9SrI
¢°99
Cc 6S
C29
LLS
‘TAS
61
OV
9I
cl
9¢
8c
6C
LS
at
8c
N
X9S
va ul
wistyd.1owrp
jenxas
1009 UI
wistydiowrp wistydsowip
jenxas
‘TAS ul
jenxas
I0[09
uaa
Jeorloqie
Jeoroqie
[eoroqse
[elnsesay
[elnso1ey
[elnso1ay
[eoroqie
[eoroqie
[eoroqie
IpAISOFTT
lADppoys vAoydojpsay
luajapla DAOYdOWwsayg
ljuauual bAéoydojp.1aZ)
napy DAoydoywsay
‘aou “ds 1pjamnyn vsoydojp.1ay
piadsp vloydojo1ay
snypnas snjoydar011aT
papqunp sijoydo,
paiupjdaa syoydo)
sareds
October 2020 | Volume 14 | Number 3 | e259
109
Amphib. Reptile Conserv.
A new species of the genus Ceratophora
Ceratophora
ukuwelai sp. nov.
0.72/-
Ceratophora aspera
1.0/84
0.99/67
0.97/75
1.0/100
0.99/75
1.0/97
1.0/90
1.0/100
1.0/100
1.0/99
1.0100 | MT992242
1.0/100
eratophe
MT992241 ]
AF128491 = Ceratophoralaspera))
AF128522
AF128521
AF128520
1.0/100 (77> Cophotis ceylanica
Cophotis dumbara
1,0/86 Lyriocephalus scutatus
4.0/95 Gonocephalus grandis
Bronchocela cristatella
eeu, Aphaniotis fusca
Harpesaurus borneensis
Calotes versicolor
Otocryptis wiegmanni
Sitana ponticeriana
Salea kakhienensis
Pseudocalotes brevipes
Diploderma splendida
Malayodracon robinsonii
Acanthosaura lepidogaster
Cristidorsa otai
Japalura variegata
Ptyctolaemus gularis
Draco blanfordii
Mantheyus phuwuanensis
0.2
Fig. 2. Bayesian inference tree of Draconinae lizards derived from the analysis of 1,084 bp of ND2 gene sequences. For voucher
specimen information and GenBank accession numbers see Table 1. Numbers at tree nodes correspond to BI PP/ML BS support
values, respectively; a black circle at a node indicates it is strongly supported (BI PP > 0.95; ML BS > 75%). Colors of clades and
locality numbers correspond to those in Fig. 1. Photos by Sanoj Wijayasekara and Sanjaya Kanishka.
between the two species of Cophotis (4.7%) [Table 3].
Deep divergence of the newly discovered Ceratophora
sp. from Salgala Forest from its congeners indicates
that the taxonomy of this group is inconsistent with its
phylogeny.
Divergence time estimations. The resulting BEAST
chronogram (see Fig. 3) had topology slightly different
from the BI tree. Specifically, Cristidorsa otai was
grouped with the clade including Salea, Pseudocalotes,
Diploderma, and Malayodracon;, Calotes versicolor
clustered with the Otocryptis + Sitana clade. These
topological differences refer to poorly supported nodes
and do not affect the analysis of relationships among
Sri Lankan agamids. The time tree analysis (see Fig.
3) reveals that tMRCA of the Sri Lankan agamid clade
including Ceratophora, Lyriocephalus, and Cophotis
originated during the middle Eocene, ca. 44.14 Ma
(36.8-51.19), and radiated within a relatively narrow
time period in the middle Oligocene ca. 27.37 Ma (23.3—
31.34), which is concordant with the earlier estimate of
Amphib. Reptile Conserv.
Grismer et al. (2016) of 28.1 Ma. A basal split within
the genus Ceratophora is estimated to have taken place
in the early Miocene ca. 19.94 Ma (17.06—22.77),
which is slightly earlier than the previous estimate by
Schulte et al. (2002), who suggested that the radiation
of Ceratophora took place in mid-Miocene (13 Ma).
The divergence between the ancestors of C. aspera and
the newly discovered Ceratophora sp. from Salgala
Forest likely happened in late Miocene, ca. 7.8 Ma
(5.43-10.54).
Rostral appendage evolution analysis. In both sexes,
the Pagel’s was close to unity and differed significantly
from zero (p < 0.05) in most of the characteristics of
body size (SVL, JL, HD, and all their log, ,-transformed
values), indicating a strong phylogenetic signal. The
only exception was jaw length in females, for which
the Pagel’s 4 was insignificant (p = 0.1). The Pagel’s 4
values in all measures of the rostrum (length, maximum
depth, log,,-transformed length and depth, length and
depth relative to SVL, and residuals from the regression
October 2020 | Volume 14 | Number 3 | e259
Karunarathna et al.
80.0 75.0 70.0 65.0 60.0 550 50.0 45.0 400 350 300 25.0
Ceratophora stoddartii WHT1512
Ceratophora stoddartii WHT1511
Ceratophora stoddartii WHT1682
=> Ceratophora erdeleni WHT1808
=6_ Ceratophora tennentii WHT1633
Ceratophora karu WHT2259
Ceratophora ukuwelai sp. nov.
Ceratophora ukuwelai sp. nov.
Ceratophora aspera WHT1825
3.02 Cophotis dumbara
T Cophotis ceylanica
Lyriocephalus scutatus
Bronchocela cristatella
Gonocephalus grandis
Aphaniotis fusca
Harpesaurus borneensis
Sitana ponticeriana
Otocryptis wiegmanni
Calotes versicolor
Salea kakhienensis
Pseudocalotes brevipes
Diploderma splendida
Malayodracon robinsonii
Acanthosaura lepidogaster
Cristidorsa otai
Ptyctolaemus gularis
Japalura variegata
Draco blanfordii
Mantheyus phuwuanensis
20.0 15.0 10.0 5.0 0.0
Fig. 3. Bayesian chronogram for Draconinae resulting from BEAST analysis of 1,084 bp of ND2 gene sequences. Node values
correspond to estimated divergence times (in Ma). Blue bars correspond to 95% confidence intervals.
of rostrum length on SVL) were not significantly
different from zero (p = 1), indicating an absence of
phylogenetic signal (see Table 4). The reconstruction of
ancestral states for relative rostrum length suggests the
presence of RA in tMRCA of Ceratophora, Cophotis,
and Lyriocephalus for both sexes and contrasting
patterns of RA evolution in males and females (Fig. 4).
Amphib. Reptile Conserv.
Systematics
The results of the updated ND2-based genealogy of Sri
Lankan agamids are largely consistent with the earlier
phylogenies of Schulte et al. (2002), Grismer et al. (2016),
Wang et al. (2019), and Kurita et al. (2020). This analysis
suggests that the population of Ceratophora sp. from
October 2020 | Volume 14 | Number 3 | e259
A new species of the genus Ceratophora
Males
Cophotis dumbara
Cophotis ceylanica
Lyriocephalus scutatus
Ceratophora aspera
Ceratophora ukuwelai sp. nov.
Ceratophora karu
Ceratophora tennentii
Ceratophora stoddartii
Ceratophora eredleni E>
0 traitvalue 17.2
length=13.054
Females
Cophotis dumbara
Cophotis ceylanica
Lyriocephalus scutatus
Ceratophora aspera
Ceratophora ukuwelai sp. nov.
Ceratophora karu
Ceratophora tennentii
Ceratophora stoddartii
7.1
tt] trait value
length=13.054 Ceratophora eredleni
Fig. 4. Relative rostral appendage (RAL/SVL) evolution among members of the Sri Lankan agamids (genera Ceratophora,
Lyriocephalus, and Cophotis). See Table 2 for RAL/SVL data. Colors of branches correspond to average RAL/SVL values in males
(A) and females (B); thumbnails show profiles of the respective lizard species (not to scale). Photos by Sanoj Wijayasekara, Sanjaya
Kanishka, and Suranjan Karunarathna.
Salgala Forest represents a divergent mtDNA lineage
sister to C. aspera, with a species-level divergence of this
population in the ND2 gene (p = 9.6%). The early (late
Miocene) split between these two lineages, along with
a number of diagnostic morphological characters which
distinguish Ceratophora sp. from Salgala Forest from C.
aspera and from other congeners (see Comparisons),
suggest that Ceratophora sp. from Salgala Forest
represents a currently undescribed species new to science
which is described below.
Ceratophora ukuwelai sp. nov.
Figs. 56; Tables 5-6.
urn:lsid:zoobank.org:act:3F34CFAS-59 BA-4B28-B9D4-7A 16B69CB9SE
Holotype. NMSL 2020.05.01, adult female, 37.9 mm
SVL, collected from rainforest flow neighboring a stream,
Salgala Forest, Kegalle District, Sri Lanka (7.120219°N,
80.251892°E, WGS1984; elevation 242 m; around 1100
h) on 22 August 2019 by Suranjan Karunarathna and
Anslem de Silva.
Paratype. NMSL 2020.05.02, adult female, 36.4 mm
SVL, collected from rainforest flow neighboring a stream,
Amphib. Reptile Conserv.
Salgala forest, Kegalle District, Sri Lanka (7.074361°N,
80.249797°E, WGS1984; elevation 269 m; around 1000
h) on 22 August 2019 by Suranjan Karunarathna and
Anslem de Silva.
Diagnosis. The new species is assigned to the genus
Ceratophora on the basis of phylogenetic data and
by having a rostral appendage developed in males,
absent in females; tympanum covered with skin;
nuchal crest indistinct; dorsal crest absent; tail not
prehensile; gular fold comparatively reduced; and
scales on flanks heterogeneous, some scales greatly
enlarged. Ceratophora ukuwelai sp. nov. can be readily
distinguished from its congeners by a combination of the
following morphological and meristic characteristics:
rostral appendage complex, comprising several scales;
maximum SVL 37.9 mm; trunk relatively long (TRL/
SVL ratio 51.4—-52.6%) with relatively short fore-body
(SA/TRL ratio 90.2—90.9%); nuchal crest feebly defined;
squamosal process present; dorsum with heterogeneous,
keeled scales, intermixed with smooth flat scales;
almost all scales on head, body, limbs, and tail bearing
1-18 mechanoreceptive pores (in a single scale), each
pore with a sensory seta; 5—7 enlarged, keeled scales
present on body flanks; nine supraciliary scales; 40-44
paravertebral scales; 72-77 midbody scales; 72-75
October 2020 | Volume 14 | Number 3 | e259
Karunarathna et al.
Table 3. Uncorrected p-distances (percentage) between the ND2 mtDNA gene sequences (below the diagonal), estimate errors
(above the diagonal), and intraspecific genetic p-distance (on the diagonal) of Sri Lankan agamid species of the genera Ceratophora,
Cophotis, and Lyriocephalus.
Species 1 2
1 Ceratophora stoddartii 0.8 0.5
2 Ceratophora erdeleni 3.8 —
3 Ceratophora tennentii 10.7 12.5
4 Ceratophora karu 18.1 18.7
2 Ceratophora aspera 18.8 20.4
6 Ceratophora ukuwelai sp. nov. 20.6 21.5
7 Cophotis ceylanica 19.8 20.8
8 Cophotis dumbara 20.1 21.2
9 Lyriocephalus scutatus 22.4 22.8
midventral scales. The new species is also clearly
distinct from all other congeners in ND2 gene sequences
(divergence over 9.6%).
Description of holotype. An adult female, 37.9 mm SVL
and 42.6 mm original TAL (Fig. 5), in a good state of
preservation (however, 15 mm of the tail was used for the
molecular work). For counts and measurements of the
holotype see Tables 5—6. Body slender, relatively long
(TRL/SVL ratio 51.4%). Head relatively large (HL/SVL
ratio 30.0% and HL/TRL ratio 58.5%), broad (HW/SVL
ratio 17.8% and HW/HL ratio 59.3%), partly depressed
(HD/SVL ratio 14.4% and HD/HL ratio 47.8%), and
distinct from neck. Snout relatively long (ES/HW ratio
56.8% and ES/HL ratio 33.7%), less than twice orbit
diameter (OD/ES ratio 84.4%), more than half length
of jaw (ES/JL ratio 51.5%), snout slightly concave in
lateral view; orbit relatively large (OD/HL ratio 28.4%),
pupil rounded; orbit length slightly greater than IV digit
of manus (OD/DLM IV ratio 100.6%); supraocular rim
moderately developed; supraciliaries uplifted; two rows
of scales separate orbit from supralabials; interorbital
distance is shorter than snout length (IO/ES ratio 49.2%),
shorter than head length (IO/HL ratio 16.6%), eye to
nostril distance greater than the interorbital distance (EN/
IO ratio 102.6%).
Dorsal, lateral, and ventral surfaces of the head,
trunk, and tail with keeled scales intermixed with smooth
heterogeneous, small and large scales, each scale with
at least one or more pores (up to 18) bearing a sensory
seta; rostral horn absent, rostral scales very small; snout
convex, scales on snout keeled and raised, smaller than
those on interorbital and occipital regions; canthus
scales present, 11/10 keeled conical scales from eye to
nostril; nasal scale large, nostril rounded and located in
the middle of an undivided nasal scale, not in contact
with supralabials; scales of the interorbital region
heterogeneous, intermixed with smooth scales; palpable
squamosal process present. Nuchal crest not prominent,
1-3 pointed and ridged scales on the neck; supralabials
12/12 keeled, infralabials 13/12 keeled, becoming
Amphib. Reptile Conserv.
113
3 4 5 6 7 8 9
1.0 1.1 1.0 1.1 1.0 1.1 1.1
1.0 1a 1.0 1.1 Ls 1.2 1.2
— £2 12 a 2 a 2
16.5 — 1.2 5 ie? 1.4 ie?
18.7 20.6 — 0.9 1.0 a 1.0
Se 23.0 9.6 — 1.1 es Ie
20.5 PAS 229 24.4 — 0.7 1.0
20.6 20.0 22.0 24.3 47 — 1.1
22.1 23.1 22:7 24.6 17.9 18.7 —
smaller towards the gape. Two scale rows separate orbit
from supralabials. Sharp and conical tubercles present
both on the sides of the neck and around the gape;
tympanum hidden under skin; enlarged, keeled, and
flat scales present on tympanum area; 44 paravertebral
scales, four diamond shaped markings with three black
Table 4. The calculated Pagel’s 4 for SVL, head, and rostral
appendage measurements for males and females of Sri Lankan
agamids of the genera Ceratophora, Cophotis and Lyriocephalus.
Asterisks denote p-values indicating significant differences of
Pagel’s X from zero (*p < 0.05; **p < 0.01). Residual RAL
and Residual Log RAL represent the residuals after regression
of RAL and Log RAL on SVL and log SVL, respectively.
PGLS means that phylogenetic signal in the residual error was
simultaneously estimated with the phylogenetic regression
parameters (the regression formula is in parentheses).
Character a
Males Females
SVL 1.10** 1.05*
Log SVL 1.10** 1.04*
JL LA0e* 1.02
Log JL i-10** 1.04
HD Lis* 1.09**
Log HD 1.09% 1.09*
RAL 0.00 1.04
Log RAL 0.11 0.00
Max RAD 1.06 1:09*
Log Max RAD 0.00 0.00
Relative RAL (to SVL) 0.46 0.00
Relative RAD (to SVL) 0.93 1.07
Residual RAL 0.00 1.09
Residual Log RAL 0.07 0.00
PGLS(RAL~SVL) 0.00 0.00
PGLS(RAD~SVL) 0.00 0.00
PGLS(LogRAL~LogSVL) 0.00 0.00
PGLS(LogRAD~LogSVL) 0.00 0.00
October 2020 | Volume 14 | Number 3 | e259
A new species of the genus Ceratophora
Fig. 5. Morphology of Ceratophora ukuwelai sp. nov. holotype, adult female (NMSL 2020.05.01). (A) Head in dorsal view; (B)
head in ventral view; (C) head in lateral view; (D) heterogeneous scales on dorsal surface of trunk; (E) keeled ventral scales; (F)
lateral surfaces of trunk showing heterogeneous scales; (G—H) dorsal and ventral surfaces of femur showing sharp spines; (I)
subdigital lamellae on manus; (J) subdigital lamellae on pes; (IK) hexagonal-shaped subcaudals. Photos by Suranjan Karunarathna.
dots present on vertebral line; 77 midbody scales; lateral
scales irregular and keeled, intermixed with 5/6 enlarged
scales on the flanks.
Ventral surfaces covered with keeled scales, each
scale with one or more mechanoreceptive pores; mental
semicircular in shape, small, posteriorly in contact with
three small postmentals (smaller than naris, chin scales,
and rostral scales), in contact with the 1* infralabial.
Gular fold short and its length is approximately 22.6% of
SVL, but dispersed and its depth 1s approximately 60.3%
of HD. Ventral scales pentagonal, subimbricate, ventral
scales larger than chin scales, dorsal scales, and lateral
scales, 75 ventral scales; keeled scales around vent and
base of tail; no precloacal or femoral pores; original tail
of holotype longer than the snout-vent length (TAL/SVL
ratio 112.3%), heterogeneous scales on the dorsal aspect
of the tail directed backwards, spine-like scales present
on tail; subcaudals keeled and small, subrhomboidal,
arranged in a single median series. Forelimbs long,
slender, upper arm longer than lower arm (LAL/SVL ratio
15.9% and UAL/SVL ratio 17.8%); hindlimbs long, tibia
slightly shorter than the femur (TBL/SVL ratio 22.8% and
Amphib. Reptile Conserv.
FEL/SVL ratio 23.7%). Anterior, dorsal, posterior, and
ventral surfaces of forelimbs and hindlimbs with strongly
keeled and less imbricate scales; anterior surfaces twice as
large as those of the other surfaces of both limbs; posterior
edges of femur and tibia with six large, conical scales.
Dorsal and ventral surfaces of manus and pes with
keeled granules; dorsal surfaces of digits with granular
scales. Digits elongate and slender with inflected distal
phalanges, all bearing slightly recurved claws. Subdigital
lamellae on digits entire, notched; lamellae on manus
(left/right): digit I (7/6), digit II (9/9), digit III (13/12),
digit IV (13/13), digit V (9/8); total lamellae on pes (left/
right): digit I (6/6), digit II (8/7), digit III (8/8), digit
IV (15/14), digit V (7/7); interdigital webbing absent;
relative length of left manual digits: I (1.8 mm), V (2.1
mm), II (2.5 mm), HI (2.9 mm), IV (3.2 mm); relative
length of left pedal digits: I (1.6 mm), II (2.2 mm), III
(2.8 mm), V (3.3 mm), IV (5.7 mm).
Variation. Measurements and morphological characters
of the type series are given in Tables 5—6. The female
paratype is generally similar to the holotype in body
October 2020 | Volume 14 | Number 3 | e259
Karunarathna et al.
Table 5. Morphometric data for two syntypes of Ceratophora aspera and two types of C. ukuwelai sp. nov. from Sri Lanka (all in
mm).
C. aspera C. ukuwelai sp. nov.
Measurement BMNH. BMNH. NMSL. NMSL.
1946.8.30.52 1946.8.30.51 2020.05.01 2020.05.02
Male Female Female Female
SVL 28.1 36.5 37.9 36.4
TRL 11.6 16.2 19.5 19.1
HL 8.5 OF 11.4 11.1
HW 5.5 6.1 6.8 6.6
HD 4.6 5.4 5.5 5.4
RAL 21 - - -
SA 13.2 Wes Le 17.2
JL oy: 5.8 is: 74
TAL (original) 40.7 42.3 42.6 41.2
OD 3.1 29) 3.2 3.2
EN oa | 19 1.9 nS
ES 3.2 2.1 3.8 3.6
SN I2 0.9 1.3 1.3
IO 22 2.4 Ie 1.9
UAL au 6.3 6.8 6.7
LAL 44 533 6.0 oo
PAL 3.5 48 6.5 6.5
DLM (1) 1.5 1.9 1.8 1.8
DLM (ii) 21 2:5 2.5 2.4
DLM (iii) 2.6 2.9 Sie) 2.8
DLM (iv) 29 3.1 3.2 |
DLM (v) 1.8 2 2.1 De
FEL 3 ria 9.0 8.9
TBL 6.6 74 8.7 8.5
HEL 79 he 9.5 9.3
DLP (1) Ma 1.5 1.6 | bas
DLP (11) 1.6 2.3 22 21
DLP (iii) 2.6 3.8 2.8 2
DLP (iv) 43 6.5 5.7 5.5
DLP (v) 2.4 2:9 3.3 3.2
proportions and coloration; the SVL of adult female
specimens in the type series of Ceratophora ukuwelai
sp. nov. (7 = 2) ranges from 36.4 to 37.9 mm; enlarged
flank scales 5—7; supralabials 12—13; infralabials 11-12:
postmentals 3—4; interorbital 9-10; canthal scales 10-11;
total lamellae on digit of the manus: digit I (6—7), digit II
(8-9), digit III (12-13), digit [V (12-13), digit V (8-9);
total lamellae on digit of the pes: digit I (6—7), digit II (7—
8), digit II (7-8), digit IV (14-16); paravertebral granules
40-44; midbody scales 72-77; ventral scales 72-75
(see Tables 5-6). Because the holotype and paratype of
the new species are females, sexual dimorphism could
Amphib. Reptile Conserv.
not be determined. However, a single male specimen
of Ceratophora ukuwelai sp. nov. was recorded at the
type locality and photographed in life (Fig. 6B). Male
specimen possessed long (RAL/SVL ratio 11.26%)
complex rostral appendage, comprised of numerous
keeled acuminate scales, including posterostral scales
and a pointed enlarged scale on the top.
Color of living specimens. In life, dorsum of head, body,
and limbs generally grey-brown (Fig. 6); forehead with
white blotch, interorbital area with a “Y’ shaped brown
marking, occiput area with a “‘W’ shaped dark marking;
115 October 2020 | Volume 14 | Number 3 | e259
A new species of the genus Ceratophora
Table 6. Meristic data of two syntypes of Ceratophora aspera and two types of C. ukuwelai sp. nov. from Sri Lanka.
C. aspera C. ukuwelai sp. nov.
Measurement BMNH. BMNH. NMSL. NMSL.
1946.8.30.52 1946.8.30.51 2020.05.01 2020.05.02
Male Female Female Female
FLSP (L/R) 10/9 11/10 5/6 7/6
SUP (L/R) 10/9 10/11 12/12 13/12
INF (L/R) 10/11 10/9 12/12 11/12
PM 4 4 3 4
SUS (L/R) 12 14 9 9
INOS 13 15 10 9
CAS (L/R) 14/13 12/13 11/10 11/10
TLM (i) (L/R) 7/8 6/5 7/6 6/6
TLM (ii) (L/R) 9/10 6/8 9/9 8/9
TLM (iit) (L/R) 12/13 10/12 13/12 12/12
TLM (iv) (L/R) 14/12 12/11 13/13 13/12
TLM (v) (L/R) 9/9 8/7 9/8 8/8
PS 58 52 44 40
MBS 61 57 77 72
MVS 92 95 75 72
TLP (1) (L/R) 6/5 7/6 6/6 7/6
TLP (it) (L/R) 7/8 6/8 8/7 7/7
TLP (iti) (L/R) 13/12 10/9 8/8 8/7
TLP (iv) (L/R) 16/17 14/14 15/14 16/15
TLP (v) (L/R) 9/8 7/8 7/7 PAE
four grey diamond-shaped vertebral markings with black
dots. Tail generally brown with faded zigzag markings.
Two brown postorbital stripes on each side with striped
labials (Fig. 5). Chin, gular, and ventral scales dirty
white mixed with red-brown. Dorsal surface of upper
and lower arm with white ring around. Posterior side
of femur with white longitudinal spine line, tibia with
white ring around. Iris copper-orange; pupil black. Inner
surfaces of mouth cavity bluish-grey. A male specimen
(not collected) showed generally similar but slightly
darker coloration than the female type (Fig. 6B).
Color of preserved specimens. After preservation in
ethanol for one year, coloration pattern of type specimens
resembles that observed in life. Dorsally specimens
turned dark brown with four distinct diamond-shaped
markings on vertebrae; interorbital area with a Y-shaped
dark marking; both limbs with dirty white rings. Ventral
surfaces turned grey-brown.
Etymology. The specific epithet is a Latinized eponym
in the masculine genitive singular, honoring evolutionary
biologist and herpetologist Dr. Kanishka Ukuwela
(Rajarata University) for his invaluable contribution to
biodiversity studies and conservation in Sri Lanka.
Amphib. Reptile Conserv.
Suggested common names. Ukuwelas’ Rough-horn
Lizard (English), Ukuwelage ralu-ang katussa (Sinhala).
Comparisons with other Sri Lankan species. The
new species, Ceratophora ukuwelai sp. nov., readily
differs from Ceratophora aspera by the presence
of fewer supraciliary scales (9 versus 12-14), fewer
paravertebral scales (40-44 versus 52-58), greater
midbody scales (72-77 versus 57-61), fewer ventral
scales (72—75 versus 92-95), trunk relatively long (TRL/
SVL ratio 51.4-52.6% versus 41.3-44.5%), and fore-
body relatively short (SA/TRL ratio 90.2—90.9% versus
107.6-113.9%). Differs from Ceratophora_ erdeleni
by the presence of a long, complex, and rough rostral
appendage in males (versus short, simple, and smooth
rostral appendage), lateral scales keeled (versus lateral
scales smooth), relatively small bodied, average SVL
of adults (37 mm versus 80 mm), found in lowland wet
zone (below 300 m versus above 900 m). Differs from
Ceratophora karu by the presence of long and rough
rostral appendage in males (versus short, pointed, and
relatively smooth rostral appendage), no prominent and
conical shaped superciliary (versus very prominent and
conical shaped superciliary presents), squamosal process
present (versus squamosal process absent), found in
116 October 2020 | Volume 14 | Number 3 | e259
Karunarathna et al.
Fig. 6. Ceratophora ukuwelai sp. nov. in life in-situ. (A) Female holotype (NMSL 2020.05.01) in dorsolateral view; (B) male
specimen (not collected) in dorsolateral aspect showing rostral appendage; (C) female paratype (NMSL 2020.05.02) in dorsal view.
Photos by Suranjan Karunarathna and Sanjaya Kanishka.
Amphib. Reptile Conserv. October 2020 | Volume 14 | Number 3 | e259
A new species of the genus Ceratophora
A
<Q Sf 7
Fig. 7. Habitat of Ceratophora ukuwelai sp. nov. at type locality
in Salgala Forest, Kegalle District, Sri Lanka. (A) General view
of Salgala Forest; (B) microhabitat of the new species inside
the dense forest with good canopy cover and thick leaf litter.
Photos by Suranjan Karunarathna.
lowland wet zone (below 300 m versus above 900 m).
Differs from Ceratophora stoddarti by the presence of
long, complex, and rough rostral appendage in males
(versus long, simple, and smooth rostral appendage),
lateral scales keeled (versus lateral scales smooth),
relatively small bodied, average SVL of adults (37 mm
versus 80 mm), found in lowland wet zone (below 300 m
versus above 800 m). Differs from Ceratophora tennentii
by the presence of rough and relatively round shaped
rostral appendage in males (versus smooth and laterally
flattened rostral appendage), lateral scales keeled (versus
lateral scales smooth), relatively small bodied, average
SVL of adults (37 mm versus 80 mm), found in lowland
wet zone (below 300 m versus above 800 m).
Distribution and natural history. The type locality,
Salgala Forest (7.109631—7.129028°N, 80.243444—
80.263494°E; Kegalle District, Sabaragamuwa Province),
is located in the lowland at elevations of 120-325 m
asl. The area falls within the northern border of the wet
bioclimatic zone, where tropical evergreen rainforests
comprise the dominant vegetation type (Gunatileke and
Gunatileke 1990). The forest acreage is approximately
150 ha and Salgala forest is isolated from other forest
massifs by the Kelani River and Maha River valleys,
numerous perennial middle-order streams, and human
modified cultural landscapes such as tea plantations.
The mean annual rainfall in the area varies between
2,500 and 3,500 mm, most of it is received during the
southwest monsoon (May-—September), while the mean
Amphib. Reptile Conserv.
annual temperature is around 29.2 °C. Salgala is rich in
tall rainforest trees and the forest floor contains thick leaf
litter. Numerous smaller streams are present within the
type locality. Ceratophora ukuwelai sp. nov. appears
to be an elusive and rare species in Salgala as only five
individuals were recorded during 10 field excursions
(nearly 500 person-hours). Specimens of the new species
were recorded on the forest floor in dense forest patches
with thick and wet leaf litter under dense canopy cover
(Fig. 7). The microhabitat of Ceratophora ukuwelai sp.
nov. was a poorly illuminated (light intensity: 455-687
Lux), relatively moist, canopy-shaded (relative humidity:
72-84% and canopy cover: 70-85%), and relatively
warm environment (substrate temperature: 27.7—28.2 °C)
by the time of our survey. The new species was recorded
in sympatry with several other agamid lizard species,
including Calotes calotes (Linnaeus, 1758), Calotes
liolepis Boulenger, 1885, Calotes versicolor (Daudin,
1802), and Otocryptis wiegmanni Wagler, 1830.
Conservation status. Application of the IUCN Red
List criteria indicates that C. ukuwelai sp. nov. has to
be considered a Critically Endangered (CR) species due
to having an area of occupancy (AOO) < 10 km? (four
locations, 0.12 km? in total assuming a 100 m radius
around the georeferenced locations) and an extent of
occurrence (EOO) < 100 km? (0.26 km’) in Kegalle
District, Sabaragamuwa Province of southwestern Sri
Lanka [Applicable criteria B2-b (111)] (UCN Standards
and Petitions Subcommittee 2016).
Discussion
In 1864, Albert Gunther described a new horned lizard,
which he named Ceratophora aspera, from Ceylon
(historical name of Sri Lanka) based on the collections
sent to London by Hugh Cuming (Gunther 1864;
Amarasinghe et al. 2009). However, Giinther mentioned
that C. aspera probably came from the montane part of
Sri Lanka, likely from the same source as the specimens
of C. stoddartii and C. tennentii (Gunther 1861,
1864). Most of the species described by Gtinther from
Cuming’s collection are now known to be restricted to
the south-west wet zone of Sri Lanka (Pethiyagoda 2007;
Meegaskumbura et al. 2008; Amarasinghe et al. 2009;
Sudasinghe and Pethiyagoda 2019), suggesting that this
area likely corresponds to the type locality of C. aspera.
Additionally, we examined the two syntypes of C. aspera
housed in British Museum of Natural History (female
BMNH.1946.8.30.51, and male BMNH.1946.8.30.52)
[Fig. 8] and obtained the morphometric and meristic
characters from these specimens for comparison. The
Salgala population described herein as Ceratophora
ukuwelai sp. nov. originates from the northern border
of the wet bioclimatic zone (Kegalle District), and so C.
aspera populations are restricted to the southern part of
the wet bioclimatic zone (Galle District). However, this
October 2020 | Volume 14 | Number 3 | e259
Karunarathna et al.
r = =
Pm 4 = )
THAT] LAY UU
Fig. 8. Syntypes of Ceratophora aspera Ginther, 1864 in lateral view: BMNH.1946.30.51 (female, above) and BMNH.1946.30.52
(male, below). Photo by Colin McCarthy (BMNH).
study revealed a number of taxonomically important
morphological differences between these populations,
and demonstrated that they are also genetically distinct
(p-distance 9.6%). The southern and northern populations
of this complex are separated by 115 km direct distance
(Fig. 1) and by the valleys of the Attanagalu, Kelani, Kalu,
and Gin rivers and a number of mountain ridges. These
geographical barriers have likely impeded gene flow,
resulting in reproductive isolation. The molecular dating
analysis suggested that Ceratophora ukuwelai sp. nov.
and C. aspera have been separated presumably since the
late Miocene. These results continue to underscore the
high degree of site-specific endemism in isolated forest
patches within the lowland areas of wet bioclimatic
zone in Sri Lanka (e.g., Manamendra-Arachchi and
Pethiyagoda 2005; Meegaskumbura and Manamendra-
Arachchi 2005; Agarwal et al. 2017; Karunarathna et al.
2019; Danushka et al. 2020) and the need for additional
field research throughout these insular habitats.
The most recent discovery of new species in the
genus Ceratophora was the description of C. erdeleni
and C. karu from Rakwana Hills over two decades
ago (Pethiyagoda and Manamendra-Arachchi 1998).
Most Ceratophora species are rare, range-restricted
endemics. At present, C. tennentii is restricted to the
Knuckles Hills, and C. stoddartii occupies the Central
Highlands; while C. erdeleni and C. karu are restricted
to the Rakwana Hills (Fig. 1). Ceratophora aspera was
Amphib. Reptile Conserv.
once thought to be a more widely ranging species with a
patchy distribution across the lowland tropical rainforests
within the wet bioclimatic zone of Sri Lanka. This study
demonstrates that the northernmost portion of its range
actually harbors a new species, Ceratophora ukuwelai
sp. nov., while C. aspera sensu stricto appears to be
restricted to the southern part of the wet bioclimatic zone
(Fig. 1). Further studies of morphological and genetic
variation across the isolated populations of C. aspera are
needed to assess the true taxonomic diversity and extend
of distribution of Ceratophora species in Sri Lanka.
In the present paper we recommend that Ceratophora
ukuwelai sp. nov. be listed as a Critically Endangered
(CR) species. The infrequent encounter rates of this
Species in its habitat and continuing habitat loss are the
primary reasons for our conservation status assessment.
In addition, Sri Lanka’s southwestern lowland rainforests
are severely fragmented; as such, edge effects and
concomitant micro-environmental changes and
subsidized predation risk could further endanger this
species. The threats to agamid lizards would appear to
stem largely from habitat loss and fragmentation. The
impacts of fragmentations could also be exacerbated by
the fact that many important montane forest fragments
are surrounded by vegetable and tea plantations. Worse
yet, vegetable cultivation in Sri Lanka involves the
intensive and indiscriminate application of pesticides
(Karunarathna et al. 2017), which can reduce the
October 2020 | Volume 14 | Number 3 | e259
A new species of the genus Ceratophora
agamids’ prey base. In addition, the bioconcentration of
pesticides in lizards has been well documented in other
tropical realms (Campbell and Campbell 2000, 2002:
Khan and Law 2005). Highways also pose a threat to
animals, not only by means of habitat fragmentation,
but also by resulting in direct mortality in terms of
incidental roadkills. The asphalt surfaces of these
highways reach thermally intolerable levels, which could
induce physiological stress. The exotic pet trade and
alien invasive species are growing threats for Sri Lankan
lizards (Karunarathna and Amarasinghe 2013; Janssen
and de Silva 2019). In addition, predation by feral or
domestic cats can also result in considerable mortality
among agamids (Arnaud et al. 1993; Tyler et al. 2016).
Further studies on the natural history and behavior of
endemic lizards of Sri Lanka are essential for better
planning and implementation of scientific conservation
and management programs (Karunarathna et al. 2011).
The promotion of ecological and behavioral studies
in schools and universities 1s required for assessing
habitat fragmentation and human impacts on Sri Lankan
endemic agamid_ lizards (Manamendra-Arachchi
and Liyanage 1994; Karunarathna and Amarasinghe
2013). Further development of public awareness
workshops and conservation action plans are necessary
for the conservation of agamid species. Reducing
road kills at road crossings and migration routes and
further development of public awareness through the
organization of workshops are important steps for the
implementation of a conservation action plan for Sri
Lankan agamid conservation (Karunarathna et al. 2013).
We are also unaware of any substantial ex-situ efforts in
the captive breeding of agamids. Sri Lanka’s zoological
and botanical gardens should explore the feasibility of
such efforts.
Our updated phylogeny for Sri Lankan agamids
allowed us to re-analyze patterns of possible evolution of
the rostral appendage—a bizarre morphological structure
characteristic to the genus Ceratophora (Fig. 4). A high
phylogenetic signal in body size traits in Sri Lankan
agamids was found, which is not surprising for such
morphological traits and was demonstrated earlier for a
number of lizard groups (Freckleton et al. 2002; Ashton
2004; Brandtand Navas 2011; Oufiero etal. 2011; Grizante
et al. 2012; Hertz et al. 2013; Openshaw and Keogh
2014; Wegener et al. 2014; Mesquita et al. 2016). Pagel’s
dX = | implied that the evolution of these traits followed
Brownian motion (Freckleton et al. 2002). Surprisingly,
however, we have not detected phylogenetic signal in
rostral appendage measurements. This could be related
to the insufficient number of species in our analysis, but
the high values of Pagel’s 4 in body size indicate that
our sample size is sufficient to detect at least a high
phylogenetic signal in traits. In the case of Ceratophora,
phylogenetically closely related species may have
opposing states for rostral appendage characters. Our
analysis thus suggests that rostral appendage length and
Amphib. Reptile Conserv.
depth have evolved largely independently of phylogeny.
For example, the two sister species with minimal genetic
divergence between them may show the presence (C.
stoddartii) or absence (C. erdeleni) of RA in both sexes
(Fig. 4; Table 2). Our reconstruction of ancestral states in
RA evolution suggested that rostral ornamentation was
likely present both in males and females of the common
ancestor of the Ceratophora — Lyriocephalus — Cophotis
clade (Fig. 4). The RA was subsequently lost in both
sexes of Cophotis and C. erdeleni, reduced in both sexes
of C. karu and females of C. aspera and C. ukuwelai
sp. nov., and enlarged in males of C. aspera and C.
ukuwelai sp. nov., and in females of Lyriocephalus and
C. tennentii. However, the absence of phylogenetic signal
in the evolution of RA structures in Sri Lankan agamids
reported here makes the goal of robustly reconstructing the
evolutionary history of this feature even more challenging.
Rostral appendages exhibit great variability in
morphology, dimorphism, and ontogeny among the
members of the Ceratophora — Lyriocephalus — Cophotis
clade (Fig. 4). Several studies have addressed the problem
of rostral appendage origin and evolution in Ceratophora
Species using parsimony (Schulte et al. 2002) and
Bayesian (Johnston et al. 2012) approaches. Schulte
et al. (2002) noted that the profound morphological
differences observed among rostral structures of C.
aspera, C. stoddartii, and C. tennentii, and the fact
that these species do not form a clade, suggest three
independent origins of these unusual ornaments in
Ceratophora. Johnston et al. (2012) provided further
morphological, allometric, and phylogenetic evidence
suggesting that rostral appendages evolved three times
within three separate lineages of Ceratophora. Johnston
et al. (2012) further argued that in the case of C. tennentii
it was likely driven by the natural selection for crypsis,
while in C. aspera and C. stoddartii the independent origin
of RA might be a result of sexual selection. Whiting et al.
(2015) analyzed sexual dimorphism in RA parameters and
coloration in C. tennentii, and did not find a correlation
between these characters with bite force or body condition
in this species. However, Whiting et al. (2015) assumed
that RAL still might be a target of sexual selection and
may serve as a cue used by females to assess some aspect
of male quality. Our results generally agree with the
hypothesis of Johnston et al. (2012) and provide further
evidence that rostral appendages in Sri Lankan agamids
likely evolved by several mechanisms, and more readily
than in any other group of lizards. Further detailed studies
of phylogeny and diversity within the Ceratophora —
Lyriocephalus — Cophotis clade, along with research on
the natural history of the comprising species, and a more
thorough anatomical comparison of rostral structures, are
needed to generate a more detailed and robust scenario of
rostral appendage evolution in this group.
Acknowledgements.—We thank Chandana _ Soortya-
bandara (Director General DWC), the research
October 2020 | Volume 14 | Number 3 | e259
Karunarathna et al.
Key to Sri Lankan species of genus Ceratophora
la*Rosiralappendage: simple! restrictedsto-1ostralscalesalome.. 53 .tr tess s.8 eee late he A pean LEER ioe. 2
1b. Rostral appendage complex, comprising more scales than rostral alone..............0 0... o ccc c ence eee )
2a. Rostral appendage rudimentary in both sexes (appendage is shorter than eye-nostril distance)........ C. erdeleni
2b. Rostral appendage prominent in males (appendage is longer than eye-nostril distance).............. C. stoddartii
3a. Rostral appendage laterally compressed...............
3b. Rostral appendage not laterally compressed.........
4a. Squamosal process absent, represented by an enlarged scale.........0.0..00.0 0c ccc cece eee e eee’,
4b. A prominent squamosal process present...............
RE Ee ee et ee Pen Lene, C. tennentii
5a. Trunk length is less than half of SVL and snout to axilla length is longer than trunk length (52—58 paravertebrals
ING 49-229 5, VST AUS) Oates neceagte ee Meanie, Seta Bi lng Remtie asad oo
Nees Se EE Ot teh fo a C. aspera
5b. Trunk length is more than half of SVL and snout to axilla length is shorter than trunk length (40-44
paravertebrals: atid72—75. VEntrals) o sscescccck eee ane ee
committee, and the field staff of the Department of
Wildlife (permits WL/3/2/42/18 a&b), and K.M.A.
Bandara (Additional Conservator of Forest Department)
and field staff assisting during the field surveys (permits
FRC/5, FRC/6 and R&E/RES/NFSRCM/2019-04)
and for granting permission. Nanda Wickramasinghe,
Sanuja Kasthuriarachchi, Lankani Somaratne, Chandrika
Munasinghe, Rasika Dasanayake, Tharushi Gamage,
Thushari Dasanayake, Ravindra Wickramanayake, and
Pannilage Gunasiri at NMSL assisted while we were
examining collections under their care. Various support
was provided by Kanishka Ukuwela (for lab work),
Colin McCarthy (for photographs of the syntypes),
Sanjaya Kanishka and Sanoj Wijayasekara (for various
photographs), Thasun Amarasinghe (for technical
advice), Hiranya Sudasinghe and Dinesh Gabadage
(for reference materials), Madhava Botejue, Hasantha
Wijethunga (photo creations), as well as Rashmini
Karunarathna and Niranjan Karunarathana. This work
was financially supported by the Rufford Foundation
(23951-1; fieldwork and lab work) to SK, and by the
Russian Science Foundation (19-14-00050; molecular
and phylogenetic analyses) to NAP. Finally, we would
like to thank Aaron Bauer and Lee Grismer for their
constructive criticisms of an earlier draft that helped to
significantly improve this paper.
Literature Cited
Agarwal I, Biswas S, Bauer AM, Greenbaum E, Jackman
TR, de Silva A, Batuwita S. 2017. Cryptic species,
taxonomic inflation, or a bit of both? New species
phenomenon in Sri Lanka as suggested by a phylogeny
of dwarf geckos (Reptilia, Squamata, Gekkonidae,
Cnemaspis). Systematics and Biodiversity 15: 1-13.
Amarasinghe AAT, Manthey U, Stockli E, Ineich I,
Kullander SO, Tiedemann F, McCarthy C, Gabadage
DE. 2009. The original descriptions and figures of Sri
Amphib. Reptile Conserv.
Ser Laie ee eee Oe Ceratophora ukuwelai sp. nov.
Lankan agamid lizards (Squamata: Agamidae) of the
18" and 19" centuries. Taprobanica |: 2-15, 4 pls.
Arnaud G, Rodriguez A, Ortega-Rubio A, Alvarez-
Cardenas S. 1993. Predation by cats on the unique
endemic lizard of Socorro Island (Urosaurus
auriculatus), Revillagigedo, Mexico. Ohio Journal of
Science 93: 101-104.
Ashton KG. 2004. Comparing phylogenetic signal in
intraspecific and interspecific body size datasets.
Journal of Evolutionary Biology 17: 1,157—1,161.
Bahir MM, Surasinghe TD. 2005. A conservation
assessment of the agamid lizards of Sri Lanka. Raffles
Bulletin of Zoology 12: 407-412.
Blomberg SP, Garland T. 2002. Tempo and mode in
evolution: phylogenetic inertia, adaptation, and
comparative methods. Journal of Evolutionary
Biology 15: 899-910.
Bossuyt F, Meegaskumbura M, Beenaerts N, Gower DJ,
Pethiyagoda R, Roelants K, Mannaert A, Wilkinson
M, Bahir MM, Manamendra-Arachchi K, et al. 2004.
Local endemism within the Western Ghats-Sri Lanka
Biodiversity Hotspot. Science 306: 479-481.
Bossuyt F, Meegaskumbura M, Beenaerts N, Gower DJ,
Pethiyagoda R, Roelants K, Mannaert A, Wilkinson
M, Schneider CJ, Bahir MM, et al. 2005. Biodiversity
in Sri Lanka and the Western Ghats - response. Science
308: 199.
Brandt R, Navas CA. 2011. Life-history evolution on
Tropidurinae lizards: influence of lineage, body size,
and climate. PLoS ONE 6: e20040.
Campbell KR, Campbell TS. 2000. Lizard contaminant
data for ecological risk assessment. Reviews of
Environmental Contamination and Toxicology 15:
39-116.
Campbell KR, Campbell TS. 2002. A logical starting
point for developing priorities for lizard and
snake ecotoxicology: a review of available data.
Environmental Toxicology and Chemistry 21: 894—
October 2020 | Volume 14 | Number 3 | e259
A new species of the genus Ceratophora
898.
Cincotta RP, Wisnewski J, Engelman R. 2000. Human
populations in the biodiversity hotspots. Nature 404:
990-992.
Cooray PG. 1967. An introduction to the geology of
Ceylon. Spolia Zeylanica 31: 1-324.
Danushka AD, Kanishka AS, Amarasinghe AAT, Vogel G,
Seneviratne SS. 2020. A new species of Dendrelaphis
Boulenger, 1890 (Reptilia: Colubridae) from the wet
zone of Sri Lanka with a redescription of Dendrelaphis
bifrenalis (Boulenger, 1890). Taprobanica 9: 30-36.
de Silva A, Ukuwela K. 2020. A Naturalist's Guide to the
Reptiles of Sri Lanka. John Beaufoy Publishing Ltd.,
Oxford, United Kingdom. 176 p.
de Silva A. 2006. Current status of the reptiles of Sri
Lanka. Pp. 134-163 In: Fauna of Sri Lanka: Status
of Taxonomy, Research, and Conservation. Editor,
Bambaradeniya CMB. IUCN Sri Lanka, Colombo,
Sri Lanka. 308 p.
Drummond AJ, Suchard MA, Xie D, Rambaut A. 2012.
Bayesian phylogenetics with BEAUti and the BEAST
1.7. Molecular Biology and Evolution 29(8): 1,969—
1,973.
Felsenstein J. 1985. Confidence limits on phylogenies: an
approach using the bootstrap. Evolution 39: 783-791.
Freckleton RP, Harvey PH, Pagel M. 2002. Phylogenetic
analysis and comparative data: a test and review of
evidence. The American Naturalist 160: 712—726.
Gibson C, de Silva A, Tognelli MF, Karunarathna S.
(Editors). 2020. Assess to Plan: Conservation Action
Planning for the Snakes and Lizards of Sri Lanka.
IUCN Conservation Planning Specialist Group, Apple
Valley, Minnesota, USA. 74 p.
Gray JE. 1833-1835. Illustrations of Indian Zoology;
Chiefly Selected from the Collection of Major-General
Hardwicke, F-R.S., Volume II. Adolphus Richter,
London, United Kingdom.
Greenbaum E, Bauer AM, Jackman TR, Vences M, Glaw
F, 2007. A phylogeny of the enigmatic Madagascan
geckos of the genus Uroplatus (Squamata:
Gekkonidae). Zootaxa 1493: 41-51.
Greller AM, Balasubramaniam S. 1980. A preliminary
floristic-climatic classification of the forests of Sri
Lanka. Sri Lanka Forester 14: 163-170.
Grismer JL, Schulte JA, Alexander A, Wagner P, Travers
SL, Buehler MD, Welton LJ, Brown RM. 2016. The
Eurasian invasion: phylogenomic data reveal multiple
Southeast Asian origins for Indian dragon lizards.
BMC Evolutionary Biology 16: 1-12.
Grizante MB, Brandt R, Kohlsdorf T. 2012. Evolution
of body elongation in gymnophthalmid lizards:
relationships with climate. PLoS ONE 7: e49772.
Gunatileke IAUN, Gunatileke CVS. 1990. Distribution
of floristic richness and its conservation in Sri Lanka.
Conservation Biology 4: 21-31.
Gunawardene NR, Daniels AED, Gunatilleke IAUN,
Gunatilleke CVS, Karunakaran PV, Nayak KG, Prasad
Amphib. Reptile Conserv.
S, Puyravaud P, Ramesh BR, Subramanian KA, et
al. 2007. A brief overview of the Western Ghats-Sri
Lanka Biodiversity Hotspot. Current Science 93:
1,567—1,572.
Gunther A. 1861. In Tennent JE, Sketches of the
Natural History of Ceylon with Narratives and
Anecdotes Illustrative of the Habits and Instincts
of the Mammalia, Birds, Reptiles, Fishes, Insects,
& including a Monograph of the Elephant and a
Description of the Modes of Capturing and Training
It. Longman, Green, Longman, and Roberts, London,
United Kingdom. 580 p.
Gunther A. 1864. The Reptiles of British India. The Ray
Society, London, United Kingdom. 452 p.
Hall TA. 1999. BioEdit: a user-friendly biological
sequence alignment editor and analysis program for
Windows 95/98/NT. Nucleic Acids Symposium Series
41: 95-98.
Helgen KM, Groves CP. 2005. Biodiversity in Sri Lanka
and Western Ghats. Science 308: 199.
Hertz PE, Arima Y, Harrison A, Huey RB, Losos JB, Glor
RE. 2013. Asynchronous evolution of physiology
and morphology in Anolis lizards. Evolution 67:
2101-2113:
Hillis DM, Moritz C, Mable BK. 1996. Molecular
Systematics. 2™ edition. Sinauer Associates,
Sunderland, Massachusetts, USA. 655 p.
Huelsenbeck JP, Hillis DM. 1993. Success of phylogenetic
methods in the four-taxon case. Systematic Biology
42: 247-264.
IUCN Standards and Petitions Subcommittee. 2016.
Guidelines for using the IUCN Red List Categories
and Criteria. Version 12. Prepared by the Standards
and Petitions Subcommittee. Available: http://www.
iucnredlist.org/documents/RedListGuidelines.pdf
[Accessed: 15 August 2020].
Janssen J, de Silva A. 2019. The presence of protected
reptiles from Sri Lanka in international commercial
trade. Traffic Bulletin 31: 9-15.
Johnston GR, Lee M, Surasinghe TD. 2012. Morphology
and allometry suggest multiple origins of rostral
appendages in Sri Lankan agamid lizards. Journal of
Zoology 289: |-9.
Karunarathna DMSS, Henkanaththegedara SM,
Amarasinghe AAT, de Silva A. 2013. Impact of
vehicular traffic on herpetofaunal mortality in a
savannah forest, eastern Sri Lanka. Zaprobanica 5:
111-119.
Karunarathna S, Amarasinghe T. 2013. Behavioral
ecology and microhabitat use by Lyriocephalus
scutatus (Linnaeus, 1758): a monotypic genus in Sri
Lanka (Reptilia: Agamidae: Draconinae), with notes
on the taxonomy. Russian Journal of Herpetology 20:
iFesLa
Karunarathna S, Henkanaththegedara S, Gabadage
D, Boteyue M, Madawala M, Surasinghe T. 2017.
Ecology and demography of the Critically Endangered
October 2020 | Volume 14 | Number 3 | e259
Karunarathna et al.
Kandian Torrent Toad Adenomus kandianus: a long-
lost endemic species of Sri Lanka. Oryx 51: 619-626.
Karunarathna S, Poyarkov NA, de Silva A, Madawala
M, Boteyue M, Gorin VA, Surasinghe T, Gabadage
D, Ukuwela KDB, Bauer AM. 2019. Integrative
taxonomy reveals six new species of day geckos of the
genus Cnemaspis Strauch, 1887 (Reptilia: Squamata:
Gekkonidae) from geographically isolated hill forests
in Sri Lanka. Vertebrate Zoology 64: 247-298.
Karunarathna S, Pradeep G, Peabotuwage I, de Silva
M. 2011. First report on the ovipositional behavior
of Calotes nigrilabris Peters, 1860 (Reptilia: Sauria:
Agamidae) from the Central massif of Sri Lanka.
Russian Journal of Herpetology 18: 111-118.
Katoh K, Misawa K, Kuma K, Miyata T. 2002. MAFFT:
a novel method for rapid multiple sequence alignment
based on fast Fourier transform. Nucleic Acids
Research 30: 3,059-3,066.
Khan MZ, Law FC. 2005. Adverse effects of pesticides
and related chemicals on enzyme and hormone
systems of fish, amphibians, and reptiles: a review.
Proceedings of the Pakistan Academy of Sciences 42:
315-323.
Kozlov A, Darriba D, Flouri T, Morel B, Stamatakis A.
2018. RAXxML-NG: A fast, scalable, and user-friendly
tool for maximum likelihood phylogenetic inference.
Bio Rxiv 447110.
Kurita T, Kojima Y, Hossman MY, Nishikawa K.
2020. Phylogenetic position of a bizarre lizard,
Harpesaurus, implies the co-evolution between
arboreality, locomotion, and reproductive mode in
Draconinae (Squamata: Agamidae). Systematics and
Biodiversity 18: 675-687.
Macey JR, Larson A, Ananjeva NB, Fang Z, Papenfuss
TJ. 1997. Two novel gene orders and the role of light-
strand replication in rearrangement of the vertebrate
mitochondrial genome. Molecular Biology and
Evolution 14: 91-104.
Macey JR, Schulte JA, Larson A. 2000a. Evolution and
phylogenetic information content of mitochondrial
genomic structural features illustrated with acrodont
lizards. Systematic Biology 49: 257-277.
Macey JR, Schulte JA, Larson A, Ananjeva NB, Wang
Y, Pethiyagoda R, Rastegar-Pouyani N, Papenfuss
TJ. 2000b. Evaluating trans-Tethys migration:
An example using acrodont lizard phylogenetics.
Systematic Biology 49: 233-256.
Manamendra-Arachchi K, Pethiyagoda R. 2005. The Sri
Lankan shrub-frogs of the genus Philautus Gistel,
1848 (Ranidae: Rhacophorinae), with description of
27 new species. Raffles Bulletin of Zoology 12: 163—
303.
Manamendra-Arachchi K, Liyanage S. 1994.
Conservation of the agamid lizards of Sri Lanka with
illustration of the extant species. Journal of South
Asian Natural History |: 77-96.
Meegaskumbura M, Bossuyt F, Pethiyagoda R,
Amphib. Reptile Conserv.
Manamendra-Arachchi K, Bahir M, Milinkovitch
MC, Schneider CJ. 2002. Sri Lanka: an amphibian
hotspot. Science 298: 379.
Meegaskumbura M, Manamendra-Arachchi K. 2005.
Description of eight new species of shrubfrogs
(Ranidae: Rhacophorinae: Phi/autus) from Sri Lanka.
Raffles Bulletin of Zoology 12: 305-338.
Meegaskumbura M, Senevirathne G, Manamendra-
Arachchi K, Pethiyagoda R, Hanken J, Schneider CJ.
2019. Diversification of shrub frogs (Rhacophoridae,
Pseudophilautus) in Sri Lanka: timing and geographic
context. Molecular Phylogenetics and Evolution 132:
14-24.
Meegaskumbura M, Silva A, Maduwage K, Pethtyagoda
R. 2008. Puntius reval, a new barb from Sri Lanka
(Teleostei: Cyprinidae). [chthyological Exploration of
Freshwaters 19: 141-152.
Mesquita DO, Costa GC, Colli GR, Costa TB, Shepard
DB, Vitt LJ, Pianka ER. 2016. Life-history patterns
of lizards of the world. The American Naturalist 187:
689-705.
MOE-SL. 2012. The National Red List of Sri Lanka:
Conservation Status of the Fauna and Flora.
Biodiversity Secretariat, Ministry of Environment,
Colombo, Sri Lanka. 451 p.
Molina-Venegas R, Rodriguez MA. 2017. Revisiting
phylogenetic signal: strong or negligible impacts of
polytomies and branch length information? BMC
Evolutionary Biology 17: 53.
Munkemiller T, Lavergne S, Bzeznik B, Dray S, Jombart
T, Schiffers K, Thuiller W. 2012. How to measure and
test phylogenetic signal. Methods in Ecology and
Evolution 3: 743-756.
Openshaw GH, Keogh JS. 2014. Head shape evolution
in monitor lizards (Varanus): interactions between
extreme size disparity, phylogeny, and ecology.
Journal of Evolutionary Biology 27: 363-373.
Orme D, Freckleton R, Thomas G, Petzoldt T, Fritz
S, Isaac N, Pearse W. 2018. R Core Team caper:
comparative analyses of phylogenetics and evolution
in R. R package version 1.0.1. Available: https://
cran.r-project.org/web/packages/caper/index.html
[Accessed: 1 June 2020].
Oufiero CE, Gartner GEA, Adolph SC, Garland T.
2011. Latitudinal and climatic variation in body
size and dorsal scale counts in Sce/oporus lizards: a
phylogenetic perspective. Evolution 65: 3,590-3,607.
Pagel M. 1999. Inferring the historical patterns of
biological evolution. Nature 401: 877-884.
Pethiyagoda R, Manamendra-Arachchi K. 1998. A
revision of the endemic Sri Lankan agamid lizard
genus Ceratophora Gray, 1835, with description of
two new species. Journal of South Asian Natural
History 3: 1-50.
Pethiyagoda R. 2007. Pearls, Spices, and Green Gold:
an Illustrated History of Biodiversity Exploration in
Sri Lanka. WHT Publications, Colombo, Sri Lanka.
October 2020 | Volume 14 | Number 3 | e259
A new species of the genus Ceratophora
241 p.
Posada D, Crandall KA. 1998. Modeltest: testing the
model of DNA substitution. Bioinformatics 14:
817-818.
Pyron RA, Kandambi HKD, Hendry CR, Pushpamal
V, Burbrink FT, Somaweera R. 2013. Genus-level
phylogeny of snakes reveals the origins of species
richness in Sri Lanka. Molecular Phylogenetics and
Evolution 66: 969-978.
R Core Team. 2020. R: a language and environment for
statistical computing. R Foundation for Statistical
Computing, Vienna, Austria. Available: http://www.R-
project.org/ [Accessed: 1 June 2020].
Rambaut A, Suchard M, Xie W, Drummond A. 2014.
Tracer v. 1.6. Institute of Evolutionary Biology,
University of Edinburgh, Edinburgh, United Kingdom.
Available: http://tree.bio.ed.ac.uk/software/tracer/
[Accessed: 1 June 2020].
Revell LJ. 2010. Phylogenetic signal and linear regression
on species data. Methods in Ecology and Evolution 1:
319-329.
Revell LJ. 2012. Phytools: an R package for phylogenetic
comparative biology (and other things). Methods in
Ecology and Evolution 3: 217-223.
Revell LJ. 2013. Two new graphical methods for
mapping trait evolution on phylogenies. Methods in
Ecology and Evolution 4: 754-759.
Ronquist F, Huelsenbeck JP. 2003. MrBayes 3: Bayesian
phylogenetic inference under mixed models.
Bioinformatics 19: 1,572—1,574.
RStudio Team. 2018. RStudio: integrated development
for R. RStudio, Inc., Boston, Massachusetts, USA.
Schulte I] JA, Macey JR, Pethtyagoda R, Larson A. 2002.
Rostral horn evolution among agamid lizards of the
genus Ceratophora endemic to Sri Lanka. Molecular
Phylogenetics and Evolution 22: 111-117.
Somaweera R, Somaweera N. 2009. Lizards of Sri Lanka:
a Color Guide with Field Keys. Edition Chimaira,
Frankfurt am Main, Germany. 303 p.
Stacklies W, Redestig H, Scholz M, Walther D, Selbig
J. 2007. pcaMethods—a bioconductor package
providing PCA methods for incomplete data.
Bioinformatics 23: 1,164—1,167.
Sudasinghe H, Pethiyagoda R. 2019. A commentary
on the taxonomic review of Sri Lankan Devario by
Batuwita et al. 2017 (Teleostei: Danionidae). Zootaxa
4543: 421-430.
Tamura K, Stecher G, Peterson D, Filipski A, Kumar
S. 2013. MEGA6: molecular evolutionary genetics
analysis version 6.0. Molecular Biology and Evolution
3092, 725-2729)
Tyler RK, Winchell KM, Revell LJ. 2016. Tails of the
city: caudal autotomy in the tropical lizard, Anolis
cristatellus, in urban and natural areas of Puerto Rico.
Journal of Herpetology 50: 435-441.
Uetz P, Cherikh S, Shea G, Ineich I, Campbell PD,
Doronin IV, Rosado J, Wynn A, Tighe KA, McDiarmid
R, et al. 2019b. A global catalog of primary reptile
type specimens. Zootaxa 4695: 438-450.
Wang K, Che J, Lin S, Deepak V, Aniruddha DR, Jiang K,
Jin J, Chen H, Siler CD. 2019. Multilocus phylogeny
and revised classification for mountain dragons of the
genus Japalura sl. (Reptilia: Agamidae: Draconinae)
from Asia. Zoological Journal of the Linnean Society
185: 246-267.
Wegener JE, Gartner GEA, Losos JB. 2014. Lizard scales
in an adaptive radiation: variation in scale number
follows climatic and structural habitat diversity in
Anolis \izards. Biological Journal of the Linnean
Society 113: 570-579.
Whiting MJ, Noble DW, Somaweera R. 2015. Sexual
dimorphism in conspicuousness and ornamentation in
the enigmatic leaf-nosed lizard Ceratophora tennentii
from Sri Lanka. Biological Journal of the Linnean
Society 116: 614-625.
Williams EE. 1979. South American anoles: the species
groups. 2. The proboscis anoles (Anolis leavis group).
Breviora 449: 1-18.
Amphib. Reptile Conserv.
Suranjan Karunarathna began his scientific exploration of biodiversity in early 2000 with the
Young Zoologists’ Association of Sri Lanka (YZA), an organization which he led in 2007 as the
President. Suranjan earned his Masters of Environmental Management from University of Colombo
(Sri Lanka) in 2017. As a wildlife researcher, he conducts research on the ecology and taxonomy
of amphibians and reptiles, and also promotes science-based conservation awareness among the Sri
Lankan community, focusing on the importance of biodiversity and its conservation. He is an active
member of few specialist groups of the IUCN/SSC, and has been an expert committee member of
the IUCN Global & National Red List development programs since 2004.
Nikolay Poyarkov is an Associate Professor in the Vertebrate Zoology Department of Lomonosov
Moscow State University in Moscow, Russia. Nikolay leads a research lab that is working on the
evolutionary biology and taxonomy of Asian amphibians and reptiles. Their efforts are mainly
focusing on the molecular systematics, phylogeography, DNA-barcoding, distribution, and
taxonomy of certain groups of Asian herpetofauna from Indochina, Eastern Asia, and Central Asia.
124 October 2020 | Volume 14 | Number 3 | e259
Amphib. Reptile Conserv.
Karunarathna et al.
Chamara Amarasinghe is the Head Ranger at Jetwing Safari Camp Yala (Sri Lanka). His love for
the natural world was instilled early in life, during his childhood days in Deraniyagala. Chamara
is a wildlife artist and photographer engaged with the Youth Exploration Society of Sri Lanka
(YES) since 1999. He also holds a Masters of Environment Management from the University of
Colombo.
Thilina Surasinghe is an Associate Professor in the Department of Biological Sciences in
Bridgewater State University, Massachusetts, USA. Thilina completed his Ph.D. in Wildlife
Biology at Clemson University, South Carolina, USA. He is a wildlife ecologist, whose academic
training encompasses conservation biology and landscape ecology. His current research focuses on
community organization and biotic homogenization along urban-rural gradients, landscape-scale
conservation planning, conservation of endangered wildlife, revision of environmental policies, and
ecology of freshwater ecosystems.
Andrey Bushuev is a Senior Researcher at the Vertebrate Zoology Department of Lomonosov
Moscow State University, Russia. He is mainly interested in the ecological and comparative
physiology of birds, with particular attention to the tropical species of Southeast Asia. Andrey is
also part of a working group that is conducting a long-term study of hollow-nesting birds in the
Moscow region.
Majintha Madawala is a naturalist who began his career and wildlife interests as a member of
the Young Zoologists Association of Sri Lanka (YZA). Mayjintha holds a Diploma in Biodiversity
Management and Conservation from the University of Colombo (Sri Lanka). As a conservationist
and naturalist, he is engaged in numerous habitat restoration efforts, snake rescue programs, and
biodiversity research projects in Sri Lanka. Currently, Majintha is engaged in herpetofauna research
at the Victorian Herpetological Society in Australia. He is also an active member of the IUCN/SSC
Crocodile Specialist Group and the IUCN Global & National Red List development programs.
Vladislav Gorin is a young researcher from Lomonosov Moscow State University, Russia. Since
the start of his herpetological career in 2015 as a master’s student of Nikolay Poyarkov, Vladislav
has participated in many expeditions throughout Asia, including Sri Lanka, Nepal, Myanmar,
Vietnam, Thailand, and others. His work focuses on different aspects of the evolution of amphibians
and reptiles in tropical Asia.
Anslem de Silva M.Sc., D.Sc. (University of Peradeniya, Sri Lanka) started keeping reptiles at the
early age of seven, and has taught herpetology at the Rajarata University of Sri Lanka and final year
veterinary students at University of Peradeniya as a visiting lecturer and consultant herpetologist.
Anselm has conducted surveys of herpetofauna in critical ecosystems in Sri Lanka and published
more than 400 manuscripts, of which nearly 60 are books and chapters in books. Anslem had
performed yeoman service for the country and the region for more than 50 years. He is the Regional
Chairman of the IUCN/SSC Crocodile Specialist Group for South Asia and Iran, and Co-Chair of
the IUCN/SSC Amphibian Specialists Group Sri Lanka. Anslem received the IUCN/SSC Sir Peter
Scott Award for Conservation Merit in October 2019, making him the first Sri Lankan to receive
this award.
125 October 2020 | Volume 14 | Number 3 | e259
A new species of the genus Ceratophora
Appendix 1. Comparative materials examined.
Ceratophora aspera. BMNH.1946.30.51 (female), BMNH.1946.30.52 (male), WHT.0178 (male), WHT.1366
(female), WHT.1369 (male), WHT.1370 (female), WHT.1371 (male), WHT.2170 (male), WHT.1396 (female),
WHT. 1400 (male).
Ceratophora erdeleni: BMNH.1996.448 (holotype male), BMNH.1996.450 (paratype male), BMNH.1996.449
(paratype female), WHT.1328 (male), WHT2070 (male), WHT.2172 (female), WHT2175 (male).
Ceratophora karu. BMNH.1996.445 (holotype male), BMNH.1996.446 (female), BMNH.1996.447 (male),
WHT.2065 (male), WHT.2067 (male), WHT.2068 (female).
Ceratophora stoddartii. BMNH.1946.8.27.37 (male), WHT.0209 (female), WHT.1170 (male), WHT.1327 (male),
WHT.1700 (male), WHT.1702 (female).
Ceratophora tennentii: BMNH.1946.8.27.33 (syntype male), WHT.0103 (male), WHT.0114 (female), WHT.1350
(male).
Cophotis ceylanica: ZMB.4240 (lectotype), WHT.0177 (female), WHT.0516 (male), WHT.0645 (male), WHT.5817
(female), WHT.5818 (female), WHT.5819 (male).
Cophotis dumbara: CMS.2006.85.01 (male holotype), CMS.2006.85.02 (female paratype), WHT.6788 (male),
WHT.6948 (male), WHT.6789 (female).
Lyriocephalus scutatus: WHT.0175 (female), NMSL.0462 (male), NMSL.0471 (male), NMSL.0485 (female).
Amphib. Reptile Conserv. 126 October 2020 | Volume 14 | Number 3 | e259
Amphibian & Reptile Conservation
14(3) [Taxonomy Section]: 127-137 (e260).
Official journal website:
amphibian-reptile-conservation.org
urn:lsid:zoobank.org:pub:6A9CD52E-F37B-468B-B0B4-ABE68F032725
A new species of terrestrial-breeding frog of the genus
Psychrophrynella (Anura: Strabomantidae) from the
Cordillera de Vilcabamba, southeastern Peru
12.*F, Peter Condori, *Aldemar A. Acevedo, ‘:”*Luis Mamani, 2J. Amanda Delgado,
and ‘?Juan C. Chaparro
'Museo de Biodiversidad del Peru, Urbanizaci6én Mariscal Gamarra A-61, Zona 2, Cusco, PERU *Museo de Historia Natural de la Universidad
Nacional de San Antonio Abad del Cusco, Paraninfo Universitario (Plaza de Armas s/n), Cusco, PERU ?Laboratorio de Biologia Evolutiva,
Departamento de Ecologia, Facultad de Ciencias Bioldgicas, Pontificia Universidad Catélica de Chile, Casilla 114-D, Alameda 340, Santiago
6513677, CHILE *Programa de Doctorado en Sistemdtica y Biodiversidad, Facultad de Ciencias Naturales y Oceanogrdaficas, Universidad de
Concepcion, CHILE
Abstract.—A new frog of the genus Psychrophrynella is described based on specimens from the Cordillera
de Vilcabamba, in the department of Cusco in southeastern Peru. The new species inhabits the humid puna
and is only known from its type locality in Challcha, near the road between Vilcabamba and Pampaconas, at
3,707 m asl. This new taxon is assigned to the genus Psychrophrynella based on a narrowest genetic distance
of 16S rRNA with P. glauca (8.3%) and the presence of a fold-like tubercle on the inner edges of the tarsus.
The description of Psychrophrynella vilcabambensis sp. nov. is based on three individuals. This new species
can be differentiated from other members of the genera Psychrophrynella and Noblella by the combination of
the following characters: light reddish-brown to tan coloration on the dorsum with dark brown markings, the
presence of a thoracic fold, ulnar tubercles, a tubercle on the heel, three tubercles on outer edge of tarsus, and
toes with lateral fringes. The SVL of male and female specimens are 16.5 and 16.6 mm, respectively.
Keywords. Amphibia, Andes, Cusco, Holoadeninae, Noblella, Psychrophrynella vilcabambensis sp. nov.
Resumen.—Describimos una nueva rana del género Psychrophrynella de la Cordillera de Vilcabamba, en el
departamento de Cusco al sudeste del Peru. La nueva especie habita la puna humeda y solo se conoce de
su localidad tipo en Challcha, cerca de la carretera entre Vilcabamba y Pampaconas, a 3,707 m snm. El nuevo
taxon se asigna al género Psychrophrynella, basandose en la distancia genética de 16S ARNr mas estrecha
con P. glauca (8.3%), y la presencia de un tubérculo alargado similar a un pliegue en el borde interior del tarso.
Psychrophrynella vilcabambensis sp. nov. fue descrita en base a tres individuos. Esta nueva especie se puede
diferenciar de otros miembros de los géneros Psychrophrynella y Noblella por la siguiente combinacion de
caracteres: coloracioOn marron rojiza clara a marron bronceada en el dorso con manchas marron oscuras,
presencia de pliegue toracico, tuberculos cubitales, un tubérculo en el talon, tres tubérculos en el borde exterior
del tarso y dedos con rebordes laterales. El SVL del macho y de la hembra es 16.5 y 16.6 mm, respectivamente.
Palabras clave. Andes, Anfibia, Cusco, Holoadeninae, Noblella, Psychrophrynella vilcabambensis sp. nov.
Citation: Condori FP, Acevedo AA, MamaniL, Delgado JA, Chaparro JC. 2020. Anew species of terrestrial-breeding frog of the genus Psychrophrynella
(Anura: Strabomantidae) from the Cordillera de Vilcabamba, southeastern Peru. Amphibian & Reptile Conservation 14(3) [Taxonomy Section]: 127-
137 (e260).
Copyright: © 2020 Condori et al. This is an open access article distributed under the terms of the Creative Commons Attribution License [Attribution
4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction in any
medium, provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced, are
as follows: official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 27 September 2020; Published: 15 October 2020
Introduction Euparkerella, | Holoaden, Microkayla, Noblella,
Psychrophrynella, and Qosqgophryne (Catenazzi et al.
The subfamily Holoadeninae Hedges, Duellman, and 2020; Heinicke et al. 2018). Psychrophrynella bagrecito
Heinicke, 2008 was constructed based on molecular | Hedges, Duellman, and Heinicke, 2008 is the type species
data, and includes the genera Barycholos, Bryophryne, of the genus Psychrophrynella, proposed by Hedges et al.
Correspondence. *
[email protected]
Amphib. Reptile Conserv. 127 October 2020 | Volume 14 | Number 3 | e260
A new species of Psychrophrynella from Peru
(2008). In the same study, Hedges et al. (2008) include
one Peruvian and 18 Bolivian species in the genus
Psychrophrynella. Subsequent studies increased the
diversity of the genus to 22 species distributed in humid
puna of the Andes of southeastern Peru and northwestern
Bolivia (De la Riva and Burrowes 2014; De la Riva and
Aparicio 2016). However, in 2017, additional molecular
studies by De la Riva et al. (2017) divided the genus
Psychrophrynella into two genera, Psychrophrynella
and the new genus Microkayla. In this new genus, these
authors included 24 species from Bolivia and three from
Peru. Moreover, De la Riva et al. (2017) supported the
monophyly and validity of the genus Psychrophrynella,
reducing the number of species in this genus to three (P.
bagrecito, P. chirihampatu, and P. usurpator), while the
other species were moved to the genus Microkayla. Later,
Catenazzi and Ttito (2018) described P. glauca from Peru.
Thus, the Peruvian endemic genus Psychrophrynella
currently contains four formally described species (P.
bagrecito, P. usurpator, P. chirihampatu, and P. glauca).
This genus is distributed along the eastern slopes of
southeastern Peruvian Andes, between the departments of
Cusco and Puno at 2,225—3,400 m asl, where these frogs
are typically found in the leaf litter and under stones and
terrestrial mosses (Catenazzi and Ttito 2016, 2018; De la
Riva et al. 2008; Lynch 1986).
Despite the advancements in the systematics and
taxonomy of the subfamily Holoadeninae (De la Riva
2020; De la Riva et al. 2017; Heinicke et al. 2018), our
understanding of some lineages is still precarious. One
example is the uncertainty regarding the phylogenetic
relationship between Psychrophrynella and Noblella
(Catenazzi and Ttito 2016, 2018; Catenazzi et al. 2020).
The genus Noblella is polyphyletic and includes two
divergent lineages: one containing five species with
distribution ranges from central Peru to Ecuador, and
the other with four species from southeastern Peru
(Catenazzi and Ttito 2019; Reyes-Puig et al. 2019;
Santa Cruz et al. 2019). The type species of Noblella
(N. peruviana) and Psychrophrynella (P. bagrecito)
are both distributed in southeastern Peru, but genetic
sequences are not available for these two species
and the synapomorphies that support Noblella and
Psychrophrynella are inconclusive (Catenazzi and Ttito
2016, 2018; De la Riva et al. 2008; Santa Cruz et al.
2019). Herein, a morphological description is provided
for a new species of terrestrial-breeding frog from
the Cordillera de Vilcabamba, department of Cusco
in southeastern Peru. This species was recognized as
a new species in some earlier studies, being listed as
Psychrophrynella sp. by Lehr and Catenazzi (2010) and
Catenazzi et al. (2020).
Materials and Methods
Data collection. Specimens were collected by hand and
euthanized by application of 8% benzocaine paste on the
Amphib. Reptile Conserv.
dorsal and ventral regions. Tissue samples (muscle) were
stored in 2 mL cryogenic tubes filled with 96% ethanol,
and specimens were fixed in 10% formalin and preserved
in 70% ethanol. Specimens were deposited in the
herpetological collection of the Museo de Biodiversidad
del Peru (MUBI).
Morphology. The description of morphological
characters of Psychrophrynella follows Duellman and
Lehr (2009), and Catenazzi and Ttito (2016, 2018). The
taxonomic classification follows Heinicke et al. (2018).
Morphometric measurements were taken using a digital
caliper and a stereoscope. Abbreviations of measurements
are as follows: snout-vent length (SVL), tibia length (TL),
foot length (FL, distance from the proximal margin of
inner metatarsal tubercle to tip of Toe IV), head length
(HL, from angle of jaw to tip of snout), head width (HW,
at level of angle of jaw), eye diameter (ED), tympanum
diameter (TY), interorbital distance (JOD), upper
eyelid width (EW), internarial distance (IND), and eye-
nostril distance (E-N, straight line distance between the
anterior corner of orbit and posterior margin of external
nares). Fingers and toes are numbered preaxially to post
axially from I-IV and I—V, respectively. To determine
the lengths of Toes HI and V, both toes were pressed
against Toe IV, and the lengths of fingers I and II were
determined by pressing these fingers against each other.
The variation in coloration in life is based on the field
notes and photographs by the third author (LM). This new
Species was compared with the descriptions as published
in the literature for the four valid and formally described
species of the genus Psychrophrynella (Catenazzi and
Ttito 2016, 2018; De la Riva et al. 2008; Lynch 1986),
and five species of the genus Nob/e/la from southern Peru
(Catenazzi and Ttito 2019; Catenazzi et al. 2015; Lehr
and Catenazzi 2009; Noble 1921; Santa Cruz et al. 2019).
Examined material is listed in Appendix 1.
DNA _ extraction, amplification, and sequencing.
Genomic DNA was extracted from the voucher specimen
MUBI 13485 using the QIAGEN DNeasy Blood and
Tissue extraction kit following the manufacturer’s
protocol. Fragments of the mitochondrial long subunit
tRNA gene (16S) were amplified by Polymerase Chain
Reaction (PCR) with the following conditions: an initial 2
min at 93 °C, followed by 35 cycles of 30 sec at 95 °C, 1
min at 42 °C, 1.5 min at 72 °C, and a final extension step
of 6 min at 72 °C. The primers used were 16Sar (CGC
CTG TTT ATC AAA AAC AT) and 16Sbr (CCG GTC
TGA ACT CAG ATC ACG T) [Palumbi et al. 1991].
Purified PCR products were sent to Macrogen Inc. (Seoul,
Republic of Korea) for sequencing in both directions with
the amplification primers. Raw sequence chromatographs
for sequences generated in this study were edited using
AliView 1.14 (Larsson 2014). One new gene sequence of
this locus was produced with GenBank accession number
MT818174.
October 2020 | Volume 14 | Number 3 | e260
Condori et al.
Table 1. GenBank codes for sequences of the species of the subfamily Holoadeninae used in this study.
Species and voucher specimens
Barycholos ternetzi CFBHT 04408
Bryophryne bakersfield MUBI 6022
Bryophryne cophites AC 270.07
Bryophryne hanssaueri MUSM 27567
Bryophryne nubilosus MUSM 27882
Bryophryne phuyuhampatu CORBIDI 18226
Holoaden luederwaldti CFBHT 07810
Microkayla chilina MNCN 43774
Microkayla iatamasi MNCN 42054
Microkayla katantika CBF 6012
Noblella lochites KU 177356
Noblella losamigos MUSA 6973
Noblella madreselva CORBIDI 15770
Noblella myrmecoides QCAZ 40180
Noblella pygmaea MUSM 24536
Noblella thiuni CORBIDI 18723
Phrynopus peruanus MUSM 38316
Psychrophrynella chirihampatu MUBI 14664
Psychrophrynella glauca CORBIDI 18729
Psychrophrynella usurpator AC186.09
Psychrophrynella vilcabambensis sp. nov. MUBI 13485
Psychrophrynella sp. MUSM 27619
Genetic distances. Uncorrected p-distances were
estimated using the 16S rRNA mitochondrial gene,
comparing the new species to some representative
species of the genera Barycholos, Bryophryne, Holoaden,
Microkayla, Noblella, Phrynopus, and Psychrophrynella,
which were available in GenBank (Table 1). The DNA
sequences were aligned in MUSCLE (Edgar 2004) and
uncorrected p-distances were estimated in MEGAX
(Kumar et al. 2018). Following Catenazzi and Ttito (2016,
2018), phylogenetic analyses were not performed because
taxonomic uncertainty exists in the genera Noble/la and
Psychrophrynella;, and molecular information about the
type species, Noblella peruviana and Psychrophrynella
bagrecito, are needed for taxonomic resolution.
Results
Generic placement. The new species is placed in the
genus Psychrophrynella (Hedges et al. 2008) on the basis
of morphological and molecular data. The main diagnostic
phenotypic traits of Psychrophrynella are: (1) tympanic
membrane and annulus differentiated (annulus and
membrane visible beneath skin); (2) tips of digits narrow
and rounded, not expanded, lacking circumferential groves
and pads; and (3) inner edge of tarsus bearing a prominent,
elongate, sigmoid-shaped or fold-like tubercle (De la Riva
et al. 2017). These aforementioned characteristics are
shared by the new species. Additionally, analyses of the
Amphib. Reptile Conserv.
GenBank accession (16S)
Source
KU495 152 Lyra et al. 2016
MF 186341 De la Riva et al. 2017
KY652641 von May et al. 2017
KY652642 von May et al. 2017
KY652643 von May et al. 2017
MF419256 Catenazzi et al. 2017
KU495249 Lyra et al. 2016
MF 186416 De la Riva et al. 2017
MF 186368 De la Riva et al. 2017
MF 186380 De la Riva et al. 2017
EU186699 Hedges et al. 2008
KY652644 von May et al 2017
MN056356 Catenazzi and Ttito 2019
JX267542 Canedo and Haddad 2012
KY652645 von May et al. 2017
MK072732 Catenazzi and Ttito 2019
MG896582 von May et al. 2018
KU884560 Catenazzi and Ttito 2016
MG837565 Catenazzi and Ttito 2018
KY652662 von May et al. 2017
MT818174 This study
MT437065 Catenazzi et al. 2020
uncorrected p-distances for 16S rRNA showed that the
new species has wide genetic distances from all species
that were compared (Table 2), the narrowest being with
P. glauca (8.3%) and N. thiuni (9.4%).
Taxonomy
Psychrophrynella vilcabambensis sp. nov.
Psychrophrynella sp. Lehr and Catenazzi 2010: 317
Psychrophrynella sp. MUSM 27619 Catenazzi et al.
2020: 10.
urn:|sid:zoobank.org:act: CS56F4DBA-5594-4069-BE91-0376E705542C
Holotype. MUBI 13485, an adult male (Fig. 1) from
Challcha (13°05’44”S, 73°01°37.7°W) [WGS84], 3,707
m asl, district of Vilcabamba, province of La Convencion,
department of Cusco, Peru; collected on 8 August 2016,
by F.P. Condori, L. Mamani, and J.A. Delgado.
Paratypes. Two specimens: one adult female, MUBI
13486 (Fig. 2A—B), and one juvenile, MUBI 13484 (Fig.
2C-D), same data as holotype.
Diagnosis. Psychrophrynella vilcabambensis sp. nov. 1s
characterized by having: (1) skin on dorsum shagreen
with small warts, coalescing into linear ridges at
midbody; dorsolateral fold visible on half of the body
129 October 2020 | Volume 14 | Number 3 | e260
A new species of Psychrophrynella from Peru
; F . ¥ *) ES Ma aN »
Fig. 1. Photographs in life of the holotype of Psychrophrynella
vilcabambensis sp. nov., adult male MUBI 13485 (SVL = 16.5
mm.). (A-B) Dorsolateral views; (C) ventral view.
and ending posteriorly in a sacral tubercle; skin on venter
smooth, discoidal, and thoracic fold present; (2) tympanic
membrane not differentiated, anteroventral part of tympanic
annulus barely visible below skin; (3) snout short, rounded
in dorsal view and in profile; (4) upper eyelid narrower
than IOD, bearing small tubercles; cranial crests absent:
(5) dentigerous processes of vomers absent; (6) vocal slits
present; nuptial pads absent; (7) fingers lacking lateral
fringes; Finger I shorter than Finger II; tips of digits rounded,
not expanded laterally; (8) ulnar tubercles present; (9) heel
with one tubercle; inner edge of tarsus bearing an elongate,
oblique fold-like tubercle; outer edge of tarsus with some
tubercles; (10) inner metatarsal tubercle prominent elliptical,
1.25 times larger than ovoid outer metatarsal tubercle;
supernumerary plantar tubercles small, poorly defined; (11)
toes with lateral fringes; webbing absent; Toe V slightly
Amphib. Reptile Conserv.
shorter than or equal to Toe III; tips of digits rounded, not
expanded; (12) dorsum light reddish brown to tan, with or
without a pale middorsal line extending from tip of snout to
the cloaca, and with dark brown markings, tnside of which
there are dermal protuberances; interorbital blotch present;
flanks dark reddish brown; chest and throat dark brown
with moderate or abundant pale gray flecks; palmar and
plantar surfaces dark brown with tiny pale gray flecks; belly
and legs grayish brown with pale gray flecks; (13) SVL of
males 16.5 mm (based on a single adult specimen), SVL
of females 16.63 mm (based on a single adult specimen)
[Table 3].
Comparative diagnosis. The new species differs
morphologically from species of Nob/ella in southern Peru
(N. losamigos, N. madreselva, N. peruviana, N. pygmaea,
and N. thiuni) based on discoidal fold. It is also different
from N. losamigos, N. madreselva, N. peruviana, and N.
pygmaea due to the absence of elongate acuminate toe
tips. Relative to all species of Psychrophrynella, it differs
in having unique characters such as light reddish-brown to
tan coloration on dorsal surfaces with dark brown marks
and in presenting a thoracic fold, toes with lateral fringes
(Fig. 3A), one tubercle on the heel and some tubercles on
the outer edge of the tarsus, and ulnar tubercles (Fig. 3B).
Morphologically, P. vilcabambensis sp. nov. is similar
to P. chirihampatu in having a large fold-like tubercle
on the inner edge of the tarsus, a prominent elliptical
inner metatarsal tubercle larger than the ovoid outer
metatarsal tubercle, and shagreen dorsum skin with small
warts forming linear ridges at the middorsum. However,
P. vilcabambensis sp. nov. can be distinguished from
P. chirihampatu by having a visible discoidal fold (not
visible in P. chirihampatu), small upper eyelid tubercles
(lacking in P. chirihampatu), and an inner metatarsal
tubercle 1.25 times larger than the outer metatarsal
tubercle (versus 1.5 times). From P. bagrecito, the new
species differs by having smooth (areolate) skin on venter,
short snout (moderately long), tarsus with an elongate
fold-like tubercle (short), inner metatarsal tubercle larger
than outer metatarsal tubercle (equal), poorly defined
small supernumerary plantar tubercles (lacking), and Toe
V slightly shorter or equal to Toe III (Toe V shorter than
Toe III). From P. glauca, it differs by having a dorsolateral
fold (absent), short snout (snout very short), small upper
eyelid tubercles (lacking), tarsus elongate with fold-like
tubercle (short), and inner metatarsal tubercle larger than
outer metatarsal tubercle (equal). From P. usurpator,
the new species differs by having shagreen dorsum skin
(smooth), small upper eyelid tubercles (lacking), inner
metatarsal tubercle larger than outer metatarsal tubercle
(inner metatarsal tubercle same size as outer metatarsal
tubercle), and Toe V slightly shorter than or equal to Toe
III (Toe V shorter than Toe III).
Description of holotype. Adult male (SVL 16.5 mm);
head narrower than the body, its length 28.30% of SVL;
October 2020 | Volume 14 | Number 3 | e260
Condori et al.
%
' ‘ a 4 “FR.. .
: ~ eA
- . “ -* , * *
. £ ' ¥, , >
’ j , = » » 4 4 .
ql i a 4
7 i re te, ae Sp: ; :
- Se a
© a ee i. iN ey « Ls ig oxy : Te mn oy o> 3
Fig. 2. Photographs in life of paratypes of Psychrophrynella vilcabambensis sp. nov. (A—B) Dorsolateral and ventral views of adult
_— “a
female, MUBI 13486 (SVL = 16.63 mm); (C—D) dorsolateral and ventral views of juvenile MUBI 13484 (SVL = 12.99 mm).
head slightly wider than long, HW 117.8% of HL; HW
33.3% of SVL; snout short, rounded in dorsal and lateral
views, ED 38.97% of HL, its diameter 1.6 times as large
as its distance from the nostril; nostrils not protuberant,
close to snout, directed laterally; canthus rostralis concave
in dorsal view, slightly convex in profile; loreal region
flat; lips rounded; upper eyelids with small tubercles;
EW 62.6% of IOD; interorbital region flat, lacking
cranial crests; E-N distance 62.1% of ED; supratympanic
fold absent; tympanic membrane not differentiated,
anteroventral part of tympanic annulus visible below
skin; postrictal tubercles present. Choanae round, small;
dentigerous processes of vomers and vomerine teeth
absent; the tongue covers almost the entire floor of the
mouth, and it 1s large and ovoid.
Skin on dorsum shagreen with small warts, which are
equally distributed on the dorsum, at middorsum these
warts conform linear ridges; dorsolateral folds present only
anteriorly and terminate posteriorly in a sacral tubercle; skin
on flanks shagreen; venter smooth; pectoral and discoidal
fold present; cloaca not protuberant, cloacal region with
small tubercles. Ulnar tubercles present; circular outer
palmar tubercle approximately the same length but twice
the width of oval thenar tubercle; supernumerary palmar
tubercles present; subarticular tubercles prominent, rounded
in ventral and lateral view; fingers lacking lateral fringes,
not webbed; relative lengths of fingers 3 > 4 > 2 > 1; tips of
digits bulbous, not expanded laterally.
Amphib. Reptile Conserv.
Hindlimbs moderately long, TL 44.4% of SVL; FL
51.5% of SVL, upper surface shagreen with moderately
small tubercles; posterior surfaces smooth; heel with
one tubercle; inner edge of tarsus bearing a large,
oblique fold-like tubercle, outer edge of tarsus with
tubercles; elliptical inner metatarsal tubercle larger than
ovoid outer metatarsal tubercle; plantar supernumerary
tubercles weakly defined; subarticular tubercles rounded
in ventral view and ovoid in profile view; toes with
lateral fringes, not webbed: toe tips weakly pointed, not
expanded laterally; relative lengths of toes 4 > 3 > 5 >
2> 1 (Fig. 2A).
Measurements of holotype (in mm). SVL 16.5, TL 7.33,
FL 8.49, HL 4.67, HW 5.5, ED 1.82, TY 0.89, IOD 2.19,
EW 1.37, IND 1.8, E-N 1.13.
Coloration of holotype in life. Dorsal surfaces of head,
body, and extremities reddish brown, with dark brown
markings bordered by a poorly defined cream stripe.
Lateral surface of the head with three dark brown labial
bars, the middle one in contact with the eye; and a dark
reddish-brown stripe, extending from the tip of the snout
to the border of the eye, crossing above the tympanum
and extending to the insertion of the forelimb. This
stripe becomes redder and lighter as it approaches the
insertion of the forelimb. Iris dark reddish brown with
abundant black reticulations and gold pallid stripe on
October 2020 | Volume 14 | Number 3 | e260
A new species of Psychrophrynella from Peru
Cel ls cles & 6
¢
I
va)
loa)
Se
oe
\o
ae
a]
Pe [voe[ es [or [ovr [cor [oer] oer [ovr oer] osr | cor [ovr ost [sr Pseslpou 19140
WZ | \O
Ol
oes Ea
CO} OV
papusdd v1/2/GON
SOSIUDSO] VIJ2]GON
Pot tT fies fies [si] ro | ro | ro | ser] scr | ssn mypnupany DEDyOUDI
Pot TT ve [ost | vor] ser] ser] sit] su | s'3r sspuupin DyPyosoIp\
Pott Tf rtf vo Pott fn | ser] scr | s'0c | puro pypyos01yy
Pt tT rt | ser | ort | eon | eet | s'8t upIps.iopant| UapDojoH]
a rupdurpyndnyd aucaydotig
Pt fz e9 | cs | stor snsoyrgnu aucaydosig
eS a AAS lianpssupy audaydodig
a an) en es sajiydos audiydodug
ne a Ee playfsaayng auduydodig
aS
Sy oe
iy
oC iy iy =
hi “~ ™ Ss
S § § 8
s §& € §
3 3 3
= ~ 9
FF $ &
> 8 = is
= BS S =
= & 3 S
= = i
=
Sp es) 2 Sy bs & we BS
a = =:
ey F&F Eg § +. Stain peas ve
Ss > >= > ‘Sy o> 3 3 3 3 8
2 2 Sg >= ss = = = = =
S)
*s = 8 : > 5 = 3 3 8 &
Q Ss S si S = S . ~
= = 3 = as > > 9 > iS
a a CS ast = 8 s 8 =
= = a as > = SS a Pad
8 8 x /— > Z =: 3 =
= ° ij ~.
S e < = gs =
=) wm 8 ~~
rs a. aX
njodumynidnyd audsydodig oe
‘onyq Ul poaYysIfYysiy ose sarsads
JepIWIS Jsou A][eoTJOUNS OY], “AvUTUOPL[OH{ ATIWIeJGns dy} UI exe} pojeo1 pue ‘aou “ds sisuaquipgvopia wjjaudsydosyods J UddMJaq SddUDNbIS WNYI SO JO sdouvysip-d poooIOSUL) *Z 9QUL
October 2020 | Volume 14 | Number 3 | e260
132
Amphib. Reptile Conserv.
Condori et al.
a2
Fig. 3. Morphological details of Psychrophrynella vilcabambensis sp. nov. (A) Plantar surface with a red arrow indicating the
presence of lateral fringes (MUBI 13484); (B) lateral view of forelimb with white arrows indicating the presence of ulnar tubercles
(MUBI 13485).
upper part of pupil. Throat, chest, and anterior part of
belly dark brown, fading into light brown posteriorly,
with moderate small pale gray flecks and abundant tiny
dots of the same color. Ventral parts of limbs brown
with moderate small pale gray flecks. Dorsal surfaces of
hind limbs with a dark transverse bar. Posterior surfaces
of thighs and groin grayish brown; plantar and palmar
surfaces brown (Fig. 3).
Coloration in preservative. Similar to coloration in life,
but dorsal coloration varies from brown to light brown.
The parts that were reddish brown lose the red coloration,
and ventral surfaces become more gray than brown.
Variation. Dorsum coloration varies from dark reddish
brown to light brown. Flecks on the back are irregular
in shape. The dark brown lateral stripe extends from the
tip of the snout to the insertion of the forelimb in the
holotype, while in the paratypes it reaches the anterior half
of the body, and the posterior half has similar coloration
as the dorsum. The belly coloration in the female paratype
(MUBI 13486) 1s light brown with abundant tiny pale
gray spots. The juvenile paratype (MUBI 13484) has a
creamy dorsal midline extending from the tip of the snout
to the cloaca; the male holotype and female do not differ
in size or general color pattern.
Amphib. Reptile Conserv.
Etymology. The specific epithet, vilcabambensis, is
given after the name of the mountain range “Cordillera de
Vilcabamba” where the species was found.
Distribution, natural history, and threats. Psychro-
Dhrynella vilcabambensis sp. nov. is known only from
elevations of 3,707 m asl in the type locality (Challcha,
department of Cusco), near the road between Vilcabamba
and Pampaconas (Fig. 4). All specimens were found in
high Andean puna (Fig. 5) during the day, under mosses
covering the rocks. Sympatric amphibian and reptile species
include Bryophryne flammiventris, Nannophryne _ sp.,
and Proctoporus lacertus. The type locality suffers from
anthropogenic activities, such as farming and livestock
production, which might be potential threats to this species.
Following the IUCN Red List criteria IUCN 2019), in the
absence of more detailed data concerning population status,
extent, and occurrence, we suggest this species be placed in
the Data Deficient category of the Red List.
Discussion
The highlands of the Andes of southeastern Peru
(departments of Cusco and Puno) are inhabited by 23
species of small, directly developing frogs, with plump
October 2020 | Volume 14 | Number 3 | e260
A new species of Psychrophrynella from Peru
Table 3. Measurements (in mm) of type series of
Psychrophrynella_ vilcabambensis sp. nov. See text for
character abbreviations.
Characters Female ( = 1) Male (n = 1)
SVL 16.6 16.5
TL 7.8 TS
FL 8.5 8.5
HL 48 47
HW Dae a5
ED 1.8 1.8
TY 0.9 0.9
IOD 2.3 2,2
EW 1.4 1.4
IND 2.0 1.8
E-N 1.3 let
TL/SVL 0.5 0.4
FL/SVL 0.5 0.5
HL/SVL 0.3 0.3
HW/SVL 0.3 0.3
HW/HL Ihet L2
E-N/ED 0.7 0.6
EW/OID 0.6 0.6
ED/HL 0.4 0.4
bodies and short legs, of the genera Psychrophrynella,
Noblella, Bryophryne, Qosqophryne, and Microkayla
(Frost 2020; De la Riva 2020). Likewise, the Andes
of southeastern Peru are formed by six cordilleras:
Apolobamba, Carabaya, Paucartambo, Urubamba,
Vilcabamba, and Vilcanota (ANA 2014; Morales 2010;
Lehr and Catenazzi 2008), where each Cordillera is
inhabited by more than one species of frog from the
subfamily Holoadeninae. Five species (B. bakersfield, B.
cophites, B. hanssaueri, B. nubilosus, and P. usurpator)
inhabit the Cordillera de Paucartambo (Chaparro et
al. 2015; De la Riva et al. 2008; Lehr and Catenazzi
2008, 2009; Lynch 1975), five species (B. tocra, B.
willakunka, M. boettgeri, N. thiuni, and P. glauca) inhabit
the Cordillera de Carabaya (Catenazzi and Ttito 2018,
2019; De la Riva et al. 2017; Lehr 2006), five species (B.
phuyuhampatu, B. quellokunka, B. zonalis, P. bagrecito,
and P. chirihampatu) inhabit the Cordillera de Vilcanota
(Catenazzi and Ttito 2016; Catenazzi et al. 2017; De la
Riva et al. 2017; Lehr and Catenazzi 2009; Lynch 1986),
three species (B. abramalagae, B. bustamantai, and Q.
gymnotis) inhabit the Cordillera de Urubamba (Chaparro
et al. 2007; Lehr and Catenazzi 2009, 2010), three species
(P. vilcabambensis sp. nov., QO. flammiventris, and Q.
mancoinca) inhabit the Cordillera de Vilcabamba (Lehr
and Catenazzi 2010, Mamani et al. 2017), and two
species (MV. chapi and M. chilina) inhabit the Cordillera
de Apolobamba (De la Riva et al. 2017). Eleven of
these species were described during the past five years
(Frost 2020) from the results of explorations of areas
Amphib. Reptile Conserv.
with difficult access. However, there are still remote
and unexplored places which could harbor additional
new species or extensions of the ranges of the described
species. One example is the study by Catenazzi et al.
(2020), which reported three undescribed species in the
genus Psychrophrynella (P. sp.P, P. sp.R, and P. sp.) and
one in the genus Noble/la (N. sp.R). In this context, the
diversity of direct-developing Andean frogs that inhabit
the high Andes is underestimated, and there is a need for
more expeditions to remote locations that lack records,
such as much of the Cordillera de Vilcabamba.
Uncorrected p-distance analyses of the 16S rRNA
sequences show that the new species, Psychrophrynella
vilcabambensis sp. nov., has a narrow genetic distance
from both P. glauca (8.3%) and Noblella thiuni (9.4%).
Thenewspecies, P. glauca, and N. thiuni are found together
in the leaf litter at the Thiuni locality, department of Puno,
Peru (Catenazzi and Ttito 2018, 2019). The phylogenetic
analysis obtained by Catenazzi and Ttito (2019), places N.
thiuni as a sister group of the species of Psychrophrynella
and Noblella in southern Peru. Therefore, the fact that
P. vilcabambensis sp. nov. and N. thiuni have a narrow
genetic distance, despite having a geographical distance
of 285 km in a straight line, provides further evidence
for the phylogenetic and taxonomic uncertainty between
the species of the genera Psychrophrynella and Noblella
(Catenazzi and Ttito 2018, 2019; De la Riva et al. 2008,
2017).
Acknowledgements.—We thank Dr. Ignacio De La Riva
and Dr. Edgar Lehr for their valuable and insightful
feedback on this paper. We also thank MUBI staff for
allowing access to their herpetological collections during
this study; to Efrain Medrano for support during fieldwork,
and to Mr. Marcelino Diaz and Mrs. Claudia Ccahuana for
hosting us in the Challcha sector. Partial funding for the
molecular work was provided by a CONICYT National
Ph.D. Scholarship (21170267). Collection permits for
the specimens held at the Museo de Biodiversidad del
Peru (MUBI) were issued and recognized by SERFOR in
Resolucion de Direccion General N° 024-2017-SERFOR/
DGGSPFFS. Finally, we would like to thank Dr. Jenny
Stynoski for providing valuable suggestions and grammar
corrections that helped to improve this publication.
Literature Cited
ANA. 2014. Inventario de Glaciares del Peru (2da
Actualizacion). Unidad de glaciologia y recursos
hidricos (UGRH), Huaraz, Peru. 198 p.
Canedo C, Haddad CF. 2012. Phylogenetic relationships
within anuran clade Terrarana, with emphasis on the
placement of Brazilian Atlantic rainforest frog genus
Ischnocnema (Anura: Brachycephalidae). Molecular
Phylogenetics and Evolution 65(2). 610-620.
Catenazzi A, Ttito A. 2016. A new species of
Psychrophrynella (Amphibia, Anura, Craugastoridae)
from the humid montane forests of Cusco, eastern
October 2020 | Volume 14 | Number 3 | e260
Condori et al.
72°0.000’W 70°0.000’W
12°0.000’S
14°0.000'S
a
72°0.000’W
16°0.000’S
70°0.000’W
MADRE DE DIOS
$,000'Do@T
% Legend
o
3 A Noblella [J Country limit
4 © Psychrophrynella ‘— Regional limit of Peru
AN. losamigos Altitude
AN. madreselva [| 0-1,242
AN. peruviana MS 1,241-2,501
AN. pygmaea Ms 2,502-3,760
AN. thiuni MB 3,761-5,019
® P bagrecito MB 5,020-6,278
® P chirihampatu
@ P glauca
@ P. usurpator
+k P. vilcabambensis
$:000°009T
Fig. 4. Map of Peru indicating the type localities of species of Psychrophrynella and Noblella from the southeastern region of the
country.
slopes of the Peruvian Andes. PeerJ 4: 1—22.
Catenazzi A, Ttito A. 2018. Psychrophrynella glauca
sp. n., a new species of terrestrial-breeding frogs
(Amphibia, Anura, Strabomantidae) from the montane
forests of the Amazonian Andes of Puno, Peru. Peer/
6: 1-18.
Catenazzi, A, Ttito A. 2019. Noblella thiuni sp. n., a new
(singleton) species of minute terrestrial-breeding frog
(Amphibia, Anura, Strabomantidae) from the montane
forest of the Amazonian Andes of Puno, Peru. Peer/
7: 1-18.
Catenazzi A, Uscapi V, von May R. 2015. A new species
of Noblella (Amphibia, Anura, Craugastoridae) from
the humid montane forests of Cusco, Peru. ZooKeys
516: 71-84.
Catenazzi A, Ttito A, Diaz MI, Shepack A. 2017.
Bryophryne phuyuhampatu sp. n., a new species of
Cusco Andes frog from the cloud forest of the eastern
slopes of the Peruvian Andes (Amphibia, Anura,
Craugastoridae). ZooKeys 685: 65-81.
Catenazzi A, Mamani L, Lehr E, von May R. 2020. A
new genus of terrestrial-breeding frogs (Holoadeninae,
Strabomantidae, Terrarana) from Southern Peru.
Diversity 12(5): 1-17.
Chaparro JC, De la Riva I, Padial JM, Ochoa JA, Lehr E.
2007. A new species of Phrynopus from Departamento
Cusco, southern Peru (Anura: Brachycephalidae).
Zootaxa 1618: 61-68.
Amphib. Reptile Conserv. 135
Fig. 5. View of the type locality of Psychrophrynella
vilcabambensis sp. nov.
Chaparro JC, Padial JM, Gutiérrez RC, De la Riva I. 2015.
A new species of Andean frog of the genus Bryophryne
from southern Peru (Anura: Craugastoridae) and its
phylogenetic position, with notes on the diversity of
the genus. Zootaxa 3994: 94-108.
De la Riva I. 2020. Unexpected beta-diversity radiations
in highland clades of Andean terarranae frogs. Pp.
741-764 In: Neotropical Diversification: Patterns and
Processes. Fascinating Life Sciences. Editors, Rull V,
Carnaval AC. Springer, Cham, Switzerland. 820 p.
De la Riva I, Aparicio J. 2016. Three new Bolivian species
of Psychrophrynella (Anura: Craugastoridae), and
October 2020 | Volume 14 | Number 3 | e260
A new species of Psychrophrynella from Peru
comments on the amphibian fauna of the Cordillera de
Apolobamba. Salamandra 52: 283-292.
De la Riva I, Burrowes PA. 2014. A new species of
Psychrophrynella (Anura: Craugastoridae) from the
Cordillera Real, Department La Paz, Bolivia. Zootaxa
3887: 459-470.
De la Riva I, Chaparro JC, Padial JM. 2008. A new, long-
standing misidentified species of Psychrophrynella
Hedges, Duellman, and Heinicke from Departamento
Cusco, Peru (Anura: Strabomantidae). Zootaxa 1823:
42-50.
De la Riva I, Chaparro JC, Castroviejo-Fisher S, Padial
JM. 2017. Underestimated anuran radiations in the
high Andes: five new species and a new genus of
Holoadeninae, and their phylogenetic relationships
(Anura: Craugastoridae). Zoological Journal of the
Linnean Society 182(1): 129-172.
Duellman WE, Lehr E. 2009. Terrestrial-Breeding Frogs
(Strabomantidae) in Peru. Natur und Tier Verlag,
Munster, Germany and Ulrich Manthey, Berlin,
Germany. 386 p.
Edgar RC. 2004. MUSCLE: multiple sequence alignment
with high accuracy and high throughput. Nucleic Acids
Research 32: 1,792-1,797.
Frost DR. 2020. Amphibian Species of the World: an
Online Reference. Version 6.1. Electronic Database.
Available: —_ https://amphibiansoftheworld.amnh.org/
index.php [Accessed: 29 August 2020].
Hedges SB, Duellman WE, Heinicke MP. 2008. New
World direct-developing frogs (Anura: Terrarana):
molecular phylogeny, classification, biogeography,
and conservation. Zootaxa 1737: 1-182.
Heinicke MP, Lemmon AR, Lemmon EM, McGrath
K, Hedges SB. 2018. Phylogenomic support for
evolutionary relationships of New World direct-
developing frogs (Anura: Terraranae). Molecular
Phylogenetics and Evolution 118: 145-155.
IUCN Standards and Petitions Committee. 2019. Guides
for using the IUCN Red List Categories and Criteria.
Version 14. Prepared by the Standards and Petitions
Committee. IUCN, Gland, Switzerland. 133 p.
Kumar S, Stecher G, L1 M, Knyaz C, Tamura K. 2018.
MEGA X: molecular evolutionary genetics analysis
across computing platforms. Molecular Biology and
Evolution 35: 1,547-1,549.
Larsson A. 2014. AliView: a fast and lightweight
alignment viewer and editor for large data sets.
Bioinformatics 30(22): 3,276-3,278.
Lehr E. 2006. Taxonomic status of some species of
Peruvian Phrynopus (Anura: Leptodactylidae), with
the description of a new species from the Andes of
southern Peru. Herpetologica 62: 331-347.
Lehr E, Catenazzi A. 2008. A new species of Bryophryne
(Anura: Strabomantidae) from southern Peru. Zootaxa
1784(1): 1-10.
Lehr E, Catenazzi A. 2009a. A new species of minute
Noblella (Anura: Strabomantidae) from southern
Peru: the smallest frog of the Andes. Copeia 2009(1):
Amphib. Reptile Conserv.
148-156.
Lehr E, Catenazzi A. 2009b. Three new species of
Bryophryne (Anura: Strabomantidae) from the
region of Cusco, Peru. South American Journal of
Herpetology 4(2): 125-138.
Lehr E, Catenazzi, A. 2010. Two new species of
Bryophryne (Anura: Strabomantidae) from high
elevations in southern Peru (Region of Cusco).
Herpetologica 66(3): 308-319.
Lynch JD. 1975. A review of the Andean leptodactylid
frog genus Phrynopus. Occasional Papers of the
Museum of Natural History, University of Kansas 35:
1-51.
Lynch JD. 1986. New species of minute leptodactylid
frogs from the Andes of Ecuador and Peru. Journal of
Herpetology 20(3): 423-431.
Lyra ML, Haddad CF, de Azeredo-Espin AML. 2017.
Meeting the challenge of DNA barcoding Neotropical
amphibians: polymerase chain reaction optimization
and new COI primers. Molecular Ecology Resources
17(5): 966-980.
Mamani L, Catenazzi A, Ttito A, Mallqui S, Chaparro
JC. 2017. A new species of Bryophryne (Anura:
Strabomantidae) from the Cordillera de Vilcabamba,
southeastern Peruvian Andes. Phyllomedusa 16: 129-
141.
Morales C. 2001. Las Cordilleras del Peru. Banco Central
de Reserva del Peru. Consejo Editorial USMP, Lima,
Peru. 201 p.
Noble GK. 1921. Five new species of Salientia from
South America. American Museum Novitates 29: 1-7.
Palumbi SR, Martin A, Romano S, McMillan WO, Stice
L, Grabowski G. 1991. The Simple Fool’s Guide to
PCR. Version 2.0. Privately published document
compiled by S. Palumbi, Department of Zoology,
University of Hawaii, Honolulu, Hawaii, USA. 47 p.
Reyes-Puig JP, Reyes-Puig C, Ron SR, Ortega JA,
Guayasamin JM, Goodrum M, Recalde F, Vieira J,
Koch C, Yanez-Mufioz MH. 2019. A new species of
terrestrial frog of the genus Noblella Barbour, 1930
(Amphibia: Strabomantidae) from the Llanganates-
Sangay Ecological Corridor, Tungurahua, Ecuador.
PeerJ 7: 1-26.
Santa Cruz R, von May R, Catenazzi A, Whitcher C,
Lopez Tejeda E, Rabosky DL. 2019. A new species of
terrestrial-breeding frog (Amphibia, Strabomantidae,
Noblella) from the Upper Madre De Dios watershed,
Amazonian Andes and lowlands of southern Peru.
Diversity 11(9): 1-20.
von May R, Catenazzi A, Corl A, Santa-Cruz R,
Carnaval AC, Moritz C. 2017. Divergence of thermal
physiological traits in terrestrial breeding frogs along
a tropical elevational gradient. Ecology and Evolution
7(9): 3,257—3,267.
von May R, Lehr E, Rabosky DL. 2018. Evolutionary
radiation of earless frogs in the Andes: molecular
phylogenetics and habitat shifts in high-elevation
terrestrial breeding frogs. PeerJ 6: 1—27.
October 2020 | Volume 14 | Number 3 | e260
Condori et al.
F. Peter Condori is a biologist who graduated from the Universidad Nacional de San Antonio Abad
del Cusco in Peru. Peter is currently a researcher at the Museo de Biodiversidad del Peru (MUBJ) and
the Museo de Historia Natural de la Universidad Nacional de San Antonio Abad del Cusco (MHNC).
His current research includes studies on the systematics, taxonomy, and biogeography of lizards and
amphibians from the Cordillera de los Andes.
Aldemar A. Acevedo is a Colombian biologist with a Master’s degree in Ecology. He has been studying
ecology, conservation biology, and evolution for 12 years, generating information about butterflies,
mammals, birds, and amphibians in Andean ecosystems. Aldemar has taught in the Faculty of Biological
Science at the University of Pamplona in Colombia for four years. Currently, he is a Ph.D. student in
Ecology in Chile, where his studies are focused on amphibian evolution, morphological variation, and the
influences of climatic conditions on evolutionary processes in the Neotropics.
J. Amanda Delgado is an Associate Researcher at the Museo de Historia Natural de la Universidad
Nacional de San Antonio Abad del Cusco, Peru (MHNC), as well as a curator of the amphibian and
reptile collections. Amanda has a B.Sc. in Biological Sciences from the Universidad Nacional de San
Antonio Abad del Cusco, Peru, and a Master’s degree in Biodiversity and Conservation of Tropical Areas
from the Universidad Internacional Menéndez Pelayo, Spain. Currently, she is working at the Organismo
de Evaluacion y Fiscalizacion Ambiental (OEFA), a public agency associated with the Ministry of the
Environment of Peru. Amanda’s research interests include the diversity, taxonomy, and ecology of
amphibians and reptiles, with a particular interest in understanding how industrial and anthropogenic
activities influence their environment and conservation. Photo by Edwin Bellota.
Juan C. Chaparro is a Peruvian biologist with extensive experience in studies on the fauna of all traditional
geographic regions of Peru. He graduated from the Biological Sciences program at the Universidad Nacional
Pedro Ruiz Gallo, Lambayeque, Peru, and received a Master’s degree in the Biodiversity and Conservation
of Tropical Areas in 2013 from an institutional consortium between the International University of Menendez
Pelayo (UIMP-Spain), the Universidad Tecnologica Indoamérica (UTI-Ecuador), and the Consejo Superior
de Investigaciones Cientificas (CSIC-Spain). Juan is currently the president of the Herpetological Association
of Peru (AHP), director of the Museo de Biodiversidad del Peru (MUBI, https://mubi-peru. org/herpetologia/
p-mubi) and curator of the Herpetological Collection of the MUBI. He also works as a consultant in
environmental studies. Juan has authored or co-authored 50 peer-reviewed scientific papers, notes, book
chapters, and books on various faunal groups, especially herpetology and arachnology, in subjects such as
taxonomy, biodiversity, systematics, phylogeny, conservation, and biogeography in South America. He is
specifically interested in species diversity, conservation, taxonomy, systematics, phylogeny, life history,
distributional patterns, and evolution using amphibians and reptiles as biological models. Juan has had
four species named in his honor: Phyllomedusa chaparroi (Amphibia), Phrynopus chaparroi (Amphibia),
Hadruroides juanchaparroi (Arachnida), and Chlorota chaparroi (Insecta).
Luis Mamani is a Peruvian biologist and researcher at the Museo de Biodiversidad del Peru (MUBI) and
the Museo de Historia Natural de la Universidad Nacional de San Antonio Abad del Cusco (MHNC). He
obtained his M.Sc. degree from the Universidad de Concepcion (UdeC) in Chile, and is currently a Ph.D.
student in Systematics and Biodiversity at the UdeC. His current research interests include systematics,
taxonomy, and biogeography of lizards from the Cordillera de los Andes.
Appendix 1. Specimens examined.
Psychrophrynella bagrecito (n = 4): PERU. Cusco: Quispicanchi: Camanti: Iskaybamba: MUBI 5255-58.
Psychrophrynella chirihampatu (n = 12): PERU. Cusco: Paucartambo: Area de Conservacion Privada (ACP) Ukumari Llaqta:
MUBI 14656, MUBI 14658, MUBI 14661-14662, MUBI 14664, MUBI 14666—72 (paratypes).
Psychrophrynella glauca (n= 1): PERU. Puno: Thiuni: Ollachea: MUBI 16323 (paratype).
Psychrophrynella usurpator (n= 3): PERU. Cusco: Paucartambo: Acjanacu: MUBI 4642-43 (paratypes).
Amphib. Reptile Conserv.
137 October 2020 | Volume 14 | Number 3 | e260
Official journal website:
amphibian-reptile-conservation.org
Amphibian & Reptile Conservation
14(3) [Taxonomy Section]: 138-155 (e261).
Evidence for cryptic diversity in the Neotropical water
snake, Helicops angulatus (Linnaeus, 1758) (Dipsadidae,
Hydropsini), with comments on its ecology, facultative
reproductive mode, and conservation
12.* John C. Murphy, *Antonio Mufioz-Merida, *Renoir J. Auguste, Oscar Lasso-Alcala,
$Gilson A. Rivas, and *”*Michael J. Jowers
'Science and Education, Field Museum, 1400 South Lake Shore Drive, Chicago, Illinois 60605, USA ?Current address: 2564 East Murdoch
Court, Green Valley, Arizona 85614 USA 3CIBIO/InBIO (Centro de Investigagdo em Biodiversidade e Recursos Genéticos), Universidade do
Porto, Campus Agrario De Vairdo, 4485-661, Vairdo, PORTUGAL ‘Department of Life Science, University of the West Indies, St. Augustine,
TRINIDAD °Museo de Historia Natural La Salle, Fundacion La Salle de Ciencias Naturales, Caracas, VENEZUELA °Museo de Biologia, Facultad
Experimental de Ciencias, Universidad del Zulia, apartado postal 526, Maracaibo 4011, estado Zulia, VENEZUELA ‘National Institute of Ecology,
1210, Geumgang-ro, Maseo-myeon, Seocheon-gun, Chungcheongnam-do, 33657, KOREA
Abstract.—The neotropical aquatic snake genus Helicops contains 19 species, some of which are oviparous,
while others are viviparous. Using phylogenetic and morphological relationships, H. angulatus from the island
of Trinidad (West Indies) is compared to other mainland populations. We recover H. angulatus as paraphyletic,
suggesting evidence of cryptic diversity within the species, and remove Helicops cyclops Cope, 1868 from
the synonymy of Helicops angulatus (Linnaeus) based on morphology; thus, increasing the number of
Helicops species to 20. Previous reports suggest some populations of the widespread Helicops angulatus are
oviparous. In contrast, other populations have been reported as viviparous, and the conflicting reports are
discussed based upon recent literature on the evolution of viviparity. Anecdotal evidence suggests Trinidad
Helicops angulatus are facultatively viviparous. The importance of conserving this unusual population, and its
associated aquatic habitats, are discussed.
Keywords. Caribbean, neotropics, ovoviviparous, Reptilia, Squamata, viviparous
Citation: Murphy JC, Mufioz-Mérida A, Auguste RJ, Lasso-Alcala O, Rivas GA, Jowers MJ. 2020. Evidence for cryptic diversity in the Neotropical
water snake, Helicops angulatus (Linnaeus, 1758) (Dipsadidae, Hydropsini), with comments on its ecology, facultative reproductive mode, and
conservation. Amphibian & Reptile Conservation 14(3) [Taxonomy Section]: 138-155 (e261).
Copyright: © 2020 Murphy et al. This is an open access article distributed under the terms of the Creative Commons Attribution License [Attribution
4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction in any
medium, provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced, are
as follows: official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 9 September 2020; Published: 27 October 2020
Introduction
Most of the 3,700 species of snakes are terrestrial, but
a few hundred have become aquatic or semi-aquatic in
freshwater and marine environments (Murphy 2012).
Two-thirds of 33 family and subfamily level clades contain
aquatic species (Murphy 2012). Some clades contain
only a single extant species that can be considered semi-
aquatic or aquatic (e.g., Viperidae), while others include
dozens of species that have radiated into freshwater
habitats (e.g., Homalopsidae and the Natricidae). Current
knowledge suggests the most diverse aquatic snake
communities occur in southeast Asia, but a significant
number of radiations into freshwater are present in cis-
Andean South America. At least 50 species in 12 genera
can be considered semi-aquatic or aquatic among the
species which inhabit the Amazon Basin and adjacent
areas (Murphy 2012).
About half of those neotropical species are in the
Dipsadidae lineage Hydropsini (Dowling 1975), a clade of
23 freshwater and brackish water snakes in three genera:
Helicops Wagler, 1828 (19 species), Hydrops Wagler,
1830 (three species), and Pseudoeryx Fitzinger, 1826
(two species). The relationship of Helicops, Hydrops, and
Pseudoeryx was suggested by Roze (1957), while Dowling
(1975) provided a name for the clade, and Zaher (1999)
hypothesized the three genera formed a clade belonging
to the Xenodontinae. Molecular evidence supporting the
Hydropsini first came from Vidal et al. (2000), when
they recovered Hydrops and Pseudoeryx as the sister
Amphib. Reptile Conserv.
October 2020 | Volume 14 | Number 3 | e261
Murphy et al.
to Helicops. Kelly et al. (2003) also found Hydropsini to
be monophyletic. Since that time, Grazziotin et al. (2012)
recovered strong support for the clade with its sister,
the terrestrial, Mexican lizard-eating snake Manolepis.
The Hydropsini was again found to be monophyletic by
Zaher et al. (2018). Vidal et al. (2010) also confirmed the
Hydropsini clade and presented molecular evidence that
Helicops angulatus is paraphyletic.
Di Pietro et al. (2014a,b) described what appeared
to be synapomorphies in the skull and upper respiratory
systems that supported the monophyly of the Hydropsini.
They (Di Pietro et al. 2014a) found two nasal features
that deviate from the pattern of nasal cartilages known
in other alethinophidian and caenophidian snakes: i.e., a
cartilaginous connection between the lamina transversalis
anterior and the concha of the Jacobson’s organ, and a small
rostral projection of the planum anteorbital, which probably
represents a reduced anterior maxillary process. They (D1
Pietro et al. 2014b) later found the unpaired foramen on the
parabasisphenoid with an anterior position to be the only
skull characteristic shared by all Hydropsini genera.
Viviparity has also been suggested as a synapomorphy
for the Hydropsini (Zaher et al. 2009); however, contrary
to previous speculation, Hydrops is oviparous, and
Pseudoeryx plicatilis is now known to lay eggs with the
female attending the nest (Braz et al. 2016). However,
within Helicops, some species are oviparous, while others
are viviparous (Scartozzoni 2009; Braz et al. 2016).
Rossman (1973) reviewed the early conflicting
evidence that suggested Helicops angulatus was
viviparous. He reported that a female from Leticia
(Colombia) laid two atypical eggs with the well-developed
embryos visible through the shells. He incubated the
eggs, and they hatched 16 and 17 days later. Speculating
on the reproductive mode of H. angulatus, he wrote, “...
there 1s a remote possibility that even this species may
be facultatively ovoviviparous.” Continuing, he discussed
the advantage of an aquatic snake being viviparous if
egg-laying sites were in short supply at times of severe
flooding.
Oviparity and viviparity are used to describe
the reproductive modes in squamates. The term
“ovoviviparity” was used until the mid-20" century with
the intention of defining an intermediate strategy between
viviparous and oviparous reproductive modes. However,
this word was eliminated because of ambiguity caused by
the variety of interpretations of its meaning (Blackburn
1994, 2000, 2006). A bipartite classification was proposed
by Blackburn (2000) that distinguishes between two
parameters: (1) the source of nutrition for embryonic
development (lecithotrophy and matrotrophy, as two
extremes of a continuum where lecithotrophy indicates
the embryo depends entirely on yolk, and matrotrophy
indicates the embryo obtains most of its nutrition via
a placenta); and (2) the packaging of the embryo (an
egeshell or membrane containing the young). While the
majority of Squamata are clearly either oviparous or
Amphib. Reptile Conserv.
viviparous, there are reports of some species which use
both reproductive modes.
In a review of oviparity and viviparity in squamates,
Tinkle and Gibbons (1977) listed 12 species (four lizards
and eight snakes) reported in the literature to have
bimodal or facultative reproduction. That is, 12 species
that use both oviparity and viviparity, including eight
snakes (7yphlops diardi, Boa constrictor, Python regius,
Diadophis punctata, Xenodermus javanicus, Cacophis
kreffti, Echis carinatus, and Trimeresurus okinavensis).
They discuss each of these literature reports and the
implications of females retaining embryos in their bodies
until they are well developed before secreting an eggshell
around the embryo and depositing the eggs in a nest.
Regarding Helicops, Rossman (1984) provides an
account of Helicops angulatus (LSUMZ 27337) from
Puerto Maldonado (Peru) collected by Richard Thomas.
When Thomas preserved the female, he removed seven
full-term young (LSUMZ 27340-46). No eggshells or
yolk were present, suggesting that had this female H.
angulatus carried the embryos to full term, she would
have functioned as a viviparous, as opposed to an
Oviparous, species. In discussing Trinidad Helicops, Boos
(2001) stated that Rodriguez saw a female giving live
birth, citing an unpublished manuscript that was missing
pages. Ford and Ford (2002) studied Helicops angulatus
in Trinidad, and reported two females laid clutches of 11
and 18 eggs in February that required 45 and 39 days of
incubation, respectively.
The distribution of Helicops angulatus is given by
Uetz et al. (2020) as “Venezuela (Amazonas, Apure,
Bolivar, Monagas, Delta Amacuro, Sucre, Portuguesa,
Anzoategui, Guarico, Cojedes), Colombia, Brazil (Para,
Rondonia, Goias, Mato Grosso, Sergipe, S. Ceara, Acre,
Bahia, Piaui, Paraiba, etc.), Bolivia, Peru, Trinidad,
Ecuador, French Guiana, Guyana.” Many authors
writing about the distribution of H. angulatus suggest
it is widespread in northern South America (Cunha and
Nacimiento 1978; Cisneros-Heredia 2006; Roberto et
al. 2009; Starace 2013; Cole et al. 2013; Nogueira et al.
2019).
Given the relatively broad distribution of Helicops
angulatus and the possible bimodal reproduction of this
snake, the Trinidad and Venezuelan populations merit
further investigation. The Trinidad and Venezuelan
Helicops 1s not likely to be an endemic cryptic taxon
to the region. Helicops angulatus is a mostly lowland
aquatic snake present in the Orinoco Delta, the Llanos,
and possibly in the low wetlands of the Guiana Shield.
Charles (2013) reported finding a juvenile Helicops that
had washed up on the South coast of Trinidad with a
mat of vegetation, suggesting a flood event transported
the snake the short distance from the Orinoco Delta to
Trinidad.
Here, through phylogenetic analyses, we present
evidence that confirms H. angulatus is paraphyletic. We
compared the morphological data from the literature and
October 2020 | Volume 14 | Number 3 | e261
Cryptic diversity and reproduction in Helicops angulatus
photographs for five type specimens with names that had
been placed in the synonymy of Helicops angulatus, and
based on that information, we reinstate Helicops cyclops
Cope, 1868 as a valid species. We also further investigate
the distribution, ecology, conservation, and the anecdotal
story of a Trinidad H. angulatus giving live birth.
Materials and Methods
Molecular methods. DNA was extracted from tissue
samples, and target gene fragments were amplified by
Polymerase Chain Reaction using the DNeasy Blood
& Tissue kit (QIAGEN, Hilden, Germany) following
the manufacturers’ instructions. Primers and specimens
sequenced and the GenBank accessions for all species are
reported in Supplemental Tables S1 and S2. Portions of
the mitochondrial small and large ribosomal subunits (12S
rDNA, 16S rDNA, respectively), cytochrome b (cytb),
and the nuclear oocyte maturation factor (c-mos) were
amplified. These gene fragments are highly informative in
interspecific and intraspecific studies on snakes, including
colubroids (e.g., Daza et al. 2009).
Templates were sequenced on both strands, and
the complementary reads were used to resolve rare,
ambiguous base-calls in Sequencher v4.9 (Gene Codes
Corporation, Ann Arbor, Michigan, USA). The lengths of
the sequences were: 12S rDNA, 342 base pairs (bp); 16S
rDNA, 436 bp; cytb, 1,060 bp; c-mos, 492 bp, although
not all individuals had the exact same length in some
alignments. Cytb and c-mos were translated to amino acids
to find the presence of stop codons. Following Moraes
Da Silva et al. (2019), the analysis included all genera
that were sister to Helicops and Pseudoeryx plicatilis and
Hydrops triangularis were used as outgroups. Sequences
were aligned in Seaview v4.2.11 (Gouy et al. 2010)
under MAFFT settings (Katoh et al. 2002). The 12S and
16S rDNA, and c-mos sequences were concatenated,
resulting in a 1,271 bp alignment. The cytb sequences
were uSed to assess genetic differentiation within the
Trinidad specimens. Because of the lack of cytb for
Helicops, this gene was not included in the concatenated
alignment.
Phylogenetic analyses were performed using the
Bayesian Inference and Maximum Likelihood methods.
MrBayes v3.2 (Ronquist and Huelsenbeck 2003) was
used to construct the Bayesian Inference tree under the
best-fitting substitution model for each gene partition.
ML searches were conducted in RAXML v7.0.4 (Silvestro
and Michalak 2010), using partition data sets under
default settings, and support was assessed by using 1,000
bootstrapped replicates. The most appropriate substitution
model was implemented for each gene fragment as
determined by the Bayesian Information Criterion in
PartitionFinder v2 (Lanfear et al. 2012) to choose the
optimal partitioning strategy for both phylogenetic
analyses. Default priors and Markov chain settings were
used, and searches were performed with random starting
Amphib. Reptile Conserv.
trees. Each run consisted of four chains of 20,000,000
generations, sampled every 2,000 generations. Posterior
distributions of parameter estimates were visually
inspected in Tracer. All analyses were performed through
the CIPRES platform (Miller et al. 2010).
Distributional analysis methods. The Vertnet and GBIF
databases were searched for mappable specimens of
Helicops angulatus. Additional specimens examined from
Trinidad and Venezuela that were not represented in the
on-line databases, and specimens reported in Appendix
B of Braz et al. (2016), were added. All localities were
plotted in ARCView (Fig. 1). Additional localities from
the map used in Nogueira et al. (2019) were added to the
map using Photoshop, and are indicated by the smallest
black markers in Fig. 1. The ARCView layers used
for the map were: The World Topographic Map, The
World Hydro Reference Overlay Map, and Freshwater
Ecoregions of the World.
Morphological methods. Traditional scale count data
were collected for 37 specimens from Trinidad and
Venezuela; and an additional eight specimens from
Brazil, Guyana, and Peru were examined. Sex was
determined by tail shape, tail length, and visual inspection
of the hemipenes. Dorsal scales were counted on the neck
at about the 10" ventral, midbody, and about 10 ventral
scales anterior to the vent, and they were all counted on
the diagonal. Ventral counts, subcaudal counts, and tail/
SVL (snout-vent length) ratios were analyzed for sexual
dimorphism. Scale counts and scale measurements were
taken under a dissection microscope on small specimens.
Scale measurements were taken with a metric ruler and
dial calipers. Snake sizes are given in millimeters. Scale
counts separated by a dash (—) represent a range taken
from different individuals; while those separated by a
slash (/) represent data taken from a single individual
in the left/right order. Helicops angulatus have keeled
subcaudal scales; and since this character is unfamiliar
to many herpetologists and is easily overlooked, it is
illustrated in Fig. 2.
Specimens examined: Brazil (n = 4): ANSP 5131-2;
CAS-SUR 7436, CAS 49324; Guyana (n = 2): FMNH
26647, FMNH 170765; Peru (” = 2): FMNH 81527,
CAS 8720; Trinidad (n = 18): CAS 231757, 231758-60;
FMNH 251219; UWIZM 2010.27.2 (n = 3), 2010.12.93,
2011.20.30 (n = 2), 2013.16.1 (n= 7); Venezuela (n = 16)
MHNLS 1429, 1439, 8444, 9093, 9884, 10953, 11786,
17731, 12082, 13137, 14100, 14426, 15885, 1754445,
18404.
Results
Molecular results. No stop codons were found in the
cytb and c-mos alignments. The best-fitting models and
partitions were partition 1 (TRN+G 12s+l6S rDNA),
partition 2 (JC+I cmos 1%+2" codon positions), and
October 2020 | Volume 14 | Number 3 | e261
Murphy et al.
GRENADA
Darien
, a“
Sa et TRINIDAD
Betsh ®, | -PYAND TOBAGO
Fig. 1. The distribution of Helicops angulatus in the Neotropics. Locality data is from the VertNet and GBIF databases, as well
as the literature. Diamonds (green oviparous, yellow viviparous): specimens reported in Appendix B of Braz et al. (2016); red
stars represent localities where Helicops was sampled for DNA; small black markers: localities from Helicops angulatus map in
Nogueira et al. (2019). As currently defined Helicops angulatus occurs in Freshwater Ecoregions: 301 North Andean Pacific Slopes,
Rio Atrato; 302 Magdalena, Sinu; 304 South America Caribbean Drainages, Trinidad; 307 Orinoco Llanos; 308 Orinoco Guiana
Shield; 311 Guianas; 313 Western Amazon Piedmont; 317 Ucayali, Urubamba Piedmont; 318 Mamore, Madre de Dios Piedmont;
319 Guapore, Itenez; 320 Tapajos, Juruena; 321 Madeira Brazilian Shield; 323 Amazonas Estuary and Coastal Drainages; 324
Tocantins, Araguaia; 325 Parnaiba; and 328 Northeastern Mata Atlantica.
partition 3 (F81+I cmos 3" codon positions). All six H.
angulatus from Trinidad recovered the same haplotype
for all genes. The two GenBank H. angulatus are the
sister clade to H. gomesi, as shown previously (Moraes
Da Silva et al. 2019). However, the inclusion of Trinidad’s
H. angulatus results in paraphyly of the species; the island
taxon is ancestral to mainland Helicops + H. gomesi (Fig.
3). All clades were recovered with high bootstrap and
posterior probabilities.
The morphological results (Table 1) suggest that
animals from Trinidad and Paria, Venezuela, are the same
species and are like some other mainland populations in
that they have nearly identical meristic traits. Dorsal scale
rows, ventral counts, and subcaudal counts are similar
for specimens examined and when compared to literature
accounts. Boulenger (1893) may have first reported the
Amphib. Reptile Conserv.
keeled subcaudals, which are difficult to detect because
they are lateral (Rossman 1973). The Trinidad and
Venezuela populations also have the first dorsal scale row
lacking keels.
Distribution and ecology. The distribution of Helicops
angulatus is shown in Fig. 1, and it extends well outside
the Amazon Basin. However, there are some records in
Colombia that need attention; one of which is a specimen
(FLMNH 57235) from the Atlantico Province, which
has a locality within 15 km of the coast, west of the
Maracaibo Basin. A second is the specimen collected in
the Cordillera Central (Sonsoén, Antioquia) at 2,300 m
(ILS no. 92) and mentioned in Pérez-Santos and Moreno
(1988). However, the identification of this specimen
requires confirmation. A third specimen (ICN MHN Rep
October 2020 | Volume 14 | Number 3 | e261
Cryptic diversity and reproduction in Helicops angulatus
Fig. 2. Photo showing that Helicops angulatus has keeled subcaudal scales, a trait that is easily overlooked because the keels are
lateral. Photo by Renoir J. Auguste.
100/1 Pseudoeryx plicatilis (PSPLOO1)
90/1 Pseudoeryx plicatilis (H1399)
100/1 Hydrops triangularis (H1476)
Hydrops triangularis (HYTROO1)
83/0.96 Helicops leopardinus (UFMTR11939)
100/1 Helicops leopardinus (H1733)
Helicops modestus (MTR11762)
Helicops modestus (MTR19715)
Helicops pictiventris (HEPIOO1)
90/1 93/1 L Helicops infrataeniatus (HINOO1)
Helicops boitata (UFMTR11940)
97/1
Helicops carinicaudus (142)
91/0.97 Helicops nentur (DJS-2016)
Helicops polylepis (H919)
Helicops hagmanni (MTR12961)
100/1
86/- Helicops hagmanni (MTR13320)
(Trinidad)
Helicops gomesi (HEGOOO1)
100/1 88/1
Helicops gomesi (141)
ulatus (HEANOO1)
81/0.9
0.0070
Fig. 3. Best Maximum Likelihood tree based on the data set of concatenated 12S and 16S rDNA, and c-mos sequences. The red clade
depicts the Helicops angulatus group. On the left and right sides of a slash (/) are values indicated at nodes for Maximum Likelihood
bootstraps (> 75%) and Bayesian Posterior probability values (> 95%), respectively. Green clades represent the paraphyly of Helicops
angulatus. The name Helicops pictiventris is currently a junior synonym of H. infrataeniatus, but it appears in the tree exactly as the
pertinent sequences appear in the GenBank dataset.
Amphib. Reptile Conserv. 142 October 2020 | Volume 14 | Number 3 | e261
Table 1. Morphological comparisons of the type specimens of species that have been synonymized under Helicops angulatus to the Trinidad/Venezuela population. The Trinidad and Venezuela
0.42,
X=
30.85), and tail/SVL ratios 0.37—0.48 (
4.42). Ten adult females have SVL 337-838 (
0.04). Female ventral counts for 21 individuals ranged from 113-123 (
=177.3,S8D
xX
65.13), tails 130-219 (
3.27) and subcaudal counts 70-83 (
36.04), and tail/SVL ratios 0.22—0.36 (
421.6, SD=
X=
animals are sexually dimorphic for body size. Six adult males have SVL 351—560 mm (
575.42, SD =
X=
75.12, SD =
X=
= 113.5, SD
xX
0.046). Eight males had ventral counts 110-118 (
142.06), tails 98-224 (x = 159.80, SD
SD
2.48):
= 118.48, SD
xX
0.29, SD
5.04); tail/SVL ratios for ten females ranged from 0.22-0.36 (
X=
0.29, SD = 0.04). nd = no data.
X=
65.33, SD=
X=
subcaudal counts for 18 females ranged from 59-77 (
cyclops Cope
fumigatus Cope
asper Wagler
surinamensis Shaw
angulatus Linnaeus
alidars Linnaeus
Suriname Brazil Trinidad/ Eastern
Brazil
Suriname
Suriname
Locality
Venezuela
Amphib. Reptile Conserv.
109-121
124
89
yes
nd
nd
no
123
nd
nd
yes
120
61
121
58
nd
nd
21
Ventral scales
59-83
82
yes
0.479
Subcaudal scales
yes
0.37-0.48
yes
Dorsal pattern extends to venter
SVL
nd
nd
19
no
nd
19
nd
nd
nd
nd
0.36
19
no
19
yes
19
nd
nd
2+3
46
19
no
Dorsal scale rows
nd
nd
nd
nd
Keels on first scale row
yes
yes
yes
nd
Keels on subcaudals
1F2
32-43
243
nd
1+2
nd
1+2
36
Temporal formula
Murphy et al.
Dorsal transverse bands on midline
10735) from Department of Tolima, west of Bogota, was
listed in the GIBF database as being from 680 m, but the
coordinates given in Google Earth suggest the elevation is
quite different, closer to 2,600 m. Helicops angulatus is a
species restricted in Colombia to the Amazon and Orinoco
basin, but the first specimen mentioned above (FLMNH
57235) is almost surely H. danieli (Rossman 2002); while
the other two individuals most likely represent records
with erroneous collection data, and for this reason, they
cannot be considered within the geographic distribution
of this species. Another specimen (LACM 58898) from
near Lima, Peru on the West side of the Andes 1s likely the
result of human transport, as the coordinates suggest it is
from a highly urbanized area.
In Trinidad and Venezuela, 37 specimens were found
from 26 localities, ranging from sea level in the coastal
regions (Trinidad: Caroni Swamp, Nariva Swamp;
Venezuela: Orinoco Delta region, Llanos), up to 940
m in forested streams of the Venezuelan Guayana.
Helicops angulatus occurs in all freshwater systems in
Trinidad, while it occurs throughout the Orinoco Basin
in Venezuela. Figure 1 documents its presence in 16
freshwater ecoregions.
This species is abundant in slow-moving or stagnant
water bodies, such as coastal lagoons, ponds, swamps,
grasslands, flooded riparian forest, and mangroves, where
the water may be clear, turbid due to high sediment loads,
or black with high concentrations of tannic acid (Sioli
1975). Italso occurs in bodies of water modified by humans
(Ford and Ford 2002; Lasso et al. 2014; Mohammed et al.
2014). Accordingly, Ford and Ford (2002) found it to be
abundant in a flooded watermelon field, from which they
collected 117 specimens in five days.
Three specimens (MHNLS 17731, 13137, 10943)
were collected in the lower Orinoco basin, as well
as in an estuary and on two fluvial islands. These
localities are on the northern edge of the range and are
likely to be influenced by tides. These specimens were
captured between March and June, when water flow and
precipitation decrease salinity levels (Novoa 2000; Lasso
and Sanchez-Duarte 2011). However, the occurrence of
H. angulatus in mangroves is evidence that it is tolerant
of some degree of salinity.
Morphological and systematic results. Linnaeus (1758:
217) described Coluber angulatus based on the type
NRM 17 (Fig. 4) said to be from Asia (in error). The type
specimen has 120 ventral scales and 60 subcaudal scales,
and came from King Adolf Fredrik’s collection at Ulricsdal
Castle, Sweden. After it was examined by Linnaeus, it
was transferred to KVA/NRM (Royal Swedish Academy
of Science/Swedish Museum of Natural History) in 1801
(Anderson 1899).
Linnaeus appears to have described C. angulatus a
second time as Coluber alidras based upon NRM 18,
which originated in the collection of Charles De Geer
(= Mus. De Geer) and gave the type locality as “Indiis.”
October 2020 | Volume 14 | Number 3 | e261
Cryptic diversity and reproduction in Helicops angulatus
Fig. 4. NRM 17, the holotype for Helicops angulatus. Photo courtesy of NRM.
Andersson (1899: 34) examined Coluber alidras and
commented that it is a“... completely discolored specimen
of Helicops angulatus.” However, it differed from C.
angulatus by having 21 rows of scales on the thickest part
of the body instead of 19 (in Coluber angulatus). Thus,
Andersson considered Linnaeus’s Coluber alidras a
synonym of Coluber angulatus. The C. alidras specimen
had a total length of 720 mm and a 165 mm tail, 121
ventral scales, and 58 subcaudal scales. He (Andersson
1899) added a footnote stating that the tail was somewhat
mutilated. NRM 18 contained the remains of the fish
Cichlasoma bimaculatum, which has a South American
distribution that includes the Orinoco River basin, in the
Caroni in River Venezuela; Guianas, from the Essequibo
River to the Sinnamary River; and the Amazon River
Amphib. Reptile Conserv.
basin, in the upper Branco River basin (Froese and
Garilao 2019).
Shaw (1802: 460) described Coluber surinamensis,
stating that it was thought to be from Suriname and listed
the holotype as a drawing (Sebae, 1735, Vol. 2, Pl. 59,
Fig. 2) [Fig. 5]. The specimen used for that illustration
survives to the present day. Bauer and Wahlgren
(2013) examined some of the snake specimens from
the 18" century Linck family collection that are in the
Naturalienkabinett Waldenburg in Saxony, Germany.
Specimens in that collection served as types of species
described by Linnaeus and Blasius Merrem, and are thus
of taxonomic importance. For example, specimen 502 is
the basis for the illustration holotype of Shaw’s Coluber
surinamensis.
October 2020 | Volume 14 | Number 3 | e261
Murphy et al.
Fig. 5. Illustration of the holotype of Coluber surinamensis Shaw. From Sebae (1735, Vol. 2, pl. 59, Fig. 2).
Eighteenth century collectors sent many animals
(alive and preserved) from Suriname to the Netherlands.
The preserved specimens found their way into private
collections and Linnaeus undoubtedly saw many Suriname
specimens because the collectors C.G. Dahlberg and D.
Rolander were sending Suriname specimens to Sweden
(Husson 1978). Thomas (1911) wrote that it would not be
unjustified to regard all South American animals in Seba’s
Thesaurus as originating in Suriname. Therefore, we
consider it likely that NRM 17, NRM 18, and the Linck
family collection specimen 502 used in Seba’s drawing
and Shaw’s description all originated in Suriname.
Wagler (1824: 37) described Natrix aspera which
is now represented by the lectotype (ZSM 1528/0).
Hoogmoed and Gruber (1983) commented that the
original Spix collection contained adults and juveniles,
and gave scale counts for two specimens (123 and 118
ventral scales and 82 and 100 subcaudals, respectively).
However, they found that only one Brazilian specimen
collected by Sp1x was still present in the Munich collection
and selected it as the lectotype of Natrix aspera Wagler.
The lectoype (Fig. 6), 1s a female which has 123 ventrals,
a divided cloacal plate, 82 subcaudals, and dorsal scales
in 19-19-17 rows. The SVL is 690 mm, the tail length is
331 mm (t/SVL = 0.479), the head length is 38.8 mm,
and it has maxillary teeth (+ 14). The specimen agrees
well with Wagler’s description except for the pattern.
Subsequently, Wagler (1830: 171) erected the genus
Amphib. Reptile Conserv.
Helicops for Coluber angulatus and used the combination
Helicops angulatus.
Cope (1868: 308) described Helicops fumigatus based
on the holotype: ANSP 5132 from Suriname, stating that it
has keeled scales that are in 19 rows and provided no other
information on scale characters. However, he described
this snake on the basis of the ventral pattern, writing,
“Belly with a broad brownish gray band from throat to
vent, the ends of the gastrosteges yellow, forming two
bands; a median longitudinal brown line on the tail.” We
have not seen any Helicops angulatus with this ventral
pattern nor a mid-ventral stripe on the tail (Fig. 7).
In the same paper, immediately following the H.
fumigatus description, Cope (1868: 309) described
Helicops cyclops based on the holotype ANSP 5131 from
Bahia, Brazil. The specimen has 19 dorsal scale rows,
124 ventral scales, and 89 subcaudals, and it has 26 dark
brown transverse bands. Boulenger (1893: 279) placed
both of Cope’s species into the synonymy of Helicops
angulatus without comment.
Helicops cyclops has a remarkably short head and
more ventral scales than have been reported for Helicops
angulatus. Its subcaudal scales are keeled. It also has chin
shields that are short and plate-like, and dorsal transverse
bands which extend around the body and across the
ventral surface. There is also a distinctive band between
the eyes, a trait not seen in members of the Helicops
angulatus group. Dorsal head plates are also imbricate,
145 October 2020 | Volume 14 | Number 3 | e261
Cryptic diversity and reproduction in Helicops angulatus
more so than those seen in members of the H. angulatus
group. Based on this morphology, we remove Helicops
cyclops Cope from the synonymy of H. angulatus.
Helicops cyclops Cope (1868)
Fig. 8
Helicops cyclops Cope 1868: 309. Holotype ANSP 5133,
Type locality Bahia, Brazil.
Helicops angulatus — Boulenger 1893, 2: 287.
Cope’s description of this species is as follows:
Helicops cyclops Cope, sp. nov.
Scales in nineteen rows, strongly keeled everywhere,
including the first row. Two pairs genials; occipitals short
and wide, long as frontal. Head exceedingly short, mouth
wide as the length of the rounded lip margin Superior
labials eight, fourth scarcely entering orbit by its upper
corer (by its whole extremity in H. angulatus), the fifth,
sixth and seventh narrow and high. Prefrontals broad as
long (much broader than long in H. angulatus). Orbitals
1—2, nearly meeting below orbit. Temporals 2 |1 | 3 (1 |
I | 3 in H. angulatus). Loreal plate wide as high, (higher
than wide in H. angulatus). Tail 0.33 total length, slender
(less than 0.25, H. angulatus). Gastrosteges 124, anal
1-1; urosteges 89. Light yellowish brown, with twenty-
six transverse deep brown rhombs across the back which
terminate at the second row of scales, being separated
from the back ventral cross-bar, which is opposite each,
by a longitudinal yellow band. This band is not distinct
between the spots. Belly strong yellow with jet black
cross bars, which are on more than two gastrosteges.
Tail black spotted below. A brown cross-band between
the eyes Length 27.5 inches. From Bahia, Brazil. Mus.
Academy, from Dr. Otho Wucherer. This species 1s at first
sight much like the AH. angulatus but differs variously
as above. In coloration the spots in the latter are always
continued into the ventral cross-bars, and not interrupted
as in H. cyclops.
At this writing, there are too many unknowns to make
further taxonomic adjustments. As further molecular and
morphological information becomes available on the type
specimens (Table 1) of the species which has been placed
in the synonymy of Helicops angulatus, the species and
nomenclature will undoubtedly change again.
Facultative reproduction. The Trinidad and Venezuela
populations are known to be oviparous (Mole 1924;
Gorzula and Sefiaris 1998: Boos 2002; Ford and Ford
2002; Natera et al. 2015). One of the authors (JCM)
collected a clutch of eight eggs laid in a terrestrial nest
under pieces of wood and tin in November 2013. The
eggs contained near full-term embryos. When combined
with the February oviposition dates reported by Ford and
Ford (2002), it seems likely this species reproduces year-
round in Trinidad.
Amphib. Reptile Conserv.
Fig. 6. The lectotype of Natrix asper Wagler. Photos by Michael
Franzen.
We also followed up on Boos’ (2001) story of viviparity
in a Trinidad specimen. Boos (recently deceased)
attributed the story to Alan Rodriguez, an avid Trinidad
snake enthusiast. One of the authors (RJA) interviewed
him, but Rodriguez did not remember much about the
incident related to Boos (2001), which took place about
1980. However, he reported that while searching for
snakes on 15 March 2011, he observed a female Helicops
angulatus giving birth in a drain with about 20 cm of
water. The observations were made in a semi-urbanized
area of Sangre Grande, Trinidad. He observed actively
moving young dispersing, but several others present in
the drain were stillborn. Thus, he saw this phenomenon
twice (once in ~1980 and in 2011).
Curiously, Cunha and Nascimento (1981) found eggs
(7-20) in 12 females from Brazil (Leste do Para), but
these authors also state that embryos were present in a
single specimen. A comment in Martins and Oliveira
(1998) by L.J. Vitt suggested this could be an error. Yet,
according to the new evidence, it is plausible that the
female examined by Cunha and Nascimento (1981) had
fully developed embryos.
A related observation in the viviparous Helicops
scalaris from the Lake Maracaibo basin (Barros et al.
2001) involved post-partum females depositing what
appeared to be shell remains (Barros, pers. comm. 2020).
October 2020 | Volume 14 | Number 3 | e261
Murphy et al.
Table 2. A comparison of the 20 described species of Helicops, including some specimens placed in the synonymy of H. angulatus and the
Trinidad populations. Scalation: AD = anterior dorsal scale rows, MD = midbody dorsal scale rows, PD = posterior body dorsal scales rows,
V m/f = ventrals in males and females, sc m/f = subcaudal scales males/females; sck = subcaudal scales keeled; UL = upper labials; ULO
in orbit = upper labials bordering the orbit. Reproductive modes: v = viviparity, 0 = oviparity, o/v both oviparity and viviparity known; ? =
reproductive mode unknown. Data are based on our counts and those published in Kawashita-Ribeiro et al. (2013), Costa et al. (2016), and
Moraes-Da-Silva (2019). nd = no data.
Species or population AD MD PD V=m/f sc m/f sck UL ULO o/v
Trinidad/Paria 18-19 19 17 109-118/113—123 70—83/59-77 Yes 8 4 or 4-5 o/v?
angulatus 19-21 19-20 17-19 = 105-—123/109-123 74—96/66-84 Yes 7-9 4 or 4-5 o/v
cyclops nd 19 nd 124 89 Yes 8 4 ?
fumigatus nd nd nd nd nd Yes 8 4 ?
apiaka 21-24 21-22 17-19 118—127/124—132 79-103/80—84 Yes 7-9 3 or 4 2
boitata 25 25 21 113/nd 68/nd No 10 34 Vv
carinicaudus 19 19 17 130-141/135—148 48-69/48-73 No 7-8 3-4, 4,45 Vv
danieli 19-21 19-20 16-19 = 125-135/130-141 76—86/61—70 No 89 4 nd
gomesi 19 19 19 125—132/128-132 71-86/67—73 Yes 8-9 4 or5 )
hagmanni 23-27 21-29 = =19-23 117-127/130-134 55-67/51—53 No 8 4 0)
infrataeniatus 17-19 17-19 = 15-19 115-138/117-138 52-88/50-83 No 7-9 3-4, 4 Vv
leopardinus 15-22. 19-22 =17-19 = 108—-126/108—130 64—89/53-76 No 8-10 34,4, 3-5 Vv
modestus 19 19 17-19 112-—125/116—122 54—70/53-64 No 8 3-4,4 Vv
nentur 17 17 15 115/111-117 56/41—52 No 8 34 ?
pastazae U3 23-25 19 121—134/130-145 93—117/72-97 No 8-10 ?
petersi 21 21-23 16 135-142/137-150 85-91/67-73 No 8 ?
polylepis 23-25 23-25 19 112-131/121-133 70—102/71-81 No 89 1-4,1-5,1-6 Vv
scalaris 21-25 19-21 16-19 110-119/113-125 83-95/67-81 Yes 8-9 4,4-5 Vv
tapajonicus 19 19 UF 118/121-123 79/67—76 No 8 4 ?
trivittatus 21-25 20-23 16-19 114-128/115—129 67—80/56—-66 No 8-10 45 Vv
yacu 25-29 25-28 18-20 124/129-136 ?/85—96 ? 8-9 4.5 ?
In discussing the reproduction mode in this species,
Natera et al. (2015) stated it is “vivipara lecitotrofica”
(i.e., embryos receive nutrients from the yolk); and they
also mentioned two females which gave birth to 21 and
22 young, in addition to a female with nine eggs in mid-
development (probably referring to developing embryos).
Table 2 compares the 20 known species of Helicops for
basic meristic traits and reproductive modes.
Discussion
Helicops angulatus shows considerable intrapopulation
variation in coloration and morphology (Murphy 1997;
Ford and Ford 2001). Some snakes have keels on the first
dorsal row of scales, and others lack them (Cope 1868).
The Trinidad and Venezuela specimens we have examined
all have keeled subcaudal scales. It is also clear that some
H. angulatus have 21 dorsal scale rows at midbody,
although none of the Trinidad and Venezuela specimens
examined had 21 dorsal rows. Thus, Linnaeus’ Coluber
aliodras may be the original description for a valid
taxon that has 21 dorsal scale rows at mid-body. Coluber
Amphib. Reptile Conserv.
147
surinamensis Shaw, Natrix asper Wagler, and Helicops
fumigatus Cope are likely conspecific with H. angulatus.
However, without access to the type specimens, this
cannot be confirmed.
Evidence of facultative reproduction in Helicops
angulatus was reported by Braz et al. (2016). They
examined 27 gravid females, and 19 had oviductal
eges surrounded by thick, opaque, and leathery shells,
indicating oviparity. The eggshell has a thick fibrous layer
overlain by a thinner inorganic layer. Developing embryos
were found in the eggs of five oviparous H. angulatus
females and were visible only after eggshells were
removed. They also reported six undisputable records
of oviparity in H. angulatus that are available in the
literature and another six female H. angulatus that were
viviparous. The viviparous females had thin, transparent
membranes surrounding yolk masses and embryos, and
developing embryos or fully-developed young were
readily visible through the extra-embryonic membranes.
Embryos were partially developed in three females and
near-term in a female from Colombia. Two other females
contained fully-developed young. They also found two
likely records of viviparity in H. angulatus. Two females
October 2020 | Volume 14 | Number 3 | e261
Cryptic diversity and reproduction in Helicops angulatus
Fig. 7. The holotype of Helicops fumigatus Cope, 1868. Photo
by Ned Gilmore.
had thin and transparent membranes surrounding the yolk
masses, but no discernible developing embryos. Another
reliable record of viviparity was obtained from a literature
report of fully-developed young found in the uterus of a
preserved female (Braz et al. 2016).
Braz et al. (2018) suggest eggshell thinning in Helicops
is associated with the evolution of viviparity. They suggest
eggshell reduction occurred independently in the origins
of viviparity in Helicops and was accomplished by the loss
of the mineral layer and thinning of the shell membrane.
Viviparous female H. angulatus have a shell membrane
thickness six times thinner than oviparous congeners.
In contrast, the shell membrane of the viviparous H.
infrataeniatus and H. carinicaudus is vestigial and 20—25
times thinner than those of their oviparous congeners.
These differences suggest that eggshell reduction is a
requirement for the evolution of viviparity, but a nearly
complete loss of the shell membrane, as in the viviparous
Helicops, 1s not.
Amphib. Reptile Conserv.
Fig. 8. The holotype for Helicops cyclops Cope. Photo by
Ned Gilmore.
We were skeptical of the ability of a population of
snakes to contain both oviparous and viviparous females,
as suggested by Alan Rodriguez’s story. However, recent
work on the Australian skink, Saiphos equalis, indicates
that this ability may be widespread but undocumented
in squamates. Laird et al. (2019) reported facultative
Oviparity by the viviparous skink, Saiphos equalis, which
is the first report of different parity modes within a single
vertebrate clutch. Eggs oviposited facultatively possess
Shell characteristics of both viviparous and oviparous
squamates, demonstrating that the same processes
produce egg coverings for both phenotypes.
Foster et al. (2019) followed up on this using
transcriptomics to compare uterine gene expression in
Oviparous and viviparous phenotypes. They provide a
molecular model for the genetic control and evolution
of reproductive modes. Many genes are differentially
expressed throughout the reproductive cycle of both
phenotypes. Thus, viviparous and oviparous snakes
October 2020 | Volume 14 | Number 3 | e261
Murphy et al.
have different gene expression profiles. The differential
expressions have similar biological functions which
are essential for sustaining embryos, including uterine
remodeling, respiratory gas and water exchange, and
immune regulation. As might be expected, the similarities
suggest long egg-retention 1s an exaptation for viviparity;
or it reflects the parallel evolution of similar changes in
gene expression needed for long egg-retention oviparous
species. In contrast, changes in gene expression across
the reproductive cycle of the long egg retaining oviparous
Saiphos equalis are dramatically different from those
of oviparous skinks. This supports the assertion that
the oviparous S. equalis exhibit a phenotype that is
intermediate between true oviparity and viviparity.
The ability of Saiphos equalis to change reproductive
modes suggests to us that the Trinidad Helicops angulatus
population (and likely other mainland H. angulatus
populations) also has this capability. Trinidad Helicops
likely have two reproductive phenotypes, making this
population incredibly valuable to science, for unraveling
a better understanding of the evolution of viviparity in
Squamata.
Conservation. Given the highly aquatic habits of these
snakes, habitat destruction and water pollution are likely
the main threats to their survival. They are found in
coastal areas as well as inland waters. Coastal mangrove
forests are changing in complex ways, with deforestation
combined with new growth (AI-Tahir and Baban 2005;
Juman and Ramsewak 2013). Trinidad coastal areas
have significant oil pollution from the thousands of large
vessels that move through Trinidad waters annually
(Water Resource Agency 2001).
Freshwater pollutants originate from urban, domestic,
and industrial waste, agricultural chemicals, as well as
sediments and oil spills. Lowering the water table to a
level which exceeds the aquifer’s replenishment abilities
has resulted in brackish water intrusion into the El
Socorro aquifers (Water Resource Agency 2001). Nitrate
and bacterial contamination result from the excessive
use of agrochemicals, leaking septic tanks, wastes from
livestock, and agro-industrial effluents such as pesticides
and fertilizers. Specifically, Trinidad has a severe problem
with the excessive use of certain fertilizers and pesticides
and the release of high concentrations of waste from
intensive animal farm operations. Sewage and solid
wastes are severe In some areas, such as the Beetham/
Laventille swamp (north of the Caroni River). Tires,
motor vehicles, major appliances, floating livestock, and
an array of consumer disposables are often deposited in
the swamp (Water Resource Agency 2001).
Deforestation in the Northern Range removes the
protective vegetation layer, resulting in an excessive
run-off that exacerbates flooding in the rainy season. Of
great concern is the increase in residential development
in watershed areas that significantly impacts the run-off
rates, sedimentation levels of rivers, and downstream
Amphib. Reptile Conserv.
flooding. Silt from quarries has raised the substrates at the
lower reaches and mouth of the Caroni River, affecting
the hydrology of the river. High concentration rates of
siltation affect rivers, such as the North Oropuche and
Aripo Rivers in the northeast.
Saaristo et al. (2018) demonstrated how chemical
contaminants (e.g., metals, pesticides, and pharmaceuticals)
are changing ecosystems by altering animal behavior
through physiological changes. Their framework shows
how the sublethal behavioral effects of pollutants can have
a mixture of negative, and sometimes positive, changes
that vary dynamically within the same individuals and
populations.
Of less concern are the snakes taken as by-catch by
fishers. Hernandez-Ruiz et al. (2014) used hoop nets to
sample turtle populations in northern Brazil and obtained
a by-catch of Helicops angulatus. However, through
discussions with fishers in Nariva Swamp, we (JCM,
RJA) found that they usually release the snakes captured
in fishing nets. The loss of the unique Helicops angulatus
populations on Trinidad and elsewhere would be a wasted
significant opportunity to expand our understanding of
the evolution of reproductive modes in the Squamata.
Acknowledgments.—The authors would like to give their
sincerest thanks to Henrique Braz and Harold K. Voris
for discussions on the text; Alan Rodriguez for sharing
his valuable observations on Trinidad Helicops,; Ned
Gilmore, National Academia of Sciences Philadelphia
(ANSP) for providing photographs of Cope’s type
specimens, and Mike G. Rutherford and Jenalee
Ramnarine, University of the West Indies Museum of
Zoology (UWIZM) for providing lab and field support in
Trinidad. MJJ is supported by the Portuguese Foundation
for Science and Technology (FCT, fellowship number
SFRH/ BPD/109148/2015).
Literature Cited
Al-Tahir R, Baban SM. 2005. An evaluation of recent
changes in mangrove forest habitats in Trinidad West
Indies. Journal of Tropical Biodiversity 8(3): 187-198.
Andersson LG. 1899. Catalogue of the Linnaean type-
specimens of snakes in The Royal Museum in
Stockholm. Bihang till Kongliga Svenska Vetenskaps-
Akademiens Handlingar 24(4:6): 1-35.
Antonelli A, Quijada-Mascarefias A, Crawford AJ, Bates
JM, Velazco PM, Wister W. 2010. Molecular studies
and phylogeography of Amazonian tetrapods and their
relation to geological and climatic models. Pp. 386—
404 In: Amazonia, Landscape and Species Evolution:
a Look into the Past. Editors, Hoorn C, Wesselingh F.
Wiley-Blackwell, Chichester, United Kingdom. 447 p.
Barros T, Lopez JC, Alvarado M. 2001. Helicops scalaris.
Reproduction. Herpetological Review 32: 47.
Bauer AM, Wahlgren R. 2013. On the Linck collection
and specimens of snakes figured by Johann Jakob
October 2020 | Volume 14 | Number 3 | e261
Cryptic diversity and reproduction in Helicops angulatus
Scheuchzer (1735), the oldest fluid-preserved
herpetological collection in the world. Bonn Zoological
Bulletin 62: 220-252.
Blackburn DG. 1994. Standardized criteria for the
recognition of embryonic nutritional patterns in
squamate reptiles. Copeia 1994: 925-935.
Blackburn DG. 2000. Reptilian viviparity: past research,
future directions, and appropriate models. Comparative
Biochemistry and Physiology A 127(4): 391-409.
Blackburn DG. 2006. Squamate reptiles as model
organisms for the evolution of viviparity.
Herpetological Monographs 20: 131-146.
Boos HEA. 2001. The Snakes of Trinidad and Tobago.
Texas A&M Press, College Station, Texas, USA. 270
p.
Braz HB, Almeida-Santos SM, Murphy CR, Thompson
MB. 2018. Uterine and eggshell modifications
associated with the evolution of viviparity in South
American water snakes (Helicops spp.). Journal of
Experimental Zoology B 330(3): 165-180.
Braz HB, Scartozzoni RR, Almeida-Santos SM. 2016.
Reproductive modes of the South American water
snakes: a study system for the evolution of viviparity in
squamate reptiles. Zoologischer Anzeiger 263: 33-44.
Burbrink FT, Lawson R, Slowinski BB. 2000.
Mitochondrial DNA phylogeography of the polytypic
North American Rat Snake (Elaphe obsoleta): a
critique of the subspecies concept. Evolution 54:
2,107—2,118.
Cisneros-Heredia DF. 2006. Reptilia, Colubridae,
Helicops angulatus and Helicops leopardinus:
distribution extension, new country record. Check List
2(1): 36-37.
Cole CJ, Townsend CR, Reynolds RP, MacCulloch RD,
Lathrop A. 2013. Amphibians and reptiles of Guyana,
South America: illustrated keys, annotated species
accounts, and a biogeographic synopsis. Proceedings
of the Biological Society of Washington 125: 317-620.
Colonnello G. 2004. Las planicies deltaicas del
rio Orinoco y Golfo de Paria: aspectos fisicos y
vegetacion. Pp. 37—54 In: Evaluacién Radpida de la
Biodiversidad y Aspectos Sociales de los Ecosistemas
Acudticos del Delta del Rio Orinoco y Golfo de Paria,
Venezuela. Boletin RAP de Evaluacion Bioldgica 37.
Editors, Lasso CA, Alonso LE, Flores AL, Love G.
Conservation International, Washington, DC, USA.
358 p.
Cope ED. 1868. Sixth contribution to the herpetology
of tropical America. Proceedings of the Academy of
Natural Science of Philadelphia 20: 305-313.
Costa HC, Santana DJ, Leal F, Korotva R, Garcia
PC. 2016. A new species of Helicops (Serpentes:
Dipsadidae: Hydropsini) from southeastern Brazil.
Herpetologica 72(2): 157-166.
Cunha OR, Nascimento FP. 1978. Ofidios da Amazonia
X. As cobras da regiao leste do Para. Publicacées
Avulsas do Museo Goeldi 31: 1-218.
Amphib. Reptile Conserv.
150
Cunha OR, Nascimento FP. 1981. Ofidios da Amazonia
XII. Observacgées sobre a viviparidade em ofidios
do Para e Maranhao (Ophidia: Aniliidae, Boidae,
Colubrida e Viperidae). Boletim do Museo Paraense
Emilio Goeldi 109: 1-20.
Cunha OR, Nascimento FP. 1993. Ofidios da Amazonia.
As cobras da regiao leste do Para. Boletim do Museo
Paraense Emilio Goeldi (Série Zoologia) 9: 1-191.
Daza JM, Smith EN, Pez VP, Parkinson CL. 2009.
Complex evolution in the Neotropics: the origin and
diversification of the widespread genus Leptodeira
(Serpentes: Colubridae). Molecular Phylogenetics and
Evolution 53: 653-667.
de Carvalho Teixeira C, de Assis Montag LF, dos Santos-
Costa MC. 2017. Diet composition and foraging
habitat use by three species of water snakes, Helicops
Wagler, 1830 (Serpentes: Dipsadidae), in eastern
Brazilian Amazonia. Journal of Herpetology 51(2):
215-222.
Di Pietro D, Alcalde L, Williams J. 2014. New cranial
characters in the tribe Hydropsini (Serpentes:
Dipsadidae: Xenodontinae). Acta Herpetologica 9(1):
1-4.
Di Pietro DO, Alcalde L, Williams JD. 1974. Nasal
cartilages, hyobranchial apparatus, larynx, and glottal
tubes in four species of Hydropsini (Serpentes:
Dipsadidae: Xenodontinae). Veterbrate Zoology 64:
103-111.
Dowling HG. 1975. The Nearctic snake fauna. Pp.
191-202 In: 1974 Yearbook of Herpetology. Editor,
Dowling HG. Herpetological Information Search
System Publications, New York, New York, USA. 256
p.
Ford NB, Ford DF. 2002. Notes on the ecology of the
South American water snake, Helicops angulatus
(Squamata: Colubridae), in Nariva Swamp, Trinidad.
Caribbean Journal of Science 38(1/2): 129-131.
Foster CS, Thompson MB, Van Dyke JU, Brandley
MC, Whittington CM. 2020. Emergence of an
evolutionary innovation: gene expression differences
associated with the transition between oviparity and
viviparity. Molecular Ecology 29(7): 1,315—1,327.
Franga FG, Venancio NM. 2010. Reptiles and amphibians
of a poorly known region in southwest Amazonia.
Biotemas 23(3): 71-84.
Franca RC, Germano CE, Franca FG. 2012. Composition
of a snake assemblage inhabiting an urbanized area in
the Atlantic Forest of Paraiba State, northeast Brazil.
Biota Neotropica. 2012(3): 183-195.
Froese R, Garilao CV. 2019. Cichlasoma bimaculatum
(Linnaeus, 1758), Black acara. FishBase. Available:
http://www.fishbase.org [Accessed: 25 February
2020].
Gorzula S, Sefiaris JC. 1998. Contribution to the
herpetofauna of the Venezuelan Guyana I. A database.
Scientia Guaianae 8: 1-269.
Gouy M, Guindon S, Gascuel O. 2010. SeaView version 4.
October 2020 | Volume 14 | Number 3 | e261
Murphy et al.
A multiplatform graphical user interface for sequence
alignment and phylogenetic tree building. Molecular
Biology and Evolution 27: 221-224.
Gray JE. 1849. Specimens of Snakes in the Collection
of the British Museum. Edward Newman, London,
United Kingdom. 125 p.
Grazziotin FG, Zaher H, Murphy RW, Scrocchi G,
Benavides MA, Zhang YP, Bonatto SL. 2012
Molecular phylogeny of the New World Dipsadidae
(Serpentes: Colubroidea): a reappraisal. Cladistics
28(5): 437-459.
Guimaraes JA, Dias EJ, Oliveira AR. 2010. Helicops
angulatus (Watersnake). Diet and _ reproduction.
Herpetological Review 41(1): 93.
Hernandez-Ruiz EJ, Wariss Figueiredo MA, Brito Pezzuti
JC. 2014. Bycatch of Helicops angulatus (Linnaeus
1758) (Reptilia: Squamata: Colubridae) in hoop-traps
used to capture fresh water turtles on the coast of Para,
Brazil. Acta Biolégica Colombiana 19(1): 119-120.
Hodges WL. 2004. Evolution of viviparity in horned
lizards (Phrynosoma): testing the cold-climate
hypothesis. Journal of Evolutionary Biology 17(6):
1,230-1,237.
Hoogmoed MS, Gruber U. 1983. Spix and Wagler type
specimens of reptiles and amphibians in the Natural
History Musea in Munich (Germany) and Leiden (The
Netherlands). Spixiana Supplement 9: 319-415.
Husson AM. 1978. The Mammals of Suriname. Brill,
Leiden, Netherlands. 729 p.
Juman R, Ramsewak D. 2013. Status of mangrove forests
in Trinidad and Tobago, West Indies. Caribbean
Journal of Science 47(2-3): 291-304.
Katoh K, Misawa K, Kuma K, Miyata T. 2002. MAFFT:
a novel method for rapid multiple sequence alignment
based on fast Fourier transform. Nucleic Acids
Research 30: 3,059-3,066.
Kawashita-Ribeiro RA, Avila RW, Morais DH.
2013. A new snake of the genus Helicops
Wagler, 1830 (Dipsadidae, Xenodontinae) from
Brazil. Herpetologica 69(1): 80-90.
Kelly CM, Barker NP, Villet MH. 2003. Phylogenetics
of advanced snakes (Caenophidia) based on four
mitochondrial genes. Systematic Biology 52(4): 439-
459.
Kocher TD, Thomas WK, Meyer A, Edwards SV, Paabo
S, Villablanca FX, Wilson AC. 1989. Dynamics of
mitochondrial DNA evolution in animals: amplification
and sequencing with conserved primers. Proceedings
of the National Academy of Sciences of the United
States of America 86(16): 6,196—6,200.
Laird MK, Thompson MB, Whittington CM. 2019.
Facultative oviparity in a viviparous skink (Saiphos
equalis). Biology Letters 15(4): 20180827.
Lambert SM, Wiens JJ. 2013. Evolution of viviparity:
a phylogenetic test of the cold-climate hypothesis in
phrynosomatid lizards. Evolution 67(9): 2,614—2,630.
Lanfear R, Frandsen PB, Wright AM, Senfeld T, Calcott
Amphib. Reptile Conserv.
B. 2016. PartitionFinder 2: new methods for selecting
partitioned models of evolution for molecular and
morphological phylogenetic analyses. Molecular
Biology and Evolution 34: 772-773.
Larkin MA, Blackshields G, Brown N, Chenna R,
McGettigan PA, McWilliam H, Valentin F, Wallace
IM, Wilm A, Lopez R. 2007. Clustal W and Clustal X
version 2.0. Bioinformatics 23(21): 2,947—2,948.
Lasso CA, Sanchez-Duarte P. 2011. Los Peces del
Delta del Orinoco. Diversidad, Bioecologia, Uso
y Conservacion. Fundacion La Salle de Ciencias
Naturales y Chevron CA _ Venezuela, Caracas,
Venezuela. 500 p.
Lasso CA, Rial A, Colonnello G, Machado-Allison
A, Trujillo F. (Editors). 2014. XI. Humedales de la
Orinoquia (Colombia-Venezuela). Serie Editorial
Recursos Hidrobioldgicos y Pesqueros Continentales
de Colombia. Instituto de Investigacion de Recursos
Biologicos Alexander von Humboldt ([AvH), Bogota,
Colombia. 303 p.
Latrubesse EM, Arima EY, Dunne T, Park E, Baker VR,
d Horta FM, Wight C, Wittmann F, Zuanon J, Baker
PA, et al. 2017. Damming the rivers of the Amazon
basin. Nature 546(7658): 363-369.
Lawson R, Slowinski JB, Crother BI, Burbrink FT.
2005. Phylogeny of the Colubroidea (Serpentes):
new evidence from mitochondrial and nuclear genes.
Molecular Phylogenetics and Evolution 37(2). 581—
601.
Linnaeus C. 1758. Systema nature per regna tria nature,
secundum classes, ordines, genera, species, cum
characteribus, differentiis, synonymis, locis. Tomus I.
Editio decima, reformata. Laurentii Salvi, Stockholm,
Sweden. 824 p.
Ma L, Buckley LB, Huey RB, Du WG. 2018. A global
test of the cold-climate hypothesis for the evolution of
viviparity of squamate reptiles. Global Ecology and
Biogeography 27(6): 679-689.
Martins M, Oliveira ME. 1998. Natural history of snakes
in forests of the Manaus region, Central Amazonia,
Brazil. Herpetological Natural History 6: 78-150.
Miller MA, Pfeiffer W, Schwartz T. 2010. Creating the
CIPRES Science Gateway for inference of large
phylogenetic trees. Pp. 1-8 In: Gateway Computing
Environments Workshop, 14 November 2010, New
Orleans, Louisiana. IEEE, Piscataway, New Jersey,
USA.
Mohammed RS, Manickchan SA, Charles SP, Murphy
JC. 2014. The herpetofauna of southeast Trinidad,
Trinidad and Tobago. Living World 2014: 12-20.
Mole RR. 1924. The Trinidad snakes. Proceedings of the
Zoological Society of London 94(1): 235-278.
Moraes-Da-Silva A, Amaro RC, Nunes PM, Striissmann
CH, Teixeira MJ, Andrade AJ, Curcio FF. 2019.
Chance, luck, and a fortunate finding: a new species
of watersnake of the genus Helicops Wagler, 1828
(Serpentes: Xenodontinae), from the Brazilian
October 2020 | Volume 14 | Number 3 | e261
Cryptic diversity and reproduction in Helicops angulatus
Pantanal wetlands. Zootaxa 4651(3): 445-470.
Murphy JC. 2012. Marine invasions by non-sea snakes,
with thoughts on terrestrial-aquatic-marine transitions.
Integrative and Comparative Biology 52: 217-226.
Natera Mumaw M, Esqueda Gonzalez LF, Castelain
Fernandez M. 2015. Atlas Serpientes de Venezuela.
Una Vision Actual de su Diversidad. Dimacofi
Negocios Avanzados S.A., Santiago, Chile. 441 p.
Neill WT. 1964. Viviparity in snakes: some ecological
and zoogeographical considerations. The American
Naturalist 98(898): 35-55.
Nogueira CC, Argdlo AJ, Arzamendia V, Azevedo JA,
Barbo FE, Bérnils RS, Bolochio BE, Borges-Martins
M, Brasil-Godinho M, Braz H, et al. 2019. Atlas of
Brazilian snakes: verified point-locality maps to
mitigate the Wallacean shortfall in a megadiverse
snake fauna. South American Journal of Herpetology
14(Suppl 1): 1-274.
Novoa D. 2000. La Pesca en el Golfo de Paria y Delta
del Orinoco Costero. CONOCO Venezuela, Editorial
Arte, Caracas, Venezuela. 140 p.
Oberdorff T, Dias MS, Jézéquel C, Albert JS, Arantes
CC, Bigorne R, Carvajal-Valleros FM, De Wever A,
Frederico RG, Hidalgo M, et al. 2019. Unexpected
fish diversity gradients in the Amazon basin. Science
Advances 5(9): p.eaav8681.
Packard GC, Tracy CR, Roth JJ. 1977. Physiological
ecology of reptilian eggs and embryos, and evolution
of viviparity within class Reptilia. Biological Reviews
of the Cambridge Philosophical Society 52: 71-105.
Palumbi SR, Martin A, Romano S, Mcmillan WO, Stice J,
Grabowski G. 1991. The Simple Fool's Guide to PCR.
University of Hawaii Press, Honolulu, Hawau, USA.
AS p.
Pérez-Santos C, Moreno AG. 1988. Ofidios de Colombia.
Monografie Museo Regionale di Scienze Naturali-
Torino 6: 1-517.
Qualls CP, Andrews RM. 1999. Cold climates and the
evolution of viviparity in reptiles: cold incubation
temperatures produce poor quality offspring in the
lizard, Sceloporus virgatus. Biological Journal of the
Linnean Society 67. 353-376.
Ribeiro SC, Roberto IJ, Sales DL, Avila RW, Almeida
WD. 2012. Amphibians and reptiles from the Araripe
bioregion, northeastern Brazil. Salamandra 48(3):
133-146.
Roberto IJ, Ribeiro SC, de Sousa Delfino MM, de Oliveira
Almeida W. 2009. Reptilia, Colubridae, Helicops
angulatus: distribution extension and rediscovery in
the state of Ceara. Check List 5(1): 118-121.
Rocha R, Lopez-Baucells A. 2014. Predation attempt
of Hypsiboas boans (Anura: Hylidae) by Helicops
angulatus (Squamata: Dipsadidae) with notes on
defensive behavior. A/ytes 30(1-4): 78-81.
Rodriguez-Diaz T, Brana F. 2012. Altitudinal variation
in egg retention and rates of embryonic development
in oviparous Zootoca vivipara fit predictions from
Amphib. Reptile Conserv.
the cold-climate model on the evolution of viviparity.
Journal of Evolutionary Biology 25(9): 1,877—1,887.
Ronquist F, Huelsenbeck JP. 2003. MrBayes 3: Bayesian
phylogenetic inference under mixed models.
Bioinformatics 19: 1,572—1,574.
Rossman DA. 1973. Miscellaneous notes on the South
American water snake genus Helicops. HISS News-
Journal 1(6): 189-191.
Rossman DA. 1984. Helicops angulatus (South American
water snake). Reproduction. Herpetological Review
[5=50.
Rossman DA. 2002. Morphological variation in the
endemic Colombian water snake, Helicops danieli
Amaral, 1937 (Serpente: Xenodontidae). Revista de la
Academia Colombiana de Ciencias Exactas, Fisicas y
Naturales 101: 589-594.
Roze JA. 1957a. Notas sobre Hydrops lehmanni Dunn,
1944, y los géneros neotropicales: Pseudoeryx,
Hydrops, y Helicops (Colubridae). Acta Bioldgica
Venezuélica 2: 17-26.
Roze JA. 1957b. Resumen de una revisién del género
Hydrops Wagler, 1830 (Serpentes: Colubridae). Acta
Biologica Venezuélica 2: 51-95.
Saaristo M, Brodin T, Balshine S, Bertram MG, Brooks
BW, Ehlman SM, McCallum ES, Sih A, Sundin J,
Wong BB, et al. 2018. Direct and indirect effects of
chemical contaminants on the behavior, ecology, and
evolution of wildlife. Proceedings of the Royal Society
B: Biological Sciences 285(1885): 20181297.
Schlegel H. 1837. Essai sur la Physionomie des Serpens.
M.H. Schonekat, Amsterdam, Netherlands. 251 p.
Sergeev A. 1940. Researches in the viviparity of reptiles.
Moscow Society of Naturalists (Jubilee Issue): 1-34.
Shaw G. 1802. General Zoology, or Systematic Natural
History. Volume 3, part 2. G. Kearsley, Thomas
Davison, London, United Kingdom. 313-615 p.
Shine R. 1985. The evolution of viviparity in reptiles: an
ecological analysis. Pp. 605-694 In: Biology of the
Reptilia, Volume 15. Editors, Gans C, Billet F. Wiley,
New York, New York, USA. 731 p.
Shine R, Bull J. 1979. The evolution of live-bearing in
lizards and snakes. The American Naturalist 113: 905—
923.
Sioli H. 1975. Tropical rivers as expressions of their
terrestrial environments. Pp. 275-288 In: Tropical
Ecological Systems. Trends in Terrestrial and Aquatic
Research. Editors, Goley F, Medina E. Springer-
Verlag, New York, New York, USA. 398 p.
Silvestro D, Michalak I. 2012. RaxmlGUI: a graphical
front-end for RAxML. Organisms, Diversity, and
Evolution 12: 335-337.
Starace F. 2013. Serpents et Amphisbénes de Guyane
Francaise. Ibis Rouge Editions, Matoury, French
Guiana. 604 p.
Tinkle DW, Gibbons JW. 1977. The distribution and
evolution of viviparity in reptiles. Miscellaneous
Publications Museum of Zoology University of
October 2020 | Volume 14 | Number 3 | e261
Murphy et al.
Michigan 154: 1-55.
Tisseuil C, Cornu JF, Beauchard O, Brosse S, Darwall
W, Holland R, Hugueny B, Tedesco PA, Oberdorff
T. 2013. Global diversity patterns and cross-taxa
convergence in freshwater systems. Journal of Animal
Ecology 82: 365-376.
Uetz P, Freed P, Hoek J. (Editors). 2020. The Reptile
Database, Helicops angulatus. Available: http://www.
reptile-database.org [Accessed: 25 February 2020].
Vidal N, Dewynter M, Gower DJ. 2010. Dissecting
the major American snake radiation: a molecular
phylogeny of the Dipsadidae Bonaparte (Serpentes,
Caenophidia). Comptes Rendus Biologies 333(1):
A48—S5.
Vidal N, Kind! SG, Wong A, Hedges SB. 2000.
Phylogenetic relationships of xenodontine snakes
inferred from 12S and 16S ribosomal RNA sequences.
Molecular Phylogenetics and Evolution 14(3): 389-
402.
Wagler JG. 1824. Serpentum Brasiliensium species
nova ou histoire naturelle des espéce nouvelle des
serpens recueillies et observées pendant le voyage
dans I’interieur du Brésil dans le années 1817, 1818,
1819, 1820 exécuté par ordre de Sa Majesté le Roi de
Baviére, publiée par Jean Spix. Monachii. Typis ES.
Hubschmanni, Munich, Germany. VIII, 75 p.
Wagler J. 1828-1833. Descriptiones et Icones
Amphibiorum. Tres Partes Cum XXXVI Tabulis. J.G.
Cottae, Munich, Stuttgart, and Tubingen, Germany.
Amphib. Reptile Conserv.
Wagler JG. 1830. Natiirliches System der Amphibien,
mit vorangehender Classification der Sdugetiere und
Vogel. Ein Beitrag zur vergleichenden Zoologie. 1.0.
J.G. Cotta, Munich, Stuttgart, and Tubingen, Germany.
354 p.
Wallach V, Williams KL, Boundy J. 2014. Snakes of the
World: a Catalogue of Living and Extinct Species.
CRC Press/Taylor and Francis, New York, New York,
USA. 1,237 p.
Water Resource Agency. 2001. National Report in
Integrating the Management of Watersheds and
Coastal Areas in Trinidad and Tobago. Prepared
for The Ministry of the Environment, Port of Spain,
Trinidad and Tobago. 125 p.
Weekes HC. 1935. Areview of placentation among reptiles,
with particular regard to the function and evolution of
the placenta. Proceedings of the Zoological Society of
London 105(3): 625-645.
Zaher H, Grazziotin FG, Cadle JE, Murphy RW, Moura-
Leite JC, Bonatto SL. 2009. Molecular phylogeny of
advanced snakes (Serpentes, Caenophidia) with an
emphasis on South American xenodontines: a revised
classification and descriptions of new taxa. Papéis
Avulsos de Zoologia 49(11): 115-153.
Zaher H, Yanez-Mufioz MH, Rodrigues MT, Grabosk1
R, Machado FA, Altamirano-Benavides M, Bonatto
SL, Grazziotin FG. 2018. Origin and hidden diversity
within the poorly known Galapagos snake radiation
(Serpentes: Dipsadidae). Systematics and Biodiversity
16(7): 614-642.
John C. Murphy is a naturalist who focuses on snakes. When he is not hiking in the desert or
examining specimens in the lab, John is often writing about reptiles. He is a retired science educator
who got serious about his lifelong fascination with lizards and snakes in the early 1980s, when he
and his family made their first trip to Trinidad. The work on Trinidad and Tobago provided valuable
lessons that shaped his views of nature and evolution. Today he is still working on the eastern
Caribbean herpetofauna. In the 1990s he worked on homalopsid snakes in Southeast Asia with other
researchers from the Field Museum (Chicago, Illinois, USA). Today John resides in southeastern
Arizona (USA) and is involved in multiple projects that concern arid habitats and the impact of
climate change on biodiversity. His most recent book, with co-author Tom Crutchfield, is Giant
Snakes, A Natural History. Born and raised in Joliet, Illinois, he first learned about reptiles on his
grandfather’s farm by watching Eastern Garter Snakes emerge from their winter dens and Snapping
Turtles depositing their eggs at the edge of a cattail marsh.
Antonio Mufioz-Mérida is a bioinformatician with a background in biology and genetics. During
his Ph.D. work, Antonio developed several bioinformatics tools and gained computing skills that
have been improved during his post-doctoral appointment as the main bioinformatician at the Centro
de Investigagao em Biodiversidade e Recursos Geneticos (CIBIO) research center in Portugal.
His expertise ranges across most of the OMICs associated with Next Generation Sequencing and
functional annotation of whole genomes.
Renoir J. Auguste is a Trinidad and Tobago herpetologist. Renoir received his M.Sc. in Biodiversity
Conservation from The University of the West Indies, St. Augustine Campus, Trinidad and Tobago,
and is interested in the ecology and conservation of amphibians and reptiles. He has conducted
herpetological surveys across Trinidad and Tobago professionally for national baseline surveys
aimed at improving protected areas, as part of his academic degrees. He has also conducted surveys
as part of his academic degree work and voluntarily with the local environmental NGO Trinidad and
Tobago Field Naturalists’ Club, in which he held the position as president for three years.
October 2020 | Volume 14 | Number 3 | e261
Cryptic diversity and reproduction in Helicops angulatus
Oscar Miguel Lasso-Alcala is Curator of the Fish Collection and a Senior Researcher at Museo de
Historia Natural La Salle (MHNLS), Fundacion La Salle de Ciencias Naturales, Caracas, Venezuela.
His undergraduate studies were in Fishing Technology, Aquaculture, and Oceanography, followed
by postgraduate work in Agricultural Zoology and Estuary Ecology. He is primarily an ichthyologist,
with more than 30 years of experience in the taxonomy, biology, ecology, and fisheries aspects of
marine, estuarine, and freshwater fauna. However, during more than 60 research projects and 230
scientific expeditions, he has participated in the study of biodiversity, including amphibians and
reptiles. In this way, he has collaborated in several studies of the herpetofauna in the Caribbean,
and different regions of Venezuela, where a frog (Zachiramantis lassoalcalai) was described in his
honor.
Gilson A. Rivas was born in Caracas, Venezuela. He currently serves as co-editor of the scientific
journal Anartia, and is a collection manager at the Museo de Biologia de la Universidad del Zulia,
Maracaibo, a Venezuelan centennial university that began academic activities on 11 September
1891. For over two decades, Gilson has devoted his studies to the taxonomy and conservation of the
neotropical herpetofauna, and has authored or co-authored more than 100 academic publications,
describing over 30 new species of amphibians and reptiles, and a new genus of dipsadine snakes,
Plesiodipsas. Gilson is the author (with G. Ugueto) of the book Amphibians and Reptiles of
Margarita, Coche, and Cubagua; and together with M. De Freitas, H. Kaiser, C.L. Barrio-Amoros,
and T.R. Barros produced Amphibians of the Peninsula de Paria: a Pocket Field Guide. Gilson’s
research interests are focused on the herpetofauna of the Venezuelan coastal range and insular
ecosystems, as well as the influences of invasive species and human development and their impact
on the native fauna.
Michael J. Jowers is an evolutionary biologist with broad interests in the processes and timing
of speciation. His work focuses on tropical island biogeography, phylogeography, systematics,
population genetics, taxonomy, and conservation. Michael is deeply involved in amphibian and
reptile studies from the islands of Trinidad and Tobago (Lesser Antilles), but he is also interested in
other organisms such as birds, mammals, and insects; and he actively leads studies throughout South
America, Africa, Europe, and Asia.
Supplementary Material
Table S1. Primers used in gene fragment amplification.
Gene Primer name and sequence Reference
12S rDNA 12SA 53’°- AAACTGGGATTAGATACCCCACTAT -3’ Kocher et al. 1989
12S rDNA 12SB 53’- GAGGG TGACGGGCGGTGTGT -3’ Kocher et al. 1989
16S rDNA 16SL 5’°- GCCTGTTTATCAAAAACAT -3’ Palumbi et al. 1991
16S rDNA 16SH 5’- CCGGTCTGAACTCAGATCACGT - 3’ Palumbi et al. 1991
cytb 14910 5’- GACCTGTGATMTGAAAAACCAYCGG -3' Burbrink et al. 2000
cytb H16064 5’- CTTTGGTTTACAAGAACAATGCTT -3' Burbrink et al. 2000
c-mos S77 5’°- CATGGACTGGGATCAGTTATG - 3’ Lawson et al. 2005
c-mos S78 S’- CCTTGGGTGTGATTTTCTCACCT - 3’ Lawson et al. 2005
Amphib. Reptile Conserv. 154 October 2020 | Volume 14 | Number 3 | e261
Murphy et al.
Table S2. GenBank accession numbers of species and specimens of Helicops and outgroup taxa included in the molecular
phylogenetic reconstructions and genetic divergence analyses. Helicops angulatus from this study are all from Trinidad (West
Indies): UWIZM.2015.18.32 (Rd. Kernahan to Bush Bush), UWIZM.2011.20.22 (Nariva Swamp), UWIZM.2013.6 (Nariva
Swamp), CAS231757 (Nariva Road, Manzanilla Beach), CAS231758 (Nariva Road, Manzanilla Beach), and CAS231760 (Nariva
Road, Manzanilla Beach).
Species
Pseudoeryx plicatilis (PSPL001)
Pseudoeryx plicatilis (H1399)
Hydrops triangularis (H1476)
Hydrops triangularis (HYTROO1)
Helicops leopardinus (UFMTR11939)
Helicops leopardinus (H1733)
Helicops modestus (MTR11762)
Helicops modestus (MTR19715)
Helicops pictiventris (HEPIO01)
Helicops infrataeniatus (HINOO1)
Helicops boitata (UFMTR11940)
Helicops carinicaudus (142)
Helicops nentur (DJS-2016)
Helicops polylepis (H919)
Helicops hagmanni (MTR12961)
Helicops hagmanni (MTR13320)
Helicops gomesi (HEGOO01)
Helicops gomesi (141)
Helicops angulatus (HEANO01)
Helicops angulatus (MRT7588)
Helicops angulatus (CAS231758)
Helicops angulatus (CAS231757)
Helicops angulatus (CAS231760)
Helicops angulatus (UWIZM.2013.6)
Helicops angulatus (UWIZM.2015.18.32)
Helicops angulatus (UWIZM.2011.20.22)
Amphib. Reptile Conserv.
12S rDNA
GQ457826
MNO038102
MNO038103
GQ457804
MNO038108
MNO038109
MNO38110
GQ457800
GQ457799
MNO38112
MNO038104
MNO38111
MNO038106
MNO38107
GQ457798
MNO038105
GQ457797
MNO038113
MT951589
MT951591
MT951590
MT951592
MT951593
MT951594
155
16S rDNA
GQ457765
MNO38115
MNO38114
GQ457744
MNO38121
MNO038120
MNO038122
MNO038123
GQ457741
GOQ457740
MNO038124
MNO038125
KT453992
MNO038118
MNO38119
GOQ457739
MNO38117
GQ457738
MNO038116
MT951597
MT951599
MT951600
MT951595
MT951598
MT951596
c-mos
GOQ457886
MNO032460
MNO032461
GOQ457864
MN032465
MN032464
MN032468
MN032469
GOQ457860
GQ457859
MNO32471
MN032462
KT453991
MNO032470
MN032467
MN032466
GQ457858
MN032463
GQ457857
MN032472
MT951603
MT951605
MT951604
MT951602
MT951601
Cyt b
MT951607
MT951608
MT951606
MT951609
MT951610
October 2020 | Volume 14 | Number 3 | e261
Official journal website:
amphibian-reptile-conservation.org
Amphibian & Reptile Conservation
14(3) [General Section]: 156-161 (e262).
Cannibalism in the High Andean Titicaca Water Frog,
Telmatobius culeus Garman, 1875
1*Arturo Munoz-Saravia, 7Adriana Aguila-Sainz, 7Ricardo Zurita-Ugarte,
2Gabriel Callapa-Escalera, and ‘Geert P.J. Janssens
‘Laboratory of Animal Nutrition, Ghent University, BELGIUM Natural History Museum Alcide d’Orbigny, Cochabamba, BOLIVIA
Abstract.—Cannibalism has been considered as an aberrant behavior, but in amphibians and reptiles, it could
play a role in the biology of a population. This paper reports conspecific predation in the Titicaca Water Frog
(Telmatobius culeus), as the first record of cannibalism of adults in this genus. Heterocannibalism describes
cases where adults eat larvae, juveniles, and adults. The phenotypical differences between predator and prey
suggest this is a case of cannibalistic polyphenism, where cannibalistic morphs seem to have features that
facilitate the predation of the conspecifics. Both females and males were observed to be cannibalistic, and
suggestions are proposed regarding why both sexes could benefit from cannibalism, as well as how a high
density of a fully aquatic species that shares the habitat, resources, and refuges with other conspecifics
increases the chances of encounters and cannibalism.
Keywords. Amphibia, conspecific predation, Critically Endangered, heterocannibalism, anurophagy, size relationships
Citation: Mufhoz-Saravia A, Aguila-Sainz A, Zurita-Ugarte R, Callapa-Escalera G, Janssens GJP. 2020. Cannibalism in the High Andean Titicaca
Water Frog, Telmatobius culeus Garman, 1875. Amphibian & Reptile Conservation 14(3) [General Section]: 156-161 (e262).
Copyright: © 2020 Mufoz-Saravia et al. This is an open access article distributed under the terms of the Creative Commons Attribution License
[Attribution 4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction
in any medium, provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced,
are as follows: official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 10 October 2020; Published: 31 October 2020
Introduction
Intraspecific predation, or cannibalism, is the process
of eating an individual of the same species and it is
widespread in the animal kingdom (Fox 1975; Polis
1981). It may be important in the population ecology of
certain amphibians, where in some genera, such as Rana
and Notophthalmus, conspecifics are reported to consist
of 7—25% of all diet items (Polis and Myers 1985). Some
of the factors that may stimulate cannibalism include
intraspecific predation, environmental and nutritional
stress, and high densities, and it may also be part of a
reproductive strategy (Fox 1975; Kaplan and Sherman
1980; Polis 1981; Polis and Myers 1985).
In amphibians, as in reptiles, the groups that are
more often cannibalized tend to be younger and
smaller animals (Polis and Myers 1985). However, in
contrast to reptiles, cannibalism among amphibians
appears to be important in the biology of these species.
Cannibalism may be an important strategy for larvae
living in ephemeral habitats, where the pressure on this
stage 1s very high, and the first individuals that will
metamorphose and emerge from water are mainly the
cannibal morph (Crump 1983). Juveniles are commonly
eaten by adult frogs, and this predation of juveniles
could be a strategy to remove future competitors for the
predator itself and for its own offspring (Kaplan and
Sherman 1980). Juveniles are more often cannibalized
before they reach a certain size. Toledo et al. (2007)
explain the term of “status inversion,” i.e. the process
of turning from prey into predator as anurans increase
in body size. Examples of status inversion have been
noted in Conraua, Ceratophrys, some Leptodactylus,
Pyxicephalus, and Lithobates, with adults that can
prey upon several types of small vertebrates and even
conspecifics (Duellman and Trueb 1994). Cannibalism
between adult individuals is less frequent and, as
explained by Measey et al. (2015), the prey size of a
conspecific adult could deliver some negative effects
and even the death of the predator. Few reports of
conspecific predation of adults are known, with
just a couple of examples such as Ceratophrys and
Lepidobatrachus Ilanensis (Cochran 1955; Hulse 1978;
Polis 1981).
Polyphenism is the occurrence of alternative
phenotypes in a population that are produced from a
single genotype in response to different environmental
stimuli (West-Eberhard 1989). The phenomenon of
cannibalistic polyphenism and its causes were reviewed
by Crump (1983, 1992) and Hoffman and Pfennig
(1999), with reference to phenotypic differences in
behavior, morphology, growth, or life history between
Amphib. Reptile Conserv.
October 2020 | Volume 14 | Number 3 | e262
Munoz-Saravia et al.
cannibal and non-cannibal forms and often resulting in
expression of the most advantageous phenotype under
current environmental conditions (Hoffman and Pfennig
1999). These adaptations include rapid development,
larger size, hypertrophied jaw musculature, and more
aggressive behavior, among other factors that could
facilitate the cannibalism in these morphs.
Lake Titicaca Frog is considered an iconic species,
and as one of the largest fully aquatic frogs in the
world (Fonturbel 2009; De La Riva 2005) it has several
adaptations to survive in the conditions that a high
Andean lake provides. For many years, the taxonomy of
the four species of 7e/matobius described in the Titicaca
basin (7elmatobius albiventris, Telmatobius craw fordi,
Telmatobius culeus, and Telmatobius marmoratus) has
been chaotic. In this area, as many as four subspecies of 7.
albiventris, six of T: culeus, two of T. crawfordi, and four
of 7’ marmoratus have been described, bringing the total
number of taxa to 16 subspecies belonging to four putative
species (De La Riva 2005). As part of the taxonomic
revision, Benavides et al. (2002) demonstrated that T.
albiventris, T: culeus, and T: crawfordi represent a single
taxon, and that 7’ culeus varies noticeably in morphology
and body size from 7: marmoratus. Benavides (2005)
suggested the absence of reciprocal monophyly for the
two species present in the lake, recognized as 7? culeus
sensu lato and 7: marmoratus. He also indicated that
lacustrine haplotypes are much older than riverine ones,
in agreement with the findings of De la Riva et al. (2010)
and also as indicated by Aguilar and Valencia (2009).
Consequently, 7’ culeus is the only species present in
lacustrine habitats.
This report provides the first evidence of cannibalism
in Titicaca Water Frog (7e/matobius culeus), a Critically
Endangered anuran of the High Andes which 1s fully
aquatic and endemic to Lake Titicaca and its surroundings
(De La Riva 2005).
Materials and Methods
During November 2008 to December 2015 studies to
monitor the species were conducted at different localities
on the Bolivian side of Lake Titicaca, Department of La
Paz. Monitoring consisted of swimming on the surface
of the water with a snorkel, and counting and observing
individuals at depths between 0.5 and 7 m. In some
cases when an individual was observed, immersions
with the snorkel up to 6 m were carried out to capture
the frogs. In addition, scuba diving observations were
carried out at depths of up to 12 m for longer periods.
When individuals were captured, Snout-Vent Length
(SVL) and body mass were obtained together with other
biotic and abiotic information. Because this species is
Critically Endangered, live frogs were not collected.
Casually observed individuals were kept for limited time
for specific measurements and then returned to the lake.
Amphib. Reptile Conserv.
Results and Discussion
During the study period, three records of wild individuals
eating conspecifics were observed, in addition to similar
observations of three others in captivity.
e On 20 January 2009 at 1147 h, in the locality of
Patapatani, Bolivia (16°4°58.58”S, 69°7°45.47°W) a
male individual (Fig. la) of Zelmatobius culeus was
captured at a depth of 5.6 m. This individual was
maintained alone during one night in an aquarium,
and the next day at 0730 h the frog excreted a juvenile
of 7! culeus with the entire body digested except for
the bones and some soft tissue.
e The second case occurred in Sicuani, Bolivia
(16°5’23.09”S, 69°6’48.50”W) on 4 November 2011.
A female individual was captured at a depth of 4
m. After some measurements, it was separated in a
container with water for about half an hour. Within
that period a sub-adult male individual was vomited
up with the head partially digested.
e On 22 January 2013 in Isla de la Luna, Bolivia
(16°2’41.24’S, 69°4°8.78”"W), a female individual
was found dead at 7 m. A post-mortem analysis was
carried out and the remains of bones of the legs were
found in the intestines of this individual.
This cannibalistic behavior was observed in both wild
populations and captive individuals, a fact suggeting
that this is a normal behavior in the species. A captive
female frog was observed eating two individuals on
two different occasions and in another occasion, one
male was observed eating a female frog (Fig. 1b,c).
Observations also indicate that cannibalism between
individuals of different stages is present in the species,
with two observations of adult and juvenile frogs eating
tadpoles. Cannibalism by larvae was also recorded
with two observations of tadpoles attacking and eating
other conspecific larvae that were alive, as well as some
juveniles that were sick or dead in the same aquarium
(Table 1).
Cannibalism in this genus has been recorded so
far in Telmatobius atacamensis (Barrionuevo 2015),
with an adult female predating a juvenile. Prior to our
observations, Pérez (1998) reported the remains of a
small anuran in the gut contents of wild 7) culeus, but
the identity of the anuran eaten was not specified. To our
knowledge, the present report is the first on conspecific
predation of adults in this genus. This behavior could
be present in this species, as in Ceratophrys and
Lepidobatrachus (Polis 1981), due to the morphological
adaptations and size differences between individuals
in the population, making the cannibalism of adult
individuals possible. It would be interesting to see if the
same behavior happens with other species of the genus
where no such size differences exist.
October 2020 | Volume 14 | Number 3 | e262
Cannibalism in Telmatobius culeus
a toll
ee
Fig. 1. Individuals of Ze/matobius culeus eating smaller conspecific frogs: (a) wild male eating a juvenile, (b) female captive frog
eating a male adult frog, (c) male captive frog eating a female adult frog. Photos by Arturo Mufioz (a), Patricia Mendoza (b), and
Adriana Aguila (c).
Cannibalism may just be opportunistic and occur as
a simple by-product of normal predatory behavior (Polis
and Myers 1985). Yet, Measey et al. (2015) reported
that among 228 anuran species, 77 were known to eat
other frogs in different stages. From this last group,
cannibalism was identified in 35% of the records. It
therefore seems to be a common behavior in anurans,
supported by many affirmations (Polis and Myers 1985).
The limited number of records of cannibalism in 7! culeus
reported here at least demonstrates that it is present in
this species, and in the future more attention should be
directed toward seeing if this is a common occurrence
in the species. This cannibalistic behavior seems to be
associated with taxonomic group, for example taxa such
as Ceratophryidae, Hylidae, and Leptodactylidae, all
Amphib. Reptile Conserv.
have elevated levels of anurophagy (Measey et al. 2015).
This could be linked with size, where body size is a
dominant predictor of anurophagy (Polis 1981; Measey
et al. 2015). Since 7’ culeus is considered a large frog
(SVL up to 170 mm) and with prominent differences
in size between adults, 1t would make a good candidate
for being a cannibalistic species. Adaptations such as a
large and wide mouth makes this species prone to predate
sizeable prey items, including other anurans and even
conspecifics as reported here.
The reasons for cannibalism in a population can be
diverse, such as demographic factors where densities
are relatively high or where scarce refuge availability
increases the chances of encounters (Measey et al.
2015). In some localities, especially in the areas where
October 2020 | Volume 14 | Number 3 | e262
Munoz-Saravia et al.
Table 1. Details of cannibalism events in wild and captive populations of 7e/matobius culeus: A = adult, J = juvenile, L = larvae, M
= male, F = female, U = undetermined sex.
Predator characteristics
Prey characteristics
Locality Date Age Sex SVL(mm)/weight (g) Age Sex SVL (mm)/weight (g)
Pata Patani 20 January 2009 A M 112/335 J U 54/—
Sicuani 4 November 2011 A F 103/280 A M 49/—
Isla de La Luna 22 January 2013 A E 135/302 A U N/A
Captive 16 March 2015 A F 119.4/270 A M 63.65/28
Captive 16 September 2016 A F 119.4/270 A F 62.34/44
Captive 3 January 2017 A M 91.10/95 A F 57.18/21
Captive 14 March 2013 A F 95 .6/— It U N/A
Captive 1 May 2013 J N/A N/A L U N/A
Captive 4 July 2017 L N/A N/A L U N/A
Captive 4 July 2017 1 N/A N/A iL U N/A
cannibalism is reported here, densities of 7? culeus were
relatively high, facilitating the likelihood of individuals
finding other frogs that could be eaten. In captive
conditions, even with sufficient refuges, cannibalistic
events occurred, probably because the chances of
encounters were relatively high. Another factor that
increases the probability of cannibalism is the similarity
of habits that predators and prey share, facilitating their
encounters (Measey et al. 2015). In 7? culeus, as a fully
aquatic frog with its entire life cycle under the water,
encounters between individuals would be expected to
be high and make it easy for large individuals to find
tadpoles, juveniles, and even small adults that could be
considered as prey.
Heterocannibalism is when there is no genetic relation
between a cannibal and its victim (Okuda 2000). There
are different reports of its occurrence in aquatic species,
such as Xenopus and Pipa, that are often present in water
bodies together with conspecific eggs and tadpoles; and
at times when these stages are abundant, they are known
to make up a large proportion of the prey eaten (Measey
1998). Here we include two reports of heterocannibalism
in captivity in 7) culeus, but nothing is known about
its occurrence in wild populations. Yet, the fact that
individuals share the same habitat suggests this kind
of cannibalism may also occur in the wild. Similar to
Telmatobius, Xenopus and Pipa species lack or have a
reduced tongue and rely on suction for most small prey
items. They are also able to take large targets through jaw
prehension and even the forelimbs are involved in the
ingestion of large prey items (Barrionuevo 2016). These
are some of the adaptations that 77 cu/eus, a fully aquatic
species, could use to capture the prey, particularly using
the two latter strategies for large prey individuals.
Predating large individuals could be _ beneficial
considering the nutrient intake, but it could also imply
costs that result in excessive handling time, as well as a
risk of injury to the predator (Wyatt and Forys 2004). In
one of the cases reported here where prey (57.18 mm)
and predator (91.1 mm) were of comparable size, the
Amphib. Reptile Conserv.
time that the individual spent trying to ingest the prey
was more than 37 hours, involving some costs with the
risk of injury during the ingestion and rendering the
predatory frog in a vulnerable position against possible
predators.
The number of reports on cannibalistic females tends
to be higher than for males in the animal kingdom overall
(Polis 1981). Despite the low number of observations
here, the ratio of four females against two males agrees
with that tendency. The great nutritive benefit of such
large prey will evidently support the increased nutritional
needs of females during the breeding season. Conspecific
individuals could thus be a good source of nutrients
that makes cannibalism a good option. Even if it is not
a common behavior in this species, cannibalism could
provide high nutritive value similar to the situation in
small fish such as Orestias—which are more difficult
to catch due to their speed when swimming, when
compared with another conspecific prey. Still, males
could also benefit from cannibalism, since it allows them
to store energy and nutrients for the breeding season. In
that regard, it is worth noting that the energy costs for
searching and protecting a territory, calling for females,
fights, amplexus, and parental care are very high, whereas
the males do not eat during this period.
Although cannibalistic polyphenism is known to be
present in different species among amphibians (Crump
1983), no information was previously available for 7.
culeus. This species 1s known to have a great phenotypic
variation, to the extent that some have considered there
to be different taxa under this name even in the same
locality (Benavides et al. 2002). Further studies on this
topic would be interesting because all of the cannibalistic
frogs reported in this study had the phenotypic features
previously ascribed to Yelmatobius albiventris (now
considered 7 culeus), 1.e., all of them were of large size,
with wide and big mouths, more robust body and more
shaggy skin as seen in Fig. 1. More thorough studies
on this topic comparing predator and prey individuals
could give us additional information on the likelihood of
159 October 2020 | Volume 14 | Number 3 | e262
Cannibalism in Telmatobius culeus
cannibalistic polyphenism in this species.
Jiménez and De la Riva (2017) pointed out that
cannibalistic lizards predating on large individuals in
Andean environments try to optimize digestion by basking
to raise their temperature. In the case of 7’ culeus, the
species has been reported to bask at hours of higher solar
radiation (Mufioz-Saravia et al. 2018), and benefitting
digestion could be one of the reasons why these frogs
bask. These findings open several questions about the
behavior and adaptations of this unique species to some
of the extreme conditions found in Titicaca Lake. To
determine whether the species really has a cannibalistic
behavior or if these are just sporadic observations, could
give us more insight about the foraging strategies of
the species and the importance of this behavior in the
nutrition of the species.
Acknowledgements.—We want to thank the Direccion
General de Biodiversidad for providing permission to
undertake this study (VMABCC#0919/11), the Museo de
Historia Natural Alcide d’Orbigny, and all the members
and volunteers of the Bolivian Amphibian Initiative. AMS
was supported by BOF UGent, Rufford Small Grants,
SOS Save our Species, Stiftung Artenschutz, Amphibian
Ark, Durrell, and Denver Zoo. Special thanks to the local
communities for their help during the fieldwork.
Literature Cited
Aguilar C, Valencia N. 2009. Relaciones filogenéticas
entre telmatobiinidos (Anura, Ceratophryidae,
Telmatobiinae) de los Andes centrales basado en la
morfologia de los estados larval y adultos. Revista
Peruana de Biologia 16(1): 43-50.
Barrionuevo J. 2015. Telmatobius atacamensis (Atacama
Water Frog). Cannibalism. Herpetological Review 46:
421.
Barrionuevo JS. 2016. Independent evolution of suction
feeding in Neobatrachia: feeding mechanisms in two
species of 7elmatobius (Anura: Telmatobiidae). The
Anatomical Record 299: 181-196.
Benavides AE, Ortiz JC, Sites Jr JW. 2002. Species
boundaries among the JTelmatobius (Anura:
Leptodactylidae) of the Lake Titicaca basin: allozyme
and morphological evidence. Herpetologica 58: 31-
55.
Benavides E. 2005. The 7e/matobius species complex
in Lake Titicaca: applying phylogeographic and
coalescent approaches to evolutionary studies of
highly polymorphic Andean frogs. Pp. 167-185 In:
Studies on Andean Frogs of the Genera Telmatobius
and Batrachophrynus’ (Anura: Leptodactylidae).
Monografias de Herpetologia 7. Editors, Lavilla EO,
De la Riva I. Asociacion Herpetologica Espafiola,
Valencia, Spain. 349 p.
Cochran DM. 1955. Frogs of southeastern Brazil. Bulletin
of the United States National Museum 206: 1-423.
Amphib. Reptile Conserv.
Crump ML. 1983. Opportunistic cannibalism by
amphibian larvae in temporary aquatic environments.
The American Naturalist 121: 281-289.
Crump ML. 1992. Cannibalism in amphibians. Pp. 256—
276 In: Cannibalism: Ecology and Evolution among
Diverse Taxa. Editors, Elgar MA, Crespi BJ. Oxford
University Press, Oxford, United Kingdom. 361 p.
De La Riva I. 2005. Bolivian frogs of the genus
Telmatobius: synopsis, taxonomic comments,
and description of a new species. Pp. 65-101 In:
Studies on Andean Frogs of the Genera Telmatobius
and Batrachophrynus (Anura: Leptodactylidae).
Monografias de Herpetologia 7. Editors, Lavilla EO,
De la Riva I. Asociacién Herpetologica Espafiola,
Valencia, Spain. 349 p.
De la Riva I, Garcia-Paris M, Parra-Olea G. 2010.
Systematics of Bolivian frogs of the genus 7e/matobius
(Anura, Ceratophryidae) based on mtDNA sequences.
Systematics and Biodiversity 8: 49-61.
Duellman WE, Trueb L. 1994. Biology of Amphibians.
Johns Hopkins University Press, Baltimore, Maryland,
USA. 670 p.
Fonturbel RE. 2004. Propuesta de produccion sostenible
e industrializacion del 7e/matobius culeus (Anura,
Leptodactylidae): hacia la conservacion de especies
endémicas que apoyen el desarrollo sostenible en el
lago Huifiaimarca (Bolivia). Pp. 32—40 In: Aportes
al Conocimiento del Manejo de Vida Silvestre
en Argentina y Bolivia. Editor, Fonturbel RE.
Publicaciones. Integrales, La Paz, Bolivia. 103 p.
Fox LR. 1975. Cannibalism in natural populations.
Annual Review of Ecology and Systematics 6: 87-106.
Hoffman EA, Pfennig DW. 1999. Proximate causes of
cannibalistic polyphenism in larval Tiger Salamanders.
Ecology 80: 1,076—1,080.
Hulse AC. 1978. Food habits of the frog Lepidobatrachus
llanensis (Amphibia, Anura, Leptodactylidae) in
Argentina. Journal of Herpetology 12: 258-260.
Jiménez-Robles O, De la Riva I. 2017. Cannibalism in
the Andean lizard Liolaemus orientalis. Studies on
Neotropical Fauna and Environment 52: 244—247.
Kaplan RH, Sherman PW. 1980. Intraspecific oophagy
in California newts. Journal of Herpetology 14(2):
183-185.
Measey GJ. 1998. Diet of feral Xenopus laevis (Daudin)
in South Wales, United Kingdom. Journal of Zoology
246(3): 287-298.
Measey GJ, Vimercati G, Villiers FA, De Mokhatla
MM, Davies SJ, Edwards S, Altwegg R. 2015. Frog
eat frog: exploring variables influencing anurophagy.
PeerJ 3: e1204.
Mufioz-Saravia A, Callapa G, Janssens G. 2018.
Temperature exposure and possible thermoregulation
strategies in the Titicaca Water Frog, 7e/matobius
culeus, a fully aquatic frog of the High Andes.
Endangered Species Research 37: 91-103.
Okuda N. 2000. Interspecific differences in male
October 2020 | Volume 14 | Number 3 | e262
Munoz-Saravia et al.
cannibalistic behavior between two
cardinalfishes (Pisces:
Ethology 18(1): 5-10.
Pérez ME. 1998. Dieta y ciclo gametogénico anual de
Telmatobius culeus (Anura, Leptodactylidae) en el
Lago Titicaca (Huifiaimarca). Tesis de Licenciatura
en Biologia, Departmento de Biologia, Universidad
Mayor de San Andrés, La Paz, Bolivia. 140 p.
Polis GA. 1981. The evolution and dynamics of
intraspecific predation. Annual Review of Ecology and
Systematics 12(1): 225-251.
Polis GA, Myers CA. 1985. A survey of intraspecific
sympatric
Apogonidae). Journal of
predation among reptiles and amphibians. Journal of
component.
department.
photography.
Amphib. Reptile Conserv.
161
Herpetology 19: 99-107.
Toledo LF, Ribeiro RS, Haddad CFB. 2007. Anurans as
prey: an exploratory analysis and size relationships
between predators and their prey. Journal of Zoology
271(2): 170-177.
West-Eberhard MJ. 1989. Phenotypic plasticity and the
origins of diversity. Annual Review of Ecology and
Systematics 20(1): 249-278.
Wyatt JL, Forys EA. 2004. Conservation implications
of predation by Cuban treefrogs (Osteopilus
septentrionalis) on native hylids in Florida.
Southeastern Naturalist 3(4): 695-700.
Arturo Mujfioz-Saravia received a Licenciature in Biology from the state university of Universidad
Mayor de San Simon, Cochabamba, Bolivia, and a Ph.D. from Ghent University, Belgium, working
on the foraging strategies and nutrition of the Lake Titicaca Frog. Arturo is co-chair of the IUCN SSC
Amphibian Specialist Group Bolivia, and has been working with amphibian research and conservation
since 1998, focusing on High Andean species.
Adriana Aguila-Sainz graduated in Biology from the state university of Universidad Mayor de San
Simon, Cochabamba, Bolivia. She has been working for more than five years in the Natural History
Museum Alcide d’Orbigny (Bolivia) in the herpetological department, mainly in the captive breeding
Ricardo Zurita-Ugarte graduated in Veterinary Sciences from the state university of Universidad Mayor
de San Simon, Cochabamba, Bolivia. He has been working for more than three years in the Natural
History Museum Alcide d’Orbigny (Bolivia) in the captive breeding component of the herpetological
Gabriel Callapa-Escalera received his Licenciature in Biology from the state university of Universidad
Mayor de San Simon, Cochabamba, Bolivia in 2017. He has worked in the Natural History Museum
Alcide d’Orbigny and with Bolivian amphibians for almost ten years on different projects involving
research, education, translocations, and conservation in Bolivia. Gabriel is passionate about nature and
Geert P.J. Janssens is a Professor at the Faculty of Veterinary Medicine at Ghent University in Belgium.
The research of his team aims to unravel nutrient metabolism in animals across the animal kingdom, often
using the principles of comparative nutritional physiology.
October 2020 | Volume 14 | Number 3 | e262
Amphibian & Reptile Conservation
14(3) [General Section]: 162-168 (e263).
Official journal website:
amphibian-reptile-conservation.org
Feeding habits of the threatened aquatic Andean frog
Telmatobius rubigo (Anura: Telmatobiidae)
*Mauricio Sebastian Akmentins and Maria Soledad Gaston
Instituto de Ecorregiones Andinas (INECOA), Universidad Nacional de Jujuy, Consejo Nacional de Investigaciones Cientificas y Técnicas
(CONICET), Canénigo Gorriti 237, Y4600 San Salvador de Jujuy, ARGENTINA
Abstract—The aquatic Andean frogs of the genus Telmatobius have evolved closely with the aquatic
ecosystems of the Andes of South America. The Laguna de Los Pozuelos’ Rusted Frog (Telmatobius rubigo)
is a Threatened and endemic species of the Central Andean Puna ecoregion in Argentina. This species has
a specialized feeding mechanism which relies on the inertial suction of prey, but our knowledge about its
natural history is still incomplete. This study examined the feeding habits of T. rubigo by the stomach flushing
technique. The relevance of the registered prey items was assessed using the dietary importance value
index, and the relationship between frog body size and prey volume was determined. In total, 189 prey items
were identified in 29 stomach content samples, reaching a representative number of diet samples for this
species. Telmatobius rubigo had a fully aquatic diet, with a clear predominance of adult aquatic coleopterans,
immature stages of benthic insects, and crustaceans; and a high incidence of non-nutritive elements (sand
and vegetation debris) was also found in the stomach contents. The results indicate that the species exhibits
generalist feeding habits, and the volume of consumed prey items is positively related to the body size of the
frogs. We suggest that the species develops mainly an active search mode of their benthic prey. This study
represents one of the most complete dietary records for a Telmatobius species, and helps us to understand
the ecology of this species in the extreme desert environment of the high Andes Puna. These results can
contribute to the conservation efforts being made for Telmatobius species.
Keywords. Aquatic prey, diet, Puna, stomach flushing, suction feeding, trophic niche
Citation: Akmentins MS, Gaston MS. 2020. Feeding habits of the threatened aquatic Andean frog Telmatobius rubigo (Anura: Telmatobiidae).
Amphibian & Reptile Conservation 14(3) [General Section]: 162-168 (e263).
Copyright: © 2020 Akmentins and Gaston. This is an open access article distributed under the terms of the Creative Commons Attribution License
[Attribution 4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction
in any medium, provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced,
are as follows: official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 27 September 2020; Published: 1 Novmber 2020
Introduction
Telmatobius is a genus of anuran amphibians that has
closely evolved with the aquatic ecosystems of the Andes
of South America; and unlike other amphibian taxa, these
aquatic Andean frogs are actually more diverse at high
altitudes (Barrionuevo 2017). The aquatic life habit in
such demanding high-altitude environments poses a
series of biological and physiological challenges for
these frogs (Lavilla and De la Riva 2005). In this regard,
there is only fragmentary knowledge about the feeding
habits of the aquatic Andean frogs; and what little is
known is mostly based on occasional observations made
on a limited number of individuals (Garman 1876; Allen
1922: Barrionuevo 2015, 2016; Cuevas and Formas
2002; Formas et al. 1999; Wiens 1993). Few studies have
assessed the trophic ecology of 7e/matobius species with
a representative number of individuals that is sufficient
to show the predominance of invertebrate aquatic prey in
Correspondence. *
[email protected]
Amphib. Reptile Conserv.
their diets (Lavilla 1984; Lobos et al. 2016; Valencia et
al. 1982; Watson et al. 2017).
In Argentina, the species of genus 7e/matobius are
significantly threatened, with the main causes of decline
being habitat alteration, the introduction of exotic
predatory fishes, chytrid fungus infection, and the indirect
consequences of extreme climate events (Barrionuevo
and Mangione 2006; Barrionuevo and Ponssa 2008;
IUCN 2020; Vaira et al. 2012). Despite the increasing
level of concern regarding the conservation of the aquatic
Andean frogs, there is very little information about the
natural history of the 15 species registered in the country
(Duré et al. 2018; Vaira et al. 2012).
The Laguna de Los Pozuelos’ Rusted Frog
(Telmatobius rubigo Barrionuevo and Baldo, 2009) is
the most recently described species of genus 7e/matobius
in Argentina. This species is endemic to the Central
Andean Puna ecoregion of Jujuy province in Argentina,
particularly in the arreic river systems of the Laguna
November 2020 | Volume 14 | Number 3 | e263
Akmentins and Gaston
a i : ;
: " * “S-- ~
Mauricio Sebastian Akmentins.
de Los Pozuelos basin (Barrionuevo and Abdala 2018;
Barrionuevo and Baldo 2009). This fully aquatic frog
has a unique feeding behavior among anurans, using a
specialized feeding mechanism of inertial suction to
capture their prey (Barrionuevo 2016). Beyond this
singular prey capture mechanism, the knowledge about
the trophic ecology of this species remains incomplete.
This study analyzed the feeding habits of the Laguna
de Los Pozuelos’ Rusted Frog in the desert Puna
environment of Jujuy province, Argentina. Due to the
combination of a strictly aquatic life habit and the inertial
suction feeding mechanism, we expected a predominance
of aquatic items in the diet of this species. Determining
the composition of prey can provide valuable biological
information to better understand the ecology of this
threatened aquatic Andean frog.
Materials and Methods
The study was conducted in three localities of occurrence
of Telmatobius rubigo in Jujuy province, Argentina
(Barrionuevo and Abdala 2018): Queta, in the southern
distributional range (22°43’7.88"S, 65°58’19.71°W;
3,548 m asl); Casa Colorada, in the western distributional
range (22°22’8.9"S, 66°13’29.7”°W; 4,333 m asl); and
Santa Catalina, in the northern distributional range,
near the type locality of the species (21°56’58.2”S,
66°02’21.6”W; 3,802 m asl). These localities are in the
Central Andean Puna ecoregion (Dinerstein et al. 1995).
The climate is typical of high-altitude desert, being cold
and dry with large daily thermal fluctuations. Precipitation
events are scarce, occurring as snow and hail in the winter
and rain in summer (Barrionuevo and Baldo 2008).
Amphib. Reptile Conserv.
Fig. 1. Adult male of Telmatobius rubigo in its natural habitat in the locality of Santa Catalina, Jujuy province, Argentina. Photo by
The frogs were located in the rivers through an active
search by visual encounter (Crump and Scott 1994),
during January and March 2020 (Fig. 1). The frogs
were captured manually, and the stomach contents were
obtained in situ by the modified technique of stomach
flushing (Legler and Sullivan 1979; Solé et al. 2005),
which avoids mortality of the frogs. The stomach
contents were individually preserved with 70% ethanol
in 1.5 ml polypropylene tubes for subsequent analysis.
For each frog, the sex was recorded based on secondary
sexual characters, such as nuptial pads and keratinized
spicules on the chest (Barrionuevo and Baldo 2009). The
size of each frog was measured as the Snout-Vent Length
(SVL) with a digital dial caliper to the nearest 0.1 mm
(Mitutoyo Absolute Digimatic, Kawasaki, Japan) and
each frog was weighed with a portable digital scale to the
nearest 0.1 g (OHAUS, Parsippany, New Jersey, USA).
After diet samples and measurements were taken, the
frogs were released at the capture site.
The stomach contents were analyzed under a
stereomicroscope, and prey were identified to the level
of subclass for Annelida, and to the level of order or
family for Arthropoda. For each item (prey category),
the number (N), volume (V), and occurrences (F) were
calculated as both absolute and percentage values. The
volume for intact prey items was estimated according
to the formula used by Dunham (1983) for a prolate
spheroid: V= 4/3 a x (prey length/2) x (prey width/2)?.
The representativeness of the diet sample was
evaluated by constructing a coverage-based (species
richness) rarefaction curve for incidence data (Chao and
Jost 2012), using INEXT package, version 2.0.5 (Chao et
al. 2016) in the program R (R Core Team 2017).
November 2020 | Volume 14 | Number 3 | e263
Feeding habits of Telmatobius rubigo
The dietary importance value index for pooled stomach
samples was calculated to determine the importance of
each prey item according to the formula described by
Biavati et al. (2004): Ip =(N% + V% + F%)/3, where N%
is numeric percentage, V% is volumetric percentage, and
F% is occurrence percentage. Intraspecific differences
in diet composition were explored by calculating the
Ip values for pooled stomach samples classified by sex
(females and males).
The trophic niche breadth, for the species and by sex,
were calculated using Levin’s standardized index (Krebs
1989):
B = aap les}
~ @=D [ary
where n is the total number of prey items, and P. is the
proportion of prey item 7 in the stomach contents. Breadth
niche values range from 0 to 1, and were arbitrarily set
here as high (> 0.6), intermediate (0.4 to 0.6), or low
(<0.4), according to Novakowski et al. (2008).
The degree of diet overlap between females and males
was calculated using the Morisita-Horn Index (Horn
1966):
my 2 Die PiPie
DD Foie a ee or
where n is the total number of prey items, P; is the
proportion of the prey item 7 consumed by females, and
P18 the proportion of the prey item 7 consumed by males.
Values greater than 0.60 were considered to represent a
significant diet overlap (Zaret and Rand 1971).
The biometric measures of females and males were
compared using a two-sample ftest to compare the
SVL (normal distribution), and a Mann—Whitney U-test
to compare weight (non-normal distribution). A linear
regression analysis was used to test the relationship
between the frog size (SVL) and the log-transformed
mean volume of the consumed prey (Hodgkison and
Hero 2003). For all analyses, p < 0.05 was considered to
represent a statistically significant difference.
Results
Thirty-one diet samples were obtained from 12 females,
18 males, and one indeterminate individual. Females had
a body size of 51.9 + 6.5 mm (mean SVL + SD) and
weight of 12.2 + 5.3 g (mean + SD). Males had a body
size of 48.4+ 6.7 mm (mean SVL+ SD) and weighed 10.8
+ 4.4 g (mean + SD). For the individual of undetermined
sex, the SVL was 40 mm and the body mass was 5.8 g.
No significant differences were found between the sexes
in the SVL (t= 1.44; p = 0.16) or the body mass (Mann-
Whitney: U=95; p= 0.539).
A total of 189 prey items were identified in 29 of
the 31 stomach content samples, with a mean number
of prey items per stomach of 6.5 + 6.4 (mean + SD).
Amphib. Reptile Conserv.
1.00
eeccceccceeesesacsasseeseseeeeseee
0.75
Sample coverage
0 10 20 30 40 50 60
Number of stomachs
Fig. 2. Coverage-based rarefaction (solid line) and extrapolation
(dotted line) curves for prey sample completeness (Hill numbers
of order q = 0) of the analyzed stomachs of 7e/matobius rubigo.
The 95% confidence interval boundaries (gray lines) were
calculated based on 200 bootstrap replicates.
The coverage-based rarefaction curve showed that the
sampling effort was appropriate and reached 95.4% of
completeness for prey richness (Fig. 2).
The trophic niche of 7’ rubigo was found to be based
on invertebrates, with prey representing a wide range of
taxa and a greater diversity of insects. The most important
prey were adults of aquatic coleopteran families
Dytiscidae and Elmidae, and the remainder of the diet
was mainly composed of slow-moving benthic prey with
a clear predominance of larvae of Coleoptera and Diptera.
Crustaceans also were a relevant food ttem, dominated
by Hyalella sp. shrimps and diminutive ostracods. The
only relevant allochthonous prey items found in the diet
of T. rubigo were earthworms. Vegetal debris and/or sand
were registered in more than half of the stomach contents
analyzed. Telmatobius rubigo has an intermediate niche
Log,, [prey volume]
35 40 45 50 55 60 65
Snout-vent length (mm)
Fig. 3. Relationship between Snout-Vent Length (SVL) of
Telmatobius rubigo and log-transformed mean volume of the
consumed prey. The white triangle represents the indeterminate
individual, grey squares represent female individuals, and
black circles represent male individuals. The red line represents
the linear fit estimated by the regression analysis considering
all individuals.
November 2020 | Volume 14 | Number 3 | e263
Akmentins and Gaston
Table 1. Summary of the identified prey items, with the absolute values and percentages of number (N), volume (V, in mm*),
frequency of occurrence (F), and dietary importance value index (/p) of the principal prey items consumed by 7e/matobius rubigo.
The development stages of the insect prey items are specified in parentheses. Categories with /p-values above 10% are in bold. In
the last row, Levin’s standardized index of trophic niche breadth 1s given for 7: rubigo.
Prey taxa N(%)
ANNELIDA
Hirudinea L023)
Oligochaeta* 8 (4.2)
ARTHROPODA
Crustacea
Amphipoda 30 (15.9)
Hyalellidae
Ostracoda 20 (10.6)
Isopoda* 6 (3.2)
Hexapoda
Coleoptera (larvae) 25 (13.2)
Elmidae
Dytiscidae
Coleoptera (adult) 45 (23.8)
Elmidae
Dytiscidae
Diptera (larvae) 25°(132)
Chironomidae
Muscidae
Tabanidae
Syrphidae
Diptera (adult) 4 (2.1)
Ephemeroptera (nymph) 9 (4.8)
Hemiptera (adult) 7 (3.7)
Notonectidae
Hymenoptera (adult)* 5 (2.6)
Formicidae
Lepidoptera (larvae)* 1 (0.5)
Odonata (nymph) 2 (1.1)
Odonata (adult)* 1 (0.5)
Vegetal debris**
Sand**
Levin’s standardized index 0.45
V(%) F(%) Ip
10.6 (0.3) 1 (3.4) 1.4
1339.5 (36.7) 4 (13.8) 18.2
265.7 (7.3) 13 (44.8) 22.7
10.9 (0.3) 6 (20.7) 10.5
75.4 (2.1) 1 (3.4) 2.9
157 (4.3) 13 (44.8) 20.8
663.9 (18.2) 15 (51.7) 31.2
44.5 (1.2) 10 (34.5) 16.3
8.5 (0.2) 4 (13.8) 5.4
62.7 (1.7) 6 (20.7) 9.1
118.1 (3.2) 3 (10.3) 5.8
18 (0.5) 5 (17.2) 6.8
147.3 (4.0) 1 (3.4) OMe
617.0 (16.9) 2 (6.9) 8.3
110.4 (3.0) 1 (3.4) 2.3
19 (65.5)
17 (58.6)
*Allochthonous prey items; **only considering the frequency of occurrence in the stomach contents.
breadth, and Table 1 shows a summary of the quantitative
analysis of the diet for the species.
Analyzing the prey consumption data by sex revealed
differences in the prey importance between females and
males, with females showing a wider trophic niche than
males. There was a significant diet overlap among sexes.
Table 2 shows a summary of the quantitative analysis of
diet for each sex. A significant positive relationship (R? =
0.382, p < 0.05) was found between the body size of the
frogs and the log-transformed mean volume of consumed
prey (Fig. 3).
Amphib. Reptile Conserv.
Discussion
The registered prey 1tems in the stomach contents of the
Laguna de Los Pozuelos’ Rusted Frog showed a clear
predominance of small slow-moving and gregarious
benthic prey, confirming the hypothesis of a fully aquatic
diet which coincides with the strictly aquatic life habits
of this species.
As found here in the diet of 7e/matobius rubigo, a
predominance of adult insects also was observed in 7.
hauthali (Lavilla 1984). In addition, several studies have
November 2020 | Volume 14 | Number 3 | e263
Feeding habits of Telmatobius rubigo
Table 2. Dietary importance value index (/p) of the prey items
consumed by females and males of 7elmatobius rubigo. The
development stages of the insect prey item are specified in
parentheses. Categories with /p-values above 10% are in bold.
The two last rows show Levin’s standardized index of trophic
niche breadth for each sex of 7. rubigo, and the Morisita-Horn
index of dietary overlap between the sexes.
Prey taxa Ip females Ip males
Hirudinea — 0.4
Oligochaeta* 3.6 20.6
Amphipoda 16.5 8.2
Ostracoda 7m! Del
Isopoda* — 2.7
Coleoptera (larva) 12.2 LO
Coleoptera (adult) 19.3 12.3
Diptera (larva) 3.6 6.0
Diptera (adult) 10.7 0.3
Ephemeroptera (nymph) 12.2 1.5
Hemiptera (adult) 13.8 —
Hymenoptera (adult)* 10.7 OF
Lepidoptera (larva)* 3.6 ——
Odonata (nymph) 3.6 0.3
Odonata (adult)* -— 1.9
Levin’s standardized index 0.66 0.51
Morisita-Horn index 0.71
*Allochthonous prey items.
shown that the immature stages of benthic insects are the
most common items in the trophic niche of other aquatic
Andean frogs (Lavilla 1984; Lobos et al. 2016; Valencia
1982; Watson et al. 2017). The amphipod shrimps
also are a representative prey in the diet of various
Telmatobius frogs (Allen 1922; Lobos et al. 2016;
Valencia 1982; Watson et al. 2017), and other species of
strictly aquatic anurans of Argentina (Cuello et al. 2006;
Velasco et al. 2019). The presence of allochthonous prey,
such as earthworms, indicates that they were most likely
consumed underwater when they accidentally fell from
the riverbanks.
The common presence of non-nutritive elements,
mainly vegetal debris and sand, in the stomachs of 7.
rubigo 1s evidence of the strategy of foraging in the
benthos of rivers and is related to the suction force of
the feeding mechanism used by these frogs for capturing
their prey (Barrionuevo 2016). A similar high incidence
of non-nutritive items in the stomach contents was
also reported in Chilean species of the Ye/matobius
marmoratus group (Valencia 1982), suggesting a shared
foraging tactic in this species group (Barrionuevo 2017).
Overall, these results show that 7 rubigo exhibits
generalist and opportunistic feeding habits, as has been
noted in other species of 7elmatobius (Lavilla 1984;
Valencia 1982). We suggest that 7 rubigo performs a
mainly active search of their prey. Despite the differences
in the importance of consumed prey and the width of the
Amphib. Reptile Conserv.
trophic niche between females and males of 7: rubigo,
we suggest there is no trophic niche segregation due to
the absence of sexual dimorphism in biometric measures
and the high diet overlap between the sexes.
Telmatobius rubigo was found in high densities in
some parts of the surveyed river systems, occurring in
sympatry with two other anuran species, Pleurodema
cinereum and Rhinella spinulosa. We did not register any
cases of cannibalism or anurophagy in 7: rubigo, as has
been reported in some other 7e/matobius species (Allen
1922: Barrionuevo 2015; Valencia et al. 1982; Wiens
1993). The insight of trophic niche segregation in 7.
rubigo indicated here, due to the relationship between the
mean volume of consumed prey with the frog size, may
be a mechanism to avoid competition and cannibalism.
However, a more in-depth analysis including seasonal
changes in the diet and prey availability/prey selection
will be necessary to fully understand the trophic ecology
of Laguna de Los Pozuelos’ Rusted Frog.
Conclusions
The results of this study have direct contributions for
understanding the ecology of Laguna de Los Pozuelos’
Rusted Frog (7e/matobius rubigo), as well as for its
conservation. 7elmatobius rubigo is threatened by direct
and indirect consequences of human activities (IUCN
2020; Vaira et al. 2012). Among the direct threats that
we observed during our fieldwork are the poor water
management for human and animal consumption, the
introduction of exotic predatory fishes (salmonids),
inappropriate management of solid waste, liquid effluents
from human settlements, and mining leachate pollution.
All these threats affect not only the aquatic Andean frogs
but also the populations of their aquatic invertebrate prey
(Valdovinos et al. 2007; Van Damme et al. 2008; Vimos
et al. 2015).
As far as we know, this study represents one of the
most complete dietary records for an aquatic Andean
frog of the genus 7e/matobius, due to the numbers of
surveyed localities and sampled individuals. The results
obtained in this study can be used as a guide for the ex
situ conservation efforts being made for 7e/matobius
species, particularly for improving the food provided to
these frogs in captive breeding programs.
Acknowledgments.—We thank Laura C. Pereyra for
helping with the statistical analyses of data. This research was
partially supported by PUE INECOA 22920170100027CO.
Permits for fieldwork were provided by Ministerio de
Ambiente, Direccion Provincial de Biodiversidad de Jujuy,
Argentina (171/2015 DPB).
Literature Cited
Allen WR. 1922. Notes on the Andean frog, 7e/matobius
culeus (Garman). Copeia 108: 52-54.
November 2020 | Volume 14 | Number 3 | e263
Akmentins and Gaston
Barrionuevo JS. 2015. Telmatobius atacamensis.
Cannibalism. Herpetological Review 46(3): 420-421.
Barrionuevo JS. 2016. Independent evolution of suction
feeding in Neobatrachia: feeding mechanisms in two
species of 7elmatobius (Anura: Telmatobiidae). The
Anatomical Record 299: 181-196.
Barrionuevo JS. 2017. Frogs at the summits: phylogeny
of the Andean frogs of the genus 7e/matobius (Anura,
Telmatobiidae) based on phenotypic characters.
Cladistics 33(1): 41-68.
Barrionuevo JS, Abdala CS. 2018. Herpetofauna de
la Puna Argentina: una sintesis. Pp. 209-228 In:
La Puna Argentina: Naturaleza y Cultura. Serie
Conservacion de la Naturaleza 24. Editors, Grau HR,
Babot MJ, Izquierdo AE, Grau A. Fundacion Miguel
Lillo, Tucuman, Argentina. 499 p.
Barrionuevo JS, Baldo D. 2009. A new species of
Telmatobius (Anura, Ceratophryidae) from northern
Jujuy Province, Argentina. Zootaxa 2030: 1-20.
Barrionuevo JS, Mangione S. 2006. Chytridiomycosis in
two species of 7e/matobius (Anura; Leptodactylidae)
from Argentina. Diseases of Aquatic Organisms 73:
171-174.
Barrionuevo JS, Ponssa ML. 2008. Decline of
three species of the genus 7e/matobius (Anura:
Leptodactylidae) from Tucuman Province, Argentina.
Herpetologica 64(1): 47-62.
Biavati GM, Wiederhecker HC, Colli GR. 2004. Diet of
Epipedobates flavopictus (Anura: Dendrobatidae) in a
Neotropical savanna. Journal of Herpetology 38(4):
510-518.
Chao A, Jost L. 2012. Coverage based rarefaction and
extrapolation: standardizing samples by completeness
rather than size. Ecology 93(12): 2,533—2,547.
Chao A, Ma KH, Hsieh TC. 2016. INEXT (iNterpolation
and EXTrapolation) online: software for interpolation
and extrapolation of species diversity. Program and
user’s guide. Available: http://chao.stat.nthu.edu.tw/
wordpress/software_ download [Accessed: 9 June
2020].
Crump ML, Scott NJ. 1994. Standard techniques for
inventory and monitoring. Pp. 76-141 In: Measuring
and Monitoring Biological Diversity: Standard
Methods for Amphibians. Editors, Heyer WR,
Donnelly MA, McDiarmid RW, Hayek LC, Foster
MS. Smithsonian Institution Press, Washington, DC,
USA. 364 p.
Cuello ME, Bello MT, Kun M, Ubeda CA. 2006. Feeding
habits and their implications for the conservation
of the Endangered semiaquatic frog, Atelognathus
patagonicus (Anura, Neobatrachia) in a northwestern
Patagonian pond. Phyllomedusa 5(1): 67-76.
Cuevas CC, Formas JR. 2002. Te/matobius philippii, una
nueva especie de rana acuatica de Ollagtie, norte de
Chile (Leptodactylidae). Revista Chilena de Historia
Natural 75: 245-258.
Dinerstein E, Olson DM, Graham DJ, Webster AL, Primm
Amphib. Reptile Conserv.
SA, Bookbinder M, Ledec G. 1995. Una Evaluacién
del Estado de las Eco-regiones Terrestres de América
Latina y el Caribe. Banco Mundial, Washington, DC,
USA. 135 p.
Dunhan AE. 1983. Realized niche overlap, resource
abundance, and intensity of interspecific competition.
Pp. 261-280 In: Lizard Ecology: Studies of a
Model Organism. Editors, Huey RB, Pianka ER,
Schoener TW. Harvard University Press, Cambridge,
Massachusetts, USA. 507 p.
Duré M, Ubeda C, Kacoliris FP, Schaefer E, Pereyra
LC, Acosta JC, Martinez TA, Rodriguez Mufioz MJ,
Akmentins MS, etal. 2018. Componente 4. Evaluacion
y categorizacion del estado de conservacion. Pp. 15—
19 In: Plan de Accion para la Conservacion de los
Anfibios de la Republica Argentina. Cuadernos de
Herpetologia, Volume 32, Supplemento 1. Editors,
Vaira M, Akmentins MS, Lavilla EO. Asociacion
Herpetologica Argentina, Jujuy, Argentina. 56 p.
Formas JR, Northland I, Capetillo J, Nufiez JJ, Cuevas
CC, Brieva LM. 1999. Telmatobius dankoi, una
nueva especie de rana acuatica del norte de Chile
(Leptodactylidae). Revista Chilena de_ Historia
Natural 72: 427-445.
Garman S. 1876. Exploration of Lake Titicaca. I. Fishes
and reptiles. Bulletin of the Museum of Comparative
Zoology 3(11): 273-278.
Hodgkison S, Hero JM. 2003. Seasonal, sexual, and
ontogenetic variations in the diet of the “declining”
frogs Litoria nannotis, Litoria rheocola, and
Nyctimystes dayi. Wildlife Research 30(4): 345-354.
Horn HS. 1966. Measurement of “overlap” in
comparative ecological studies. The American
Naturalist 100(914): 419-424.
IUCN. 2020. The IUCN Red List of Threatened
Species. Version 2020-1. IUCN, Gland, Switzerland.
Available: https://www.iucnredlist.org [Accessed: 15
June 2020].
Krebs CJ. 1989. Ecological Methodology. Harper and
Row, New York, New York, USA. 654 p.
Lavilla EO. 1984. Redescubrimiento de 7e/matobius
hauthali Koslowsky, 1985, y descripcion de su larva.
Acta Zoologica Lilloana 38(1): 51-57.
Lavilla EO, De la Riva I. 2005. Estudios sobre las ranas
andinas de los géneros 7elmatobius y Batrachophrynus
(Anura: Leptodactylidae). Monografias de Herpetologia
7: 65-101.
Legler JM, Sullivan LJ. 1979. The application of stomach-
flushing to lizards and anurans. Herpetologica 35(2):
107-110.
Lobos G, Rebolledo N, Charrier A, Rojas O. 2016.
Natural history notes of Ze/matobius dankoi (Anura,
Telmatobiidae), a Critically Endangered species from
northern Chile. Studies on Neotropical Fauna and
Environment 51: 152-157.
Novakowski GC, Hahn NS, FugiR. 2008. Diet seasonality
and food overlap of the fish assemblage in a pantanal
November 2020 | Volume 14 | Number 3 | e263
Feeding habits of Telmatobius rubigo
pond. Neotropical Ichthyology 6(4): 567-576.
R Core Team. 2017. R: a language and environment for
statistical computing. R Foundation for Statistical
Computing, Vienna, Austria. Available: https://
www.R-project.org/ [Accessed: 5 June 2020].
Solé M, Beckmann O, Pelz B, Kwet A, Engels W.
2005. Stomach-flushing for diet analysis in anurans:
an improved protocol evaluated in a case study
in Araucaria forests, southern Brazil. Studies on
Neotropical Fauna and Environment 40(1): 23-28.
Vaira M, Akmentins M, Attademo M, Baldo D, Barrasso
D, Barrionuevo S, Basso N, Blotto B, Cairo S,
Cajade R, et al. 2012. Categorizacién del estado
de conservacion de los anfibios de La Republica
Argentina. Cuadernos de Herpetologia 26(Suppl 1):
131-159.
Valdovinos C, Moya C, Olmos V, Parra O, Karrasch
B, Buettner O. 2007. The importance of water-level
fluctuation for the conservation of shallow water
benthic macroinvertebrates: an example in_ the
Andean zone of Chile. Biodiversity and Conservation
16: 3,095-3,109.
Valencia J, Veloso A, Sallaberry M. 1982. Nicho trofico
de las especies de los herpetozoos del transecto
Arica-Chungara. Pp. 269-289 In: La Vegetacion y
Amphib. Reptile Conserv.
Vertebrados Ectotérmicos del Transecto Arica- Lago
Chungara. Volume I. Editors, Veloso A, Bustos E.
ROSTLAC, Montevideo, Uruguay. 327 p.
Van Damme PA, Hamel C, Ayala A, Bervoets L. 2008.
Macroinvertebrate community response to acid
mine drainage in rivers of the High Andes (Bolivia).
Environmental Pollution 156(3): 1,061—1,068.
Velasco MA, Akmentins MS, Kass CA, Kacoliris FP.
2019. Diet of Critically Endangered Valcheta Frog,
Pleurodema somuncurense (Anura: Leptodactylidae),
in the Somuncura Plateau, Patagonia, Argentina.
North-western Journal of Zoology 15(2): 147-151.
Vimos DJ, Encalada AC, Rios-Touma B, Suarez E, Prat N.
2015. Effects of exotic trout on benthic communities
in high-Andean tropical streams. Freshwater Science
34(2): 770-783.
Watson AS, Fitzgerald AL, Baldeon OJD. 2017. Diet
composition and prey selection of Zelmatobius
macrostomus, the Junin Giant Frog. Endangered
Species Research 32: 117-121.
Wiens JJ. 1993. Systematics of the leptodactylid frog
genus Jelmatobius in the Andes of northern Peru.
Occasional Papers of the Museum of Natural History,
the University of Kansas 162: 1—76.
Zaret TM, Rand AS. 1971. Competition in tropical
stream fishes: support for the competitive exclusion
principle. Ecology 52(2): 336-342.
Mauricio Sebasti4n Akmentins is an Assistant Researcher at the Consejo Nacional de
Investigaciones Cientificas y Tecnicas (CONICET) of Argentina. Mauricio received a Doctorate
degree in Biological Sciences from the Universidad Nacional de Cordoba (Argentina). His main
areas of interest are in the bioacoustics, ecology, and conservation of anuran amphibians of the
Andean ecoregions of northwestern Argentina.
Maria Soledad Gaston is an Assistant Researcher at the Consejo Nacional de Investigaciones
Cientificas y Tecnicas (CONICET) of Argentina. Maria received a Doctorate degree in Biological
Sciences from the Universidad Nacional de Cordoba (Argentina). Her main areas of interest are
the ecophysiology, behavior, and conservation of amphibians.
November 2020 | Volume 14 | Number 3 | e263
Official journal website:
amphibian-reptile-conservation.org
Amphibian & Reptile Conservation
14(3) [Taxonomy Section]: 169-176 (e264).
urn:lsid:zoobank.org:pub:6CC8A3EA-F9AE-4057-BD4F-E4975CAC50DA
A new species of green pit viper of the genus Trimeresurus
Lacepede, 1804 (Reptilia: Serpentes: Viperidae) from the
Nicobar Archipelago, Indian Ocean
1S.R. Chandramouli, Patrick D. Campbell, and **Gernot Vogel
'Department of Ecology and Environmental Sciences, School of Life Sciences, Pondicherry University, Puducherry - 605014, INDIA *Department
of Life Sciences, Darwin Centre, Natural History Museum, Cromwell Road, South Kensington, London SW7 5BD, England, UNITED KINGDOM
*Society for South East Asian Herpetology, Im Sand-3, Heidelberg, GERMANY
Abstract.—A new species of green pit viper of the genus Trimeresurus, in the T. albolabris complex, is described
from Car Nicobar Island of the Nicobar Archipelago, Indian Ocean. The new species, Trimeresurus davidi sp.
nov., can be distinguished from all other members of this group by the following characteristics: medium to
large body size (277-835 mm SVL); dorsal scales in a series of 21—25:21—23:15—17 rows; nasal partly fused with
the first supralabial; 166-179 ventrals, 58-70 subcaudals; one preocular; 2—3 postoculars; 10—12 supralabials;
12-15 infralabials; two internasals usually in contact with each other; 11-14 cephalic scales; verdant green
dorsal and ventral color, absence of white ventrolateral stripes along the sides of the body; males with a white
supralabial streak, bordered by a reddish tinge above; a pair of white and red stripes along the sides of the
tail in both sexes; a reddish brown colored tail and a greenish iris. The new species is endemic to Car Nicobar
Island of the Nicobar Archipelago, and should be regarded as an Endangered species owing to its restricted
distribution range.
Keywords. Endangered, endemic species, Nicobar Islands, Reptilia, Squamata, Trimeresurus albolabris complex
Citation: Chandramouli SR, Campbell PD, Vogel G. 2020. A new species of green pit viper of the genus 7rimeresurus Lacépéde, 1804 (Reptilia:
Serpentes: Viperidae) from the Nicobar Archipelago, Indian Ocean. Amphibian & Reptile Conservation 14(3) [Taxonomy Section]: 169-176 (e264).
Copyright: © 2020 Chandramouli et al. This is an open access article distributed under the terms of the Creative Commons Attribution License
[Attribution 4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction
in any medium, provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced,
are as follows: official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 14 October 2020; Published: 1 November 2020
Introduction
Asian pit vipers of the genus 7rimeresurus Lacépede,
1804 are currently represented by 50 species ranging
from the Western Ghats of peninsular India in the west
to the Lesser Sunda Islands in the east (Uetz et al.
2020; Vogel 2008). Among these species, the white-
lipped green pit vipers include five species in the 7.
albolabris complex, which constitute nearly 10% of the
diversity, and their collective geographic distribution
ranges from the Western Himalayan Mountains (for 7.
septentrionalis, Kramer 1977) in the west to the Lesser
Sunda Islands (for 7) insularis, Kramer 1977) in the
east (Vogel 2008; Kramer 1977; Mirza et al. 2020;
Chen et al. 2020; Uetz et al. 2020). The white-lipped
pit vipers are currently classified under the subgenus
Trimeresurus under the genus 7rimeresurus (David et
al. 2011). Two new members, namely 7. salazar Mirza,
Bhosale, Phansalkar, Sawant, Gowande, Patel, 2020 and
T! caudornatus Chen, Yu, Vogel, Shi, Song, Tang, Yang,
Correspondence. *Gernot.
[email protected]
Amphib. Reptile Conserv.
Ding, Chen, 2020, have recently been added to this group
(Mirza et al. 2020; Chen et al. 2020). One member of this
species complex, traditionally identified as Trimeresurus
albolabris Gray, 1842 (Smith 1943; Vijayakumar and
David 2006), has been reported from Car Nicobar
Island of the Nicobar Archipelago in the past (Smith
1943; Vijayakumar and David 2006; Vogel et al. 2014).
Herein, we reassess the systematic status of this insular
population of Trimeresurus and provide evidence for
its specific distinction from 7! albolabris sensu stricto,
thereby describing it as a species new to science.
Materials and Methods
Pit vipers of the genus 7rimeresurus encountered in the
field (on Car Nicobar) were carefully restrained, measured,
and scored for morphological characters, followed by their
release back into their native habitat. One dead specimen
from Chuckchucka Village (9.2179°N, 92.8003°E, 6 m asl),
Car Nicobar, was collected and deposited in the collection
November 2020 | Volume 14 | Number 3 | e264
A new species of 7rimeresurus from Nicobar Archipelago
L
\ \\i MMA \ \ \ NW
a)
Fig. 1. Holotype (BNHS 3304) of Trimeresurus davidi sp. nov. Photo by Rahul Khot.
of the Department of Ocean Studies and Marine Biology,
Pondicherry University (DOSMB), Port Blair, India. Six
specimens of this species available in the collections of the
Natural History Museum, London (NHMUK), which were
collected during Lord Moyne’s expedition to the Nicobar
Islands (Smith 1943), were examined for comparison.
One additional specimen deposited in the collections of
the Bombay Natural History Society (BNHS) was studied
and ascribed to this species.
The following characters were recorded: snout-
vent length (SVL); tail length (TaL); total length (TL;
SVL+TaL); head length, measured from the snout tip to
the jaw angle (HL); head width at the level of the eyes
(HW); maximum head depth (HD); horizontal diameter of
the eye (ED); eye-nostril distance (EN); snout length, from
anterior margin of the eye to snout tip (ES); inter-orbital
distance, measured dorsally as the distance between the
eyes (IO); inter-narial distance, measured as the distance
between the nares (IN); dorsal scale-rows near neck, at
midbody and near tail (DSR); number of cephalic scales,
counted in a horizontal series between the elongated
supraoculars (CEP); and ventrals, counted following
Dowling (1951). The sex of the specimens was determined
by examination for presence or absence of hemipenis by
palpating the tail, coupled with the relative tail length,
expressed as the ratio of tail length to the total length of the
snake (TaL/TL). Individuals with incomplete/regenerated
tails (bold values in Table 2) are excluded from the relative
tail length range. Geographic coordinates of the localities
of the specimen occurrences were recorded with a Garmin
GPSMAP 78s and mapped with ARC MAP vy. 10.
Amphib. Reptile Conserv.
Museum acronyms for comparative specimens
examined (Appendix 1) are as follows: NHMUK: Natural
History Museum [formerly the British Museum (Natural
History)], London, United Kingdom; CAS: California
Academy of Sciences, San Francisco, California, USA:
CIB: Chengdu Institute of Biology, Chengdu, People’s
Republic of Chinas MHNG: Muséum _ d'Histoire
Naturelle, Ville de Geneve, Switzerland; MNHN:
Muséum National d’Histoire Naturelle, Paris, France;
NMW: Naturhistorisches Museum Wien, Austria;
RMNH: Nationaal Natuurhistorisch Museum (Naturalis),
Leyden, The Netherlands; NHMB: Naturhistorisches
Museum Basel, Switzerland; SMF: Natur-Museum und
Forschungs-Institut Senckenberg, Frankfurt-am-Main,
Germany; ZMB: Zoologisches Museum fiir Naturkunde
der Humboldt-Universitaét zu Berlin, Berlin, Germany;
ZMH: Zoologisches Museum Hamburg [formerly
Zoologisches Institut und Museum], Universitat
Hamburg, Hamburg, Germany; ZSI: Zoological Survey
of India, Kolkata [Calcutta], India.
Systematics
Trimeresurus davidi sp. nov. (Figs. 1—2)
urn:Isid:zoobank.org:act:9A2A4D25-071E-4C1C-91B0-28E3F61F020B
Trimeresurus albolabris — Vijayakumar and David
(2006).
Trimeresurus albolabris — Smith (1943) part, Vogel
(2008) part, Vogel et al. (2014) part.
November 2020 | Volume 14 | Number 3 | e264
Chandramouli et al.
‘é
Fig. 2. Trimeresurus davidi sp. nov. in life from Car Nicobar
(top and middle: males, bottom: female).
Holotype. BNHS 3304, an adult female from
Chuckchucka Village (9.2161°N, 92.8109°E, 14 m asl),
Car Nicobar, collected by a group of Nicobari men (fide
Viyayakumar and David 2006).
Paratypes. DOSMB 05104, an adult male from
Chuckchucka Village, Car Nicobar; NHMUK 1936.7.7.40,
NHMUK_ 1936.7.7.41, NHMUK_ 1936.7.7.42, (three
adult females from ‘Car Nicobar, Nicobar Is.’), NHMUK
1936.7.7.46 an unsexed adult from “Car Nicobar, Nicobar
Is... NHMUK_ 1936.7.7.47 and NHMUK 1936.7.7.48
(two adult males from ‘Nicobar Is.’ and ‘Andaman Is.’
[doubtful], respectively), collected during Lord Moyne’s
expedition to the Nicobar Islands.
Etymology. The specific epithet is a patronym, named
in genitive singular case, honoring Patrick David, an
eminent reptile taxonomist for his immense contribution
to the systematics of Asian pit vipers and, in particular, to
the Nicobar snake fauna.
Diagnosis. 7rimeresurus davidi sp. nov. is an arboreal
member of the genus 7rimeresurus restricted to the Car
Nicobar Island of the Nicobar archipelago, characterized
by: medium to large sized body (277-835 mm SVL);
dorsal scales ina series of 21—25:21—23:15—17 rows; nasal
partly fused with the first supralabial; 166-179 ventrals;
46-70 subcaudals; one preocular; 2-3 postoculars;
Amphib. Reptile Conserv.
10-12 supralabials; 12-15 infralabials; two internasals
usually in contact with each other; 11—14 cephalic scales;
relative tail length (TaL/TL) ranging from 0.143-0.20;
dorsal and ventral verdant green in color, lacking white
ventrolateral stripes; males with a white supralabial
streak, bordered by a reddish tinge above; a pair of white
and red stripes along the sides of the tail in both males
and females; a reddish brown colored tail and a greenish
iris; hemipenis reaching the 13" caudal plate.
Description of the holotype. BNHS 3304, an adult
female, in a fairly good state of preservation. Head
large (HL/SVL 0.05), longer than broad (HL/HW 1.41);
triangular in shape and fairly distinct from a slender neck.
Nostrils situated more towards the snout tip than the eyes
(EN/ES 0.87). Eyes relatively small and oval (ED/HL
0.2), with a vertically elliptical pupil. Dorsal and lateral
head scales smooth and imbricate. Rostral barely visible
from above; followed by two large intranasals not in
contact with each other. Fourteen cephalic scales in a line
between the two elongated supraoculars. Nasal partially
fused with the 1* supralabial; 12/12 supralabials; 3"
largest; 14/14 infralabials, of which, the first three contact
the anterior chin shields. Loreal pit large and triangular.
Two small postoculars; one preocular and crescent shaped
subocular scales on either side of the head. Dorsal scales
in 23:23:15 rows; with very feeble median longitudinal
keels. Ventrals 173; broad and extending throughout the
width of the belly; anal single; subcaudals 61; divided.
Temporal scales small and smooth. Tail relatively short
(TaL/TL 0.146) and prehensile.
Overall dorsal coloration dark grey in preservation,
with a pale grey venter. Ventral surface of the tail lighter in
color, bearing two incomplete white lateral stripes along
the sides. Dorsal surface of the tail is a different color
than the body, and of a lighter shade when compared to
the body. Ventrolateral stripes absent on the body; white
ventrolateral stripes present along the sides of the tail
extending from the vent to the 13" subcaudal.
Variation. Measurements and scale counts of the
paratypes and referred material are given in Table 1.
Mid-body scale rows range from 21—25:21—23:15-17;
ventrals range from 170-179 in males and 166—178 in
females. Subcaudals range from 67—70 in males and 55—
64 in females. Internasals usually in contact with each
other, but separated by a small scale in one specimen.
Cephalic scales range from 11-14; postoculars range
from 2-3. Relative tail length in males: 0.178—0.200;
in females: 0.143-0.161. Sexual dimorphism apparent
in body for the tail dimensions and the number of
subcaudals. Verdant green colored in life, both dorsally
and ventrally, without a white ventrolateral pair of stripes
along the sides of the body; but with a pair of white and
red lateral stripes along the sides of the tail. Males have
a thin white labial stripe bordered by red above the
supralabials on either side of the head (absent in females)
November 2020 | Volume 14 | Number 3 | e264
A new species of 7rimeresurus from Nicobar Archipelago
2 70°0'0"E 80°0'0"E 90°0'0"E 100°0'0"E 110°0'0"E 120°0'0"E z=
S ; S
% @ 3
T. septentrionalis
= =
=) =)
= | a
oOo o
N N
Z Zz
= t a
2 : =
° s Car Nicobar | °
T. davidi sp. nov. ;
S 18
oO} a)
ro) 410
. A a, \
.
~ i ‘ * : . ‘ ) : ‘,
elas es a
el
w I T T T T T ] ss © Gt: Qew wo
©} 0 250 500 1,000 Kilometers “e& we o
oOo 4 * =
=) fee a =)
“ — 70°0'0"E 80°0'0"E 90°0'0"E 100°0'0"E 110°0'0"E 120°0'0"E “i
Fig. 3. Distribution of members of the 7rimeresurus albolabris complex showing the type locality and distribution of 7. davidi sp. nov.
and a white stripe bordered by red along the subcaudals
from the vent until about half the length of the tail (also
present in females).
Natural history and distribution (Fig. 3). Five
individuals of 7. davidi sp. nov. were encountered during
this study. They were always observed as active and
foraging during the night (2100 h and later) and were
never encountered during the day. Individuals were seen
on shrubs at heights ranging from 1.20 m (n= 2) to about
8 m (n = 1) above the ground; also seen on the rocky
walls of old buildings (7 = 1). One was found dead in a
coconut plantation, presumably killed by someone. The
large (~120 cm) female individual observed on the top
of a tree at a height of about 8 m had a swollen anterior
belly, indicating that it had fed recently. Lizards of the
genera Coryphophylax, Bronchocela, Cyrtodactylus, and
Gehyra were observed at close quarters (~2 m) from the
point where the snakes were sighted. Other relatively
small-bodied, endemic species of snakes, namely 7
labialis (Fitzinger in: Steindachner, 1867) and Lycodon
tiwarii Biswas and Sanyal, 1965, were observed to be
sympatric with 7: davidi sp. nov. and could be potential
competitors as they are also nocturnal snakes feeding on
prey species similar to 7° davidi sp. nov.
Comparison. 7rimeresurus davidi sp. nov. does not
have any superficially similar looking, green-colored
arboreal congeners on Car Nicobar Island, on which its
Amphib. Reptile Conserv.
distribution is restricted. It can be distinguished from
other members of the 7? albolabris complex by the
following combination of characters: dorsal scales of
1. davidi sp. nov. in 21—25:21—23:15—17 rows (vs. 21—
23:19-21:15 in Tf. albolabris and T: insularis, 21:21:15
in 7! caudornatus, 21:19:17 in T: septentrionalis, and
21:19:15 in T salazar). There is some overlap in this
character, as 1s expected; however, five of the 11 (45%)
examined T° davidi specimens had 23 dorsal scale rows
at midbody. This character has never been recorded in
any of the other species within this complex. Also, there
seems to be a certain degree of overlap in scalation
characters between the currently recognized members
of 7. albolabris complex, which makes the partially
overlapping values with 7 davidi sp. nov. quite
understandable. 7rimeresurus davidi sp. nov. has 166—
179 ventrals (vs. 149-173 in 7: albolabris, 161—163 in
T. caudornatus, 160-181 in T: septentrionalis, 156—167
in 7. insularis, and 163-171 in T: salazar); an absence
of white ventrolateral stripes along the body in 7: davidi
sp. nov. (vs. present in 7! septentrionalis and T. salazar),
and the presence of a pair of red and white ventrolateral
stripes along the sides of the tail (vs. absent in all other
species). 7rimeresurus davidi sp. nov. is considerably
larger than all other species of this complex. For further
comparisons, see also the morphological characters
(Table 2) for the material examined (Appendix 1) in
this study.
From the two other sympatric congeners, 7’ andersoni
172 November 2020 | Volume 14 | Number 3 | e264
Chandramouli et al.
IT
19B]U0D
@
I
I
4
891
91:CC:CT
poseurep/AIp
I
ef
+01
SLE
oo L
8E¢
9EX
€8C
v8 L
L8 01
vy OC
L¢El'0
6S
CLE
umouyun
< SJ JEQOSIN,
or LL9¢el
MOQINHN
‘Pog Ul UMOYS are [Ie] aJo;duOdUT/paye1oUdsoI & YJIM STENPIAIPUI JO} syUsWOINseay ‘(adAjO[oOY soyeorpul ,.) ‘AOU “ds IpiAvp sNAnsasauUIAT JO Sisopljoyd pue (WI UT) SJUdWIAINSRO|| *[ IQUL
cl
19e]U09
G
I
I
89
OLI
SI-1C- 17
Sc
S|] uewepuy,
8r'° LL 9¢ol
MOINHN
IT
1Oe]UOD
©
I
I
OL
CLI
SI-1C-VC
cl
Ol
Sate
68 OL
ce9
IV
SCe
€8°8
8 El
v9 IC
0610
66
ICV
W
< ST JeEQOoIN,
LVL L9¢el
MQINHN
Cl
19e]U0D
C
I
I
89
Sil
ST-1C-1C
el
Ol
9T E
618
vy v
(oe 9
61 €
9E°S
ce Ol
OVI
8Z1 0
09
LLG
W
eyonyoyonyg eyonyoyonyo
P2}99]109 JON
Cl
1OR]UOD
c
I
I
L9
6LI
CL-€T-ST
Ol
CoS
9S'€
v8 °C
862
91 €l
VSI
S810
OL
VEE
W
vOTSO
aINSOd
IT
1ORIUOD
C
I
I
gs
8Zl
CL-€T-€7
EOL
eyonypyonya
|
yOR]UOD
C
I
I
£9
891
LI-I7:17
eyonyoyony)
Cl
19e]UOD
C
I
I
v9
991
LI-€T-ST
688
IeqooiN ead
P2}99T109 JON PPPIITFOIJON CH'L'L'9EGT
MOAINHN
IT
19e]U0D
C
I
I
8S
OLI
91-€T:ST
Ss Il
ve el
60 6
IeqooiN Ie9d
IV'L'L9¢6l
SMIAINHN
IT
19B]U0D
C
I
I
8S
ELI
CL-1T-€7
6l II
JeqooIN Jeg = Byonyoyonya
Or'LL9¢el
MOINHN
vl
poyeredas
C
I
I
19
ELI
C1-€C-€C
ecV
»VOESESHNA
soreydag
sTeseuso}Uy
jeseuloyuy
Jepnoo0qns
jeuy
sjepnesqns
sTeUsA,
SMOI
g]eos [esioqd
sie[nd0}sog
sIe[nd0dI1g
syeiqeyelyuy
sjeiqeyeidns
Q0UvISIP
[eleuraqU]
90Ub}SIP
[eyqso19quy
ynous-oAq
[lsou-oAq
JQOWIRIp Aq
ydop peoH
IpIM peo
Y}sud] peop
TL/TeL
yysugy [BL
TAS
xasg
AV[eo0'T
Jaquinu
IIYINOA
November 2020 | Volume 14 | Number 3 | e264
173
Amphib. Reptile Conserv.
A new species of 7rimeresurus from Nicobar Archipelago
Table 2. Comparison of morphological characters within the 7rimeresurus albolabris group, adapted from Chen et al. (2020), Mirza
et al. (2020), and Grismer et al. (2008) in addition to the specimens examined during this study, the numbers of which are given
under each species name.
Character T. davidi sp.nov. _‘T. albolabris
n=11 n= 46
Mid-body scale rows 21-23 19-21
Ventrals 166-179 149-173
Subcaudals 58-70 48-67
SVL 277-835 297-668
TaL 60-160 31-146
TaL/TL 0.14—0.20 0.19-0.24
Ventrolateral body stripes absent present/absent
Ventrolateral tail stripes present absent
Theobald, 1868 and 7° /abialis Fitzinger in: Steindachner,
1867, T: davidi sp. nov. can be distinguished by its verdant
green dorsal coloration (vs. predominantly brown in both
1! andersoni and T: labialis); midbody dorsal scales in
21-23 rows (vs. 23-25 in T. andersoni, 23 in T: labialis),
and the first supralabial united with the nasal in 7: davidi
sp. nov. (vs. separate in 7? labialis).
Additionally, from the green color morph of
Trimeresurus cantori (Blyth 1846) which occurs on
islands of the central group of the Nicobar archipelago,
T: davidi sp. nov. can be distinguished by a lower number
of mid-body scale rows (21—23 in 7: davidi sp. nov. vs.
25-29 in 7! cantori); and the absence of a pair of white
ventro-lateral stripes along the sides of the body in 7
davidi sp. nov. (vs. present in 7? cantori) [Whitaker and
Captain 2008].
Discussion
Among the members of the genus 7rimeresurus, T:
albolabris has been and continues to be shown as
comprising multiple cryptic lineages across its known
distribution range in various parts of Southeast Asia
(Kramer 1977; Zhu et al. 2016; Chen et al. 2020; Mirza et
al. 2020). Currently, this complex comprises five species
spanning a distribution across the Western Himalayan
Nepal in the west to the Lesser Sunda Islands in the
east. Herein, 7’ davidi sp. nov. has been added as a sixth
member, occurring towards the southwestern extremity
of the distribution range of the 7? albolabris complex.
This population has been known since Smith (1943:
524) mentioned six Nicobarese specimens, three males
and three females, collected by Lord Moyne from Car
Nicobar. He also remarked that these specimens lack
the light flank stripe on the body, but have an unusually
distinct one along the sides of the tail. The specimens
described here from Car Nicobar also show this unique
ventrolateral tail stripe.
Car Nicobar Island, to which 7: davidi sp. nov. is
restricted, is a small island of about 125 km?. With a nearly
flat terrain and a maximum elevation of about 90 m asl, it
is fairly densely populated. However, Car Nicobar does
Amphib. Reptile Conserv.
174
T. insularis T. salazar_ T. septentrionalis T. caudornatus
n=7 n=6 n=18 n=2
19-21 19-21 19-21 21
156-168 163-171 160-181 161-163
54-75 59-74 55-83 52-72
418-613 363-415 454-675 425-537
115 60-94 104-197 77-122
0.21-0.35 0.14-0.18 0.19-0.24 0.15-0.19
absent present present absent
absent absent absent absent
not have any protected areas such as national parks or
wildlife sanctuaries and hence, a species such as 7? davidi
sp. nov. which is restricted only to this island is under a
high level of threat. Unfortunately, the local Nicobarese
people usually kill such snakes when encountered.
Instances of bites from this species have been known
(Vijayakumar and David 2006), and in one case a casualty
was reported (Edmond, pers. comm.). According to the
current data on its geographic distribution and abundance,
we recommend that 7’ davidi sp. nov. be regarded as an
Endangered species, following the criteria B1 (extent of
occurrence < 5000 km?) and B2 (area of occupancy < 500
km?) of the IUCN guidelines, which indicates a need for
immediate conservation attention. There are two other
sympatric pit viper species on Car Nicobar, namely 7
labialis Fitzinger in Steindachner, 1867 and T. andersoni
Theobald, 1868 (Vogel et al. 2014). Of these, 7. labialis
shows a similar pattern of distribution to 7. davidi sp.
nov. by being endemic to this one single island, while the
other species (7: andersoni) is known to occur throughout
the Andaman archipelago as well (Whitaker and Captain
2008).
Acknowledgements.—We thank the Department of
Environment and Forests, Andaman and Nicobar Islands
for permission (permit numbers: CWLW/WL/134/(J)/
Folder/417 and CWLW/WL/134 (L)/ 60) to conduct
this study and for the infrastructure provided. SRC
thanks Prof. K.V. Devi Prasad and the faculty of the
Department of Ecology and Environmental Sciences and
the Department of Ocean Studies and Marine Biology,
Pondicherry University, for the lab space and other
support they extended. Edmond (forest laborer) assisted
with the fieldwork and provided logistics, for which
we are grateful. SRC thanks the Mohamed bin Zayed
Species Conservation Fund for a grant (#160514249)
which partly facilitated this study. We thank Rahul Khot
and Omkar Adikari (BNHS) for pictures and data from
the specimens under their care. We thank Jens Vindum
and Alan Leviton (CAS), Yuezhao Wang, Xiaomao
Zeng, Jiatang Li, and Ermi Zhao (CIB), Andreas Schmitz
(MHNG), Denis Vallan and Raffael Winkler (NHMB),
November 2020 | Volume 14 | Number 3 | e264
Chandramouli et al.
Alain Dubois and Annemarie Ohler (MNHN), Silke
Schweiger, Richard Gemel, and Georg Gassner (NMW),
Pim Arntzen and Esther Dondorp (RMNH, Leiden),
Mark-Oliver Rodel and Frank Tillack (ZMB), Jakob
Hallermann (ZMH), and Channakesava Murthy (ZSI,
Kolkata) for data on the specimens in collections under
their care.
Literature Cited
Chen Z, Yu J, Vogel G, Shi S, Song Z, Tang Y, Yang J,
Ding L, Chen C. 2020. A new pit viper of the genus
Trimeresurus (Lacépede, 1804) (Squamata: Viperidae)
from Southwest China. Zootaxa 4768(1): 112-128.
David P, Vogel G, Dubois A. 2011. On the need to follow
rigorously the Rules of the Code for the subsequent
designation of a nucleospecies (type species) for
a nominal genus which lacked one: the case of
the nominal genus 7rimeresurus Lacépede, 1804
(Reptilia: Squamata: Viperidae). Zootaxa 2992(1):
1-51.
Dowling HG. 1951. A proposed standard system of
counting ventrals in snakes. British Journal of
Herpetology 1: 97-99.
Grismer LL, Tri NV, Grismer JL. 2008. A new species of
insular pitviper of the genus Cryptelytrops (Squamata:
Viperidae) from southern Vietnam. Zootaxa 1715:
57-68.
Kramer E. 1977. Zur Schlangenfauna Nepals. Revue
Suisse de Zoologie 84(3): 721-761.
Mirza ZA, Bhosale HS, Phansalkar PU, Sawant M,
Gowande GG, Patel H. 2020. A new species of
green pit vipers of the genus 7rimeresurus Lacépéde,
1804 (Reptilia, Serpentes, Viperidae) from western
Arunachal Pradesh, India. Zoosystematics and
Evolution 96(1): 123-138.
Smith MA. 1943. The Fauna of British India, Ceylon
and Burma, including the whole of the Indo-
Chinese subregion. Reptilia and Amphibia. Volume
III. Serpentes. Taylor and Francis, London, United
Kingdom. xii + 583 p.
Uetz P, Freed P, HoSek J. (Editors). 2020. The Reptile
Database. Available: http://www. reptile-database. org.
[Accessed: 10 February 2020].
Vyayakumar SP, David P. 2006. Taxonomy, natural
history, and distribution of the snakes of the Nicobar
Islands (India), based on new materials and with an
emphasis on endemic species. Russian Journal of
Herpetology 13: 11-40.
Vogel G. 2008. Venomous Snakes of Asia / Giftschlangen
Asiens. Terralog Series 14. Edition Chimaira,
Frankfurt am Main, Germany. 148 p.
Vogel G, David P, Chandramouli SR. 2014. On the
systematics of Trimeresurus labialis Fitzinger in
Steindachner, 1867, a pitviper from the Nicobar
Islands (India), with revalidation of 7rimeresurus
mutabilis Stoliczka, 1870 (Squamata, Viperidae,
Crotalinae). Zootaxa 3786: 557-573.
Whitaker R, Captain A. 2008. Snakes of India — the Field
Guide. Draco Books, Chengalpet, India. 481 p.
Zhu F, Liu Q, Che J, Zhang L, Chen Z, Yan F, Murphy
R, Guo C, Guo P. 2016. Molecular phylogeography
of white-lipped tree viper (7rimeresurus, Viperidae).
Zoologica Scripta 45: 252-262.
Amphib. Reptile Conserv. 175
S.R. Chandramouli obtained his Doctoral Degree in Ecology and Environmental Sciences from
Pondicherry University, India. His work focuses on systematics, taxonomy, ecology, and biogeography of
the squamate reptiles and amphibians of peninsular India and the Andaman and Nicobar Islands, and has
resulted in the discovery of two new species of amphibians and five new lizards. He serves as a member of
several committees for conservation within the IUCN.
Patrick D. Campbell holds a B.Sc. in Biological Sciences with 33 years working experience in the
Department of Life Sciences (Zoology) at the Natural History Museum (NHM), London, United Kingdom,
where he is Senior Curator of Reptiles and manages over ~174,000 herpetological specimens. Patrick has
travelled the world in an official capacity as a collector, diver, science officer, surveyor, and conference
speaker, as far afield as China, Brazil, Sri Lanka, India, Thailand, Kenya, French Guiana, Ecuador, the
United States, Spain, and Milos (Greece) to name but a few. He has published nearly 50 papers (mostly
collaborative) on a variety of topics involving various lower vertebrate groups, but most recently and
primarily on the taxonomy, osteology, and conservation of reptiles.
Gernot Vogel was born in Heidelberg, Germany, obtained his Ph.D. in Chemistry, and is now working as
a chemist. Beginning many years ago as a reptile keeper, he developed a great interest in the snake fauna
of the Orient. His special interest lies in the systematics of snake genera which have large distribution
areas, including 7rimeresurus, Boiga, Oligodon, Lycodon, Pareas, Dendrelaphis, and others, with his main
geographical emphasis on China, India, and Indonesia. He has published several papers specifically on the
snakes of the Andamans.
November 2020 | Volume 14 | Number 3 | e264
A new species of 7rimeresurus from Nicobar Archipelago
Appendix 1. Comparative material examined.
Trimeresurus albolabris (17 specimens). China. NHMUK 1946.1.19.85, NHMUK 1946.1.23.73 (Syntypes) “China.” MNHG
1464.88-89 “Tung Kum, Canton.” NMW 23927, “Koksingas Port.” NMW 23905:2, 23905:5—7, “Hainan, Ting-An.” NMW
23626.4—5 “Hongkong.” ZMB 27669 “S-Kuang-tung.” ZMB 52600, “Fung Wan.” ZMB 66282 “Lu Kung, Katon.” ZMB 66283
“N-Kuantung.” Vietnam. CIB GV2019111704—5, “Tam Dao.”
Trimeresurus cf. albolabris (29 specimens). Vietnam. NMW 23901.8 “Phuc-Son, Annam.” NMW 23904.3-5, NMW 23920.7
“Annam.” NMW 23920.3 “Saigon.” Thailand. NVW 19528 “Thailand.” NMW 23901:3-4 “Dom Rek.” NMW 23926.1, NMW
23926.6-9, NMW 23930.1—2 “Pu-Kin.” NMW 27946.2-3, 27946.5—6 “Hills of Bangkok.” NMW 23898.1—2 “Don-Pia-Fei.”
ZMB 70196 “Surat Thani.” Indonesia. NMW 23901.6, 23926.1—3 “Java.” MNW 23902 “Tasikmalaja, W Java.” RMNH 17189
“Sumatra.”
Trimeresurus septentrionalis (18 specimens). Nepal. CAS 135750 (Paratype) “Nahe Pokhara.” MHNG 1404.31. (Holotype)
MHNG 1400.18, 24—26, 29-32, 34-39, 45, 47 (all Paratypes) “Nahe Pokhara.”
Trimeresrus insularis (7 specimens). Indonesia. NHMB 12773 (Holotype) “Soe, Timor.” NMW 39581 “Bali.” MNHN 4056,
“Timor Island.” MNHN 4057, “Indes Orientales.”” MNHN 2002.0402, “Wetar Island.” SMF 76352, 76353, “Flores Island.”
Trimeresrus erythrurus (22 specimens). India. NHMUK 1940.3.9.22 “Naga Hills.” NMHW 23903: 1—2, Guwahati, Assam. ZSI
3052, ZSI 3002, ZSI 3013, ZSI 3045—46 “Samagooting, Assam.” ZMH R-6933 “Himalaya.” Myanmar. NHMUK 61.10.2.5-6,
1908.6.23.96 “Rangoon,” ZMH R-6934 “Rangoon.” CAS 220377, 240036, 204989 “Rakhin.” CAS 239352, 239502, 239511,
40120 “Ayeyarwaddi State.” CAS 240120 “Kakhim State.” CAS 243175 “Magway.”
Trimeresurus fasciatus (4 specimens). NHMUK 96.4.29.46 (Holotype), “Jampea Island,” now Tanahjampea, Province of
Sulawesi Selatan, Indonesia. MNHN 1999.9071, MNHN 2002.0401-—02, Tanahjampea, Province of Sulawesi Selatan, Indonesia,
through the pet trade.
Amphib. Reptile Conserv. 176 November 2020 | Volume 14 | Number 3 | e264
Amphibian & Reptile Conservation
14(3) [General Section]: 177-188 (e265).
Official journal website:
amphibian-reptile-conservation.org
of
>
— ae
€ptile-cons®
Forensic bioacoustics? The advertisement calls of two
locally extinct frogs from Colombia
1*Ignacio De la Riva, ‘Claudia Lansac, *Belisario Cepeda, *Guillermo Cantillo, ‘Jacopo de Luca,
S‘Laura Gonzalez, ‘°Rafael Marquez, and °Patricia A. Burrowes
'Department of Biodiversity and Evolutionary Biology, Museo Nacional de Ciencias Naturales-CSIC, C/ José Gutiérrez Abascal, Madrid 28006,
SPAIN *Universidad de Naritio, Departamento de Biologia, Facultad de Ciencias Exactas y Naturales, Calle 18 Cr 50, Ciudadela Universitaria
Torobajo, Pasto, Narifto, COLOMBIA 3Reserva Natural La Planada, San Isidro, Ricaurte, Naritio, COLOMBIA *Via delle Antille, 26, Roma (RM),
00121, ITALY °Fonoteca Zoolégica, Department of Biodiversity and Evolutionary Biology, Museo Nacional de Ciencias Naturales-CSIC, C/ José
Gutiérrez Abascal, Madrid 28006, SPAIN °Department of Biology, University of Puerto Rico, San Juan 00931, Puerto Rico
Abstract.—Analyses of vocalizations are an important tool for anuran species taxonomy and identification, and
can become especially important for detecting rare or threatened species. Based on recordings obtained in
1986 in the Reserva Natural La Planada (Department of Narino, southern Colombia), we describe the acoustic
characteristics of the advertisement calls of Paruwrobates andinus (Dendrobatidae) and Gastrotheca guentheri
(Hemiphractidae), two Andean anuran species not seen since the 1990s and considered locally extinct. The call
of P. andinus consists of a rapid series of short notes emitted in three call groups. The first two groups have five
notes with 6-7 pulses each and a duration of about 2 sec, while the third call group contains 50 notes or more,
with 5-8 pulses each and a duration of about 30 sec. On average, the notes have a fundamental frequency of 2.2
kHz and a dominant frequency of 4.4 kHz. This call differs from that of its likely most closely-related species, P.
erythromos, in having shorter notes repeated at a higher rate. The call of G. guentheri has a single loud, short
note (average duration, 0.262 sec) composed of 3-4 pulses, with negative frequency modulation, a fundamental
frequency of 0.9 kHz, and a dominant frequency of 1.8 kHz. Advertisement calls of members of the Gastrotheca
longipes group (to which G. guentheri belongs) are poorly known and seem to be quite variable, making it
difficult to establish reliable comparisons.
Keywords. Amphibia, Andes, Dendrobatidae, extinction, Gastrotheca guentheri, Hemiphractidae, Paruwrobates
andinus, vocalizations
Resumen.—Los analisis de las vocalizaciones son una importante herramienta en la taxonomia e identificacion
de anuros, y pueden ser especialmente importantes para detectar especies raras 0 amenazadas. A partir de
grabaciones obtenidas en 1986 en la Reserva Natural La Planada (Departamento de Narinho, sur de Colombia),
describimos las caracteristicas de los cantos de Paruwrobates andinus (Dendrobatidae) y Gastrotheca guentheri
(Hemiphractidae), dos especies de anuros andinos que no han sido observadas desde 1990 y se consideran
extintas localmente. El canto de P. andinus consiste en series rapidas de notas cortas emitidas en tres grupos
de Ilamadas, las dos primeras conteniendo 5 notas con 6-7 pulsos cada una, y una duracion de cerca de 2
segundos, mientras que el tercer grupo contiene 50 notas o mas, con 5-8 pulsos cada una y una duracion
de cerca de 30 segundos; en promedio, la frecuencia fundamental es de 2.2 kHz y la frecuencia dominante
es de 4.4 kHz. Este canto difiere del de la que probablemente es la especie mas proxima, P. erythromos, por
tener notas mas cortas repetidas a un ritmo mas rapido. El canto de G. guentheri tiene una sola nota alta y
corta (duracion media, 0.262 segundos) compuesta por 3-4 pulsos, con modulacion de frecuencia negativa,
frecuencia fundamental de 0.9 kHz y frecuencia dominante de 1.8 kHz. Los cantos dentro del grupo de especies
de Gastrotheca longipes (al cual pertenece G. guentheri) no se conocen bien y parecen ser muy variables, por
lo que no se pueden hacer comparaciones fiables.
Palabras clave. Amphibia, Andes, Dendrobatidae, extincion, Gastrotheca guentheri, Hemiphractidae, Paruwrobates
andinus, vocalizaciones
Citation: De la Riva I, Lansac C, Cepeda B, Cantillo G, De Luca J, Gonzalez L, Marquez R, Burrowes P. 2020. Forensic bioacoustics? The
advertisement calls of two locally extinct frogs from Colombia. Amphibian & Reptile Conservation 14(3) [General Section]: 177-188 (e265).
Copyright: © 2020 De la Riva et al. This is an open access article distributed under the terms of the Creative Commons Attribution License [Attribution
4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction in any
medium, provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced, are
as follows: official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 11 October 2020; Published: 9 November 2020
Correspondence. *
[email protected] (IDIR),
[email protected] (BC),
[email protected] (GC), fonoteca-zoologica@mncn.
Amphib. Reptile Conserv. AZT November 2020 | Volume 14 | Number 3 | e265
Calls of two extirpated Colombian frogs
Introduction
“Extinction is forever” is a famous sentence often quoted
in texts on evolution and conservation biology, but
deciding when a species is extinct 1s not an easy task.
Empirical data, either on the existence of surviving
individuals or their disappearance, are often difficult to
obtain, especially for poorly known, rare, widespread,
or elusive species. While the conservation status of
species with small or restricted distributions can be more
easily evaluated, surveying the entire range of species
with large and/or patchy distributions in order to know
whether they are extant or extinct is a much greater
challenge. For this reason, a more conservative and
less compromising approach is simply to refer to local
extinctions or extirpations, instead of extinction (see
Smith-Paten et al. 2015).
Within the current Sixth Mass Extinction crisis,
amphibians are the most threatened class of vertebrates
due to several factors (Wake and Vredenburg 2008).
In particular, chytridiomycosis has been linked to the
extinction of at least 90 species of amphibians and the
decline of 501 others (Scheele et al. 2019). The amphibian
crisis is especially severe in the American tropics, where
mountain forest ecosystems, even pristine ones, have
suffered the collapse of entire amphibian communities
(e.g., Lips 1998, 1999; Lips et al., 2006, 2008; Catenazzi
et al. 2011, 2014), usually including precipitous declines
of many species and the extirpation of others. Because
the beta-diversity is high and many amphibian species
have reduced distributions in tropical mountains, in
many cases local extirpation equals the extinction of the
species altogether.
One case of amphibian community collapse in the
tropical Andes which remains poorly documented is
that of the Reserva Natural La Planada, in southern
Colombia (Fig. 1A—B). In 1986, during a three-month
period from April to June, Patricia Burrowes carried
out the first (and hitherto only) comprehensive study
of the amphibian community of La Planada (Burrowes
1987). A total of 42 species of amphibians were
reported, including 12 species of anurans new to science
(Myers and Burrowes 1987; Duellman and Burrowes
1989; Lynch and Burrowes 1990). After 1986, further
amphibian monitoring and inventory in La Planada has
been anecdotal and intermittent, mostly carried out by
G. Cantillo and field parties from the Universidad de
Narifio (e.g., Mufioz-Arcos et al. 2016). In April 2019,
four of the authors of this article (DIR, PAB, GC, and
BC) and several students returned to La Planada to carry
out amphibian surveys. Although the temporal sampling
effort was much shorter than in 1986, that brevity was
partially compensated by having a large team instead
of a single person doing the fieldwork. Preliminary data
indicated that massive declines in numbers and species
diversity have taken place in La Planada, suggesting
chytridiomycosis and climate change as potential factors
Amphib. Reptile Conserv.
involved in the observed collapse (De la Riva and
Burrowes 2019; data not shown).
Two of the most iconic anurans studied in La
Planada by Burrowes in 1986 were the poison arrow
frog, Paruwrobates andinus (Myers and Burrowes,
1987) [Fig. 1C], and the marsupial frog, Gastrotheca
guentheri (Boulenger, 1882) [Fig. 1D]. Paruwrobates
andinus was described (as Epipedobates andinus) by
Myers and Burrowes (1987) based on nine specimens.
This small species (snout-to-vent length [SVL] of males
19.5—20.1 mm; females, 20.7—21.5 mm) is considered
diurnal, terrestrial, and semiarboreal, being observed
near water-filled bromeliads in trees and near fallen
tree branches (Myers and Burrowes 1987). The species
is only known from La Planada, where it was observed
across an elevation range of 1,700—2,020 m asl (Myers
and Burrowes 1987; Lotters et al. 2007; Kahn et al. 2016;
Frost 2020). It has not been seen at the type locality since
the 1990s (G. Cantillo, field notes), and its conservation
status 1s “Critically Endangered (Possibly Extinct)”
according to IUCN (2019a). While it is possible that
the species still occurs somewhere in southwestern
Colombia or even nearby northwestern Ecuador, it has
not been found despite several search attempts, both in
La Planada since 2013 and at nearby Rio Nambi Natural
Reserve (IUCN 2019a). Thus, this is an example of a
Species extirpated locally, and perhaps extinct.
The case of Gastrotheca guentheri is quite different.
The species has been known since its original description
as the only anuran with true teeth in the lower jaw,
which led Boulenger (1882) to place it in its own
genus, Amphignathodon, meaning “teeth in both
jaws,” a phenomenon studied and discussed by Wiens
(2011). Despite this exceptional peculiarity, different
phylogenetic analyses have consistently placed the
species deeply nested in the genus Gastrotheca (e.g.,
Duellman et al. 1988; Wiens et al. 2007; Castroviejo-
Fisher et al. 2015). This moderately large species (SVL of
males 67.8—76 mm; females, 69.9—-82 mm) is nocturnal
and usually associated with canopy vegetation, including
bromeliads, and frequently found next to rivers (Arteaga
et al. 2013; Duellman 2015). It preys on small vertebrates,
such as frogs and lizards, and large insects, such as
orthopterans (Arteaga et al. 2013; Paluh et al. 2019), a
feeding behavior expected by Wiens (2011) based on the
functional teeth in the lower jaw which enable the species
to catch and swallow large prey. Gastrotheca guentheri
occurs between 1,200—2,010 m asl in Andean cloud
forests along the Cordillera Occidental from provinces
Cotopaxi, Imbabura, and Pichincha in northwestern
Ecuador to the Department of Antioquia in northwestern
Colombia. A distribution gap of about 500 km has been
noted between a Narifio-Cauca nucleus in the south of
Colombia and a nucleus in the north comprising the
departments of Risaralda-Choco-Antioquia. However,
based on specimen IND 4853, collected by J.V. Rueda
on 3 December 1989 and examined by two of the authors
November 2020 | Volume 14 | Number 3 | e265
De la Riva et al.
: x @
Fig. 1. Geographic location (A) and general view (B) of Reserva Natural La Planada (Department of Narifio, Colombia; (C)
Paruwrobates andinus and (D) Gastrotheca guentheri from Reserva Natural La Planada, Colombia. Photos by I. De la Riva (B) and
P.A. Burrowes (C—D).
(PAB and IDIR) at the herpetological collection of the
Institute Von Humboldt, the species is also recorded in
Risaralda (see below). A dubious record exists from the
Amazonian slopes of northeastern Ecuador (Duellman
2015; IUCN 2019b; Frost 2020).
Gastrotheca guentheri 1s globally considered as Data
Deficient, although its situation differs in Ecuador and
Colombia (IUCN 2019b). In Ecuador, the species 1s
considered as possibly extinct, because it has not been
observed since 1996 despite active searches at known
localities (Arteaga et al. 2013; IUCN 2019b), and the
most recent specimen was collected on 1 January 1991
(L. Coloma, pers. comm.). In Colombia, its conservation
status is difficult to assess due to its broader and apparently
patchy distribution. It was last seen in 1990, and was not
found in surveys carried out in La Planada in 2005 or
in Parque Nacional Natural Munchique (Department of
Amphib. Reptile Conserv.
Cauca) in 2014-2016 (IUCN 2019b). Two specimens
deposited at the Instituto de Ciencias Naturales-
Universidad Nacional de Colombia [ICN 50102-3]
were collected in Munchique in 1990 (A. Acosta, pers.
comm. ), although the species was not reported in the park
by Pisso et al. (2018). The disappearances of the species
at some locations may be explained by pollution and
habitat loss, but those at pristine habitats are attributed to
climate change or/and chytridiomycosis (IUCN 2019b).
In 1986, P. Burrowes and G. Cantillo obtained
recordings in La Planada of P. andinus and G. guentheri,
two species for which the advertisement calls were then
unknown. Later, the general vocal behavior of P. andinus
was outlined by Myers and Burrowes (1987), who
described the vocalizations of the species as “a distinctive
call comprised of a series of well-spaced ‘creek’ notes”
often emitted from bromeliads at different heights in
November 2020 | Volume 14 | Number 3 | e265
Calls of two extirpated Colombian frogs
the trees. As for G. guentheri, the call was described
by Duellman (2015) as “a single loud ‘bop,’ usually
repeated at intervals of several minutes,” although “some
individuals have been heard to produce two or three calls
in quick succession.”
This paper provides the first comprehensive analyses,
including the first numerical descriptions, of the
advertisement calls of these two species, which are now
apparently extirpated from La Planada, and might be
extinct altogether. Because observing frogs is usually
harder than hearing them, this case study of what can
be termed “forensic bioacoustics” may prove useful in
future surveys and acoustic monitoring of anurans in the
Pacific Andean forests of Colombia and Ecuador.
Materials and Methods
The study site, Reserva Natural La Planada, is a protected
area of 3,200 hectares at 1,700-—2,010 m asl, in the cloud
forests of the Pacific slopes of the Andes, Department of
Narifio, Colombia (1°09’29"N, 77°58’36’W), near the
Ecuadorian border (Fig. 1A).
The recordings were obtained from individuals (adult
males in both cases) kept in captivity on 7 May 1986 at
1915 h for G. guentheri, and on 5 June 1986 at 1030 h for
P. andinus. Unfortunately, records were not made of the
air temperature or the size of the recorded specimens. The
sound files were originally obtained by means of a Sony
stereo cassette recorder TCS-350 and stored in analog
cassettes, then digitized in a lossy compressed format
(mp3). Because the cassettes were not available at the
time of our study, the *.mp3 files were finally converted
to *.wav for analyses with Raven 1.05 software (Cornell
Lab of Ornithology 2014). Figures were generated with
the R package Seewave (Suerur et al. 2008). Temporal
data were obtained from the oscillograms and frequency
information was obtained using fast Fourier transforms
(FFTs; frame width: 1,024 points).
The terminology used for the call descriptions is
based on Kohler et al. (2017) and the oscillograms and
audiospectrograms presented follow the format of Bosch
et al. (2000). Due to the compression imposed by the
MP3 format, some of the properties of the recordings
could be affected as reported by Araya-Salas et al. (2019).
Several parameters were considered for the analyses of
the calls: call group duration, intercall group duration,
note repetition rate, internote duration, dominant
frequency, and fundamental frequency. To determine the
point in which the amplitude is maximum within each
call/note three points were used: at the beginning of
the call (tl), at the middle section (t2), and at the end
(t3); thus, providing some information about frequency
modulation (t3 minus t1). In addition, the delta harmonic
energy (dB) was measured as the difference between the
peak intensity of the dominant frequency minus the peak
intensity of the fundamental frequency. This parameter
provides information about the energy distribution in
Amphib. Reptile Conserv.
the spectrum. The number of pulses within calls/notes
and pulse rate (pulses per sec) within calls/notes were
difficult to estimate because the pulses were not clearly
delimited due to their incomplete amplitude modulation.
The numerical parameters of the advertisement calls are
shown in Tables 1 and 2. The acoustic characteristics of
the advertisement calls of P andinus and G. guentheri
were compared with those of other species which are
phylogenetically closely related to them.
The original recordings are deposited in the scientific
collection of the Fonoteca Zoologica of the Museo
Nacional de Ciencias Naturales-CSIC, with collection
numbers 11998 (P. andinus call) and 11997 (G. guentheri
call) and are available in the web checklist Frog Calls
of the World at the following links for P andinus
(http://www.fonozoo.com/fnz_detalles_ registro eng.
php?tipo_registro=2&1d=22942&id_ sonido=1116) and
G. guentheri (http://www.fonozoo.com/fnz_detalles_
registro _eng.php?tipo_registro=2&1d=22943&id |
sonido=1117).
Results
The description of the call of P. andinus is based on
the analysis of two call sequences. Only one type of
call was heard, and three call groups were identified:
A and B are similar to each other, while C is markedly
different regarding the number of notes. Call groups A
and B are composed of five notes with 6—7 pulses each,
while call group C is longer, encompassing 53 notes
with 5—8 pulses each (Fig. 2). For the analyses, only
50 notes were considered due to the background noise.
The sounds of these individual notes are very similar in
all call groups, having an average duration of 0.118 sec
per note and an average inter-note duration of 0.450 sec
(n = 73). The envelope shape of the audiospectogram
is slightly asymmetrical, with rise time faster than fall
time. An average call group duration of 2.089 sec (n
= 2) was registered for call groups A and B, and a call
duration of 30.139 sec for call group C. The inter-call
group duration between A and B 1s 2.247 sec (n = 2), and
1.778 sec between B and C. Inter-call group durations
were considered from the end of one call group to the
beginning of the next call group. The note repetition rate
in group C is 1.76 notes/sec. Inter-note durations were
measured from the end of one note to the beginning of
the next one. All of the call groups contain a series of
notes with an average fundamental frequency around 2.2
kHz, a dominant frequency of 4.3 kHz, and one harmonic
around 6.5 kHz. The presence and relative power of other
harmonics were difficult to ascertain because of the MP3
format compression and the likely automatic gain control
used in the recorder. The average delta harmonic energy
is 29.9 dB (SD + 8.246, range 17.1-46.4) and the average
frequency modulation is 222.2 Hz (SD + 129.6, range
129.2—344.5). In call group C, there is an increase in the
amplitude level possibly due to a closer approach of the
November 2020 | Volume 14 | Number 3 | e265
De la Riva et al.
Amplitude
ae Time (s)
; | i eee 20 30
10 S. Sarr = ‘
FFT = 1024 Amplitude
(dB)
8 teak arabe dyin mda am, de ah, ds Ody de a ard Godt aes Safa: dy Reged a deandva a a-ded ata aNd ga AE ea i gtth- sagt Md kobe eat Ran agit ob cob eed ai Rod a ob. dh denna lage dol ital ded al
WwW 10)
~ 7
— 6 Pee eee reer eee eer reer errr errr errr errr err reer rer rr err reer reer reer reer reer reer reer reer reer reer errr errr re -5
o
= -10
oO
=I 4 -15
©
U. -20
2
-25
0 -30
o
TO
2
rod
£
<
0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7
Time (s)
Fig. 2. Full-scale oscillogram (top), and expanded oscillogram and its audiospectrogram (bottom) of the advertisement call of
Paruwrobates andinus. Call groups (A, B, and C), inter-call group interval (ci), and background noise (bn) are represented in the
full-scale oscillogram. The note duration (nd), inter note interval (ni), dominant frequency (df), and fundamental frequency (ff) are
indicated in the expanded box.
recorder to the sound source. The numerical data of the
advertisement calls are summarized in Table 1.
At La Planada, the loud call of G. guentheri could
be heard coming from the canopy and, despite it being
a mostly nocturnal species, some individuals started to
vocalize as early as 1400 h when raining (data not shown).
The analyses here are based on two recorded calls. Only
one type of call was heard, and each call was composed
by only one note constituted by 3-4 pulses (Fig. 3). The
envelope shape of the audiospectogram is asymmetrical,
with a fast rise time and a more extended fall time.
Notes have an average duration of 0.262 sec, an average
fundamental frequency around 0.9 kHz, and a dominant
frequency of 1.8 kHz. The presence of other harmonics
was difficult to measure due to the same issue as in the P
andinus recordings. Frequency modulation is negative,
and amplitude modulation is also predominately negative
(see the descendant envelope shape in the oscillogram,
Fig. 3). The inter-call duration, considered between the
end of the first call and the beginning of the second
one, was 20.4 sec. However, due to the fact that only a
Amphib. Reptile Conserv.
sequence of two calls was recorded, we cannot consider
that this inter-call duration is representative. The
average delta harmonic energy is 6.4 dB and the average
frequency modulation is -0.2 kHz. The numerical data of
the advertisement calls are summarized in Table 2.
Discussion
Recordings and knowledge of anuran advertisement
calls not only constitute a powerful taxonomic tool, but
call parameters can also contain valuable phylogenetic
information. However, anuran advertisement calls are
subjected to strong sexual selection, which can promote
rapid character differentiation even in species which
are closely related, especially if they occur in sympatry
(see Goicoechea et al. 2010, and references therein). On
the other hand, similar selective pressures affecting the
evolution of advertisement calls of non-related species
can lead to high levels of homoplasy in particular
bioacoustic parameters. Thus, when comparing anuran
vocalizations, determining which similarities are due to
November 2020 | Volume 14 | Number 3 | e265
Calls of two extirpated Colombian frogs
Table 1. Summary of numerical parameters of vocalizations of Paruwrobates andinus and some other species of dendrobatoid frogs
(mean + SD, range). Acoustic data of P. ervthromos were extracted from Myers and Burrowes (1987); of E. atopoglossus from Grant
et al. (1997); of E. isthminus from Myers et al. (2012); and of the species within the Ameerega picta group from Serrano-Rojas
et al. (2017). *Note: In P. andinus, the inter-call interval represents the value of the mean inter-call group interval of this species.
Note Inter-note
duration (s) _ interval (s)
Paruwrobates andinus
Note repetition
rate (notes/s)
Fundamental
frequency (Hz)
Dominant
frequency (Hz)
Inter-call
interval (s)
Mean + SD 0.118+0.011 0.45+0.113
Range 0.105— 0.157 0.31-0.58
n= 60 n=60
Paruwrobates erythromos
Mean + SD 0.135+0.007) 1.340.141
Range 0.13-0.14 1.2-1.4
Ectopoglossus atopoglossus
Mean + SD < 0.03 -
Range = :
Ectopoglossus isthminus
Mean + SD 0.085 + 0.007 -
Range 0.08—0.09 -
Amereega shihuemoy
Mean + SD 0.098+0.007 1.04+0.19
Range 0.084—0.12 0.97-1.2
Amereega simulans
Mean + SD 0.105 + 0.01 -
Amereega picta
Mean + SD 0.046 + 0.002 -
Amereega hahneli
Mean + SD 0.013 + 0.003 -
Amereega boliviana
Mean + SD 0.081 + 0.009 -
Amereega yungicola
Mean + SD 0.048 + 0.005 -
Amereega macero
Mean + SD 0.038 + 0.001 -
1.76 2.013+0.331 4,323.8 + 774.0 2,169.1 + 405.0
- 1.778-2.247* 4,134.4-4.478.9 2,067 .2—2,756.2
= n=2 E =
0.63 - 4,166.7 + 611.0 -
- - 3,500—4,700
14.8 - 4,733.3 + 924.6 -
- - 4,160—5,800
1.3 - 4,166.7 + 642.9 -
- - 3,700-4,900
0.9+0.1 1.04 + 0.187 4672.7 +251 4,237 + 281.9
0.8-1.0 - 4.478 .9-4,909.6 -
13+0.1 0.691+0.163 4,460.3 + 157.7 4,060.9 + 74.6
22+0.1 0.430 + 0.045 4,044.2 + 94.7 3,770.7 + 76.7
85+0.1 0.107+ 0.013 4550+ 49.1 2,516.8 + 83.7
12+0.1 0.783 + 0.089 3,846 + 46.3 3,416.1 + 68.2
5.2+0.0 0.148 + 0.007 3,703.7 + 0.0 3,475.7 + 43.5
8.7+ 0.0 0.076 + 0.003 3,617.6 + 0.0 3,353.7 + 38.1
convergence and which ones represent a phylogenetic
signal can be contentious. In any case, it is useful to
make call comparisons of species that are closely related
and, if they have allopatric distributions, the observed
similarities may support hypotheses of relatedness based
on other sources of evidence. The two species studied
herein are rare and their closest relatives are also poorly
known; as a consequence, they have not been thoroughly
studied from a bioacoustics standpoint. However,
some inferences can be made from comparing the data
available at hand.
Parubrowates andinus was originally described by
Myers and Burrowes (1987) in the genus Epipedobates,
which was then a diverse and broadly distributed group
in South America; however, it was later split into
various genera, one of them being Ameerega, in which
the species was included as Ameerega andina (Frost et
al. 2006; Grant et al. 2006). The genus Ameerega was
Amphib. Reptile Conserv.
subsequently rearranged by Grant et al. (2017), and
Paruwrobates (a genus described by Bauer [1994] to
include the species from La Planada) was resurrected from
its synonymy to accommodate only three trans-Andean
species: the Colombian P. andinus (type species), and
the Ecuadorian P. erythromos, and P. whymperi. Edwards
(1971) included P. whymperi in the genus Colosthetus,
and Coloma (1995), in his review of Ecuadorian species
of this genus, had already pointed out the similarity
of this species with P. erythromos (then in the genus
Epipedobates). Unfortunately, the call of P. whymperi
is unknown. Finally, Grant et al. (2017) suggested that
the colorful, aposematic Colombian species Colosthetus
ucumari might belong to Paruwrobates, but its call is
also unknown.
At the moment, phylogenetic hypotheses of
dendrobatoid frogs are mostly based on morphological
and genetic characters, with the occasional support of
182 November 2020 | Volume 14 | Number 3 | e265
De la Riva et al.
rs)
= Amplitude
FFT = 1024 | (aay
4
i 0
Z
— 3 -5
o
c -10
S
3
UL. -20
4
-25
0 -30
o
c?)
2
a
=
0.0 0.2 0.4 0.6 0.8
Time (s)
Fig. 3. Full-scale audiospectrogram (top) and oscillogram (bottom) of the advertisement call of Gastrotheca guentheri. The note
duration (nd), dominant frequency (df), and fundamental frequency (ff) are indicated.
data from skin alkaloids (see Grant et al. 2006, 2017,
and references therein). Myers and Burrowes (1987)
described the call of P erythromos (as Dendrobates
erythromos) and opportunely considered it useful to
compare this call with that of the new species from La
Planada, whenever recordings were available. In fact, the
recordings analyzed here had been obtained by the time
of the description of P andinus, but they were then “in
storage” and only now available to be formally described.
They now provide an opportunity to make the desired
comparisons in order to ascertain whether the allocation
of P andinus and P. erythromos in the same genus is
somehow supported by bioacoustical data as an additional
source of evidence. This study also compares the call of P.
andinus with those of two (out of seven) representatives
of Ectopoglossus (E. atopoglossus and E. isthminus),
another trans-Andean and Panamanian genus which is
the sister group of Paruwrobates (Grant et al. 2017; Frost
2020). At the end of the convoluted taxonomic trajectory
of many groups of dendrobatid frogs, Ameerega and
Paruwrobates have ended up in different subfamilies,
Colosthetinae and Hyloxalinae, respectively, within the
family Dendrobatidae (Grant et al. 2017; Guillory et al.
2019; Frost 2020). Because of this distant phylogenetic
relatedness, the calls of P andinus are compared with
those of some representatives of Amereega for descriptive
purposes only; searching for possible shared character
states, either as a result of having a common ancestor or of
convergence, is beyond the scope of this paper.
Comparing the calls of P erythromos and P. andinus.
The call of P erythromos was verbally described as a
series of well-spaced “short repetitive chips” (Vigle and
Miyata 1980), and then a 3.6 min sequence was analyzed
and figured by Myers and Burrowes (1987). These
authors described it as follows:
“The advertisement call is a long train of harsh
but not very loud ‘chirps,’ given continuously for
many seconds. The one recording made includes an
unbroken sequence of 136 notes given in 3 min, 35 s,
for an overall repetition rate of 0.63 notes/s. Spacing
between notes varied from 1 to 4 s, with an internote
interval of about 1.2-1.4 s being most typical.
Individual notes are 0.13-0.14 s duration and have
a median frequency of about 4.5 kHz. Frequency is
modulated within the note, there being a slow rise and
more rapid fall, as indicated by the frequency-time
Table 2. Mean + standard deviation (SD) and range of call parameters of Gastrotheca guentheri (n = 2).
: Dominant
Note duration (s) Intercall (s) frequency (Hz)
0.262 + 0.015 20.411 1,765.7 182.716
0.273-0.251 1,636.5—1,894.9
Amphib. Reptile Conserv.
Fundamental Delta harmonic Frequency
frequency (Hz) energy (dB) modulation (Hz)
861.3 + 0.00 6.442.121 -215.3 + 182.716
861.3—861.3 49-79 (-344.5)(-86.1)
November 2020 | Volume 14 | Number 3 | e265
Calls of two extirpated Colombian frogs
curvature on spectrograms [...]; sections of a few
notes show the dominant frequency starting at about
4,300 Hz, rising to about 4,700 Hz, then dropping
back below 4,500 Hz. The individual note is strongly
pulsed at a rate of 131 pulses/s; the first several pulses
are produced more rapidly than subsequent ones.”
Comparisons of anuran calls among different studies
would be easier if the same terminology and forms of
graphical representation were used, but we are still far
from reaching this desirable standardization (see Kohler
et al. 2017). The terminology and type of figure that
Myers and Burrowes (1987) used to describe the call
of P. erythromos differ from those presented herein.
However, a careful reading of their description of the
call, and a visual comparison of their Fig. 12 (Myers
and Burrowes [1987, p. 15]) with the audiospectrogram
in Fig. 2 of this paper, allows for useful comparisons.
Both calls consist of a rapid succession of short notes. In
the temporal domain, the call of P. andinus has slightly
shorter notes (0.118 sec on average, vs. 0.13—0.14 sec in
P. erythromos), they are composed by fewer pulses (5—8
vs. 17, in the figure by Myers and Burrowes cited above),
the inter-note intervals are shorter (0.45 sec on average
vs. 1-4 sec, but most often 1.2—1.4 sec), and notes are
repeated at a higher rate (note repetition rate 1.76 notes/
sec vs. 0.63 notes/sec). Data are not available on the
temperatures at the times of recording in either species.
However, despite the known general effect of temperature
on the behavioral and physiologically-induced variation
of gross temporal parameters of anuran calls (the higher
the temperature, the faster the call [Gerhardt 1994]), the
differences found here are sufficiently remarkable to
affirm that the call of P. andinus is notably faster than that
of P. erythromos. In the spectral component, both species
have a similar dominant frequency around 4.3 kHz, but
P. andinus shows a narrower frequency modulation (0.2
kHz vs. 0.4 kHz in P. erythromos), and the envelope of
the audiospectrogram shows a more complex call in P.
erythromos, with a slow rise at the beginning of the note
and a more rapid fall at the end.
Comparison with calls of Ectopoglossus species.
Advertisement calls have been described for two species
of the genus Ectopoglossus, the sister group of the genus
Paruwrobates (Grant et al. 2017). The calls of those
two species are quite different from each other, and
also differ noticeably from those of P andinus and P.
erythromos. The call of E. atopoglossus was described
by Grant et al. (1997). It consists of a fast succession of
12-14 short notes (note duration < 0.03 sec) repeated at a
high rate (note repetition rate 14.8 notes/sec, as deduced
from call duration and notes per call), emitted with a
rising frequency from 4.16—4.24 kHz in the first notes
of the call to 5.80 kHz in subsequent notes and with a
decline in the last notes. The call of E. isthminus was
described by Myers et al. (2012), and consists of a long
Amphib. Reptile Conserv.
train of weakly pulsed (3 pulses/note) short notes (note
duration 0.08—0.09 sec) repeated at a much lower rate
than in E. atopoglossus (1.3 notes/sec); frequency is also
modulated, rising sharply from 3.7—3.9 kHz to 4.9 kHz.
In summary, the calls of species of Parubrowates
and Ectopoglossus share the common feature of being
composed of long trains of pulsed notes; in Paruwrobates
notes are moderately long (one order of magnitude longer
than those of Ectoploglossus) and frequency modulation
is not very marked. In contrast, species of Ectopoglossus
share calls composed of short notes with remarkable
frequency modulation but highly variable note repetition
rates. Whether these similarities and differences can
be explained by phylogenetic relatedness is difficult to
ascertain.
Comparison with calls of Amereega species. Species
of Paruwrobates were formerly placed in the genus
Ameerega (Grant et al. 2017; Guillory et al. 2019).
Serrano-Rojas et al. (2017) provided call analyses of
several species of Ameerega in the A. picta group (a group
not recognized by Guillory et al. 2019). In comparison to
those species of Ameerega analyzed by Serrano-Royjas et
al. (2017), the advertisement call of P. andinus has, in
general, a longer note duration and inter-call duration,
sustains the highest fundamental frequency, and has
a dominant frequency which falls within the dominant
frequency range (Table 1). However, considering the
great heterogeneity of call characteristics shown even
by closely related species of Ameerega, comparing their
calls with those of P. andinus does not shed much light
on their phylogenetic relationships.
Comparisons of calls of G. guentheri with those of
other Gastrotheca species. Gastrotheca guentheri
was included by Castroviejo-Fisher et al. (2015) in the
Gastrotheca longipes group (equivalent to the subgenus
Amphignathodon used by Duellman [2015]), which also
comprises G. andaquiensis, G. angustifrons, G. antomia,
G. bufona, G. cornuta, G. dendronastes, G. helenae, G.
longipes, G. walkeri, G. weinlandii, and G. williamsoni.
According to Castroviejo-Fisher et al. (2015), the species
most closely related to G. guentheri is G. weinlandii.
However, as far as we know, the only one of these
species for which bioacoustic characteristics have been
comprehensively described and analyzed is G. cornuta,
which occurs in the Pacific lowlands of Ecuador and
Colombia, reaching the Caribbean slopes of Costa Rica
across Panama. According to Duellman (1970), males of
this rare species (as G. ceratophrys) vocalize from the
canopy, and the call sounds like a loud "bop" reminiscent
of the sound of uncorking a bottle of champagne. It
consists of one to three notes emitted at long intervals,
usually between 8-12 min. The note duration is
approximately 0.08 sec, and the inter-note interval is 0.6
sec (when the call is composed by more than one note).
The note consists of three harmonics of 0.8 kHz (dominant
November 2020 | Volume 14 | Number 3 | e265
De la Riva et al.
frequency), 1.6 kHz, and 2.4 kHz and there is frequency
modulation, with each note diminishing abruptly from
the beginning to the end. Comparisons of the numerical
parameters of Duellman (1970) and the accompanying
audiospectrogram of the call of G. cornuta (Plate 36.1)
with those of G. guentheri presented herein (Fig. 3) show
that G. cornuta emits shorter notes (0.08 sec vs. 0.262
sec in G. guentheri), with a lower dominant frequency
(0.8 kHz vs. 1.8 kHz) and a much more pronounced,
descending frequency modulation. Duellman (2015)
briefly described the call of some other species of the G.
longipes group. The calls of G. dendronastes is a loud
chuckle-like sound followed by three to four “clucks;” G.
helenae generates a call of 12-15 monosyllabic notes in
a period of about five sec, and the call is repeated every
20-30 min; and the call of G. weinlandii is characterized
by an explosive “wrock” usually followed by one or two
shorter notes, “rock-rock” (Duellman 2015). Thus, the
call characteristics within the G. /ongipes group seem
quite variable, with short “bop” or “wrock”-like calls,
either followed by short notes or not, and there are also
calls composed by a succession of many monosyllabic
notes like that of G. helenae.
Unfortunately, analyses of Gastrotheca vocalizations
remain too scarce to make sound comparisons that would
be sufficient to detect general inter- and intra-species
group patterns. However, some patterns in vocalization
characters variation seem to be detectable among several
groups. For example, Sinsch and Juraske (2006) found
consistent differences in calls of members of the G.
plumbea group in relation to those of the G. marsupiata
group (although all these species are now included in the
broader G. marsupiata group of Castroviejo et al. [2015]).
In general, these authors found that members of the G.
marsupiata group emitted long pulsed advertisement
calls in contrast to the more erratic, shorter calls of some
members of their G. plumbea group. They even found
distinctive call features among two clades within such a
G. plumbea group, supporting a previous phylogenetic
hypothesis by Duellman and Hillis (1987) based on
allozymes. The short, erratic calls with frequency
modulation often described as “bop” or “wrock” might
be distinctive of members of the G. /ongipes group,
although more research on Gastrotheca bioacoustics is
needed to confirm this.
Conclusions
In cases of vanishing anuran species, description of the
calls can be extremely useful for detecting remnants of
populations, but it is important to record and safely store
this type of information in general sound archives. For
this reason, the publication of the calls in web checklists,
like Frog Calls of the World (http://www.fonozoo.com),
allows the comparison of any new recordings or hearing
events with existing recorded sounds. The information
on acoustic signals of Paruwrobates andinus and
Amphib. Reptile Conserv.
Gastrotheca guentheri provided in this study could be
useful to researchers and the personnel of local nature
reserves or conservation projects, in order to detect these
Species in nature once again. Several Andean anuran
Species once considered extinct have been rediscovered
in recent years in the form of relict populations (e.g.,
Barrio-Amoros et al. 2020, and references therein). In
particular, rare species inhabiting the forest canopy can be
especially difficult to register visually, so they can remain
unnoticed for long periods of time even when they are
present, e.g., the Colombian large treefrog Ecnomiohyla
phantasmagoria (Dunn, 1943) reported by Duellman and
di Domenico (2020) after nearly 80 years without any
records. This might be the case of G. guentheri, but the
conspicuous call of the species described herein should
be useful in detecting it. Thus, we remain hopeful that,
someday, researchers will announce the re-discovery of
one of the two species of anurans studied herein, which
were once sadly considered to be “extinct forever.”
Acknowledgements.—We are indebted to the Awa
community in charge of the Reserva Natural La Planada,
especially to its former director Byron Guanga, for their
support during PAB and IDIR’s visit to La Planada in
2019, to Mauricio Zambrano for his help during the
fieldwork, and to Andrés Acosta-Galvis for assisting
us at the Instituto Alexander Von Humboldt in Villa de
Leyva (Colombia). This research was funded by project
PGC2018-097421-B-I00 of the Spanish Government
(PI: I. De la Riva).
Literature Cited
Araya-Salas M, Smith-Vidaurre G, Webster M. 2019.
Assessing the effect of sound file compression and
background noise on measures of acoustic signal
structure. Bioacoustics 28(1): 57-73.
Arteaga A, Bustamante L, Guayasamin JM. 2013.
The Amphibians and Reptiles of Mindo. Life in the
Cloudforest. Universidad Tecnologica Indoameérica,
Quito, Ecuador. 257 p.
Barrio-Amoros CA, Costales M, Vieira J, Osterman E,
Kaiser H, Arteaga A. 2020. Back from extinction:
rediscovery of the Harlequin Frog, Ate/opus
mindoensis Peters, 1973, in Ecuador. Herpetology
Notes 13: 325-328.
Bauer L. 1994. New names in the family Dendrobatidae
(Anura, Amphibia). Ripa [Den Haag] 1994(Fall): 1-6.
Bosch J, De la Riva I, Marquez R. 2000. Advertisement
calls of seven species of hyperoliid frogs from
Equatorial Guinea. Amphibia-Reptilia 21(2): 246-255.
Boulenger GA. 1882. Catalogue of the Batrachia
Salientia s. Ecaudata in the Collection of the British
Museum. Second Edition. Vaylor and Francis, London,
United Kingdom. 503 p.
Burrowes PA. 1987. An ecological study of a cloud
forest herpetofauna in southern Colombia. MLS.
November 2020 | Volume 14 | Number 3 | e265
Calls of two extirpated Colombian frogs
Thesis, Department of Systematics and Ecology, The
University of Kansas, Lawrence, Kansas, USA.
Castroviejo-Fisher S, Padial JM, De la Riva I, Pombal
JP, da Silva HR, Royas-Runjaic FJM, Medina-Méndez
E, Frost DR. 2015. Phylogenetic systematics of egg-
brooding frogs (Anura: Hemiphractidae) and the
evolution of direct development. Zootaxa 4004: 1-75.
Catenazzi A, Lehr E, Rodriguez LO, Vredenburg VT.
2011. Batrachochytrium dendrobatidis and _ the
collapse of anuran species richness and abundance
in the upper Manu National Park, southeastern Peru.
Conservation Biology 25(2): 382-391.
Catenazzi A, Lehr E, Vredenburg VT. 2014. Thermal
physiology, disease, and amphibian declines on the
eastern slopes of the Andes. Conservation Biology 28:
509-517.
Coloma LA. 1995. Ecuadorian frogs of the genus
Colostethus (Anura: Dendrobatidae). Miscellaneous
Publications, Museum of Natural History, University
of Kansas 87: 1-72.
Cornell Lab of Ornithology. 2014. Raven Pro: interactive
sound analysis software. Version 1.5. Available:
http://ravensoundsoftware.com/software/raven-pro/
[ Accessed: 20 March 2020].
De la Riva I, Burrowes PA. 2019. Alarma en el paraiso:
pasado, presente (jy futuro?) de los anfibios en la
reserva natural de La Planada, Colombia. Natural Mente
23: 55-62.
Duellman WE. 1970. The hylid frogs of Middle America.
Monograph of the Museum of Natural History, the
University of Kansas |: 1-753.
Duellman WE. 2015. Marsupial Frogs: Gastrotheca
and Allied Genera. John Hopkins University Press,
Baltimore, Maryland, USA. 427 p.
Duellman WE, Burrowes PA. 1989. New species of frogs,
Centrolenella, from the Pacific versant of Ecuador and
southern Colombia. Occasional Papers of the Museum
of Natural History, University of Kansas 132: 1-14.
Duellman WE, Hillis DM. 1987. Marsupial frogs (Anura:
Hylidae: Gastrotheca) of the Ecuadorian Andes:
resolution of taxonomic problems and phylogenetic
relationships. Herpetologica 43: 141-173.
Duellman WE, di Domenico S. 2020. Rediscovery of
the Fantastic Treefrog, Ecnomiohyla phantasmagoria
(Dunn) (Anura: Hylidae). Herpetological Review
51(2): 232-234.
Duellman WE, Maxson LR, Jesiolowski CA.
1988. Evolution of marsupial frogs (Hylidae:
Hemiphractinae): immunological evidence. Copeia
1988: 527-543.
Edwards SR. 1971. Taxonomic notes on South American
Colostethus with descriptions of two new species
(Amphibia, Dendrobatidae). Proceedings of the
Biological Society of Washington 84: 147-162.
Frost DR. 2020. Amphibian Species of the World: an
Online Reference. Version 6.1. American Museum
of Natural History, New York, New York, USA.
Amphib. Reptile Conserv.
Available: —_ https://amphibiansoftheworld.amnh.org/
index.php [Accessed: 15 April 2020].
Frost DR, Grant T, Faivovich J, Bain RH, Haas A, Haddad
CFB, de Sa RO, Channing A, Wilkinson M, Donnellan
SC, et al. 2006. The amphibian tree of life. Bulletin of
the American Museum of Natural History 297: \—370.
Gerhardt HC. 1994. The evolution of vocalization in frogs
and toads. Annual Review of Ecology and Systematics
25: 293-324.
Goicoechea N, De la Riva I, Padial JM. 2010. Recovering
phylogenetic signal from frog mating calls. Zoologica
Scripta 39(2): 141-154.
Grant T, Humphrey EC, Myers CW. 1997. The median
lingual process of frogs: a bizarre character of
Old World ranoids discovered in South American
dendrobatids. American Museum Novitates 3212:
1-40.
Grant T, Frost DR, Caldwell JP, Gagliardo R, Haddad
CFB, Kok PJR, Means DB, Noonan BP, Schargel
WE, Wheeler WC. 2006. Phylogenetic systematics
of dart-poison frogs and their relatives (Amphibia:
Athesphatanura: Dendrobatidae). Bulletin of the
American Museum of Natural History 299: 1-262.
Grant T, Rada M, Anganoy-Criollo MA, Batista A, Dias
PHS, Jeckel AM, Machado DJ, Rueda-Almonacid JV.
2017. Phylogenetic systematics of dart-poison frogs
and their relatives revisited (Anura: Dendrobatoidea).
South American Journal of Herpetology 12(Special
Issue): 1-90.
Guillory WX, Muell MR, Summers K, Brown JL. 2019.
Phylogenomic reconstruction of the Neotropical
poison frogs (Dendrobatidae) and their conservation.
Diversity 11(8): 126.
IUCN. 2019. The IUCN Red List of Threatened Species.
Version 2019-3. Available: http://www. iucnredlist.org
[ Accessed: 30 March 2020].
IUCN SSC Amphibian Specialist Group. 2019a.
Ameerega andina. The IUCN Red List of Threatened
Species 2019: e.T55212A49338865.
IUCN SSC Amphibian Specialist Group. 2019b.
Gastrotheca guentheri. The IUCN Red List of
Threatened Species 2019: e.T55338A85898956.
Kahn TR, La Marca E, Lotters S, Brown JL, Twomey
E, Amézquita A. (Editors). 2016. Aposematic
Poison Frogs (Dentrobatidae) of the Andean
Countries: Bolivia, Colombia, Ecuador, Peru, and
Venezuela. Tropical Field Guide Series. Conservation
International, Arlington, Virginia, USA. xxii + 588 p.
Kohler J, Jansen M, Rodriguez A, Kok PJR, Toledo LF,
Emmrich M, Glaw F, Haddad CFB, Rodel M-O, Vences
M. 2017. The use of bioacoustics in anuran taxonomy:
theory, terminology, methods, and recommendations
for best practice. Zootaxa 4251(1): 1-124.
Lips KR. 1998. Decline of a tropical montane amphibian
fauna. Conservation Biology 12: 106-117.
Lips KR. 1999. Mass mortality and population declines
of anurans at an upland site in western Panama.
November 2020 | Volume 14 | Number 3 | e265
De la Riva et al.
Conservation Biology 13: 117-125.
Lips KR, Brem F, Brenes R, Reeve JD, Alford RA,
Voyles J, Carey C, Livo L, Pessier AP, Collins JP.
2006. Emerging infectious disease and the loss of
biodiversity in a Neotropical amphibian community.
Proceedings of the National Academy of Sciences of
the United States of America 103: 3,165—3,170.
Lips KR, Diffendorfer J, Mendelson III JR, Sears MW.
2008. Riding the wave: reconciling the roles of disease
and climate change in amphibian declines. PLoS
Biology 6(3): e72.
Lotters S, Jungfer K-H, Henkel FW, Schmidt W.
2007. Poison Frogs. Biology, Species, and Captive
Husbandry. Edition Chimaira, Frankfurt am Main,
Germany. 668 p.
Lynch JD, Burrowes PA. 1990. The frogs of the genus
Eleutherodactylus (family Leptodactylidae) at the
La Planada Reserve in southwestern Colombia, with
descriptions of eight new species. Occasional Papers
of the Museum of Natural History, University of
Kansas 136: 1-31.
Mufioz-Arcos R, Guerrero-Cupacan JA, Cepeda-Quilindo
B. 2016. First record of Pristimantis crucifer Boulenger,
1899 (Anura: Craugastoridae) from Colombia, Narifio
Department. Check List 12(6): 2,021.
Myers CW, Burrowes PA. 1987. A new poison frog
(Dendrobates) from Andean Colombia, with notes on
a lowland relative. American Museum Novitates 2899:
1-17.
Myers CW, Ibafiez R, Grant T, Jaramillo CA. 2012.
Discovery of the frog genus Anomaloglossus in
Panama, with descriptions of two new species from the
Chagres Highlands (Dendrobatoidea: Aromobatidae).
American Museum Novitates 3763: 1-19.
Paluh DJ, Stanley EL, Blackburn DC. 2019. First dietary
record of Gastrotheca guentheri (Boulenger, 1882), the
lone anuran with true mandibular teeth. Herpetology
Notes 12: 699-700.
Pisso GA, Silva ML, Maya AM, Vanegas J, Duran G.
2018. Lista preliminar de los anfibios del Parque
Nacional Natural Munchique y areas de influencia,
departamento del Cauca—Colombia. Revista
Novedades Colombianas 13(1): 49-80.
Scheele BC, Pasmans F, Berger L, Skerratt L, Martel A,
Beukema W, Acevedo AA, Burrowes PA, Carvalho T,
Catenazzi A, et al. 2019. Amphibian fungal panzootic
reveals catastrophic and ongoing loss of biodiversity.
Science 363(6434): 1,459-1,463.
Serrano-Rojas SJ, Whitworth A, Villacampa J, Von May
R, Gutiérrez RC, Padial JM, Chaparro JC. 2017. Anew
Species of poison-dart frog (Anura: Dendrobatidae)
from Manu province, Amazon region of southeastern
Peru, with notes on its natural history, bioacoustics,
phylogenetics, and recommended conservation status.
Zootaxa 4221(1): 71-94.
Sinsch U, Juraske N. 2006. Advertisement calls of
hemiphractine marsupial frogs: II. Gastrotheca
plumbea_ group. Pp. 149-152 In: Herpetologia
Bonnensis IT. Proceedings of the 13 Congress of the
Societas Europaea Herpetologica. Editors, Vences
M, Kohler J, Ziegler T, Bohme W. Societas Europaea
Herpetologica, Bonn, Germany. 262 p.
Smith-Patten BD, Bridge ES, Crawford PH, Hough DJ,
Kelly JF, Patten MA. 2015. Is extinction forever?
Public Understanding of Science 24(4): 481-495.
Sueur J, Aubin T, Simonis C. 2008. Equipment review:
Seewave, a free modular tool for sound analysis and
synthesis. Bioacoustics 18: 218-226.
Vigle GO, Miyata K. 1980. A new species of Dendrobates
(Anura: Dendrobatidae) from the lowland rain forests
of western Ecuador. Breviora 459: 1-7.
Wake DB, Vredenburg VT. 2008. Are we in the midst
of the sixth mass extinction? A view from the
world of amphibians. Proceedings of the National
Academy of Sciences of the United States of America
105(Supplement 1): 11,466—11,473.
Wiens JJ. 2011. Re-evolution of lost mandibular teeth
in frogs after more than 200 million years, and re-
evaluating Dollo’s Law. Evolution 65: 1,283—1,296.
Wiens JJ, Kuczynski CA, Duellman WE, Reeder TW.
2007. Loss and re-evolution of complex life cycles
in marsupial frogs: does ancestral trait reconstruction
mislead? Evolution 61(8): 1,886—1,899.
Ignacio De la Riva is a tenured scientist and Curator of Herpetology at the Museo Nacional de
Ciencias Naturales-High Council of Scientific Research (MNCN-CSIC) in Madrid, Spain. He
graduated and obtained his Ph.D. in Biology from the Universidad Complutense (Madrid, Spain), and
later held postdoctoral and visiting scholar positions at The University of Kansas (USA) and James
Cook University (Australia). His main lines of research include systematics, life history, thermal
ecology, biogeography, and the roles of emergent diseases and climatic change on several groups of
tropical amphibians and reptiles. Ignacio is an author of more than 180 scientific publications and
has described nearly 80 new species of tropical amphibians and reptiles. Two species have been
named after him, an Amazonian treefrog (Dendropsophus delarivai) and (shared with J.M. Padial)
a Saharan gekkonid (Ptvodactylus rivapadiali).
Amphib. Reptile Conserv.
187
November 2020 | Volume 14 | Number 3 | e265
Amphib. Reptile Conserv.
Calls of two extirpated Colombian frogs
Claudia Lansac studied Biology at the Universidad Complutense (UCM) in Madrid and completed
her M.Sc. in Conservation and Biodiversity of Tropical Areas at the Universidad Internacional
Menéndez Pelayo-Spanish National Research Council (UIMP-CSIC). Her main research interests
are the ecology, systematics, biogeography, bioacoustics, and conservation of tropical herpetofauna,
particularly amphibians.
Belisario Cepeda-Quilindo obtained his Ph.D. from the Universidad Nacional de Colombia,
Bogota, and is currently a full Professor of Biology at the Facultad de Ciencias Exactas y Naturales,
Universidad de Narifio, Pasto (Colombia), and curator of the collection of amphibians and reptiles
(PSO-CZ) of that university. Belisario belongs to the research group on the Biology of Paramos and
Andean Ecosystems, and his main interests are the life history, taxonomy, biogeography, ecology, and
conservation of Andean and Pacific lowland amphibians and reptiles.
Guillermo Cantillo Figueroa studied Biology at the Universidad del Valle, Cali (Colombia),
and was one of the founders of the Reserva Natural La Planada, where he collected many of the
amphibians and reptiles that are currently deposited at the PSO-CZ of the Universidad de Narifio,
Pasto. He participates in the implementation of the management plan of La Planada, and works on
the conservation of amphibians and reptiles in the Awa territory (which includes areas in Ecuador and
Colombia), promoting scientific tourism in the area.
Jacopo De Luca is an Italian zoologist who received his B.Sc. in Biology and Master’s degree in
Biodiversity and Ecosystem Management from the Universita degli Studi Roma Tre, Rome. Jacopo is
interested in the ecology and conservation of amphibians and reptiles in Italy, and his current research
focuses on bioacoustic, biotremological, and behavioral ecology studies.
Laura Gonzalez Ortiz is a biologist, manager of the animal sound library Fonoteca
Zoologica, and webmaster of its website at http://www.fonozoo.com. The Fonoteca Zoologica
belongs to the Museo Nacional de Ciencias Naturales-CSIC (Madrid, Spain), and is one of the major
collections of animal sounds in the world, including the calls of over 1,000 species of frogs. This
resource provides support for research on bioacoustics and acts as a global repository of animal
recordings for scientific research.
Rafael Marquez obtained his B.S. and M.S. degrees from University of California, Berkeley, and
his Ph.D. in Ecology and Evolution from the University of Chicago (Illinois, USA). He is a senior
researcher at Museo Nacional de Ciencias Naturales (CSIC), Madrid, Spain, and the founder and
director of Fonoteca Zoolégica—the museum’s scientific collection of animal sounds at http://www.
fonozoo.com. His research deals with bioacoustics and animal communication, the conservation
biology of amphibians and reptiles, ecoacoustics, and biotremology.
Patricia A. Burrowes is a Professor in the Department of Biology at The University of Puerto Rico in
San Juan. She received her Ph.D. at the University of Kansas under the mentorship of W.E. Duellman,
and her early-career research interests included the community ecology, reproductive behavior, and
population genetics of tropical amphibians. During the precipitous decline of amphibian populations
worldwide, she has dedicated her efforts to studying the factors involved in this crisis, particularly
the ecology of chytridiomycosis under enzootic conditions and the responses of tropical amphibians
to climate warming.
188 November 2020 | Volume 14 | Number 3 | e265
Official journal website:
amphibian-reptile-conservation.org
Amphibian & Reptile Conservation
14(3) [General Section]: 189-199 (e266).
of
Ry
ptile-con*
Alien populations of painted frogs, genus Discoglossus,
on the southeastern coast of France: two examples of
anthropogenic introduction
1*Julien Renet, 7Rémi Duguet, *Mathieu Policain, *Alison Piquet, “Vincent Fradet, °Pauline Priol,
‘Grégory Deso, *Francgois Grimal, °Giuseppe Sotgiu, and ‘°Miguel Vences
‘Conservatoire d’espaces naturels de Provence-Alpes-Cote d’Azur, Pole Biodiversité régionale, 18 avenue du Gand, 04200 Sisteron, FRANCE
*Alcedo Faune et Flore, 85 impasse Bas Laval, 07110 Sanilhac, FRANCE ?Association Colinéo, 1 chemin des Grives, 13013 Marseille, FRANCE
424 avenue de Ballancourt, 91760 Itteville, FRANCE °53 chemin Cami Founjut, 34350 Valras Plage, FRANCE °StatiPop-Scientific Consulting, 4
avenue de Nimes, 34190 Ganges, FRANCE ‘Association herpétologique de Provence Alpes Méditerranée, Maison des associations, 384 route de
Caderousse, 84100 Orange, FRANCE *Ligue pour la Protection des Oiseaux Provence-Alpes-Cote d’Azur, 6 Avenue Jean Jaurés, 83400 Hyéres,
FRANCE °Zirichiltaggi - Sardinia Wildlife Conservation, Non Profit Association, Sassari, ITALY '°Zoological Institute, Technische Universitdt
Braunschweig, Mendelssohnstr. 4, 38106 Braunschweig, GERMANY
Abstract.—Introductions of animals and plants by humans permanently restructure the distribution ranges of
species and the compositions of communities, a phenomenon which has been intensified in recent decades
with globalization. However, it is often difficult to date these introductions or to identify the geographic origin
of the introduced individuals. In this study, genetic variation in the mitochondrial gene for cytochrome b was
examined in native populations of painted frogs (genus Discoglossus) and introduced individuals discovered
at two novel locations in the south-east of France, to determine their specific ranks and origins. The population
of Discoglossus sardus identified at Marseille probably originated from Corsica, and that of Discoglossus
pictus discovered at Grimaud in the Var Department probably originated from the previously introduced range
of the species in the southwestern Mediterranean region of France. These newly discovered populations of
painted frogs represent an unresolved conservation issue, as they are allochthonous in the respective regions
on one hand, but on the other hand they belong to species which are legally protected in France and Europe. As
next steps, assessing their range expansion is important, as is studying the nature of the relationship between
these painted frog populations and the native amphibian communities.
Keywords. Anura, biogeography, conservation, human introduction, invasive capacity, native range
Résumé.—Les introductions humaines d’animaux et de plantes restructurent en permanence Il’aire de repartition
des espéces et la composition des communautés, phenomeéne qui s’est intensifié ces dernieres décennies avec
la mondialisation. Cependant, il est souvent difficile de dater ces introductions et d’identifier leurs origines.
Dans cette etude, la variation génétique du gene mitochondrial du cytochrome b a ete examinee dans des
populations indigenes de discoglosses (genre Discoglossus) et chez des individus introduits, découverts
sur deux localités inédites dans le sud-est de la France. L’objectif etant de déterminer le rang spécifique et
l’origine des discoglosses observes sur ces nouvelles localités. Les analyses temoignent de la présence de
Discoglossus sardus (probablement originaire de Corse) a Marseille et de Discoglossus pictus (provenant
probablement de l’aire d’introduction de l’espece située dans le sud-ouest de la region méditerraneene
francaise) a Grimaud dans le département du Var. Ces populations nouvellement déecouvertes representent
un probleme de conservation non resolu, car elles sont d’une part allochtones dans les localités respectives,
mais d’autre part appartiennent a des espéces légalement protégées en France et en Europe. A l’avenir, il sera
important d’évaluer leur expansion geographique et d’etudier la nature de la relation entre ces populations de
discoglosses et les communauteés d’amphibiens indigenes.
Mots clés. Anoure, biogéographie, conservation, introduction humaine, capacité d’ invasion, aire de répartition d’ origine
Citation: Renet J, Duguet R, Policain M, Piquet A, Fradet V, Priol P, Deso G, Grimal F, Sotgiu G, Vences M. 2020. Alien populations of painted frogs,
genus Discoglossus, on the southeastern coast of France: two examples of anthropogenic introduction. Amphibian & Reptile Conservation 14(3)
[General Section]: 189-199 (e266).
Copyright: © 2020 Renet et al. This is an open access article distributed under the terms of the Creative Commons Attribution License [Attribution
4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction in any
medium, provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced, are
as follows: official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 19 June 2020; Published: 6 November 2020
Correspondence. *
[email protected]
Amphib. Reptile Conserv. 189 November 2020 | Volume 14 | Number 3 | e266
Anthropogenic introduction of Discoglossus in southern France
Introduction
The presence of barriers, both natural (e.g., rivers, sea,
mountains) and artificial (e.g., roads, urban centers), often
limits the dispersal of terrestrial vertebrates (Peres et al.
1996; Epps et al. 2005; Riley et al. 2006; Delaney et al.
2010; Chiari et al. 2012). However, by their historic and
contemporary activities, such as transport, international
trade, experiments, agriculture, etc., humans have
caused the introduction of species into territories far
from their original distribution (PySek et al. 2010). This
phenomenon has been exacerbated in recent decades
due to globalization, which has intensified terrestrial,
aerial, and sea transport, and increased international
trade (Levine and D’ Antonio 2003; Westphal et al. 2008:
Hulme 2009). Many organisms, including amphibians,
are affected by these anthropic introductions (either
accidental or voluntary), which are often characterized
by high potential population growth rates, allowing the
introduced species to become permanently established
(Kraus 2015; Aellen et al. 2017).
In France, numerous non-native amphibian species
have settled successfully. Among the more historical
introductions (1.e., in the early 20" century) are
Discoglossus pictus in Banyuls-sur-Mer (Pyrénées-
Orientales) and probably 7riturus carnifex, which was
introduced in Chéne-Bourg (Switzerland) [Lescure and
de Massary 2012] very near the border with France
and is now present in Ain and Haute-Savoie, around
Leman Lake (Arntzen 2001; Dufresnes et al. 2016).
During the mid-20" century, Pelophylax bergeri was
translocated from Central Italy multiple times, resulting
in introgressive hybridization with native populations
of its sister taxon Pelophylax lessonae (Dufresnes et al.
2017). During this time, massive importations of several
other Pelophylax species (e.g., P. bedriagae) for human
consumption also occurred (Pagano et al. 2003).
More recently, Lithobates catesbeianus was
introduced in Arveyres (Gironde), Xenopus laevis in
Bouillé-Saint-Paul (Deux-Sevres), Bombina bombina in
Albestroff (Moselle), and Eleutherodactylus johnstonei
in the urban zone of Nantes (Loire-Atlantique) [Lescure
and de Massary 2012; Labadesse and Eggert 2018]. In
addition, some indigenous species have been translocated
within France, such as Hyla meridionalis into Hyeres
Islands (Knoepffler 1961), Jchthyosaura alpestris on
the limestone plateau of Larzac (Hérault) [Denoél 2005;
Geniez and Cheylan 2012], and Speleomantes strinatii
into a mine in the French Pyrénées (Ariege) [Lunghi et
al. 2018] and a cave near Angles-sur-l’ Anglin (Vienne)
[Lucente et al. 2016].
This report documents two additional cases, based on
observations of painted frogs (Discoglossus) between
2011 and 2018 at two continental localities in the south-
east of France, in the city of Marseille (Bouches-du-
Rhone Department), and in a plain and semi-urban zone
in the locality of Grimaud (Var Department) [Table 1,
Fig. 1]. These observations have generated strong interest
because the localities are geographically distant from the
documented ranges of the two species of Discoglossus
known to be present in France (Fig. 1). Discoglossus
sardus is distributed in Sardinia, in the Tuscan
Archipelago and the adjacent Italian coast, and in France
in the eastern part of Hyeres Islands (Port-Cros and the
Levant Islands) and Corsica (Delaugerre and Cheylan
1992; Lescure and de Massary 2012). The other species,
Discoglossus pictus, is indigenous to North Africa
(Algeria and Tunisia), Sicily, Malta, and Gozo (Sindaco
et al. 2006). However, since D. pictus was originally
introduced into France in the department of Pyrenees-
Orientales, it has colonized the adjacent departments
of Aude, Hérault (Knoepffler 1962; Fradet and Geniez
2004; Geniez and Cheylan 2012), and the extreme north-
east of Spain (Franch et al. 2007).
Because of the difficulty in unambiguously identifying
species of Discoglossus by morphological criteria alone,
molecular phylogenetic analyses were conducted to
assess the species identity and geographic origins of the
observed painted frogs from the two novel locations in
mainland France.
Materials and Methods
Genetic samples. Tissue samples and buccal swabs were
taken on 31 May 2018 and 17 June 2018, respectively,
from nine tadpoles from Marseille; and on 7 November
Table 1. Available data on the occurrences of the two introduced species of Discoglossus on the southeastern coast of France. Ind. =
Indeterminate.
Latitude
Species Date Locality (N)
Discoglossus sardus 17 June 2011 Marseille 43°20°47.3”
17 June 2015 Marseille 43°20°46.5”
31 March 2018 Marseille 43°20’20.9”
16 April 2018 Marseille 43°21°00.7”
Discoglossus pictus 2016-2017 Grimaud 43°16732.2”
2016-2017 Grimaud 43°16759.0”
2016-2017 Grimaud 43°16712.7”
7 November 2018 Grimaud 43°15’52.6”
Amphib. Reptile Conserv.
190
Longitude Number of
(E) specimens an ht
5°267 10:9" 3-4 A. Piquet
5°26722.4” 1 V. Mariani
5°26°32.4” 3 M. Policain
5226125" 60 M. Policain and F. Grimal
Gs a5 2e) Ind. V. Fradet and A. Dubois
6°30’59.8” Ind. V. Fradet and A. Dubois
6°33’02.6” Ind. V. Fradet and A. Dubois
6°33'39N" 3 J. Renet, M. Policain, and M. Marmier
November 2020 | Volume 14 | Number 3 | e266
Renet et al.
por Rey ee
S
a LD
ll iF:
100 200km N
A
Levant Island
mg Oe .... Island
Fig. 1. (A) Map of the ranges of D. sardus (orange: native population range) and D. pictus (purple: original distribution range; pink:
introduced population range). (B) Enlarged view of the area with the newly introduced populations of the two species in southern
France (orange star: D. sardus in Marseille; pink square: D. pictus in Grimaud), which is indicated by the black rectangle in (A).
2018 from two adult specimens from Grimaud (Fig. 2C).
The sampled individuals were collected at night along two
small shady streams and in a water-filled moat bordering
a wasteland and a vineyard (Fig. 2B,D). Additional
comparative samples were collected from various sites
in Sardinia, Corsica, and the Hyeres Archipelago (Port-
Cros), in the form of either muscle tissue samples from
roadkill specimens or tail tips of tadpoles.
Genetic analyses. Total genomic DNA was extracted
from the buccal swabs and tissue samples using a salt
extraction protocol (Bruford etal. 1992). A fragment of the
mitochondrial gene for cytochrome b (cob) was amplified
using the primers in Zangari et al. (2006): MVZ15-L
Amphib. Reptile Conserv.
(GAACTAATGGCCCACACWWTACGNAA) | and
H15149-H (AAACTGCAGCCCCTCAGAATGATATT
TGTCCTCA). As these primers did not reliably
amplify the respective fragment, particularly in D.
sardus, most samples were also amplified using
two newly developed specific primers: Dsard-Fwd
(TGACCTACCTACCCCATCCA) and Dsard-Rev
(GGGCAGTACGTAGCCTACAA). For both primer
pairs, the PCR protocol consisted of an initial step of 90
sec at 94 °C, followed by 35 steps of 94 °C (30 sec),
53 °C (45 sec), 72 °C (90 sec), and a final elongation
step of 10 min at 72 °C. PCR products were treated
with exonuclease I (New England Biolabs) and shrimp
alkaline phosphatase (Promega) to inactivate remaining
November 2020 | Volume 14 | Number 3 | e266
Anthropogenic introduction of Discoglossus in southern France
ee,
vs
Fig. 2. (A) Discoglossus sardus from Marseille, 31 May 2018. (B) Discoglossus sardus habitat in the city of Marseille.
(C) Adult Discoglossus pictus from Grimaud, 7 November 2018. (D) Discoglossus pictus habitat in Grimaud. The white arrow
indicates the position of a ditch filled with water, where three individuals were observed. Photos by Mathieu Policain (A—B), Julien
Renet (C), and Google Map/Street View (D).
primers and dNTPs, and then sent for sequencing to
LGC Genomics (Berlin, Germany). Chromatographs
were checked and obvious errors in automated sequence
reads were corrected using Codon-Code Aligner (v2.0.6,
Codon Code Corporation). All newly determined
sequences were submitted to GenBank (accession
numbers MT569346—MT569387).
The cytochrome 5 fragment used was chosen to allow
comparisons with the results of Zangari et al. (2006), who
published sequences of D. sardus and all other species
in the genus from various localities. These sequences
were downloaded from GenBank and trimmed to match
the shorter length of the sequences produced using the
specific D. sardus primer pairs listed above. Note that
this fragment is not homologous with the one used by
Martinez-Solano (2004) and Vences et al. (2014), and
therefore direct comparisons with the results of those
studies (which focused on D. galganoi and D. pictus) are
not possible.
Sequences were aligned and phylogenetic analysis
was conducted using MEGA, v. 7 (Kumar et al. 2016).
The sequences were first aligned using the Clustal
algorithm, then the appropriate substitution model
(Kimura-2-parameter + G) was selected under the
Akaike Information Criterion, phylogenetic trees were
subsequently inferred under the Maximum Likelihood
Amphib. Reptile Conserv.
(ML) optimality criterion with NNI branch swapping, and
node support was assessed with 500 bootstrap replicates.
The tree was rooted with D. montalentii, which represents
the sister species to all other Discoglossus (Zangari et al.
2006; Pabiyjan et al. 2012; Biton et al. 2013; Dufresnes et
al. 2020).
Results and Discussion
Genetic Identity of the New Discoglossus Populations
The Maximum Likelihood tree reconstructed from the
258 bp cytochrome 5b segment retained for analysis
(Fig. 3) recovered phylogenetic relationships among
Discoglossus species which were largely similar to those
of more comprehensive, multi-gene studies (Zangari et
al. 2006; Pabijan et al. 2012; Biton et al. 2013; Dufresnes
et al. 2020). However, as expected from such a short
gene fragment, the relationships among most species
were not reliably resolved. All species of Discoglossus
were recovered as monophyletic groups, with bootstrap
supports of 90-99%,
For the new continental French populations that are
the focus of the present study, the tree is unambiguous
in placing the samples from Marseille into the D. sardus
clade, and the samples from Grimaud into the D. pictus
November 2020 | Volume 14 | Number 3 | e266
Renet et al.
France: Marseille / 170618 8
France: Marseille / 17061:
France: Marseille / 0106
| France: Marseille / 0106:
France: Marseille / 01062
France: Marseille / 0106
| France: Marseille / 0106
France: Marseille / 01062
France: Marseille / 17061:
France: Corsica, Vivario / 2013
France: Corsica, Col de L
France: Corsica, La |
L
France: Corsica, ne
France: Corsica, Tiucci:
France: Port-Cros, Notr
63|| France: Port-Cros, Anse |
France: Port-Cros, Ni
5| France: Port-Cros, Notr
France: Port-Cros, Vall
France: Port-Cros, Vall
62 France: Port-Cros, Ve
| Italy: Sardinia, Tempio Pai
‘Italy: Sardinia, Tempio Pai
Italy: Sardinia, Santa Ter
Italy: Sardinia, Santa Ter
Italy: Sardinia, Thiesi / S:
Italy: Sardinia, Thiesi / S2
France: Corsica, Col de E
- Italy: Sardinia, Sassari /
Italy: Sardinia, Sassari / S20:
Italy: Sardinia, near Nuoro / Z
9g| Morocco: Kenitra / Z ph14
| Morocco: Kenitra / Z phn1
| Moroceat Oued Laou / Z
Spain: Arené
Spain: Sierra Morena
Spain: Sierra Moren:
Spain: Ronda / Z gh
Morocco: near Debdou / Z ph8 (AY
94| Morocco: Sebdou and Taforalt / Z phd
Morocco: near Debdou / Z ph7 (AY347
Algeria: Akfadou / Z ph6 (AY347426)
| Italy: Sicily, near Palermo / Z ph2 :
Italy: Sicily, Piane Albanesi / Z ph rd
Tunisia: Tabarca and. 5E
Italy: Sicily, near Pale é
~ Malta / Z ph10 (AY347.
| France: Grimaud / MVTIS €
59] France: Banyuls sur iat
72' France: Grimaud /
France: Corsica, near Vizzavon
eae France: Corsica, Cascade des An
ne 84' France: Corsica, near Stazzone de
Fig. 3. Maximum Likelihood tree of Discoglossus based on a 258 bp fragment of the mitochondrial cytochrome b gene. Numbers
at nodes are bootstrap values (500 pseudoreplicates) in percent. After the locality, sample numbers are given, including GenBank
accession numbers in parentheses for those sequences taken from GenBank. “Z” marks sequences from the work of Zangari et al.
(2006). Samples from the two newly discovered introduced populations are highlighted in bold, red font.
Amphib. Reptile Conserv. 193 November 2020 | Volume 14 | Number 3 | e266
Anthropogenic introduction of Discoglossus in southern France
clade. All nine D. sardus specimens sequenced from
Marseille had identical sequences, and the same haplotype
was also found in two localities in Corsica. In contrast,
all sequenced specimens from the Hyeres Archipelago
and from Sardinia differed by at least three mutations,
suggesting that the Marseille population most likely
originated by the introduction of only a few individuals
from Corsica. Of the two specimens from Grimaud, one
had a haplotype identical to that of a specimen from
Banyuls-sur-Mer, while the second one differed by a
single mutation. This suggests a probable origin of this
population by introduction from the invasive range of D.
pictus in the southwestern French Mediterranean region.
The tree generated here also recapitulates the
surprising finding of Zangari et al. (2006) regarding the
presence of rather distinct mitochondrial haplotypes of
D. pictus in Sicily. It also reveals that D. sardus from
Corsica and Sardinia are not reciprocally monophyletic
based on mitochondrial DNA. In this latter case, the one
Corsican D. sardus (from Col d’Eustache) clustering
among the Sardinian haplotypes was sequenced several
months before the samples from Sardinia were processed,
which excludes the possibility of an artifact due to a
mislabelled sample or contamination.
Geographic Origin and Status of the New Discoglossus
Populations
The results of this analysis shed a new light on the ranges
of the two species of Discoglossus that are present in the
south of France. In the population of D. sardus established
in Marseille represents the second known mainland
population, after the population of Monte Argentario
peninsula (Tuscany, Italy). The genetic similarity of the
Marseille samples with those from the two Corsican
localities allow us to refute the hypothesis of an ancient
relict population naturally occurring in Marseille. In
such a case we would expect genetic relationships with
the individuals from Port-Cros or the Levant islands
(Hyeres Archipelago), which are geographically much
closer to Marseille than Corsica. On the contrary, an
introduction from Corsica is consistent with the intensity
of the maritime traffic between Corsica and Marseille,
and the apparent lack of genetic diversity in the Marseille
samples is also in agreement with an introduced origin.
Even if the date of introduction of this species cannot be
determined, its spread over an area of approximately 0.66
km? suggests that the arrival of D. sardus in Marseille is
not very recent.
With a geographic extension of almost 210 km to
the east (1.e., the distance between the easternmost
population known to date and the recently discovered
population at Grimaud), and its crossing of the Rhone
River, the anthropic introduction of D. pictus is beyond
doubt. Its arrival in Grimaud, along the La Garde river,
could be linked with the trade activities of the many
nurseries and garden stores (12 shops identified within
Amphib. Reptile Conserv.
10 km of the sampling locality), which are known to be
vectors of various species introductions worldwide (e.g.,
anurans, snails, plants; Christy et al. 2007; Bergey et al.
2014).
The two newly detected introductions of Discoglossus
in continental France could have been accidental, or they
could have been deliberate due to a variety of motivations,
such as experimental studies on naturalization conducted
in the past, or the liberation of captive animals. For
instance, D. sardus tadpoles from Port-Cros Island were
introduced into a tributary of la Mole river (Var) as an
experiment in 1955, and this attempt at establishing a
reproducing population is known to have succeeded at
least until 1959 (Knoeppfler 1962).
The discoveries of these new populations testify
once again that today the natural elements, such as
rivers or oceans, do not represent absolute barriers for
either native or allochthonous species. Invasion success
generally depends more on the ability of a species to
respond to natural selection than on broad physiological
tolerance or plasticity (Lee 2002). In the present case,
considering the ranges of these two species and their
reproductive status, it seems that they can be considered
as successful colonizers. In fact, more comprehensive
phylogeographic studies of D. pictus and D. sardus in
the future should also examine the possibilities of D.
sardus translocations among Corsica and Sardinia (given
the clustering of the one Corsican haplotype among the
Sardinian haplotypes; Fig. 3) and of D. pictus to or from
Sicily (given the presence of highly distinct haplotypes
on this island; Fig. 3).
Conservation Issues
Williamson (1996) considers that a biological invasion
occurs when an organism takes root outside of its
indigenous range. The IUCN Invasive Species Specialist
Group proposes a more specific definition—that a
biological invasion has occurred as soon as an introduced
species 1s a factor of damage and affects the local
biodiversity. In fact, it is important to distinguish between
an allochthonous species introduced by humans, which
is inoffensive in many cases, and an invasive species,
which, by definition, is not only introduced outside of
is indigenous range but also exerts a negative impact
on biodiversity and more globally on the ecosystem
(Lambertini et al. 2011).
In the urban and sub-optimal ecological context of the
city of Marseille, the population of D. sardus probably
does not represent a threat to the ecosystem, which is
a priori of ‘low ecological value.’ Furthermore, this
population is already threatened by a large-scale urban
development project. Although D. sardus is considered
to be Least Concern in both the IUCN Red List and the
National French Red List (Andreone et al. 2009; UICN
France et al. 2015), the global assessment has determined
a decreasing population trend. This points to an important
November 2020 | Volume 14 | Number 3 | e266
Renet et al.
and challenging dilemma highlighted by Marchetti and
Engstrom (2016): how to manage allochthonous, or even
invasive species, that are threatened (or may become
threatened in the future) in their native range? Several
authors (e.g., Marris 2014; Heise 2018) have suggested
pragmatic approaches when dealing with non-native
species, especially in urban environments which indeed
could become sanctuaries for many species (native
or not) that are threatened in their original habitat.
Especially with shifting ranges due to climatic change, the
distinctions between native and non-native will become
increasingly vague, and human-aided translocations of
some threatened species are already being discussed
(Egan et al. 2018).
These elements lead us to consider the presence of
these new Discoglossus populations as a high-priority
conservation issue. We can also add that D. sardus is
assessed as Threatened in the Var Department (cat. VU
IUCN Redlist) [Marchand et al. 2017], and as threatened
with extinction at Port-Cros Island, Port-Cros National
Park (Duguet et al. 2019).
Concerning D. pictus, the question of its biological
status requires more scrutiny because other authors have
attributed an invasive nature with a high rate of dispersal
to this species (Montori et al. 2007). Its invasive capacity
does not seem to be related to its adaptive advantages,
but rather to the suitability of local abiotic conditions
(Escoriza et al. 2014). The modeling of its potential
habitat conducted by Escoriza et al. (2014) includes areas
that are geographically near the locality of Grimaud, and
incorporation of the new occurrences should allow an
adjustment of the predictive models. Furthermore, the
potential area of this species should be considered as
wider than suggested by previous models. In any case,
the expansion of D. pictus from a single location in
Banyuls-sur-Mer, Eastern Pyrénées a century ago (see
Wintrebert 1908) is not an artifact; 1.e., 1t represents a
natural range expansion (Pujol-Bux6 et al. 2019a) into a
currently occupied area in France and Catalonia of more
than 10,000 km? (Montori et al. 2009). A negative impact
of this species on co-occurring anurans (e.g., Pelodytes
punctatus and Epidalea calamita) has been suspected
(Escoriza and Boix 2012, 2014; Richter-Boix et al. 2013;
San Sebastian et al. 2015). However, this possibility
requires further study as some have hypothesized that
temporal or evolutionary changes may have moderated
the effects and disturbance of D. pictus on native species
(Pujol-Bux6 et al. 2019b).
In any event, according to the actual current French
regulations, all individuals of both species, as well as
their “core” habitat, are strictly protected by a ministerial
order (DEVNO0766175A). Although a recent update of
this order would specifically exclude D. pictus, we hope
for the continued regulatory protection of D. pictus in
French territory. Given the similarities in biotic features
between the source and recipient communities (Escoriza
and Ruhi 2016), we suspect that Discoglossus species
Amphib. Reptile Conserv.
are probably not harmful to the local French anuran
communities, and we therefore do not recommend the
eradication of their non-native populations.
Lastly, to better manage this situation going forward,
we recommend a monitoring program to: (1) characterize
a predictable range expansion of these two painted
frog species in adjacent localities; and (2) implement
complementary studies in order to better assess the nature
of the relationship between these introduced species and
the native amphibian communities.
Acknowledgements.—Fieldwork and sampling were
permitted by the French Government (permits n° 2017-
68/PJI and by prefect order of the Bouches-du-Rh6ne).
We warmly thank the two reviewers, Daniel Escoriza
and Sebastiano Salvidio, for providing useful comments.
We also would like to thank Marin Marmier for his field
assistance, and Giacomo Rosa for the revision of the
English text.
Literature Cited
Aellen WL, Street SE, Capellini I. 2017. Fast life history
traits promote invasion success in amphibians and
reptiles. Ecology Letters 20: 222-230.
Andreone F, Lecis R, Miaud C, Corti C, Sindaco
R, Romano A. 2009. Discoglossus sardus. The
IUCN Red List of Threatened Species 2009:
e.T55271A11265832.
Arntzen JW. 2001. Genetic variation in the Italian
Crested Newt, 7riturus carnifex, and the origin of a
non-native population north of the Alps. Biodiversity
and Conservation 10: 971-987.
Bergey EA, Figueroa LL, Mather CH, Martin, RJ, Ray
EJ, Kurien JT, Westrop DR, Suriyawong P. 2014.
Trading in snails: plant nurseries as transport hubs for
non-native species. Biological Invasions 16: 1,441-
1,451.
Biton R, Geffen E, Vences M, Cohen O, Bailon S,
Rabinovich R, Malka Y, Oron T, Boistel R, Brumfeld
V, et al. 2013. The rediscovered Hula Painted Frog 1s a
living fossil. Nature Communications 4: e1959.
Bruford MW, Hanotte O, Brookfield JFY, Burke T.
1992. Single-locus and multilocus DNA fingerprint.
Pp. 225-270 In: Molecular Genetic Analysis of
Populations: a Practical Approach. Editor, Hoelzel
AR. IRL Press, Oxford, United Kingdom. 445 p.
Chiari Y, van der Meijden A, Mucedda M, Louren¢o
JM, Hochkirch A, Veith M. 2012. Phylogeography
of Sardinian cave salamanders (genus Hydromantes)
is mainly determined by geomorphology. PLoS
One 7(3): €32332.
Christy MT, Savidge JA, Rodda GH. 2007. Multiple
pathways for invasion of anurans on a Pacific island.
Diversity and Distributions 13: 598-607.
Delaney KS, Riley SP, Fisher RN. 2010. A rapid, strong,
and convergent genetic response to urban habitat
November 2020 | Volume 14 | Number 3 | e266
Anthropogenic introduction of Discoglossus in southern France
fragmentation in four divergent and widespread
vertebrates. PLoS One 5(9): e12767.
Delaugerre M, Cheylan M. 1992. Atlas de répartition des
batraciens et reptiles de Corse. L’ Oikéma, Pamplona,
Spain. 128 p.
Denoél M. 2005. Persistance et dispersion d’une
population introduite de Triton alpestre (7riturus
alpestris) dans les causses du Larzac (Sud de la
France). Revue d’Ecologie (Terre et Vie) 60: 139-148.
Dufresnes C, Pellet J, Bettinelli-Riccardi S, Thiebaud
J, Perrin N, Fumagalli L. 2016. Massive genetic
introgression in threatened Northern Crested Newts
(Triturus cristatus) by an invasive congener (7°
carnifex) in Western Switzerland. Conservation
Genetics 17: 839-846.
Dufresnes C, Di Santo L, Leuenberger J, Schuerch
J, Mazepa G, Grandjean N, Canestrelli D, Perrin
N, Dubey S. 2017. Cryptic invasion of Italian Pool
Frogs (Pelophylax bergeri) across Western Europe
unraveled by multilocus phylogeography. Biological
Invasions 19: 1,407—1,420.
Dufresnes C, Pribille M, Alard B, Goncalves H, Amat F,
Crochet PA, Dubey S, Perrin N, Fumagalli L, Vences
M, et al. 2020. Integrating hybrid zone analyses
in species delimitation: lessons from two anuran
radiations of the Western Mediterranean. Heredity
124: 423-438.
Duguet R, Priol P, Deso G, Geoffroy D. 2019. Mise a
jour des connaissances sur le Discoglosse sarde
Discoglossus sardus Tschudi in Otth, 1837 dans lile
de Port-Cros en 2018: habitats potentiels, état de la
population et mesures de gestion. Scientific Reports of
Port-Cros National Park 33: 101-126.
Egan PA, Bourke D, Thuiller W, Baudraz MEA, Georges
D, Renaud J, Stout JC. 2018. Invasive aliens threatened
with native extinction: examining best practice for
species translocations under climate change. bioRxiv
preprint. Available: https://doi.org/10.1101/429084
[Accessed: 15 March 2020].
Epps CW, Palsboll PJ, Wehausen JD, Roderick GK,
Ramey RRII, McCullough DR. 2005. Highways
block gene flow and cause a rapid decline in genetic
diversity of desert Bighorn Sheep. Ecology Letters 8:
1,029-1,038.
Escoriza D, Boix D. 2012. Assessing the potential impact
of an invasive species on a Mediterranean amphibian
assemblage: a morphological and ecological approach.
Hydrobiologia 680: 233-245.
Escoriza D, Boix D. 2014. Reproductive habitat
selection in alien and native populations of the genus
Discoglossus. Acta Oecologica 59: 97-103.
Escoriza D, Ben Hassine J, Boix D. 2014. Factors
regulating the invasive success of an alien frog: a
comparison of the ecology of the native and alien
populations. Hydrobiologia 730: 127-138.
Escoriza D, RuhiA. 2016. Functional distance to recipient
communities may favor invasiveness: insights from
Amphib. Reptile Conserv.
two invasive frogs. Diversity and Distributions 22:
519-533.
Fradet V, Geniez P. 2004. La répartition du Discoglosse
peint Discoglossus pictus Otth, 1837 (Amphibien,
Anoure, Discoglossidés) dans le Sud de la France:
note sur sa présence dans le département de
VHeérault. Bulletin de la Société Herpétologique de
France 109: 35-41.
Franch M, Llorente GA, Montori A, Richter-Boix
A, Carranza S. 2007. Discovery of an introduced
population of Discoglossus pictus beyond its known
distributional range. Herpetological Review 38: 356—
359:
Geniez P, Cheylan M. 2012. Les Amphibiens et les
Reptiles du Languedoc-Roussillon et régions
limitrophes: atlas biogéographique. Muséum national
d Histoire naturelle, Paris, France and Biotope, Meéze,
France. 448 p.
Heise UK. 2018. The case for ‘sanctuary cities’ for
endangered species. Available: https://www.citylab.
com/environment/201 8/06/the-case-for-sanctuary-
cities-for-endangered-species/562091/ [Accessed: 15
March 2020].
Hulme PE. 2009. Trade, transport, and trouble: managing
invasive species pathways in an era of globalization.
Journal of Applied Ecology 46(1): 10-18.
Knoepffler LP. 1961. Les Batraciens et principalement
le genre Discoglossus dans les iles méditerranéennes.
Colloques internationaux du Centre National de la
Recherche Scientifique 94: 159-161.
Knoepffler LP. 1962. Contribution a I’étude du genre
Discoglossus (Amphibiens Anoures). Vie et Milieu
13: 1-94.
Kraus F. 2015. Impacts from invasive reptiles and
amphibians. Annual Review of Ecology, Evolution,
and Systematics 46: 75-97.
Kumar S, Stecher G, Tamura K. 2016. MEGA7:
Molecular Evolutionary Genetics Analysis version 7.0
for bigger datasets. Molecular Biology and Evolution
33(7): 1,870—1,874.
Labadesse M, Eggert C. 2018. La gestion intégrée
des amphibiens exotiques envahissants en France
métropolitaine. Faune Sauvage 321: 58-63.
Lambertini M, Leape J, Marton-Lefevre J, Mittermeier
RA, Rose M, Robinson JG, Stuart SN, Waldman B,
Genovesi P. 2011. Invasives: a major conservation
threat. Science 333: 404-405.
Lee CE. 2002. Evolutionary genetics of invasive species.
Trends in Ecology and Evolution 17(8): 386-391.
Lescure J, de Massary JC. 2012. Atlas des Amphibiens
et Reptiles de France. Biotope, Meze, France and
Muséum national d’ Histoire naturelle, Paris, France.
272 p.
Levine JM, D’ Antonio CM. 2003. Forecasting biological
invasions with increasing international trade.
Conservation Biology 17: 322-326.
Lucente D, Renet J, Gailledrat M, Tillet J, Nascetti G,
November 2020 | Volume 14 | Number 3 | e266
Renet et al.
Cimmaruta R. 2016. A new population of European
cave salamanders (genus Hydromantes) from west-
central France: relict or introduction? Herpetological
Bulletin 138: 21-23.
Lunghi E, Guillaume O, Blaimont P, Manenti R. 2018.
The first ecological study on the oldest allochthonous
population of European cave salamanders
(Hydromantes sp.). Amphibia-Reptilia 39: 113-119.
Marchand MA, Roy C, Renet J, Delauge J, Meyer D,
Hayot C. 2017. Liste rouge régionale des amphibiens
et reptiles de Provence-Alpes-Céte d'Azur.
Conservatoire d’espaces naturels Provence-Alpes-
Cote d’Azur, Aix-en-Provence, France. 14 p.
Marchetti MP, Engstrom T. 2016. The conservation
paradox of endangered and invasive species.
Conservation Biology 30: 434-437.
Marris E. 2014. Opinion: it’s time to stop thinking that
all non-native species are evil. National Geographic
Magazine. Available: http://news.nationalgeographic.
com/news/2014/07/140724-invasive-species-
conservation-biology-extinction-climate-science/
[Accessed: 9 August 2019].
Martinez-Solano I. 2004. Phylogeography of Iberian
Discoglossus (Anura, Discoglossidae). Journal of
Zoological Systematics and Evolutionary Research
42: 298-305.
Montori A, Llorente GA, Richter-Boix A, Geniez P,
Villero D, San Sebastian O, Franch M, Garriga N.
2009. L’expansion de Discoglossus pictus pose
t-elle des problemes de coexistence pour les autres
amphibiens? Oral presentation at: 37°" Congres de la
Société herpétologique de France, 8—10 octobre 2009,
Montpellier, France.
Montori A, Llorente GA, Richter-Boix A, Villero D,
Franch M, Garriga N. 2007. Colonizacion y efectos
potenciales de la especie invasora Discoglossus pictus
sobre las especies nativas. Munibe 25: 14—27.
Pabijan M, Crottini A, Reckwell D, Irisarri I, Hauswaldt
JS, Vences M. 2012. A multigene species tree for
Western Mediterranean painted frogs (Discoglossus).
Molecular Phylogenetics and Evolution 64: 690-696.
Pagano A, Dubois A, Lesbarreres A, Lodé T. 2003. Frog
alien species: a way for genetic invasion? Comptes
Rendus Biologies 326: 85-92.
Peres CA, Patton JL, Nazareth F, da Silva M. 1996.
Riverine barriers and gene flow in Amazonian Saddle-
back Tamarins. Folia Primatologica 67: 113-124.
Pujol-Buxo E, Garcia Cisneros A, Miaud C, Llorente GA.
2019a. Genetic relationships and diversity patterns
within the invasive range of the Mediterranean
Painted Frog. Journal of Zoology 309: 125-132.
Pujol-Buxo E, Riafio GM, Llorente GA. 2019b. Stable
isotopes reveal mild trophic modifications in a
native-invasive competitive relationship. Biological
Amphib. Reptile Conserv.
Invasions 21: 1,167—1,177.
PySek P, Jarosik V, Hulme PE, Kuhn I, Wild J, Arianoutsou
M, Bacher S, Chiron F, Didziulis V, Essl F, et al. 2010.
Disentangling the role of environmental and human
pressures on biological invasions across Europe.
Proceedings of the National Academy of Sciences of
the United States of America 107(27): 12,157—12,162.
Richter-Boix A, Garriga N, Montori A, Franch M, San
Sebastian O, Villero D, Llorente GA. 2013. Effects of
the non-native amphibian species Discoglossus pictus
on the recipient amphibian community: niche overlap,
competition, and community organization. Biological
Invasions 15: 799-815.
Riley SP, Pollinger JP, Sauvagot RM, York EC, Bromley
C, Fuller TK, Wayne RK. 2006. A southern California
freeway 1s a physical and social barrier to gene flow in
carnivores. Molecular Ecology 15: 1,733-1,741.
San Sebastian O, Pujol-Buxo E, Garriga N, Richter-
Boix A, Llorente GA. 2015. Differential trophic traits
between invasive and native anuran tadpoles. Aquatic
Invasions 10(4): 475-484.
Sindaco R, Doria G, Razzetti E, Bernini F. 2006. Atlas of
Italian Amphibians and Reptiles - Atlante degli Anfibi
e dei Rettili d'Italia. Societas Herpetologica Italica -
Edizioni Polistampa, Firenze, Italy. 789 p.
UICN France, MNHN, SHF. 2015. La Liste rouge des
espéces menacées en France. Chapitre Reptiles
et Amphibiens de France métropolitaine. Union
internationale pour la conservation de la nature
France, Muséum national d’Histoire naturelle, and
Société herpétologique de France, Paris, France. 7 p.
Vences M, de Pous P, Nicolas V, Diaz-Rodriguez J,
Donaire D, Hugemann K, Hauswaldt JS, Amat F,
Barnestein JAM, Bogaerts S, et al. 2014. New insights
on phylogeography and distribution of painted frogs
(Discoglossus) in northern Africa and the Iberian
Peninsula. Amphibia-Reptilia 35: 305-320.
Westphal MI, Browne M, MacKinnon K, Noble I. 2008.
The link between international trade and the global
distribution of invasive alien species. Biological
Invasions 10: 391-398.
Williamson M. 1996. Biological Invasions. Chapman
and Hall, London, United Kingdom. 256 p.
Wintrebert P. 1908. Quinzi¢me Assemblée Générale
Annuelle, Séance du 25 février 1908. Intervention
de M. Wintrebert sur la présence a Banyuls-sur-Mer
(Pyrénées-Orientales) du Discoglossus pictus Otth.
Bulletin de la Société Zoologique de France 33: 54.
Zangari F, Cimmaruta R, Nascetti G. 2006. Genetic
relationships of the western Mediterranean painted
frogs based on allozymes and mitochondrial markers:
evolutionary and taxonomic inferences (Amphibia,
Anura, Discoglossidae). Biological Journal of the
Linnean Society 87. 515-536.
November 2020 | Volume 14 | Number 3 | e266
Amphib. Reptile Conserv.
Anthropogenic introduction of Discoglossus in southern France
Julien Renet is a French wildlife biologist at the NGO Conservatoire d’ espaces naturels de Provence Alpes
Céte d’ Azur (CEN PACA, http://www.cen-paca.org/), where he designs, coordinates, and implements the
conservation programs for several species of herpetofauna (e.g., Pelobates cultripes, Triturus cristatus,
Emys orbicularis, Euleptes europaea) of the Provence-Alps-Céte d’Azur region in France. His work
concerns the general framework of conservation biology, more specifically ecology, biogeography,
population dynamics, and assessments of non-invasive individual marking methods. Additional
information about his work is available on his ResearchGate page, at: https://www.researchgate.net/
profile/Julien_Renet/research.
Rémi Duguet is a private consultant for biodiversity assessments and monitoring, and a part-time teacher
of herpetology at the University of Franche-Comté, Besancon, France. Rémi has worked for many years
in amphibian and reptile conservation, especially in France and in the western Indian Ocean islands.
He edited the book Les Amphibiens de France, Belgique et Luxembourg, published in 2003 by Biotope
(Meze, France).
Mathieu Policain is a naturalist who has worked for the NGO Colinéo-Assenemce (Marseille, France,
https://colineo.fr/) for five years. He has a special interest in the Mediterranean herpetofauna, and is
currently an active volunteer in various efforts to protect amphibians and reptiles.
Alison Piquet is a French herpetologist with a Master’s degree and almost ten years of national and
international experience in the field. Specializing in reptiles, and snakes in particular, she travels
extensively to conduct inventory field studies and observe reptiles, amphibians, birds, and spiders in the
wild. As a herpetologist, she joined the Radeau des Cimes international expedition to Laos in 2014, in
order to inventory the herpetofauna in a poorly-known primary forest area. She also spent a few years in
Australia studying and photographing the amazing wildlife of that country.
Vincent Fradet is an amphibian specialist who graduated from the Ecole Pratique des Hautes Etudes
(Paris-Sorbonne) where he studied Discoglossus pictus phylogeography. Vincent now works in the
service of nature for several environmental NGOs.
Pauline Priol works as scientific consultant in conservation biology, has spent several years managing
conservation programs for endangered species (Emys orbicularis, Pelobates cultripes), and obtained two
graduate degrees from universities in France and Canada. Pauline is now working with field practitioners,
various stakeholders, and statisticians to develop methods for modeling population dynamics, building
and evaluating monitoring protocols, estimating demographic parameters, evaluating impacts of
perturbations, and evaluating/defining management actions. Her specialty is herpetofauna (e.g., European
pond turtles Emys and Mauremys, crested newts, Discoglossus, spadefoot toads, Mediterranean lizards)
but she also works on birds (stock programs, woodcock), crayfish, and insects (dragonflies, butterflies).
Grégory Deso is a herpetologist who has been active in environmental organizations since 1999 on the
Mascarene Islands, where his work has focused on the distribution and ecology of various native and
introduced species and their interactions linked to human activity. He now resides in mainland France
(Provence Alps Céte d’ Azur region) where he founded the NGO Association Herpétologique de Provence
Alpes Méditerranée (https://ahpam.fr/), which works toward the protection of amphibians and reptiles.
Today, Gregory’s work concerns all aspects of the continental and island Mediterranean herpetofauna.
198 November 2020 | Volume 14 | Number 3 | e266
Amphib. Reptile Conserv.
Renet et al.
Francois Grimal is a French wildlife biologist at the NGO Ligue pour la Protection des Oiseaux
(LPO, https://www.lpo.fr/), an affiliate of Birdlife International. Francgois designs and coordinates
conservation and monitoring programs for several amphibian populations of the Provence-Alps-
Céte d’Azur region, in particular Epidalea calamita and Pelophylax sp. His work concerns the
ecology, population dynamics, implementation of genetic and bioacoustic studies, and photographic
and individual marking methods.
Giuseppe Sotgiu is an Italian biologist who works as an independent researcher specializing in the
conservation of the insular herpetofauna and ichthyofauna of Sardinia. The species he primarily
studies is the Sardinian Newt, Euproctus platycephalus, one of the most endangered urodeles
in Europe. Giuseppe collaborates with the Department of Zoology of the University of Sassari,
Sardinia, Italy. Since 2007, he has also collaborated with the Institute of Zoology at the Zoological
Society of London, in order to understand the impacts of pathogens such as chytridiomycete fungi
on the amphibian populations in the Mediterranean islands. He is also interested in studying the
impacts of alien species on native endemic species, and developing methods to mitigate the effects
of ecological invasions.
Miguel Vences is a zoologist and evolutionary biologist at Braunschweig University of
Technology, Germany. He leads a long-standing research program on amphibian and reptile
biology, with investigations spanning classical taxonomy, molecular evolution, diversification
processes, biogeography, and conservation biology. Miguel has worked extensively on the
herpetofauna of Madagascar, and also on numerous taxa in Europe.
199 November 2020 | Volume 14 | Number 3 | e266
Official journal website:
amphibian-reptile-conservation.org
Amphibian & Reptile Conservation
14(3) [General Section]: 200-205 (e267).
On the Critically Endangered Cofre de Perote Salamander
(Isthmura naucampatepeti): discovery of a new population in
Puebla, Mexico, and update of its known distribution
12,"Leonardo Fernandez-Badillo, ‘Nallely Morales-Capellan, *Giovany Tonatiuh Gonzalez-Bonilla,
4Luis Canseco-Marquez, and 2*Dante Alfredo Hernandez-Silva
'Predio Intensivo de Manejo de Vida Silvestre X-Plora Reptilia, Carretera México-Tampico s/n, Pilas y granadas, 43350, Metztitlan, Hidalgo,
MEXICO ?Centro de Investigaciones Biolégicas, Universidad Autonoma del Estado de Hidalgo, Km.4.5 Carr. Pachuca-Tulancingo, Mineral de
la Reforma, Hidalgo, MEXICO ?Wild Forest Consulting S.C., Galeana # 3, Huitchila, 62923, Tepalcingo, Morelos, MEXICO ‘Laboratorio de
Herpetologia, Facultad de Ciencias, Universidad Nacional Autonoma de México, Distrito Federal 04510, MEXICO
Abstract.—The presence of the Cofre de Perote Salamander, /sthmura naucampatepeti, in the state of Puebla,
Mexico, is confirmed based on a population found during recent forestland surveys. The new population is the
largest known for the species, including at least 26 individuals. Information about the size, weight, and color
pattern variations is provided for this rarely seen species, and its distribution and conservation needs are
briefly discussed.
Keywords. Amphibia, Caudata, confirmation, color pattern, lost species, Plethodontidae
Citation: Fernandez-Badillo L, Morales-Capellan N, Gonzalez-Bonilla GT, Canseco-Marquez L, Hernandez-Silva DA. 2020. On the Critically
Endangered Cofre de Perote Salamander (/sthmura naucampatepetl): discovery of a new population in Puebla, Mexico, and update of its known
distribution. Amphibian & Reptile Conservation 14(3) [General Section]: 200-205 (e267).
Copyright: © 2020 Fernandez-Badillo et al. This is an open access article distributed under the terms of the Creative Commons Attribution License
[Attribution 4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction
in any medium, provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced,
are as follows: official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 2 October 2020; Published: 21 November 2020
Introduction
Amphibians are one of the vertebrate groups in which the
current mass extinction episode is most evident (Bishop
et al. 2012). The Zoological Society of London identified
100 priority amphibian species as Evolutionarily Distinct
and Globally Endangered (1.e., “EDGE species’), and
the Amphibian Survival Alliance lists 34 Lost Species
of amphibians (ZSL 2008; Garcia-Bafiuelos et al. 2017).
Among salamanders, the IUCN lists 57 Mexican species
as Critically Endangered (IUCN 2020), one of which is the
Cofre de Perote Salamander (/sthmura naucampatepetl).
A member of the /sthmura belli complex (Parra-Olea
et al. 2005), naucampatepetl was described based on
five specimens, all of which were collected in 1981 on
a narrow ridge extending east from Cofre de Perote and
terminating in a small peak (Cerro Volcancillo) in the
Sierra Madre Oriental of central Veracruz, México. The
collecting locality was Cerro Las Lajas on the slopes
of Cofre de Perote, and Cerro Volcancillo (Parra-Olea
and Wake 2001; Parra-Olea et al. 2005; IUCN 2020).
Recently, J. naucampatepetl was recorded at two localities
in Puebla State, and those records were uploaded into the
Naturalista, CONABIO portal (https://www.naturalista.
Correspondence. *
[email protected]
Amphib. Reptile Conserv.
mx/search?q=Isthmura%20naucampatepetl; | Accessed:
1 September 2019). The photographs were taken on 6
October 2015 in the Municipality of Teziutlan, near the
localities of San Juan Acateno and Atoluca, and published
in the Naturalista website without precise locality
information. Therefore, this vague record was not included
in the most recent cataloging of the herpetofauna of Puebla
(Woolrich et al. 2017).
Only very limited information on this species has been
available thus far, based on only seven specimens from
four localities. This article provides data from the largest
known population of the species (26 individuals) which
was found in a new locality in Puebla, Mexico, confirming
the presence of /. naucampatepetl in this state. Herein we
provide novel data on the size, weight, and color pattern
variations of this enigmatic species, and briefly comment
on relevant conservation implications.
Materials and Methods
Surveys were conducted on 20 forested lands of the
Unidad de Manejo Forestal (UMAFOR 2103-Teziutlan)
in the Sierra Norte of Puebla, including the zone Bienes
Comunales San Mateo Chignautla, in the Municipality
November 2020 | Volume 14 | Number 3 | e267
Fernandez-Badillo et al.
19°41'40"
isthmura naucampatepetl
@ Present work
% Parra-Olea et al. 2001
Naturalista
A Pérez y Soto 2016
©) State division
©) San Mateo Chignautla
= ~~ Contour lines (masi)
#¥ Roads
19°4145"
19°40'50"
Template forest
@ Oak )) Oak-pine
Oyamel @B Cloud
Pine
0 625 05
km
Fig. 1. Distribution maps of /sthmura naucampatepetl. Black circles
represent published records, star represents the new population in
the Municipality of Chignautla, Puebla, Mexico. The photograph
shows the habitat at the new population. Photo by L. Ferndndez-
Badillo.
of Chignautla, state of Puebla, México (Fig. 1). The zone
Bienes Comunales has an area of 5,740.2 ha, of which
969.33 ha are earmarked for wood harvesting. The work
presented here formed part of the project Estudio regional
de fauna en bosques de produccion de la UMAFOR 2103
Teziutlan, Puebla, México (WFC and ARST 2018). Field
work was authorized by SEMARNAT permit SGPA/
DGVS/07199/17.
All captured [ naucampatepetl individuals were
measured, weighed, and photographed in the field, and
subsequently released at the original collection site.
Measurements of length were taken using a digital caliper,
and weights were obtained using an electronic pocket
scale (max. 500 g, min. 0.1 g). Length measurement
abbreviations are as follows: SVL = snout-vent length; TL
= tail length; and T = total length. A photograph of one
salamander was deposited in the photographic collection of
the Herpetological Collection of the Biological Research
Centre of the Autonomous University of Hidalgo (CH-
CIB).
A bibliographic review of the available information
on this species was also performed. This review includes
information from a record provided by Pérez y Soto (2016),
who presented a photograph and data for some specimens
identified as /. gigantea, but they actually correspond to
I. naucampatepetl. Additional records in the Naturalista
database (Naturalista CONABIO 2020) are also included.
This information serves to comprehensively update the
known distribution of this species.
Amphib. Reptile Conserv.
Results
Field records. The first salamander was observed on
6 July 2017 (CH-CIB 117; Figs. 1,2a) under a rock in
grassland habitat at ca. 1100 h (19.70668°N, -97.43773°
W; WGS 84), elevation 2,879 m. On 16 September 2017,
25 additional salamanders were found in a grassland
habitat with some reforested pine trees at around 1700
h (19.680720°N, -97.428987°W; WGS 84), elevation
2,918 m (Fig. 1). Ten of these salamanders were found
under bunch grass, another six were found ca. 30 m away
under a dry Yuca, seven more were found ca. 15 m away
under another dry Yuca, and two additional salamanders
were found under a rock.
Morphological description. Among the 26 captured
I. naucampatepetl, SVL spanned 23—83.2 mm (mean +
SD: 77.86 + 10.75), TL varied from 0-—73.4 mm (67.47
+ 10.18), T ranged from 23—156.6 mm (145.33 + 20.93),
and weight varied from 0.1—23 g (10.86 + 2.83; Table 1).
One individual with no tail had the smallest SVL value.
Four of the 26 animals (with SVL ranging from 62.4—-85
mm; Table 1) had clearly visible rounded mentonian
glands and prominent nasolabial protuberances,
suggesting they were sexually mature males. Another six
animals were greater than 62.4 mm in SVL (range: 69.5—
83.2 mm; Table 1), but lacked both mentonian glands and
prominent nasolabial protuberances, so we concluded
that they were adult females. The remaining salamanders
were smaller than the smallest sexually mature male, so
we considered them to be juveniles of undetermined sex.
Color pattern variation. All 26 captured J.
naucampatepetl display a solid black body color with
pale marks; these marks are orange in smaller individuals
and pink or pinkish cream in larger individuals (Fig. 2).
In all animals, the pale marks are arranged in a consistent
pattern as follows: a pair of spots on the back of the head
that vary in size, but are usually about the diameter of the
orbit; a pair of inverted, rather elongated triangular marks
on the shoulders; one to 11 pairs of small spots positioned
dorsolaterally on the intercostal areas of the trunk; and
a large, conspicuous mark on the caudosacral region
that resembles a pelvis bone, ranging from a rounded to
more quadrangular U-shape, and always with two small,
rounded black marks. In addition, some individuals show
one or two rounded orange, pink, or pinkish-cream spots
in the nuchal region. The venter is pale to dark gray, and
the mentonian gland in adult males is pale gray (Fig. 2).
Literature records. The work of Pérez y Soto (2016)
reported some records and a photograph of a salamander
found in Tetela de Ocampo, Puebla, Mexico, which was
misidentified as /. gigantea but actually corresponds to I.
naucampatepetl. Two of those specimens were deposited
in the Herpetological Collection of the Zoological
Museum Alfonso L. Herrera (MZFC 28819—20). That
November 2020 | Volume 14 | Number 3 | e267
Isthmura naucampatepetl in Puebla, Mexico
Table 1. Morphological measurements of /sthmura naucampatepetl from the Municipality of Chignautla, Puebla, Mexico. Snout-
vent length = SVL, tail length = TL, total length = T, all measurements in mm. Note: Specimen numbers match the numbers of
photographs in Fig. 1.
Specimen number Sex SVL (mm) TL (mm) T (mm) Weight (g)
l Female 83.8 69 152.8 3
2 Female 83.2 73.4 156.6 23
3 Female 78.2 73 151.2 14
4 Female 78.1 69.8 147.9 11
5 Male 66.9 60.1 2g 9
6 Male 85 PO: 15537. 10
E: Female 69.8 56.3 126.1 6
8 - 52.3 46.7 99 5
9 - 59.7 45.3 105 5
10 - 54.4 33.5 87.9 4
11 - 48.6 34.7 83.3 3
12 - 59.7 45 104.7 4
13 Female 69.5 56.7 126.2 9
14 - 47.9 26 73.9 4
15 - 60.9 42.5 103.4 6
16 Male 63.7 449 108.6 6
KZ - 34 223 56.3 is
18 Female 73.8 54.7 128.5 5
19 Male 62.4 43.2 105.6 3
20 - 38.2 23:2 61.4 1
Zz - 37.3 21,5 58.8 0.5
22 - 40.5 21.4 61.9 1
23 - 22.3 11 33.3 0.2
24 - 23 0) 23 0.1
23 - 61.9 46.7 108.6 4.5
26 - 56.1 38.8 94.9 3
Mean 77.86 67.47 145.33 10.86
SD 10.75 10.18 20.93 2.83
author did not include the precise number of the observed
individuals, but she described it as a “common species,”
a category assigned in that work to the species with an
abundance of 12—22 individuals.
Naturalista records. As mentioned above, this review
includes the two records for £ naucampatepetl that
were uploaded into the portal Naturalista, CONABIO
(https://www.naturalista.mx/search?q=Isthmura%20
naucampatepetl; Accessed: 1 September 2019). These
photographs were taken on 6 October 2015 in the
Municipality of Teziutlan, near the localities of San
Juan Acateno and Atoluca, and they were published in
Naturalista without precise locality information (Fig. 1,
plus signs).
Habitat description. The site where the new population
of J. naucampatepetl was found is (currently) under forest
Amphib. Reptile Conserv. 202
management, which includes various activities such as fire
protection, reforestation, soil conservation and restoration,
and wood harvesting. All the forest management in the area
is performed according to the standard methodologies in
México as specified in Método Mexicano de Ordenacion
de Bosques Irregulares and the Método de Desarrollo
Silvicola. In the specific site of specimen collection, the
landscape is dominated by trees of the genera Pinus,
Quercus, Abies, and Alnus, that vary in size and age,
within ranges of 1.5—38 m high and 1-60 years old.
Discussion
Isthmura naucampatepetl was recently rediscovered in
the state of Puebla, with two photographs uploaded in the
Natualista portal and cited by Aguilar-Lopez et al. (2019).
The work reported here confirms the presence of the species
in another population in Puebla for the first time (Garcia-
November 2020 | Volume 14 | Number 3 | e267
Fernandez-Badillo et al.
Fig. 2. Color patterns of each captured /sthmura naucampatepetl individual. Photo numbers correspond to the specimen numbers
given in Table 1. Photo 27 is a ventral view of the chins of an adult female (left) and an adult male (right), showing the male
mentonian gland. Photos by L. Ferndandez-Badillo.
Vazquez et al. 2009; Woolrich-Pifia et al. 2017) and records
the highest number of individuals reported for any known
population. These records extend the geographic distribution
of the species by 75.43 km from the report of Pérez y Soto
(2016), 38 km from the reports of Naturalista, and 36.9 km
(field records) from the type locality (Parra-Olea and Wake
2001; Parra-Olea et al. 2005). These records show this
species has a wider distribution in the Sierra Norte of Puebla
than was previously known, so additional search efforts in
other regions of this area, with similar environmental and
microhabitat conditions, could potentially reveal other
populations and provide valuable data on the natural history
of this rarely-encountered species.
During the field work for this study, many individuals
of I. naucampatepet!l were found grouped together, but we
are currently unable to explain the reason for this behavior.
However, local residents mentioned that in the previous
year they unearthed a congregation of ca. 50 individuals
Amphib. Reptile Conserv.
of the species while extracting soil near the area where our
I. naucampatepetl were encountered, suggesting that this
behavior may be a regular occurrence.
The color pattern of the 26 individuals found generally
agrees with the description available in Parra-Olea and Wake
(2001), but some variations are described above and clearly
evident in Fig. 2. The data from this population modestly
increase the maximum known SVL of adult females from
82.9 mm (Parra-Olea and Wake 2001) to 83.2 mm. For
males, Parra-Olea and Wake (2001) reported that sexually
mature individuals vary from 67.6—82.1 mm SVL, a range
that our data broadens (62.4—85 mm SVL).
This contribution increases our knowledge of the species
regarding its conservation. The IUCN (2020) indicates a
decreasing current population trend for 2. naucampatepetl.
In contrast, we recorded a strong signal of demographic
variability in the newly discovered population, including
two individuals of less than 50 mm T), nine of 56.3—99
November 2020 | Volume 14 | Number 3 | e267
Isthmura naucampatepetl in Puebla, Mexico
mm T, and 15 of 103.4-156.6 mm T. This size variation
distribution suggests that the population is actively
reproducing, but more observations and long-term study are
necessary to rigorously assess the population size and trends
in this species.
The IUCN (2016) identifies extensive logging, farming
(especially for potatoes), and expanding human settlements
as the major threats to . naucampatepetl at the type locality
in Veracruz. At the new locality (Bienes Comunales San
Mateo Chignautla, Puebla), the land owners have a legal
permit to sell wood from the forest, but we also detected
some other disturbances (like cattle, feral and domestic
dogs, some threats inherent to the forest management, and
also wildfires) which can pose risks for this species.
Adequate protection of this species would benefit from
the inclusion of management actions specifically related to
I. naucampatepetl in an updated forest management plan,
and perhaps the establishment of conservation areas where
timber extraction can be limited. To better inform decisions
on how to preserve this newly discovered population,
there is an urgent need to acquire basic natural history and
population data. It 1s also imperative to educate the local
inhabitants about the global importance of this salamander
and the need to conserve it. Grassroots buy-in 1s necessary
for any successful conservation strategy, as is involvement
by governmental and non-governmental stakeholders. If
coordinated in alliance with local residents and landowners,
and linked with forest management strategies, we can
show that the conservation of 1 naucampatepetl and the
sustainable use of the forest go hand in hand.
Acknowledgements.— The authors are grateful to the
Comision Nacional Forestal (CONAFOR) for funding
the project Estudio regional de fauna Silvestre en bosques
de produccién de la UMAFOR 2103 Teziutlan, Puebla
that made this work possible. We thank the communal
authorities and local residents of Bienes Comunales San
Mateo Chignautla for their support, especially Leonidez
Aquino Cordova, Santiago Cesilio Castro, Agustin Ramirez
Camacho, Vidal Lucas Bautista, and Francisco Velero
Ramirez, and also the Asociacion Regional de Silvicultores
de Teziutlan, A.C. We particularly thank Giovanni Gomez
Garcia, Fred Gonzalez Cruz, José Luis Jiménez Villegas,
and Cristian Duran Moreno for their assistance with field
work. Comments on the manuscript were provided by
Adam Clause, and we thank Hublester Dominguez Vega
for the review of the manuscript. We also thank to the two
anonymous reviewers for their valuable comments and
suggestions.
Literature Cited
Aguilar-Lopez JL, Garcia-Bufiuelos P, Pineda E,
Rovito SM. 2019. Thorius narismagnus (Amphibia:
Plethodontidae): rediscovery at the type locality and
detection of a new population. Amphibian & Reptile
Conservation 13(2) [General Section]: 126—132 (e193).
Amphib. Reptile Conserv.
Bishop PJ, Angulo A, Lewis JP, Morre RD, Rabb GB,
Garcia-Moreno J. 2012. The amphibian extinction crisis:
what will it take to put the action into the amphibian
conservation action plan? S.4.P.I.EN.S 5: 97-111.
Furbush R, Caviedes-Solis IW, Méndez de la Cruz FR,
Leache AD. 2017. Missing 1n action for nearly 50 years:
rediscovery of the Mexican treefrog Duellmanohyla
ignicolor (Anura: Hylidae). Mesoamerican Herpetology
4: 120-127.
Garcia-Bafiuelos P, Aguilar-Lopez JL, Pineda E, Garcia-
Vinalay A. 2017. Rediscovery of Bromeliohyla
dendroscata at the type locality: a threatened treefrog
surviving in a highly human modified landscape in
Mexico. Mesoamerican Herpetology 4: 684-688.
Garcia-Vazquez UO, Canseco-Marquez L, Gutiérrez-
Mayen G, Trujano-Ortega M. 2009. Actualizacion del
conocimiento de la fauna herpetoldgica en el estado de
Puebla, México. Boletin de la Sociedad Herpetolégica
Mexicana 17: 12-36.
IUCN SSC Amphibian Specialist Group. 2016. /sthmura
naucampatepetl. The IUCN Red List of Threatened
Species 2016: e.T59389A53983432.
IUCN. 2018. The IUCN Red List of Threatened Species
Version 2017-3. Available: http://www.tucnredlist.org
[ Accessed: 3 December 2019].
Naturalista (CONABIO). 2020. /sthmura naucampatepetl.
Available: http://www. naturalista.mx/taxa/2488 1 07-
Isthmura-naucampatepetl [Accessed: 12 February 2020].
Parra-Olea G, Wake DB. 2001. New species of lungless
salamanders of the genus Pseudoeurycea (Amphibia:
Caudata: Plethodontidae) from Veracruz. Scientific
Papers, Natural History Museum, University of Kansas
20: 1-9.
Parra-Olea G, Garcia-Paris M, Papenfus TJ, Wake DB.
2005. Systematics of the Pseudoeurycea belli (Caudata:
Plethodontidae) species complex. Herpetologica 61:
145-158.
Pérez y Soto R. 2016. Anfibios y reptiles de Tetela de
Ocampo, Puebla. B.Sc. Thesis. Benemérita Universidad
Autonoma de Puebla, Puebla, Mexico.
WFC (Wild Forest Consulting), ARST (Asociacion
Regional de Silvicultores de Teziutlan). 2018.
Estudio Regional de Fauna Silvestre en Bosques de
Produccion en la UMAFOR 2103 Teziutlan, Puebla.
Wild Forest Consulting S.C. and Asociacion Regional
de Silvicultores de Teziutlan A.C. Comision Nacional
Forestal, Puebla, México. 257 p.
Woolrich-Pifia GA, Garcia-Padilla E, DeSantis DL, Johnson
JD, Mata-Silva V, Wilson LD. 2017. The herpetofauna
of Puebla, Mexico: composition, distribution, and
conservation status. Mesoamerican Herpetology 4: 790—
884.
ZSL_ (Zoological Society of London). 2008. EDGE
of Existence Programme. Available: http://www.
edgeofexistence.org/index.php [Accessed: 10 August
2020].
November 2020 | Volume 14 | Number 3 | e267
Fernandez-Badillo et al.
Leonardo Fernandez-Badillo is a Director and researcher at the Herpetarium X-Plora Reptilia,
Hidalgo, Mexico, and is working on his Ph.D. at the Universidad Autonoma del Estado de
Hidalgo, Hidalgo, México. Leonard’s work focuses on the herpetoculture and conservation of
Mexican amphibians and reptiles, as well as training people on safe snake handling procedures
and first aid for snakebite cases. Leo has authored two books, co-authored a third book, and
published 50 papers and scientific notes. He is very interested in the study and conservation of
the Mexican herpetofauna.
Nallely Morales-Capellan is a Biologist and M.Sc. student in Biodiversity and Conservation
at the Universidad Autonoma del Estado de Hidalgo, Hidalgo, México. She is an independent
researcher, specializing in the study of amphibians and reptiles, with more than 10 years of
experience. Nallely is the management and maintenance program subdirector at the X-Plora
Reptila Herpetarium (Hidalgo, Mexico). Her principal interests are in environmental education,
conservation, and the responsible use and management of the Mexican herpetofauna.
Giovany Tonatiuh Gonzalez-Bonilla is an animal production engineer and Director of
Wild Forest Consulting S.C. He is a specialist in biodiversity monitoring in natural resource
management areas. Tonatiuh participates in the design and validation of biodiversity monitoring
systems using a landscape approach. He is also a collaborator in research on the sustainable use
and conservation of natural resources.
Luis Canseco-Marquez is a Mexican herpetologist interested in the systematics, biogeography,
and natural history of Mexican amphibians and reptiles. He is currently working on the
molecular phylogeny of the snake genus Geophis. Luis has authored about 100 research papers,
which include the descriptions of several new species in Mexico, and three books. His studies
have focused primarily in southeastern Mexico, and he has also been involved in assessing the
herpetofauna of Mexico for the IUCN.
Dante Alfredo Hernandez-Silva is a wildlife manager who graduated with a degree in Animal
Production and a Ph.D. in Biodiversity and Conservation from the Universidad Autonoma del
Estado de Hidalgo, Hidalgo, Mexico. He is interested in wildlife monitoring in production and
natural areas, and biological conservation, especially focusing on the biodiversity on land under
forest management in the state of Hidalgo, Mexico. On the other hand, as an advanced level user
of geographic information systems, he is currently developing a project on a network of com-
munity monitors in a region of temperate forests in the state of Hidalgo.
Amphib. Reptile Conserv. 205 November 2020 | Volume 14 | Number 3 | e267
Official journal website:
amphibian-reptile-conservation.org
Amphibian & Reptile Conservation
14(3) [Taxonomy Section]: 206-217 (e268).
Unearthing the species diversity of a cryptozoic snake,
Tantilla melanocephala, in its northern distribution with
emphasis on the colonization of the Lesser Antilles
12,"Michael J. Jowers, *Gilson A. Rivas, *Robert C. Jadin, *Alvin L. Braswell, *Renoir J. Auguste,
“Amaél Borzée, and John C. Murphy
'CIBIO/INBIO (Centro de Investigagado em Biodiversidade e Recursos Genéticos), Universidade do Porto, Campus Agrario De Vairdo, 4485-661,
Vairado, PORTUGAL National Institute of Ecology, 1210, Geumgang-ro, Maseo-myeon, Seocheon-gun, Chungcheongnam-do, 33657, REPUBLIC
OF KOREA *?Museo de Biologia, Facultad Experimental de Ciencias, Universidad del Zulia, Apartado Postal 526, Maracaibo 4011, VENEZUELA
‘Department of Biology and Museum of Natural History, University of Wisconsin Stevens Point, Stevens Point, Wisconsin 54481, USA *North
Carolina State Museum of Natural Sciences, 11 West Jones Street, Raleigh, North Carolina 27601, USA °Department of Life Science, University of
the West Indies, St. Augustine, TRINIDAD ‘Laboratory of Animal Behavior and Conservation, College of Biology and the Environment, Nanjing
Forestry University, Nanjing 210037, CHINA *Science and Education, Field Museum, 1400 South Lake Shore Drive, Chicago, Illinois 60605, USA
(Current address: 2564 East Murdoch Court, Green Valley, Arizona 85614, USA)
Abstract.—Tantilla is a diverse New World Colubrid genus comprising 69 small to medium sized, cryptozoic
and semi-fossorial species. Morphological data of Tantilla melanocephala in the Eastern Caribbean region,
and more precisely on the islands of Trinidad and Tobago and nearby Venezuela, have shown differences in
scales and color patterns associated with these localities, which may suggest the presence of cryptic species
in the region. Assessing the monophyly of Tantilla melanocephala is key as its paraphyly could compromise
important decisions for conservation and management. In this study, we conduct phylogenetic analyses of
all available Tantilla from GenBank (n = 11), including T. melanocephala from French Guiana and Brazil, along
with novel sequences from Guyana, Venezuela, Trinidad, and Tobago. Broadly, we recover two sister clades
within Tantilla, a North American-Central American clade and a Central American-South American clade with a
time since its most recent ancestor dating to the Mid-Miocene. We found the sampled T. melanocephala to be
monophyletic in all analyses and estimated the origin of this clade towards the early Pleistocene. The close
association between Trinidad and Venezuela, dating towards the end of the Pleistocene, suggests connections
in the recent past. This study is the first to assess the intraspecific variation in the species and we hope it will
set a landmark to complete the systematic characterization of the entire species throughout its widespread
distribution.
Keywords. Biogeography, colonization, dispersal, Reptilia, Tobago, Trinidad
Citation: Jowers MJ, Rivas GA, Jadin RC, Braswell AL, Auguste RJ, Borzée A, Murphy JC. 2020. Unearthing the species diversity of a cryptozoic
snake, Tantilla melanocephala, in its northern distribution with emphasis on the colonization of the Lesser Antilles. Amphibian & Reptile Conservation
14(3) [Taxonomy Section]: 206-217 (e268).
Copyright: © 2020 Jowers et al. This is an open access article distributed under the terms of the Creative Commons Attribution License [Attribution
4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction in any
medium, provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced, are
as follows: official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 9 September 2020; Published: 12 December 2020
of northern South America with the Caribbean Sea to
the north, the Atlantic Ocean to the east, and the Gulf
Introduction
Despite the widespread distribution ranges of certain
cryptic species, their presence on islands often reveals
lineages divergent from those on the mainland and
even the presence of new species (Card et al. 2016;
Jowers et al. 2019; Murphy et al. 2019a,b). Therefore,
an understanding of both the ecology and evolutionary
history of an endangered species on islands are pivotal
for ensuring their effective protection and conservation
(Young 2000; Spielman et al. 2004). The Trinidad and
Tobago Archipelago is located on the continental shelf
Correspondence. ‘
[email protected]
Amphib. Reptile Conserv.
of Paria to the west. It is composed of two main islands
(Trinidad and Tobago) and about 20 smaller satellites and
offshore rocks. While both larger islands are considered
the southernmost Lesser Antilles, they have a continental
flora and fauna with two distinctly different geological
origins. Trinidad was previously attached to Venezuela
and formed by a pull-apart basin in the Late Miocene,
when a downward warping event separated both land
masses (Liddle 1946; Erlich and Barrett 1990). Tobago,
on the other hand, was formed as an oceanic island on
December 2020 | Volume 14 | Number 3 | e268
Jowers et al.
the front edge of the Caribbean Plate far to the West of
its current position (Pindell and Kennan 2007; Jowers et
al. 2015). These islands can be considered as an eastward
extension of the sky island complex formed by the
Venezuelan coastal ranges. Their geographic position
is also unique because they lie just to the north of the
Guiana Shield at the mouth of the Orinoco River (Fig. 1).
Widespread taxa that span across biogeographic
barriers can pose a particular challenge for taxonomists
as isolation processes can often lead to the presence of
cryptic lineages. Barriers to gene flow allow opportunities
for speciation, and their removal offers the opportunity for
secondary contact that may result in introgression. Species
that are widely distributed are also dispersing from
multiple distant locations, and genetic material from these
populations could converge at more proximate geographic
localities with the assistance of wind or water (Reynolds
et al. 2020). Furthermore, these species are key for
understanding how diverse ecological factors may drive
regional patterns of species divergence and speciation
(Card et al. 2016). Fortunately, advances in molecular
phylogenetics can provide resolution to our understanding
of the evolutionary history of even rarely studied species.
The black-headed snakes of the genus Tantilla are
small to medium sized (usually < 300 mm) Western
Hemisphere snakes that specialize in feeding on
arthropods, particularly centipedes (Marques and Puorto
1998). Currently, the genus comprises 69 species (Uetz
et al. 2020) distributed from sea level to at least 3,000 m
and ranges from Nebraska (USA) to Santa Fe Province
(Argentina). It is present on both the Pacific and Atlantic
versants from Guatemala southward through Central
America into South America, reaching as far south
as southern Peru, Bolivia, northern Argentina, and
Uruguay; and it is also present in the Lesser Antilles, on
the Trinidad and Tobago islands (Henderson and Powell
2006, 2018). Coluber melanocephala Linnaeus (1758)
was the first member of the genus described, and it has
A. 6 0 250
— ®. Tobago
= MS Trinidad
Altitude (m)
- 5075
*.
es.
500 km
a ee
Fig. 1. (A) Zantilla melanocephala sample localities for this study
been re-described at least ten times since Linné’s original
description (Wilson and Mena 1980). The distribution of
T. melanocephala as currently understood covers much
of the Neotropics, from Colombia to northern Argentina
and Uruguay, including the islands of Trinidad and
Tobago (Fig. 1). Recently, this species was recorded on St.
Vincent and Grenada banks, where its presence has been
documented since at least 2005, and it presumably arrived
through human-mediated introduction in construction
material from Guyana and probably also from Trinidad
and Tobago (De Silva and Wilson 2006; Henderson
and Powell 2006, 2018; Berg et al. 2009; Henderson
and Breuil 2012). Records from Panama correspond to
misidentifications of 7? armillata (Ray 2017). Like some
congeners, it is also present on both sides of the Andes.
Greenbaum et al. (2004) synonymized 7! equatoriana
Wilson and Mena 1980 with 7’ melanocephala based on
a morphometric data principal component analysis.
The phylogenetic position of Tantilla remains
inconclusive as several molecular phylogenetic studies
have found alternative placements of the genus among
the Colubridae (Pyron et al. 2013; Jadin et al. 2014;
Koch and Venegas 2016; Figueroa et al. 2016; Zaher et
al. 2019). Pyron et al. (2013) used only 7? melanocephala
as a representative for the genus in their squamate study,
finding Jantilla and Salvadora mexicana to be the sister
to Coluber and Masticophis. This generic placement of
Tantilla contrasted with Jadin et al. (2014) who found
1! relicta as sister to Conopsis, Pseudoficimia, and
Sympholis. However, both of these relationships were
later confirmed by Figueroa et al. (2016) who included
more Zantilla taxa and found the genus to be paraphyletic,
reached similar conclusions to Pyron et al. (2013) and
Jadin et al. (2014), and consequently considered its
placement in the larger snake phylogeny unresolved. Koch
and Venegas (2016) included 7: amilatae, T: impensa, T.
melanocephala, and T: vermiformis in their description
of 7! tHiasmantoi but had no support for intergeneric
B
Deserts
ft Savannas
M& Lake
~. Mangroves
Mediterranean Schrub
'» Mountain Grassland
» Temperate Deciduous Forests
Temperate Grasslands
i Tropical Coniferous Forests
& Tropical Dry Forests
& Tropical Moist Forests
1000 km
(red circles) in the northern region of its distribution. (B) The
distribution of Tantilla melanocephala in the Neotropics. Locality data are from VertNet and the GBIF databases, as well as the
literature (Nogueira et al. 2019). Within the Lesser Antilles, Union Island and the Mustique islands are not shown. Red circles are
T. melanocephala localities included in the phylogenetic analyses. The map suggests this species inhabits several different biomes.
Amphib. Reptile Conserv. 207 December 2020 | Volume 14 | Number 3 | e268
Tantilla melanocephala diversity in Trinidad, Tobago, and Venezuela
relationships. Zaher et al. (2019) reported 7: relicta and 7:
melanocephala as being sister to Scolecophis, and together
they were sister to a clade of colubrids consisting of
Conopsis, Ficimia, Gyaliopion, Pseudoficimia, Svmpholis,
Sonora, and Stenorrhina.
Along with Boa constrictor, Tantilla melanocephala
is among the most widely distributed snakes in South
America. Tantilla melanocephala is distinguished from
congeners by the following combination of traits: (1)
dark head cap transitions into dark nape band with two
pale spots covering the posterior parietals, posterior edge
of temporals, and associated post parietal scales; (2)
pale preocular spot; (3) lateral extension of the head cap
contacts gulars; (4) no pale nape band posterior to the
dark nape band; (5) background color tan with nine dark
brown stripes; and (6) a greater number of subcaudals
compared to other members of the 7? melanocephala
group. Tantilla melanocephala is characterized by
extensive geographic variation in the color pattern, a wide
range of ventral (126-177 ventrals) and subcaudal counts
(41—74), as well as occupation of seven different biomes
(Wilson and Mena 1980; Wilson 1992). Several attempts
to clarify the marginal populations have been conducted
superficially based in their morphology, mainly on color
patterns and cephalic scutelation (Wilson and Mena
1980; Vuoto 1998). Wilson and Mena (1980) discussed
the variation of 7’ melanocephala ventral scale counts
in two Caribbean islands, noting that the differences in
ventral counts between specimens from Trinidad, adjacent
Venezuela, and Tobago, are striking (Fig. 2). Similarly,
the authors found significant differences in subcaudals
between mainland Venezuela and the islands. In addition,
six color patterns were detected across the range in 7.
melanocephala by Wilson and Mena (1980), with Trinidad
and Tobago specimens expressing two of these patterns
along with specimens from Argentina, Colombia, Guyana,
Paraguay, Suriname, Uruguay, and Venezuela.
Herein, we assess whether populations from the
islands of Trinidad and Tobago, and proximal mainland
localities of Venezuela (Peninsula de Paria) and Guyana,
constitute the same lineage or if they are part of a cryptic
lineage complex. Furthermore, molecular phylogenetics
are used to examine evolutionary relationships within
Tantilla. Finally, the likely time of colonization from the
mainland is explained, along with colonization of the
islands in relation to climatic conditions in the region.
Given the morphological variation between the two island
populations that are now separated by 50 km of water and
were once connected to each other at glacial maxima when
sea levels had dropped, the genetic distance between the
two populations is investigated.
Materials and Methods
Tantilla melanocephala specimens were collected from
locations in Trinidad, Tobago, and Venezuela, under
licenses from the Trinidad and Tobago Government
Amphib. Reptile Conserv.
re a 7 fe
-
tos oe re: Sip. Ne
ete ms % Ree ="
“y
Fig. 2. Specimens of Zantilla melanocephala from (A) Tobago,
Pigeon Point, (B) Trinidad, Bush Bush, Nariva Swamp, and (C)
Venezuela, Caracas, Distrito Capital. Photos by J.C. Murphy
(A—B) and L.A. Rodriguez (C).
Wildlife Section: Special Game Licenses issued for
scientific purposes in 2015—2016 to John Murphy, Renoir
Auguste, and Mike Rutherford; and under collection
permit number 1,375 granted to Gilson A. Rivas by
the Ministerio del Poder Popular para Ecosocialismo y
Aguas, Venezuela. Animals were euthanized following
the ASIH guidelines (Beaupre et al. 2004) using
pentobarbital. Museum acronyms follow Sabaj (2019).
DNA was extracted using a Qiagen DNeasy blood
and tissue kit (Qiagen, Hilden, Germany) following
the instructions of the manufacturer (see Supplemental
Table S1 for list of primers). The target genes were the
mitochondrial small and large ribosomal subunits (12S
December 2020 | Volume 14 | Number 3 | e268
Jowers et al.
rDNA and 16S rDNA, respectively), cytochrome 5b
(cytb) and the nuclear oocyte maturation factor (c-mos;
see Supplemental Table S2). Sequence editing follows
Murphy et al. (2019c). Despite some individuals having
different lengths in some alignments, the lengths of the
alignments were: 12S rDNA, 404 base pairs (bp); 16S
rDNA, 494 bp; cytb, 1,086 bp; and c-mos, 561 bp. Cytb
and c-mos were translated into amino acids to check for
the presence of stop codons. Following Jadin et al. (2014,
2019), Figueroa et al. (2016), and Zaher et al. (2019),
all genera that were sister to Zantilla were included,
while Drymarchon couperi and D. corais were used
as outgroup (Supplemental Table S2). Sequences were
aligned in Seaview v4.2.11 (Gouy et al. 2010) under
ClustalW2 default settings (Larkin et al. 2007) for the
cytb and c-mos fractions, and with MAFFT (Katoh et
al. 2002) for the 12S and 16S rDNA. The 12S and 16S
rDNA, cytb, and c-mos sequences were concatenated,
resulting in a 2,548 bp alignment.
Phylogenetic analyses were performed using the
Bayesian Inference and Maximum Likelihood methods.
MrBayes v3.2 (Ronquist and Huelsenbeck 2003) was
used to construct the Bayesian Inference tree under the
best-fitting substitution model for each gene partition.
ML searches were conducted in RAxML v7.0.4
(Silvestro and Michalak 2012), using partition data sets
under default settings, and support was assessed by using
1,000 bootstrapped replicates. The most appropriate
substitution model was implemented for each gene
fragment as determined by the Bayesian Information
Criterion in PartitionFinder v2 (Lanfear et al. 2017)
to choose the optimal partitioning strategy for both
phylogenetic analyses (Supplemental Table S3). Default
priors and Markov chain settings were used, and searches
were performed with random starting trees. Each run
consisted of four chains of 20 million generations,
sampled every 2,000 generations.
BEAST v1.8.4 (Drummond et al. 2012) was used to
simultaneously estimate the phylogeny and divergence
times between taxa. The most appropriate substitution
model was implemented for each gene fragment as
determined by the Bayesian Information Criterion in
jModeltest v2 (Posada 2008). A Yule speciation tree
prior was applied, along with a relaxed lognormal clock
for the concatenated 12S+16S rDNA and for the c-mos
alignments. A strict clock, using a substitution rate of
1.34% substitutions per million years, was applied for the
cytb gene fragments, as estimated by Daza et al. (2009)
for Neotropical colubrids based on four calibration
points. As priors for the rates, the approximate reference
(CTMC) prior was selected (Ferreira and Suchard 2008).
BEAST was run twice with 50 million generations per
run, sampling every 5,000 steps. Convergence of the runs
was verified in Tracer v1.6 (Rambaut et al. 2013), both
runs were combined in LogCombiner, and the Maximum
Clade Credibility Tree was computed using Tree
Annotator (BEAST v1.8.4). All analyses were performed
Amphib. Reptile Conserv.
through the CIPRES platform (Miller et al. 2010).
Results
No stop codons were found in the cytb and c-mos
alignments. The best-fitting models are shown in
Supplemental Table S3. All phylogenetic analyses
recovered Tantilla melanocephala as monophyletic
(Figs. 3-4). Similarly, all analyses recovered a strongly
supported 7’ melanocephala from Venezuelat+Trinidad
clade. The relationship with Tobago is weakly supported
(Fig. 3). The timing of the most recent common ancestor
of Zantilla dates to the Middle Miocene (~12 Mya:
95% HPD 10.7-14.3 Mya), but this time estimate is
likely to change when other species are included in
future phylogenetic analyses (Fig. 4). Timing of the
T! melanocephala clade varies considerably, with the
time since the most recent common ancestor (TMRCA)
dating to the beginning of the Pleistocene (2.3 Mya: 95%
HPD 1.8—3 Mya). This early split relates to the timing
between 7. melanocephala from Brazil and all other
localities of 7’ melanocephala. The divergence between
Guyana + French Guiana and Venezuela + Trinidad
+ Tobago dates to 1.8 Mya (95% HPD 1.2—2.4 Mya)
(Fig. 4). A more recent TMRCA towards the end of the
Pleistocene is recovered between Trinidad and Venezuela
T! melanocephala (0.2 Mya, 95% HPD 0.014—0.48
Mya). The recovered sister clade relationship between T.
tjiasmantoi (from Peru) and 7: melanocephala requires
further investigation as 7? Hiasmantoi 1s the only Tantilla
Species missing cytb and c-mos sequence data.
Discussion
The analyses presented here recovered two clades
within TJantilla, a North American-Central American
clade consisting of 7. coronata, T. gracilis, T.
hobartsmithi, T. impensa, T. nigriceps, T. planiceps,
and 7. relicta and a Central American-South American
clade with T. armillata, T: vermiformis, T. tjiasmantoi,
and 7. melanocephala. The calibration estimates for
T! melanocephala divergence reject a vicariant event
between Trinidad and northern South America in the Late
Miocene when Trinidad detached from the Peninsula de
Paria of northern Venezuela ~4 Mya (Babb and Mann
1999; Flinch et al. 1999), and point to a divergence in the
Late Pleistocene. The Late Pleistocene was a time of rapid
and abrupt topographic change in the eastern Caribbean
associated with eustatic sea level changes in the region
(Murphy 1997; Hansen et al. 2013; Murphy et al.
2019c). The low genetic divergence of 7’ melanocephala
recovered between Venezuela and Trinidad is similar to
that found in Atractus trilineatus between Guyana and the
islands (Murphy et al. 2019c), and it likely results from
the changing topographical conditions that facilitated the
connections between regions (Murphy 1997; Murphy et
al. 2019c). Different parts of the Trinidad and Tobago
December 2020 | Volume 14 | Number 3 | e268
Tantilla melanocephala diversity in Trinidad, Tobago, and Venezuela
- French Guiana
- Brazil
- Guyanal
Guyana2
74/0.97 ;
la - Trinidad
Tantilla tjiasmantoi1
Tantilla tjiasmantoi2
Tantilla armillata
Tantilla vermiformis
100/1 Tantilla gracilis
81/- Tantilla hobartsmithi
100/1 Tantilla planiceps
1400/1 Tantilla nigriceps
4100/1, Tantilla relicta1
92/- 100/1 Tantilla relicta2
Tantilla coronata
Tantilla impensa
79/- Chionactis occipitalis
96/1 Sonora semiannulata
98/1 Sonora aemula i)
1400/1 99/1 Sonora mutabilis
97/1 83/- Sonora michoacanensis
Chilomeniscus stramineus
Stenorrhina freminvillei
79/1 Pseudoficimia frontalis
79/1 Sympholis lippiens
1400/1 Conophis vittatus
Conophis biseralis
94/1
4100/1 Drymarchon couperi
Drymarchon corais
Fig. 3. Best Maximum Likelihood tree based on the data set of concatenated 12S and 16S rDNA, cytb, and c-mos sequences. Red
clade depicts the genus Zantilla. Values on the left and right sides of a slash (/), are the values indicated at nodes of Maximum
Likelihood bootstraps (>70%) and Bayesian Posterior probability values (>95%), respectively. The 7antilla melanocephala pictured
is from the western versant of the Occidental slopes in Ecuador (from the Rio Manduriacu Reserve). Photo by R. Maynard.
[0.014-0.48
[0.91-2.03]]; 4 0.2 - Venezuela
1 - Tobago
- Guyanal
- Guyana2
- French Guiana
) - Brazil
[1.26-2.38]]1.8
[0.002-0.25
[1.78-3.08] 1,2 0.09
2.3
[0.68-1.94]
[6.2-10.49] 8.3
@ BPP= 1.0 [9.4-13.0] [0-0.67|<— Tantilla tjiasmantoi1
: 0.15 Tantilla tjiasmantoi2
10.4 Tantilla armillata
[8.49-12.44] —— Tantilla vermiformis
[2.25-3.87] Tantilla gracilis
[10.7°14-3] gy i2.4 [4.87°7.15] $5 4 28 Tantilla hobartsmithi
poset eg Tantilla planiceps
[7.50-10.27] oh Tantilla nigriceps
i 0.02, Tantilla relicta1
[8.78-12.18] dis (1.67°3.00] &55 — [0.0-0.1] * Tantilla relicta2
[14.50-19.33] digs Tantilla coronata
Tantilla impensa
[6.19-10.21] Sonora mutabilis
[9.69-13.86] 11.7 ss Sonora michoacanensis
[10.64-14.63] 4 1, Chilomeniscus stramineus
[6.11-9.75] 795 Sonora aemula
[12.44-16.96] bs 4 ¢ [7.92-11.57] 9.6 Sonora semiannulata
Chionactis occipitalis
Stenorrhina freminvillei
[9.02-13.8] i Pseudoficimia frontalis
- Sympholis lippiens
[4.39-7.14] 57 Conophis biseralis
17.0 Conophis vittatus
[0.30-0.95] Drymarchon corais
Drymarchon couperi
@ BPP= 0.95-0.99
[16.08-21.75] @18.7
[11.66-16.53] 14.0
[14.17-19.82]
0.6
20 17.5 15 12.5 10 7.5 5 2.5 O Mya
Fig. 4. Bayesian time tree as inferred by BEAST for the data set of concatenated 12S and 16S rDNA, cytb, and c-mos sequences
from Tantilla specimens (in red). Red values by nodes denote the median time estimates, whereas values in brackets denote 95%
Highest Posterior Density ranges. Red and black nodes are posterior probabilities (1.00 and > 95-99%), respectively. Photo by J.C.
Murphy.
Amphib. Reptile Conserv. 210 December 2020 | Volume 14 | Number 3 | e268
Jowers et al.
archipelago were connected to the mainland multiple
times, with Trinidad connected to the mainland for more
prolonged periods than Tobago (Murphy et al. 2019c).
When sea levels dropped during the Pleistocene, gene
flow could be expected between island populations and
the mainland, as connections could be established with
sea level drops as moderate as 50 m (Murphy 1997;
Hansen et al. 2013). Thus, recent divergences in a variety
of organisms were likely. For example, Robinson’s
Mouse Opossum (Marmosa robinsoni) from Venezuela
and Trinidad and Tobago has been shown to diverge 0.34
Mya (Gutierrez et al. 2014), and the skinks Marisora
aurulae from Trinidad and M. falconensis from Estado
Falcon in the Paraguana Peninsula, diverged ca. 0.5
Mya (Hedges and Conn 2012). Therefore, vicariance is
more plausible than an over-water dispersal during the
interglacial periods. Nevertheless, over-water dispersal
cannot be ruled out as an explanation for the arrival of
species in Tobago from Trinidad (e.g., Boos 1984a,b;
Camargo et al. 2009; Murphy et al. 2016). For example,
the shared Micrurus diutius haplotypes in Trinidad and
Guyana and the low divergence of Atractus trilineatus
from Trinidad, Tobago, and Guyana suggest dispersal
through either Pleistocene land bridge formations or
rafting (Murphy et al. 2019c).
Furthermore, recent work on the fossorial Trinidad
Threadsnake, Epictia tenella, has shown a remarkable
genetic similarity between Guyana and_ Trinidad,
suggesting colonization by recent dispersal rather than
ancient vicariance (Murphy et al. 2016). The results
of the current study indicate that mainland southern
localities (Guyana and French Guiana) show deeper
divergence compared to Venezuela-Trinidad and Tobago,
with a TMRCA dating to circa 1.8 Mya and a basal split
between Brazil and the rest of the clade dating to 2.3
Mya. Similarly, the frog Leptodactylus validus originates
from northern South America (Guyana/Brazil) and
its dispersal to Trinidad ~1 Mya has been attributed to
periods of intermittent land connections, or overwater
dispersal, throughout the Pleistocene (Camargo et al.
2009). This pattern was also reported for Atractus
trilineatus between individuals from coastal Guyana
and Trinidad-Tobago (Murphy et al. 2019c). Indeed,
dispersals from the northern mainland to Trinidad may
be a regular occurrence and a source of close genetic
associations with local herpetofaunal populations
(Charles 2013). More effective conservation measures
can thus be implemented based on increased knowledge
of the distribution and systematics of relevant species
(Bohm et al. 2013).
The recovery of a strongly monophyletic clade
contrasts with what we might have expected based on
morphological data (Wilson and Mena 1980). Combining
data from Wilson and Mena (1980) and the data presented
here, the mean ventral counts on Trinidad males (146.8)
are lower by approximately 5.8 scales than on animals
from adjacent Venezuela (where males average 152.6);
Amphib. Reptile Conserv.
for females the difference is even greater at 9.3 scales
(Trinidad averages 150.7 ventrals and adjacent Venezuela
averages 160). Comparing Tobago and Trinidad, male
ventral numbers again increase markedly in Tobago
over those in Trinidad, and are greater than those from
mainland Venezuela. Wilson and Mena (1980) also
commented that only specimens from upper Central
America have higher ventral counts than those from
Tobago. Comparable figures for Tobago females were
not available, but the count for the single Tobago female
(168) was nine scales more than the highest count for
Trinidad females. In contrast, subcaudal counts were
higher in Venezuela (male average 66.4) and Trinidad
(male average 57.2), but subcaudal counts in Tobago
males averaged 73.25. Additional population sampling
will be required from marginal populations (such as those
in Argentina, Uruguay, southern Brazil, and west of the
Andes) to encompass the wider distribution of the species
and ascertain the complete range of morphological
variation in the species.
Our phylogenetic analyses provide evidence for the
idea that at least a portion of the Trinidad and Tobago
herpetofauna has closer ties to the Caribbean Coastal
Ranges (CCR) of Venezuela than to the Guiana Shield.
Distribution patterns and molecular evidence from other
taxa, such as various frogs (Flectonotus fitzgeraldi,
Hyalinobatrachium orientale, Mannophryne olmonae, M.
trinitatis, Pristimantis charlottevillensis, P. turpinorum),
lizards (Anolis cf. tigrinus, Bachia trinitatis, Gonatodes
ceciliae, G. ocellatus, Oreosaurus shrevei, Plica
caribeana, Polychrus auduboni), and snakes (Atractus
fuliginosus, Dipsas variegata, Erythrolamprus bizona,
E. pseudoreginae, Ninia atrata, Micrurus circinalis),
corroborate a shared fauna between Trinidad, Tobago,
and the CCR (Murphy 1997; Angarita-Sierra 2014;
Jowers et al. 2015; Murphy et al. 2018). However,
Tantilla melanocephala 1s a widespread species that
also has a shared genetic history with the CCR despite
its proximity to the Guiana Shield. We suspect that as
more species are examined this pattern will become more
prevalent.
Conservation
The total number of 7antilla melanocephala individuals
observed on Trinidad and Tobago over 15 field trips was
only 12 (JCM field notes). In contrast, Lynch (2015)
found 7: melanocephala to be among the five most
frequently encountered snakes in African Oil Palm
plantations that were sampled in the department of Meta,
Colombia. However, 7’ melanocephala was among the
rarest snakes found in oil palm plantations at all other
sites sampled across Colombia. Such findings suggest
that 7. melanocephala might be associated with certain
habitat types or dynamics (e.g., oil palm plantations
surrounded by forest as opposed to pasture), being very
common in some areas or very rare in others. However, it
December 2020 | Volume 14 | Number 3 | e268
Tantilla melanocephala diversity in Trinidad, Tobago, and Venezuela
is also plausible that the 77 melanocephala data reported
by Lynch (2015) are representative of more than one
lineage, suggesting that some populations are more
tolerant of disturbed habitats than others.
Our study shows the lack of cryptic species diversity
within a few regions of the peripheral populations of
I! melanocephala. This finding implies that (at least
for now) its conservation status of Least Concern
(IUCN 2020) is suitable. Increasing the collection and
sequencing efforts across most of the distribution range
of this species will be challenging, but such an effort
would likely address the presence of population diversity
and morphotypes from different habitats. In particular,
sampling of biogeographically important regions (e.g.,
Trans-Andean) might reveal divergent lineages that
warrant a more protective conservation status.
Acknowledgements.—Special thanks to S. Mourao and
P. Ribeiro for their lab assistance, and to Mayke De
Freitas for his support and companionship during several
fields trips in Peninsula de Paria, Venezuela. This work
was supported by a fellowship from the Portuguese
Foundation for Science and Technology (FCT, SFRH/
BPD/109148/2015) and by an international collaboration
grant to MJJ from the South Korean National Institute
of Ecology (NIE). Special thanks to CAS (California
Academy of Sciences) and AMNH (American Museum
of Natural History) for tissue samples. We are also
thankful to R. Maynard, M.D. Cardwell, and an
anonymous reviewer.
Literature Cited
Angarita-Sierra T. 2014. Hemipenial morphology in
the semifossorial snakes of the genus Ninia and a
new species from Trinidad, West Indies (Serpentes:
Dipsadidae). South American Journal of Herpetology
9: 114-130.
Babb S, Mann P. 1999. Structural and sedimentary
development of a Neogene transpressional plate
boundary between the Caribbean and South American
plates in Trinidad and the Gulf of Paria. Pp. 495-557
In: Caribbean Sedimentary Basins. Elsevier Basins
of the World. Editor, Mann P. Elsevier, Amsterdam,
Netherlands. 699 p.
Beaupre SJ, Jacobson ER, Lillywhite HB, Zamudio K.
2004. Guidelines for Use of Live Amphibians and
Reptiles in Field and Laboratory Research. American
Society of Ichthyologists and Herpetologists,
Lawrence, Kansas, USA. 14 p.
Berg CS, Jeremiah A, Harrison B, Henderson RW.
2009. New island records for Zantilla melanocephala
(Squamata: Colubridae) on the Grenada Bank. Applied
Herpetology 6: 403-404.
Bohm M, Collen B, Baillie JEM, Zug G. 2013. The
conservation status of the world’s reptiles. Biological
Conservation 157: 372-385.
Amphib. Reptile Conserv.
Boos HEA. 1984a. A consideration of the terrestrial
reptile fauna on some offshore islands north west of
Trinidad. Living World, Journal of the Trinidad and
Tobago Field Naturalists’ Club 1984: 19-26.
Boos HEA. 1984b. Reptiles of Soldado Rock, Trinidad.
Living World, Journal of the Trinidad and Tobago
Field Naturalists’ Club 1984: 12.
Burbrink FT, Lawson R, Slowinski BB. 2000.
Mitochondrial DNA phylogeography of the polytypic
North American Rat Snake (Elaphe obsoleta): a
critique of the subspecies concept. Evolution 54:
2,107—2,118.
Camargo A, Heyer WR, de Sa RO. 2009. Phylogeography
of the frog Leptodactylus validus (Amphibia: Anura):
patterns and timing of colonization events in the Lesser
Antilles. Molecular Phylogenetics and Evolution 53:
571-579.
Card DC, Schield C, Shield DR, Richard AH, Corbin
AB, Perry BW, Audra AL, Pasquesi GIM, Smith
EN, Jezkova T, et al. 2016. Phylogeographic and
population genetic analyses reveal multiple species
of Boa and independent origins of insular dwarfism.
Molecular Phylogenetics and Evolution 102: 104—
116.
Charles SC. 2013. An interesting reptile dispersal event
from continental South America to Trinidad, Trinidad
and Tobago. Living World, Journal of The Trinidad
and Tobago Field Naturalists’ Club 2013: 63.
Daza JM, Smith EN, Paez VP, Parkinson CL. 2009.
Complex evolution in the Neotropics: the origin and
diversification of the widespread genus Leptodeira
(Serpentes: Colubridae). Molecular Phylogenetics
and Evolution 53: 653-667.
De Silva M, Wilson D. 2006. A Natural History of
Mustique. The Mustique Company, Ltd., Mustique
Island, St. Vincent and the Grenadines. 331 p.
Drummond AJ, Suchard MA, Xie D, Rambaut A. 2012.
Bayesian phylogenetics with BEAUti and the BEAST
1.7. Molecular Biology and Evolution 29: 1,969-
1973:
Erlich RN, Barrett SF. 1990. Cenozoic plate tectonic
history of the northern Venezuela-Trinidad area.
Tectonics 9: 161-184.
Ferreira MA, Suchard MA. 2008. Bayesian analysis of
elapsed times in continuous-time Markov chains.
Canadian Journal of Statistics 36(3): 355-368.
Figueroa A, McKelvy AD, Grismer LL, Bell CD,
Lailvaux SP. 2016. A species-level phylogeny of
extant snakes with description of a new colubrid
subfamily and genus. PLoS ONE 11: e0161070.
Flinch JF, Rambaran V, Ali W, De Lisa V, Hernandez
G, Rodrigues K, Sams R. 1999. Structure of the
Gulf of Paria pull-apart basin (Eastern Venezuela-
Trinidad). Pp. 477-494 In: Caribbean Sedimentary
Basins. Elsevier Basins of the World. Editor, Mann P.
Elsevier, Amsterdam, Netherlands. 669 p.
Goebel AM, Donnelly JM, Atz ME. 1999. PCR primers
December 2020 | Volume 14 | Number 3 | e268
Jowers et al.
and amplification methods for 12S ribosomal DNA,
the control region, cytochrome oxidase I, and
cytochrome b in bufonids and other frogs, and an
overview of PCR primers which have amplified DNA
in amphibians successfully. Molecular Phylogenetics
and Evolution 11: 163-199.
Gouy M, Guindon S, Gascuel O. 2010: SeaView version
4. A multiplatform graphical user interface for
sequence alignment and phylogenetic tree building.
Molecular Biology and Evolution 27. 221-224.
Greenbaum E, Carr JL, Almendariz A. 2004. Taxonomic
status of Tantilla equatoriana Wilson and Mena 1980
(Serpentes: Colubridae). The Southwestern Naturalist
49: 457-464.
Gutierrez EE, Anderson RP, Voss RS, Ochoa-G J,
Aguilera M, Jansa SA. 2014. Phylogeography of
Marmosa robinsoni: insights into the biogeography
of dry forests in northern South America. Journal of
Mammalogy 95: 1,175—1,188.
Hansen J, Sato M, Russell G, Kharecha P. 2013. Climate
sensitivity, sea level, and atmospheric carbon
dioxide. Philosophical Transactions of the Royal
Society A 371: 20120294.
Hedges SB, Conn CR. 2012. A new skink fauna
from Caribbean islands (Squamata, Mabuyidae,
Mabuyinae). Zootaxa 3288: 1-244.
Henderson RW, Powell R. 2006. Geographic distribution,
Tantilla melanocephala. Herpetological Review 37:
501.
Henderson RW, Breuil M. 2012. Lesser Antilles. Pp. 150—
161 In: Zsland Lists of West Indian Amphibians and
Reptiles. Bulletin of the Florida Museum of Natural
History, Volume 51, number 2. Editors, Powell R,
Henderson RW. Florida Museum of Natural History,
Gainesville, Florida, USA. [85|-166 p.
Henderson RW, Powell R. 2018. Amphibians and Reptiles
of the St. Vincent and Grenada Banks, West Indies.
Edition Chimaira, Frankfurt am Main, Germany. 448 p.
IUCN. 2020. Black-headed Snake, TZantilla melano-
cephala. The IUCN Red List of Threatened Species
2019: e.T203321A2763890.
Jadin RC, Burbrink FT, Rivas GA, Vitt LJ, Barrio-
Amoros CL, Guralnick RP. 2014. Finding arboreal
snakes in an evolutionary tree: phylogenetic placement
and systematic revision of the Neotropical birdsnakes.
Journal of Zoological Systematics and Evolutionary
Research 52: 257-264.
Jadin RC, Blair C, Jowers MJ, Carmona A, Murphy
JC. 2019. Hiding in the lianas of the tree of life:
molecular phylogenetics and species delimitation
reveal considerable cryptic diversity of New World
Vine Snakes. Molecular Phylogenetics and Evolution
134: 61-65.
Jowers MJ, Lehtinen RM, Downie RJ, Georgiadis AP,
Murphy JC. 2015. Molecular phylogenetics of the
glass frog Hyalinobatrachium orientale (Anura:
Centrolenidae): evidence for Pliocene connections
Amphib. Reptile Conserv.
between mainland Venezuela and the island of
Tobago. Mitochondrial DNA 26: 613-618.
Jowers JM, Garcia-Mudarra JL, Charles SP, Murphy
JC. 2019. Phylogeography of West Indies coral
snakes (Micrurus): island colonization and banding
patterns. Zoologica Scripta 48(3): 263-276.
Katoh K, Misawa K, Kuma K, Miyata T. 2002. MAFFT:
a novel method for rapid multiple sequence alignment
based on fast Fourier transform. Nucleic Acids
Research 30: 3,059-3,066.
Koch C, Venegas PJ. 2016. A large and unusually colored
new snake species of the genus Zantilla (Squamata:
Colubridae) from the Peruvian Andes. PeerJ 4: e2767.
Kocher TD, Thomas WK, Meyer A, Edwards SV, Paabo
S, Villablanca FX, Wilson AC. 1989. Dynamics
of mitochondrial DNA _ evolution in animals:
amplification and sequencing with conserved primers.
Proceedings of the National Academy of Sciences of
the United States of America 86(16): 6,196—6,200.
Lanfear R, Frandsen PB, Wright AM, Senfeld T, Calcott
B. 2017. PartitionFinder 2: new methods for selecting
partitioned models of evolution for molecular and
morphological phylogenetic analyses. Molecular
Biology and Evolution 34: 772-773.
Larkin MA, Blackshields G, Brown N, Chenna R,
McGettigan PA, McWilliam H, Valentin F, Wallace
IM, Wilm A, Lopez R. 2007. Clustal W and Clustal X
version 2.0. Bioinformatics 23(21): 2,947—2,948.
Lawson R, Slowinski JB, Crother BI, Burbrink FT.
2005. Phylogeny of the Colubroidea (Serpentes):
new evidence from mitochondrial and nuclear genes.
Molecular Phylogenetics and Evolution 37(2): 581-
601.
Liddle RA. 1946. The Geology of Venezuela and
Trinidad. Paleontological Research Institution, Ithaca,
New York, USA. 890 p.
Lynch JD. 2015. The role of plantations of the African
palm (Elaeis guineensis JacQ.) in the conservation of
snakes in Colombia. Caldasia 37: 169-182.
Marques OV, Puorto G. 1998. Feeding, reproduction, and
growth in the Crowned Snake, Zantilla melanocephala
(Colubridae), from southeastern Brazil. Amphibia-
Reptilia 19: 311-318.
Miller MA, Pfeiffer W, Schwartz T. 2010. Creating
the CIPRES Science Gateway for inference of
large phylogenetic trees. Pp. 1-8 In: 20/0 Gateway
Computing Environments Workshop (GCE), New
Orleans, Louisiana, USA. 14 November 2010. TEEE:
Piscataway, New Jersey, USA. 115 p.
Murphy JC. 1997. Amphibians and Reptiles of Trinidad
and Tobago. Krieger, Malabar, Florida, USA. 245 p.
Murphy JC, Rutherford MG, Jowers MJ. 2016. The
threadsnake tangle: lack of genetic divergence in
Epictia tenella (Squamata, Leptotyphlopidae):
evidence for introductions or recent rafting to the
West Indies. Studies on Neotropical Fauna and
Environment 51: 197— 205.
December 2020 | Volume 14 | Number 3 | e268
Tantilla melanocephala diversity in Trinidad, Tobago, and Venezuela
Murphy JC, Downie JR, Smith JM, Livingstone SM,
Mohammed RS, Lehtinen RM, Eyre M, Sewlal JAN,
Noriega N, Casper GS, et al. 2018. A Field Guide to
the Amphibians and Reptiles of Trinidad & Tobago.
Trinidad and Tobago Field Naturalists’ Club, Port of
Spain, Trinidad and Tobago. 336 p.
Murphy JC, Braswell AL, Charles SP, Auguste RJ, Rivas
GA, Borzée A, Lehtinen RM, Jowers MJ. 2019a. A
new species of Erythrolamprus from the oceanic island
of Tobago (Squamata, Dipsadidae). ZooKeys 817:
19 te Ears
Murphy JC, Salvi D, Santos JL, Braswell AL, Charles
SP, Borzée A, Jowers MJ. 2019b. The reduced limbed
lizards of the genus Bachia (Reptilia, Squamata,
Gymnophthalmidae): biogeography, cryptic diversity,
and morphological convergence in the eastern
Caribbean. Organisms, Diversity, and Evolution 19:
321-340.
Murphy JC, Salvi D, Braswell AL, Jowers MJ. 2019c.
Phylogenetic position and biogeography of Three-
lined Snakes (Atractus_ trilineatus: Squamata,
Dipsadidae) in the eastern Caribbean. Herpetologica
75: 247-253.
Nogueira CC, Argolo AJ, Arzamendia V, Azevedo JA,
Barbo FE, Bérnils RS, Bolochio BE, Borges-Martins
M, Brasil-Godinho M, Braz H, et al. 2019. Atlas of
Brazilian snakes: verified point-locality maps to
mitigate the Wallacean shortfall in a megadiverse
snake fauna. South American Journal of Herpetology
14(Supplement): 1-274.
Palumbi SR, Martin A, Romano S, McMillan WO, Stice
J, Grabowski G. 1991. The Simple Fool's Guide to
PCR. University of Hawaii Press, Honolulu, Hawaii,
USA. 45 p.
Pindell JL, Kennan L. 2007. Cenozoic kinematics
and dynamics of oblique collision between two
convergent plate margins: the Caribbean-South
America collision in eastern Venezuela, Trinidad, and
Barbados. Transactions of Gulf Coast Section, Society
of Economic Paleontologists and Mineralogists
(GCSSEPM) 27: 458-553.
Posada D. 2008. jModelTest: phylogenetic model
averaging. Molecular Biology and Evolution 25:
1,253-1,256.
Ptacek MB, Gerhardt HC, Sage RD. 1994. Speciation
by polyploidy in treefrogs: multiple origins of the
tetraploid, Hyla versicolor. Evolution 48: 898-908.
Pyron RA, Burbrink FT, Wiens JJ. 2013. A phylogeny and
revised classification of Squamata, including 4,161
species of lizards and snakes. BMC Evolutionary
Biology 13: 93.
Rambaut A, Suchard MA, Xie W, Drummond AJ. 2013.
Tracer v.1.6.0: MCMC Trace Analysis Tool. BEAST
Amphib. Reptile Conserv.
Developers, Edinburgh, Scotland. Available: http://
beast.bio.ed.ac.uk.
Ray JM. 2017. Snakes of Panama: a Field Guide to All
Species. Team Snake Panama, Lexington, Kentucky,
USA. 213 p.
Reynolds RG, Kolbe JJ, Glor RE, Lopez-Darias M,
Gomez Pourroy CV, Harrison AS, Queiroz K, Revell
LJ, Losos JB. 2020. Phylogeographic and phenotypic
outcomes of Brown Anole colonization across the
Caribbean provide insight into the beginning stages
of an adaptive radiation. Journal of Evolutionary
Biology 33: 468-494.
Ronquist F, Huelsenbeck JP. 2003. MrBayes 3: Bayesian
phylogenetic inference under mixed models.
Bioinformatics 19: 1,572—1,574.
Sabaj MH. 2019. Standard symbolic codes for
institutional resource collections in herpetology and
ichthyology: an online reference. Version 7.1 (21
March 2019). American Society of Ichthyologists and
Herpetologists, Washington, DC, USA. Available:
https://asih.org/standard-symbolic-codes [Accessed:
1 March 2019].
Silvestro D, Michelack I. 2012. RaxmlIGUI: a graphical
front-end for RAxML. Organisms, Diversity, and
Evolution 12: 335-337.
Spielman D, Brook BW, Frankham R. 2004. Most
species are not driven to extinction before genetic
factors impact them. Proceedings of the National
Academy of Sciences of the United States of America
101: 15,261—15,264.
Uetz P, Freed P, HoSek J. (Editors). 2020. The Reptile
Database. Available: http://www.reptile-database.org
[Accessed: 10 February 2020].
Vuoto JA. 1998. Se confirma la presencia de Tantilla
melanocephala (Linnaeus, 1758) (Serpentes:
Colubridae) en Pcia. de Entre Rios-Argentina. Museo
de Ciencias Naturales y Antropologicas ‘Prof.
Antonio Serrano.” Serie Vertebrados (Los Reptiles)
6: 1-12.
Wilson LD, Mena CE. 1980. Systematics of the
melanocephala group of the colubrid snake genus
Tantilla. San Diego Society of Natural History
Memoirs 11: 5-58.
Wilson LD. 1992. Tantilla melanocephala. Catalogue of
American Amphibians and Reptiles 547: |-3.
Young TP. 2000. Restoration ecology and conservation
biology. Biological Conservation 92: 73-83.
Zaher H, Murphy RW, Arredondo JC, Graboski R,
Machado-Filho PR, Mahlow K, Montingelli GG,
Quadros AB, Orlov NL, Wilkinson M, et al. 2019.
Large-scale molecular phylogeny, morphology,
divergence-time estimation, and the fossil record of
advanced caenophidian snakes (Squamata: Serpentes).
PLoS ONE 14: e0216148.
December 2020 | Volume 14 | Number 3 | e268
Jowers et al.
Michael J. Jowers is an evolutionary biologist with broad interests in the processes and the timings of speciation.
His work focuses on tropical island biogeography, phylogeography, systematics, population genetics, taxonomy,
and conservation. Michael is deeply involved in amphibian and reptile studies from the islands of Trinidad and
Tobago (Lesser Antilles), but he is also interested in other organisms such as birds, mammals, and insects, and
actively leads studies throughout South America, Africa, Europe, and Asia.
Gilson A. Rivas was born in Caracas, Venezuela. He currently serves as co-editor of the scientific journal
Anartia, and is a collection manager at the Museo de Biologia de la Universidad del Zulia, Maracaibo—a
Venezuelan centennial university that began academic activities on 11 September 1891. For over two decades,
Gilson has been devoted to the taxonomy and conservation of the neotropical herpetofauna, having authored or
co-authored more than 100 academic publications, describing over 30 new species of amphibians and reptiles,
and a new genus of dipsadine snake, Plesiodipsas. Gilson is the author (with G. Ugueto) of the book Amphibians
and Reptiles of Margarita, Coche, and Cubagua; and together with M. De Freitas, H. Kaiser, C.L. Barrio-
Amoros, and T.R. Barros produced Amphibians of the Peninsula de Paria: a Pocket Field Guide. Gilson’s
research interests are focused on the herpetofauna of the Venezuelan coastal range and insular ecosystems, as
well as the influences of invasive species and human development and their impacts on the native fauna.
Robert C. Jadin is a lecturer and curator at the University of Wisconsin, Stevens Point (USA). Robert completed
his Ph.D. from the Department of Ecology and Evolutionary Biology at the University of Colorado, Boulder,
after transferring from the University of Texas at Arlington. Robert’s specialties are biodiversity informatics,
herpetology, and systematics, and he typically works on snakes. More specifically, his research encompasses
bioinformatic and comparative approaches to address evolutionary and biodiversity questions about species
relationships, distributions, adaptations, and conservation implications. In this photo, Robert holds a Sibon
longifrenis at La Selva, Costa Rica. Photo by S.A. Orlofske.
Alvin L. Braswell has a B.S. in Wildlife Biology and an MLS. in Zoology with an emphasis in Herpetology. He
retired after 40 years with the Museum of Natural Sciences (MNS, Raleigh, North Carolina, USA) where he
transitioned thru the ranks as Collections’ Manager for Herpetology and Ichthyology, Curator of Amphibians,
Curator for Herpetology, Research Lab Director, and finally Deputy Museum Director for Operations. After
4.5 years of retirement, the joy of being a biologist again, and discovering new and wonderful things, he was
called back to serve as Interim Director of the MNS. Now (a year and half later), he is looking forward to re-
retirement and having the chance to be a biologist again. Alvin holds an adjunct position at North Carolina State
University, where he has co-taught Herpetology from 1996-2013.
Renoir J. Auguste is a Trinidad and Tobago herpetologist. Renoir received his M.Sc. in Biodiversity
Conservation from The University of the West Indies, St. Augustine Campus, Trinidad and Tobago, and
is interested in the ecology and conservation of amphibians and reptiles. He has conducted herpetological
surveys across Trinidad and Tobago for national baseline surveys aimed at improving protected areas, as part
of his academic degrees, and also voluntarily with the local environmental NGO Trinidad and Tobago Field
Naturalists’ Club, in which he has held the position of President for three years.
Amaél Borzée is principally interested in behavioral ecology and the conservation of species; and his current
research focus 1s on amphibian breeding behavior and conservation in North East Asia. Amaél has been mostly
focusing on treefrogs so far, but is currently expanding his interests to address broader questions for the con-
servation of multi-species populations over large landscapes, including the use of multiple types of approaches
and analytical tools.
John C. Murphy is a naturalist with a focus on snakes. When he is not hiking in the desert or examining
specimens in the lab, he is often writing about reptiles. Murphy is a retired science educator who got serious
about his lifelong fascination with lizards and snakes in the early 1980s when he and his family made their first
trip to Trinidad. The work on Trinidad and Tobago provided valuable lessons that shaped his views of nature
and evolution, and today he is still working on the eastern Caribbean herpetofauna. In the 1990s he did some
work on homalopsid snakes in Southeast Asia with others from the Field Museum (Chicago, Illinois, USA).
He now resides in southeastern Arizona, and is involved in multiple projects on arid habitats and the impacts
of climate change on biodiversity. His most recent book is Giant Snakes, A Natural History (with co-author
Tom Crutchfield). Born and raised in Joliet, Illinois, he first learned about reptiles on his grandfather’s farm by
watching Eastern Garter Snakes emerge from their winter dens and Snapping Turtles depositing their eggs at
the edge of a cattail marsh.
Amphib. Reptile Conserv. 215 December 2020 | Volume 14 | Number 3 | e268
Tantilla melanocephala diversity in Trinidad, Tobago, and Venezuela
Supplementary Material
Table S1. Primers used in gene fragment amplification, indicating the gene fragments amplified, primers, and references.
Gene Primer name and sequence Reference
12S rDNA 12SA 5’°- AAACTGGGATTAGATACCCCACTAT -3’ Kocher et al. 1989
12S rDNA 12SB 3’- GAGGGTGACGGGCGGTGTGT -3’ Kocher et al. 1989
16S rDNA 16SL 53’°- GCCTGTTTATCAAAAACAT -3’ Palumbi et al. 1991
16S rDNA 16SH 5’- CCGGTCTGAACTCAGATCACGT -3’ Palumbi et al. 1991
cytb 14910 5’- GACCTGTGATMTGAAAAACCAYCG -3’ Burbrink et al. 2000
cytb H16064 5’- CTTTGGTTTACAAGAACAATGCTT -3’ Burbrink et al. 2000
cytb Pacek-L (short) 5’°-TGAGGACAAATATCATTCTGAGG -3’ Ptacek et al. 1994
cytb CB3Xen-H 5’- GGCGAATAGGAARTATCATTC -3’ Goebel et al. 1999
c-mos S77 5’- CATGGACTGGGATCAGTTATG -3’ Lawson et al. 2005
c-mos S78 5’- CCTTGGGTGTGATTTTCTCACCT -3’ Lawson et al. 2005
Table S2. Species used in this study, vouchers, and GenBank accession numbers. na: not applicable; asterisks (*) indicate locality
identity not confirmed.
Species Ingroup vouchers Ingroup country 1SrDNA_ 16S rDNA Cytb C-mos
Chilomeniscus stramineus na na -- -- GQ895856 GQ895800
Chionactis occipitalis na na -- -- GQ895857 = =§«GQ895801
Conophis vittatus na na -- -- GQ895862 GQ89I5806
Conopsis biserialis na na -- -- GQ895860 GQ89I5804
Pseudoficimia frontalis na na -- -- GQ895886 GQ89I5827
Sonora aemula na na -- -- JQ265959 JQ265952
Sonora michoacanensis na na -- -- JQ265958 JQ265951
Sonora mutabilis na na -- -- JQ265956 JQ265950
Sonora semiannulata na na -- -- AF471048 AF471164
Stenorrhina freminvillei na na HMS565769 -- GQ895889 GQ895830
Drymarchon corais na na HM565758 HM582218 AF471064 AF471137
Drymarchon couperi na na -- -- KP765662 KP765646
Sympholis lippiens na na -- -- GQ895890 GQ895831
Tantilla coronata LSU H-18896 USA -- -- KP765669 KP765653
Tantilla gracilis OMNH41880 USA -- -- KP765670 KP765654
Tantilla hobartsmithi MVZ233299 USA -- -- KP765671 KP765650
Tantilla planiceps TAPL340 USA -- -- KP765673 KP765651
Tantilla armillata FN256487 Guatemala* KR814613 =KR814644 = KR814702 ~=—«KR814681
Tantilla impensa FN253542 Guatemala* KR814614. = KR814645 = KR814688 KR814677
Tantilla vermiformis FN256027 Guatemala* KR814615 KR814646 KR814684 KR814665
Tantilla nigriceps OMNH41890 USA -- -- KP765672 KP765655
Tantilla relicta\ CAS200845 USA -- -- AF471045 = AF471107
Tantilla relicta2 KW0362 USA -- -- KP765668 KP765652
Tantilla tiiasmantoi\ CORBIDI:7726 Peru KY006875 = KY006877 -- --
Tantilla tiasmantoi2 ZFMK:95238 Peru -- KY006876 -- --
Tantilla melanocephala MZUSP12976 Sao Paulo, Brazil MK209216 MK209331 MK209288 --
Tantilla melanocephala MNHN 1996.7876 Kourou, French Guiana AF158424 AF158491 -- --
Amphib. Reptile Conserv.
216
December 2020 | Volume 14 | Number 3 | e268
Table S2 (continued). Species used in this study,
indicate locality identity not confirmed.
Species Ingroup vouchers
Tantilla melanocephala\ AMCC101309
Tantilla melanocephala2 AMCC101356
Tantilla melanocephala UWIZM.2015.18.28
Tantilla melanocephala UWIZM.2016.22.54
Tantilla melanocephala MBLUZ 1291
Jowers et al.
vouchers, and GenBank accession numbers. na: not applicable; asterisks (*)
Ingroup country
Aishalton, Guyana
Dubulay, Guyana
Trinidad
Tobago
Macuro, Venezuela
12S rDNA
MT968708
MT968709
MT968711
MT968707
MT968710
16S rDNA Cytb C-mos
MT968713, = MT968722 MT968717
MT968714 MT968723 MT968718
MT968716 MT968725 MT968720
MT968712 MT968721 --
MT968715 MT968724 MT968719
Table S3. Best partition schemes selected in PartitionFinder for the RaxML and MrBayes analyses, and best models selected in
jModeltest for BEAST.
Scheme
Partition Finder
12S, 16S rDNA, cytb 1* codon
cytb 2™ codon
cytb 3 codon
c-mos 1+ 2"4 codon
c-mos 3 codon
jModeltest
12S rDNA+16S rDNA
cytb
C-Mmos
Amphib. Reptile Conserv.
217
Model
GTR+I+G
TRN+I+G
K81UF+G
K80
HKY
TIM2+I+G
TPM2uf+I+G
KHY
December 2020 | Volume 14 | Number 3 | e268
Official journal website:
amphibian-reptile-conservation.org
Amphibian & Reptile Conservation
14(3) [General Section]: 218-225 (e269).
The most northeastern record of the Turkish endemic viper,
Pelias barani (Bohme and Joger, 1984), from northeastern
Anatolia: two viper species in a valley
Serkan Gil
Department of Biology, Faculty of Arts and Sciences, Recep Tayyip Erdogan University, 53100 Rize, TURKEY
Abstract.—The CGaglayan Valley is located in Findikli district of Rize province, and represents a 34.7-km
linear stretch that starts in Findikli district and ends in the Yusufeli district borderland of Artvin province in
Turkey. Moreover, the valley is the home of two endemic viper species, Pelias barani (a Turkish endemic) and
Pelias kaznakovi (a Caucasus endemic), that are classified by the IUCN as Near Threatened and Endangered,
respectively. Here, Pelias barani is documented in the Gaglayan Valley for the first time. Due to several threats,
most notably a proposed hydroelectric power plant (HPP), these viper species will face increasing challenges
such as habitat loss and fragmentation in the near future. Therefore, this study emphasizes that the Gaglayan
Valley should be a protected area in terms of these two viper species, and it also shows this area to be the
nearest contact zone between P. barani and P. kaznakovi found thus far.
Keywords. Biodiversity, CaSlayan Valley, contact zone, Reptilia, Rize, Viperidae
Citation: Gul S. 2020. The most northeastern record of the Turkish endemic viper, Pelias barani (B6hme and Joger, 1984), from northeastern Anatolia:
two viper species in a valley. Amphibian & Reptile Conservation 14(3) [General Section]: 218-225 (e269).
Copyright: © 2020 Gil. This is an open access article distributed under the terms of the Creative Commons Attribution License [Attribution 4.0
International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction in any medium,
provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced, are as follows:
Official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 31 March 2020; Published: 2 December 2020
Introduction
Pelias barani, also known as Baran’s Viper or Baran’s
Adder, is a member of family Viperidae and one of
several Anatolian vipers. It was first described by Bohme
and Joger (1983) based on a female specimen from
northwestern Anatolia, with a type locality of 60 km N
of Adapazari, Turkey, at 400 m asl. Many subsequent
studies have shown new locality records for P. barani
from the northwestern and northeastern parts of Anatolia
(Baran et al. 1997, 2001, 2005; Franzen and Heckes
2000; Kutrup 2003; Avci et al. 2004; Kumlutas et al.
2013; Gocmen et al. 2015; Gul 2015; Mebert et al. 2014,
2015; Gul et al. 2016a,b). In addition, the taxonomic
status of P. barani has been evaluated in several studies.
Joger et al. (1997, 2003) indicated that P. barani is a
species distinct from P. berus in terms of morphological,
molecular, and hemipenial data; and this status was also
supported by several later studies (Kalyabina-Hauf et al.
2004; Garrigues et al. 2005). As a result, P. barani is an
endemic species which is only distributed in northwestern
and northeastern Anatolia (Gé¢cmen et al. 2015).
Anatolia, which is also known as Asia Minor or the
Anatolian peninsula, is home to three of the world’s
Amphib. Reptile Conserv.
36 biodiversity hotspots: the Mediterranean basin,
Caucasus, and Irano-Anatolian (CEPF 2019; Ergiiner
et al. 2018), and is the biological crossroads of Asia,
Europe, and northern Africa (Ergtiner et al. 2018).
Northeastern Anatolia in particular is considered as a
diversity “hotspot within a hotspot” for the vipers because
it includes at least 10 species within a radius of 200 km
from Erzurum province (Mebert et al. 2015). Another
Caucasus hotspot endemic viper found in the CaSlayan
Valley, Pelias kaznakovi (Nikolsky, 1909), is classified
as Endangered according to the IUCN Red List category
and criteria (Gul et al. 2016b). This study reports the most
northeastern record of the Turkish endemic P. barani
(Bohme and Joger 1983), demonstrating that it is another
viper species which occupies the Caglayan Valley.
Materials and Methods
Study area. Findikli is a district of Rize Province,
Turkey, on the Black Sea coast of northeastern Anatolia,
and is also home of two large valleys: the Caglayan
and the Aril1 (Selim 2009, 2011). These valleys have
particular national and international importance in terms
of their unique ecological features (Selim 2011). The
December 2020 | Volume 14 | Number 3 | e269
Serkan Gill
Fig. 1. Distribution map of Pelias barani and Pelias kaznakovi
(created using ArcGIS 10.4). Red stars: Pelias barani from
Mebert et al. (2015), blue star: new locality record for Pelias
barani, yellow stars: known localities of Pelias kaznakovi.
Inset map indicates previously known localities. Photo by
Serkan Giil.
Caglayan Valley includes areas covering Yusufeli and
Arhavi districts of Artvin Province in the southeastern
part of the valley, and is 34.7 km in length (Selim 2009).
A stream in the valley, known as “Caglayan Stream,”
reaches to the Black Sea and has important influences
on various agricultural, settlement, forest, and aquatic
ecosystems (Selim 2009). The broader area has a humid
subtropical climate with an annual average precipitation
of 2,296 mm recorded over the 90-year period of 1928-
2018 (TSMS 2019). The study area is largely under the
influence of very moist conditions, and summers are
usually wetter than winters; annual rainfall is highly
variable (TSMS 2019).
Specimen information. One wounded female specimen
of Pelias barani was found by Tarik Ziya Cengiz in the
Caglayan Valley in Findikli, Rize, at 87 m asl on 26
June 2019 (Fig. 1). The specimen was preserved in 96%
ethanol and taken to the Zoology Research Laboratory,
Recep Tayyip Erdogan University (Rize, Turkey). Photos
of the specimen and its habitat (Fig. 2) were taken by the
author, Serkan Gul. The snout-vent length and tail length
of the specimen were taken (to the nearest mm) using a
ruler and the ventral plates were counted according to
Dowling (1951). The terminology used in describing the
specimen 1s 1n accordance with previous studies (Franzen
and Heckes 2000; Avci et al. 2004; Baran et al. 2005;
Kumlutas et al. 2013; Gul 2015; Gul et al. 2016a,b). All
external morphological characters are given in Table 1
along with the data for this species from the relevant
literature. Geographic coordinates were collected using
the Commander Compass Go 3.9.9 app.
Results and Discussion
Morphological features. The new specimen from a
lowland population of the Caglayan Valley shows little
difference in terms of scalation and color pattern from
the literature data for this species. The specimen had a
total length of 525 mm (head and body length 450 mm;
Amphib. Reptile Conserv.
tail length 75 mm), 144 ventral scales, 32/30 subcaudal
scales, and 23 scales on longitudinal rows of the dorsal
surface at mid-body. The specimen had two apicals in
contact with rostral and two canthals on each side of the
head. Loreal scales between the preocular and the post-
nasal were 4/4, and there were five scales between the
supraoculars. Scale rows between the eyes and upper
labials were 1/1 (Table 1).
Color pattern. As described previously by Gil et al.
(2016a), the dorsal color pattern of the specimen is
almost gray in hue, with a blackish zigzag structure
across the dorsal surface (Fig. 2). The head of female
specimen is relatively large (Fig. 2A). The ventral color
includes many different shades of black, sometimes dark
or whitish black, and the ground color of the ventral side
is whitish in the anterior part, 1.e., the ventral part of the
head and neck (Fig. 2B). This whitish color variation
continues across both upper labials and lower labials on
each side of the head, and to the posterior the ventrals are
black with white spots (Fig. 2C—D).
Habitat. Pelias barani is usually known to prefer
habitats with bush, scrubland, rocky areas, hills, and
oak forest (UCN 2019). The new locality in which
the specimen was found has highly transformed
anthropogenic post-forest biotopes (Fig. 3A). In fact, P.
barani actually occupies semi-open landscapes, which
fits into the descriptions of the biotopes in other parts
of the range, that is, with respect to the openness of
the landscape and the combination of light and shade.
Additionally, the species richness of trees and shrubs
probably play a secondary role. The predominant species
at this site include Chestnut (Castanea sativa), Oriental
Alder (Alnus orientalis), European Hornbeam (Carpinus
betulus), Common Hazel (Corylus avellana), various
ferns such as Preridium tauricum, and Blackberry (Rubus
fruticosus) |Fig. 3B]. Other reptile and amphibian
species, such as Bufo bufo (Pallas, 1814), Hyla orientalis
(Bedriaga, 1890), Anguis fragilis (Linneaus, 1758), and
Darevskia rudis (Bedriaga, 1886), probably occupy the
same geographic area with P. barani (Fig. 3C).
Distribution. Pelias barani has a geographic range
within the northwestern and northeastern coastal areas
of Turkey (Fig. 1). Recently, many new geographic
records have appeared in the literature, but a gap remains
in terms of its geographic range in the north of Turkey.
Gul et al. (2015) showed a geographic record taken from
Baran et al. (2001) as the most northeastern point (see
Fig. 2 in Gul et al. 2015); however, some authors have
highlighted that this geographic record likely represented
the “V. pontica” (a hybrid of P kaznakovi x Vipera
ammodytes) collected by Max. Pissié near Chorokhi,
Artvin (Zinenko et al. 2013; G6o¢men et al. 2015).
Therefore, the geographic record presented in this study
is very important with respect to establishing a contact
219 December 2020 | Volume 14 | Number 3 | e269
Pelias barani in the GCaglayan Valley, Turkey
December 2020 | Volume 14 | Number 3 | e269
220
Ic Ic Ic Ic Ic Ic Ic EC, Ic Ic Ic Ic Sa
eyep ou pyep ou pyep ou eyep ou eyep ou L/I L/I eyep ou eyep ou eyep ou eyep ou I/I Taq
eyep ou pyep ou eyep ou eyep ou eyep ou ¢ 74 eyep ou eyep ou eyep ou eyep ou ¢ OSS
C/T C/T C/T C/T C/T C/T C/T C/T C/T C/T C/T c/€ sjeqyue’)
eyep ou eyep ou eyep ou eyep ou eyep ou 9/S b/S b/P b/P b/P b/P eyep ou SAB[Nn
IT/01 IT/01 IT/O1 IT/TI IT/TI IT/01 6/6 €1/cl CI/Cl IT/TI IT/TI GUGl S[BIqU] 1IMO'T
8/6 6/6 6/8 byep OU/6 6/6 8/6 L/6 6/6 8/6 O1/6 6/6 OT/OI sjeiqey 19ddy)
16 Z Zz Z Z Z (Z) I eyep ou eyep ou eyep ou ejep ou Z sjpoidy
Ly 11/8 O1/6 OL/OL CI/EL 6/6 8/6 OL/TI O/T 6/6 CI/CI CI/TI SABPNIOUIMNIAT)
S/v S/V S/V eyep ou/¢ S/S S/V S/S 6/IT v/s v/v S/S S/S SO[BIS [BI1O'T
6¢ 8E/LE I¢/O€ ey De 8C/ST 6C/8C O€/TE 9E/9E O€/TE Ie/Te LE/Le sjepnesqns
orl Svi—-0rl al Ivl Orl cri cri Srl cri orl Srl Srl S[PR.QUIA
WU 8/7 WU OP-ge WU 69-CE wu ¢€8 WU 78 wu [¢ UWIU 69 WU C9 wu ¢7 WILT 89 ww O¢ UWIU 89 yysugy [Ie],
Wu Wu
WU Peo L6I-CLI L79-981 wu Eps WU 81S WI C6E wu 7[¢ WU C6¢ wu CPs WU C9 WU OCP ul CLV TAS
oyeUld] eM o[eUld] oe oe oyBUId 4 oyeula.y oyeuld.y aT oyeUuld.y oyeuld.y oyeuld.y XIs
¢ ¢ ¢ ¢ ¢ Vv Vv € oi € Cc I JIUIAIJIY
uozqe.y, uozqe.y, uozqe.y, Oz Osu uozqeAy, uozqely, uosapry gneais Ginga} SSS pay Livzedepy
‘BIWIOK = AIQOyYyVA «= SAIQoyIpyvA BaABYAB) BaivyAR’) ‘AIBA JON A}IBIO'T
MIRE GIL@) “yrpure) “yrpure-) JO PPsns IO “woul nzosediy nzosediy = evunsaiy 49d 49d MIS SUMTUES) Wy 09
‘ApNys JOLIN ZT “(STOT) Te 0 UOUISOD :TT (P9TOT) ‘Te 19 IMD ‘OT (STOTZ) IMD 6 (ZIOZ) ‘Te 19 SeINTUINY :g “(SOOT) ‘Te 10 URIeg ‘1 “(POOT) Te 1 AV ‘9 “(EOOT) dnaMy :¢ “(T0OZ) ‘Te 19 URIEg
‘y (OO0Z) SOY9OH pue uozuely :¢ “(Z66]) Je 19 UeIeg °Z “(€Z6]) JOsOL puw OUIYOY =] ‘SOOUDIOJOY “SoyTeos [eSIOP JO SMOI [eUIPNyISUO] :Sq ‘sjeIqey] Joddn puv sada UddMJAaq SMOI B[VIS : TNA
‘srenoovidns UddM4Oq S9TBIS ‘OSS “YISUd] JUDA-JNOUS ‘TAS ‘AU ]LOO] MOU OY} PUL dIN}eIO}I] SY} WO] Byep UO poseg SUdTIDSds UMOUY JO SJUNOD o]vdS PUP S}UDWIOINSeOU SIOWIOYCIOW *[ 9qQVy
Amphib. Reptile Conserv.
Serkan Gill
€C CC ke Ic CC Ic CC €C Ic ae eyep ou CC Sd
MOI
I/T I/T I/T I/T I/T I/T C/T uoxOlq I/T I/T eyep ou I/T Td
¢ ¢ pyep ou eyep ou vyep ou eyep ou ¢ ¢ ¢ ¢ pyep ou 7 OSS
C/T C/T eyep ou byep ou eyep ou byep ou C/T C/T C/T C/T C/T ou speqjyue)
MOI
v/v v/P eyep ou eyep ou eyep ou eyep ou v/v uayoiq v/P v/v eyep ou v/v sivpny
MOI
IT/O1 I1/cl OT/OI OT/OI IT/TI IT/O1 MOT USYO1Q usyolq CI/TI CI/Cl IT/TI CI/Cl S[BIqey 1IMO'T
MOI
8/6 8/6 O1/6 6/6 6/6 O1/6 11/6 usyolq 6/6 6/6 6/6 6/6 sjeiqey] 1oddy)
C C C Cc Cc Cc Cc Cc Cc ¢ Cc Cc sjeaidy
ZI/ MOI
IT/O1 CI/TI O1/6 OT/OI €1/cl IT/TI MOI USYO1Q usyolq CI/TI €1/Tl €1/Tl €I/cl SAB[MIOUINIAT)
v/v S/V S/V v/v S/S v/v v/v v/v S/S v/v S/S S/V SO[BOS [BI10'T
O€/CE I€/O€ 1+cv/CV I+€C/€€ I+€v/€V I+€v/€V O€/0E 8C/OE O€/6C VE/EE SELES SE/VE sjepneosqns
bri Srl bri Lvl Srl bri evi cri cri Srl Srl Lvl S[RAVUIA
wu
wu C7 ww ¢/ WU 78 wu CP WU 66 WU [8 wu 79 wu C9 wu Q/ WIL (9 wu 79 LS yysug] [lel
Wu
WU OCP wu OCP wu CCL WU 697 wu OCG wu ey WU 80S ww QOS ww O09 WU OOP UWI €()¢ SIV TAS
oyeuls.y o[BUld] eW oyeuls.y oe eM oyeula.y oyeuls.y oyeuls.y eA oyeuls.y eM XIs
cl Il Il Il Il im OI OI 6 8 L 9 DIUIAIJIY
vdyeyn vs.in 191 nyo nyo IBZB np.
Ipipury /Aoppea . cnae ie ee Son Lage eae AIVZEq /ISUTIIA ae eZzIy yoAey yepnsuoz = Livezedepy hae kyea07
ueAupse,) ‘Byes eyedde’y ‘epABATWe) = IPLIWIQ) AIAIWI) SeyeL SByyIL aopyn Ang nom eahor) i
‘Apnys yuoLing
‘TI (STOTZ) [219 USUSOD “TI “(POTOT) TB 49 IND ‘OL (S107) IMD °6 (Z10Z) Te 19 SeINfUINY :g “(CQOT) ‘Te 19 UBIEg ‘7 “(POOT) Te 19 1DAV ‘9 “(€00T) dnnNy :¢ “(100Z) ‘Te 19 UBIeg ‘fp “(000Z)
SOydOH pue uozuely :¢ “(Z66]) ‘Te 19 UeIeY :Z “(€Q6]) JOSOL puv SUIYOY :] :SdOUdIOJOY ‘So[Vos [esIOP JO SMO [eUIPNISUO] ‘Sq ‘syeiqe] Joddn pue sod9d UddM4O9q SMOI B[BIS °TMq “Siepnoovidns
UdIMJ9q S3TBIS ‘OSS “YISUI] JUDA-JNOUS :TAS ‘Aj[VdO] MOU OY} PUL SINILID}T] DY} WOT] BJEp UO poseg SUdUTIDSdS UMOUY JO SJUNOD IBIS PUP SJUDIINSKOWW SINOWOYCIOPY *panuljzuod *[ sq],
December 2020 | Volume 14 | Number 3 | e269
221
Amphib. Reptile Conserv.
Pelias barani in the Caglayan Valley, Turkey
Fig. 2. Dorsal (A) and ventral (B) views of typical head pattern, and each side of the head (C—D) in a female specimen of Pelias
barani from the Caglayan Valley, Findikh, Turkey. Photos by Serkan Giil.
zone between P. barani and P. kaznakovi. While Mebert
et al. (2015) reported that Isikli Valley would be the most
likely area for a contact zone between them, this study
indicates that the Caglayan Valley is the most likely
contact zone between P. kaznakovi and P. barani (Fig. 4).
In addition, based on the finding reported in this study,
it appears that the eastern part of the CaSlayan Valley is
occupied by P. kaznakovi whereas the western part of the
Caglayan Valley is also the habitat of P. barani (Fig. 4).
Furthermore, with this new finding, the known distance
between the P. barani and P. kaznakovi vipers 1s reduced
from 20.3 km down to only 1.3 km. At the same time,
the known distribution of P. barani is hereby extended
by a distance of up to 19 km northeast from the nearest
previously reported site (Mebert et al. 2015; Fig. 4).
An additional reason for these distribution patterns
may be related to the Colchic regional characteristics.
The Colchis is an ancient region south of the Caucasus
Mountains at the eastern end of the Black Sea that is
known for many relicts in terms of faunal and floral
speciation (Tuntyev 1997). Moreover, the Colchis is a
refugial area that explains the presence of relict species
in post-glacial dispersal (Tarkhnishvili 2014). It seems
that the Caglayan Valley is likely to be the westernmost
border of the Colchic refugium in the eastern Black Sea.
Amphib. Reptile Conserv.
Threats and conservation status. In the IUCN Red List,
P. barani is assigned to the Near Threatened category
and criteria. General threats in this area, such as habitat
loss due to tourism and recreation areas, hunting and
trapping of terrestrial animals for biological resource use,
deaths caused by the local people, and road deaths, are
potentially threatening for the P. barani population (Gul
2015; IUCN 2019). In addition, the increasing human
population, and consequent increases of agricultural use,
building houses in hitherto unused natural areas, etc.,
have become additional major threats in the region over
the last decade.
However, it seems that the most important threat for
both P. barani and the overall ecosystem of the valley is
hydroelectric power plants (HPP). Although the Caglayan
Valley was declared as a 1* degree priority natural
protected area in 2008 by the Trabzon Regional Board
for the Protection of Cultural and Natural Heritage, there
are still active efforts to build HPP in the valley (Sarihan
2019). In addition, the Arili Valley (which is other major
valley of Findikli) is facing the same problem (DHA
2019). This study indicates that the Caglayan Valley hosts
two endemic viper species, one of which (P. kaznakovi)
is endemic to the Caucasus hotspot, while the other
viper (P. barani) is endemic to Turkey. Therefore, the
December 2020 | Volume 14 | Number 3 | e269
Serkan Gill
Fig. 3. Several views of the habitat of Pelias barani from the
Caglayan Valley, Findikli, Turkey. Photos by Serkan Giil.
construction and operation of the HPP would negatively
affect the natural habitats of both species, as well as the
other fauna of the river systems and wildlife populations
in the valley (Gul et al. 2016a,b). This pursuit of HPP
may be a serious problem that leads to decreasing trends
of the species populations.
Pelias barani is currently in the IUCN Red List
category of Near Threatened (NT), but as stated by
Mebert et al. (2015), it will probably qualify for the
Vulnerable (VU) category in the near future. In this same
valley, P. kaznakovi is currently in the Endangered (EN)
category, and populations of both species have decreasing
trends. Considering all of these factors, clearly the
Caglayan Valley serves as an important habitat for these
two viper species of conservation concern. In addition,
Mertensiella caucasica is an endemic salamander species
of the Caucasus hotspot which is also found in this valley
and it is listed as Vulnerable by IUCN (Gul et al. 2018).
Therefore, the CaSlayan Valley needs to be studied more
thoroughly with regard to the diverse herpetofauna and
the potential impacts of continuing HPP development.
In conclusion, this study suggests that the Caglayan
Valley should be a protected area, and provides basic
information for a conservation action plan for P. barani
in light of a recent recommendation for the development
of a comprehensive, global “Action Plan” for the
conservation of vipers (Maritz et al. 2016).
Amphib. Reptile Conserv.
Mébert et al (2015)
Mebert et al'(2015)
g. 4. Proximity of nearest known Pelias barani and Pelias
kaznakovi localities (map generated using Google Earth
7.3.2). Blue pin marker: Pelias barani from Mebert et al.
(2015), red pin markers: Pelias kaznakovi from Mebert et al.
(2015) and Gil et al. (2016b), yellow pin marker: new locality
record of Pelias barani in this study. Distance between blue
and yellow pin markers is ~19 km. Note that the short distance
between Pelias barani and Pelias kaznakovi \ocalities in the
Caglayan Valley indicates a potential contact zone.
Acknowledgements.—I would like to thank Tarik Ziya
Cengiz, who found the specimen and is a nature lover
from Beydere Village on Caglayan Valley, Findikl,
Turkey.
Literature Cited
AvciA, Uziim N, Olgun K. 2004. A new record of Vipera
barani Bohme and Joger, 1983 (Reptilia, Viperidae)
from northeastern Anatolia, Turkey. Russian Journal
of Herpetology 11: 77-79.
Baran I, Tosunoglu M, Kaya M, Kumlutas Y. 1997. On
the herpetofauna of the vicinity of Camlihemsin.
Turkish Journal of Zoology 21: 409-416.
Baran I, Joger U, Kutrup B, Turkozan O. 2001. On new
specimens of Vipera barani Bohme and Joger, 1983,
from northeastern Anatolia, and implications for the
validity of Vipera pontica Billing, Nilson, and Sattler,
1990 (Reptilia, Viperidae). Zoology in the Middle
East 23: 47-53.
Baran I, Kumlutas Y, Ilgaz C, Iret F. 2005. Geographical
distributions and taxonomical states of Telescopus
fallax (Fleischman, 1831) and Vipera barani Bohme
and Joger, 1983. Turkish Journal of Zoology 29: 217—
224.
Bohme W, Joger U. 1983. Eine neue Art des Vipera
berus-Komplexes aus der Turkei. Amphibia-Reptilia
4: 265-271.
CEPF. 2019. Critical Ecosystem Partnership Fund.
Available: https://www.cepf.net/ [Accessed: 10 July
2019].
DHA (Demiroren Haber Ajans1). 2019. Findikli’da HES
Protestosu. Available: https://www.haberturk.com/
rize-haberleri/674972 1 1-findiklida-hes-protestosu
[Accessed: 20 July 2019].
December 2020 | Volume 14 | Number 3 | e269
Pelias barani in the Caglayan Valley, Turkey
Dowling HG. 1951. A proposed standard system of
counting ventrals in snakes. British Journal of
Herpetology 1: 97-99.
Ergiiner Y, Kumar J, Hoffman FM, Dalfes HN, Hargrove
WW. 2018. Mapping ecoregions under climate
change: a case study from the biological ‘crossroads’
of three continents, Turkey. Landscape Ecology 34:
35-40.
Franzen M, Heckes U. 2000. Vipera barani Bohme
and Joger 1983 aus dem ostlichen Pontus-Gebirge,
Turkei: Differentialmerkmale, Verbreitung, Habitate.
Spixiana 23: 61-70.
Garrigues T, Ferquel CE, Choumet V, Failloux AB. 2005.
Molecular phylogeny of Vipera Laurenti, 1768 and the
related genera Macrovipera (Reuss, 1927) and Daboia
(Gray, 1842), with comments about neurotoxic Vipera
aspis aspis populations. Molecular Phylogenetics and
Evolution 35. 35-47.
Gocmen B, Mebert K, Karis M. 2015. New distributional
data on Vipera (berus) barani from western and
northeastern Anatolia. Herpetology Notes 8: 609-615.
Gul S. 2015. Potential distribution modeling and
morphology of Pelias barani (Bohme and Joger,
1983) in Turkey. Asian Herpetological Research 6:
206-212.
Gul S, Kumlutas Y, Ilgaz C. 2016a. A new locality
record of Pelias barani (Bohme and Joger, 1983)
from the northeastern Anatolia. Russian Journal of
Herpetology 23: 319-322.
Gul S, Kumlutas Y, Ilgaz C. 2016b. Predicted distribution
patterns of Pelias kaznakovi (Nikolsky, 1909) in the
Caucasus Hotspot with a new locality record in Turkey.
Russian Journal of Herpetology 23: 224—230.
Gul S, Kumlutas Y, Ilgaz C. 2018. Potential distribution
under different climatic scenarios of climate change of
the Vulnerable Caucasian Salamander (Mertensiella
caucasica). a case study of the Caucasus Hotspot.
Biologia 73: 175-184.
IUCN. 2019. The IUCN Red List of Threatened Species.
Version 2019-2. Available: https://www.tucnredlist.org
[Accessed: 25 July 2019].
Joger U, Lenk P, Baran I, Bohme W, Ziegler T, Heidrich
P, Wink M. 1997. The phylogenetic position of Vipera
barani and of Vo nikolskii within the Vipera berus
complex. Pp. 185-194 In: Herpetologia Bonnensis.
Editors, Bohme W, Bischoff W, Ziegler T. Zoologisches
Forschungsinstitut und Museum A. Koenig, Bonn,
Germany. 414 p.
Joger U, Kalyabina-Hauf SA, Schweiger S, Mayer W,
Orlov NL, Wink M. 2003. Phylogeny of Eurasian Vipera
(subgenus Pelias). Abstract 77 In: Programme and
Abstracts. 12th Ordinary General Meeting of the S.E.H.,
St. Petersburg, Russia, 12-16 August 2003. Societas
Europaea Herpetologica, Bonn, Germany. 200 p.
Kalyabina-Hauf S, Schweiger S, Joger U, Mayer W,
Orlov N, Wink M. 2004. Phylogeny and systematics
of adders (Vipera berus complex). Mertensiella 15:
Amphib. Reptile Conserv.
7-15.
Kumlutas Y, Sozen M, Ilgaz ©. 2013. New record of
the rare Vipera barani Bohme and Joger, 1983.
Herpetozoa 25: 183-188.
Kutrup B. 2003. The identification of new specimens
of Vipera from Trabzon, Turkey, with affinities to
Vipera barani and V. pontica. Herpetological Review
43: 28-31.
Maritz B, Penner J, Martins M, Crnobrnyja-Isailovic J,
Spear S, Alencar LR, Sigala Rodriquez J, Messenger
K, Clark RW, Soorae P, et al. 2016. Identifying global
priorities for the conservation of vipers. Biological
Conservation 204: 94-102.
Mebert K, I%ci N, Gocmen B, Ursenbacher S.
2014. Vipern der Nordost-Tuirkei: Genfluss und
Umweltfaktoren zwischen den Taxa des Vipera
barani-kaznakovi-darevskii-Komplexes. Elaphe 49:
58-67.
Mebert K, Gocmen B, I&ci N, OSuz MA, Karis M,
Ursenbacher S. 2015. New records and search
for contact zones among parapatric vipers in
the genus Vipera (barani, kaznakovi, darevskii,
eriwanensis), Montivipera (wagneri, raddei), and
Macrovipera (lebetina) in northeastern Anatolia. The
Herpetological Bulletin 133: 13-22.
Sarihan Z. 2019. Findikl’da dogal sit alanina hes
planliyorlar. Available: http://www.findiklihaber.
com/findikli/findikli-da-dogal-sit-alanina-hes-
planliyorlar-h1999 html [Accessed: 20 July 2019].
Selim S. 2009. Dou Karadeniz yoresi, Findikli
ilgesi, CaSlayan ve Arili vadi ekosistemleri ile bu
ekosistemlerin etkilesimler1 Uzerine arastirmalar.
Masters Thesis, Institute of Science, Ege University,
Izmir, Turkey.
Selim S. 2011. Akarsu Vadisindeki Insan Kaynakli
Faalityetlerin Ekosistem Butinltgtine Olasi Etkileri:
Caglayan Vadisi Ornegi. Siileyman Demirel
Universitesi, Fen Bilimleri Enstitiisii Dergisi 15:
94-101.
Tarkhnishvili D. 2014. Historical Biogeography of the
Caucasus. Nova Science Publishers, New York, New
York, USA. 234 p.
TSMS. 2019. Turkish State Meteorological Service,
Ankara, Turkey. Available: —https://www.mgm.
gov.tr/veridegerlendirme/il-ve-ilceler-istatistik.
aspx?k=A&m=RIZE [Accessed: 28 July 2019].
Tuntyev BS. 1997. About exact borders of the Colchis
biogeographical province. Russian Journal of
Herpetology 4: 182-185.
Zinenko O, Stimpel N, Mazanaeva LF, Shiryaev kK,
Nilson G, Orlov NL, Tuniyev BS, Ananjeva NB,
Murphy R, Joger U. 2013. The puzzling phylogeny
of the Vipera kaznakovi-complex. Pp. 197 In:
Programme and Abstracts, 17th European Congress
of Herpetology (SEH), 20-27 August 2013, Veszprém,
Hungary. Societas Europaea Herpetologica, Bonn,
Germany. 332 p.
December 2020 | Volume 14 | Number 3 | e269
Serkan Gill
Serkan Giil is an Associate Professor at Recep Tayyip Erdogan University (Rize,
Turkey). His main areas of interest are the phylogeny, ecology, and morphology of
amphibians and reptiles in Turkey. Serkan has recently been focusing on ecological
niche modelling, and has published many articles in this area. He 1s now conducting
several research projects using amphibians and reptiles as the test subjects.
Amphib. Reptile Conserv. 225 December 2020 | Volume 14 | Number 3 | e269
Official journal website:
amphibian-reptile-conservation.org
Oy,
ts).
. ie
teptile-come™
Amphibian & Reptile Conservation
14(3) [General Section]: 226—230 (e270).
Rediscovery of Oligodon catenatus (Blyth, 1854) (Squamata:
Colubridae) from India
Lalbiakzuala and *Hmar Tlawmte Lalremsanga
Developmental Biology and Herpetology Laboratory, Department of Zoology, Mizoram University, Aizawl 796004, Mizoram, INDIA
Abstract.—The poorly known Assam Kukri Snake, Oligodon catenatus (Blyth, 1854), in the Oligodon dorsalis
group, is here reported from Mizoram State, northeastern India, based on a single male specimen. This report
extends the distributional range of the species. This specimen is only the second one collected from India,
and it is very important as the holotype of the species has been lost. A brief description of the new specimen
is presented.
Keywords. Assam Kukri Snake, distribution, first record, Mizoram, moist deciduous forest, Tam Dil, wetland
Citation: Lalbiakzuala, Lalremsanga HT. 2020. Rediscovery of Oligodon catenatus (Blyth, 1854) (Squamata: Colubridae) from India. Amphibian &
Reptile Conservation 14(3) [General Section]: 226-230 (e270).
Copyright: © 2020 Lalbiakzuala and Lalremsanga. This is an open access article distributed under the terms of the Creative Commons Attribution
License [Attribution 4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and
reproduction in any medium, provided the original author and source are credited. The official and authorized publication credit sources, which will
be duly enforced, are as follows: official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 18 November 2019; Published: 9 December 2020
Introduction
The Assam Kukri Snake, Oligodon catenatus (Blyth,
1854), is a poorly known species in India. The type
specimen was collected from “Asam” (which currently
spans seven states) in northeastern India by Blyth
(Smith 1943), but has been lost from the Asiatic Society
Museum, Kolkata (Sclater 1891). The distribution of
this species includes Myanmar, Laos, Vietnam, China,
and possibly Cambodia (Green 2010), and the species
has been found at elevations of around 700—1,000 m
asl (Zhao et al. 1998). While it has been considered
rare since the day of its description (Sharma 2019),
the species has not been reported from India in recent
years. In Vietnam, it has been collected from evergreen
secondary forest (Pham et al. 2014), but very little is
known about its ecology (Gong et al. 2002). The nearest
known distribution record outside of India is in Nam
Tamai Valley near the Tibetan border, Kachin Hills,
Myanmar (Smith 1943).
Oligodon catenatus had been a synonym of O.
eberhardti (e.g., Zhao 2006a,b), but was recently
removed from synonymy (see Ziegler et al. 2007;
Thy and Nguyen 2012). Oligodon catenatus 1s very
similar to, has been confused with, O. eberhardti (Thy
and Nguyen 2012), but they differ by the absence of
the loreal in O. catenatus (Pham et al. 2014). In fact,
Vassilieva (2015) noted that the absence of a loreal
scale is rare among Kukri snakes. Among the 22 species
of Oligodon known from Indo-China, this character is
found only in three species: O. catenatus (Blyth 1854),
O. annamensis (Leviton 1953), and O. lacroixi (Angel
and Bourret 1933); and it is facultatively absent in both
O. mouhoti (Boulenger 1914) and O. macrurus (Angel
1927). Before this current report, there had been no
previous records of the species from Mizoram (Mathew
2007; Lalremsanga et al. 2011).
Methods
A single male specimen was found dead in a field, and
collected on 4 June 2019 from a forest pathway near
Tamdil National Wetland (23°44’20’N, 92°57’06”’W;
elevation 760 m asl), Aizawl District, Mizoram, 64
km E from Aizawl, the capital of Mizoram State,
northeastern India. The specimen was fixed in 4%
formalin, transferred to 70% ethanol, and deposited
in the Departmental Museum of Zoology, Mizoram
University, India (as specimen MZMU _ 1446).
Measurements were taken with a slide caliper to the
nearest 0.1 mm, except for snout-vent length (SVL)
and tail length (TaL), which were measured with a ruler
to the nearest 1 mm. The ventral scales were counted
according to Dowling (1951), and dorsal scale rows are
given at one head length behind the head, at mid-body,
and at one head length before the vent. The terminal
Amphib. Reptile Conserv.
December 2020 | Volume 14 | Number 3 | e270
Lalbiakzuala and Lalremsanga
Fig. 1. Head of Oligodon catenatus in dorsal (A), ventral
(B), and lateral (C) views. Photos by Lalbiakzuala,
Melvin Selvan, and Nilanjan Mukherjee.
scute is excluded from the number of subcaudals.
Morphometric characters and pholidosis measurements
are given in Table 1.
Abbreviations. MZMU: Museum of Zoology
Department, Mizoram University, Aizawl, India; DST-
SERB: Department of Science and Technology, Science
and Engineering Research Board, Government of India;
SVL: snout-vent length; TaL: tail length; TL: total
length; TaL/SVL: ratio tail length/snout-vent length;
HL: head length; HW: head width; DSR: number of
dorsal scale rows (at the three positions as described
above); VEN: ventral scales; IF: infralabials; SL:
supralabials; PosOc: postocular scale; PreOc: preocular
scales; SC: subcaudal scales; ATem: anterior temporal
scale; PTem: posterior temporal; LOR: loreal scale;
SL2: number of supralabials touching eye; EYD: eye
diameter; END: eye-nostril distance; WSN: width of
snout; LSN: length of snout.
Amphib. Reptile Conserv.
Fig. 2. The dorsal (A) and ventral (B) views of Oligodon
catenatus in preservation. Photos by Lalbiakzuala,
Melvin Selvan, and Nilanjan Mukherjee.
Results and Discussion
The specimen, an adult male, shows an injury ventro-
laterally between the 8" and 9" ventral scales, and the
Opening reaches up to the middle of the ventral region.
The body of the snake is cylindrical and it has a small,
indistinct head (Fig. 1); small eyes with round pupil;
nape with incomplete cross bar; dorsum (Fig. 2) with
a chain of 62 continuous diamond-shaped vertebral
patterns from the anterior neck region up to the vent,
and continuing with a longitudinal stripe to tail-tip; in
preservation, outer end of ventral shields with dark
squarish spots; mid-ventral with plain pale lemon color
from chin to tail tips; ventral tail roughly immaculate,
and ends with pointed tip. The loreal scale is absent on
both sides; 13 rows of dorsal scales at mid-body; anal
shield divided; six supralabials with 3 and 4" entering
orbit on both sides, half of the posterior of 3 supralabial
to half of the anterior of 5" supralabial with marbled
December 2020 | Volume 14 | Number 3 | e270
Oligodon catenatus in India
Table 1. Morphometric and pholidosis data of Oligodon
catenatus specimen found in India in 2019 (voucher number
MZMU 1446). See text for abbreviations.
Attribute State or value
Sex Male
Collection locality Tamdil National Wetland, Mizoram, India
Collectors Lalremsanga and Lalbiakzuala
Date of collection 4 June 2019
EYD 1.96 mm
END 2.78 mm
WSN 3.53 mm
LSN 0.93 mm
HW 8.16 mm
HL 10.82 mm
TaL 64 mm
SVL 480 mm
TaL/SVL 0.13
VEN 203
DSR 13-13-13
IF 6
SL 6
SL2 34 and 4"
ATem l
PTem 2
PosOc l
PreOc 1
LOR Absent
SC 37
dark color, anterior part of the snout is mottled with dark
patches; six infralabials; one anterior temporal; 37 paired
subcaudals. This description agrees with those given by
other workers, except for the ventrals here being 203 vs.
186-196 (Smith 1943) and 179-184 (Pham et al. 2014),
but in agreement with the pooled sex ventral range 179-—
212 (Pauwels et al. 2002; Das 2010).
This collection of the Assam Kukri Snake, Oligodon
catenatus, from Tam Dil National Wetland is the first
record for Mizoram State, and constitutes only the second
specimen from India (Fig. 3), since no other specimen
has been reported from India after the description of
this species in 1854. The holotype had apparently
disappeared before the collections of the Asiatic Society
were transferred to the Indian Museum (Sclater 1891).
The present specimen was collected from an altitude of
760 m asl, which is in the ranges reported by Zhao et
al. (1998) and Gong et al. (2007). The present specimen,
MZMU 1446, represents the only known specimen for
India. The fact that no other specimen has been found
in India in over 165 years may be due to the scarcity
of surveys and/or population declines due to habitat
defragmentation.
Amphib. Reptile Conserv.
96°0'0"E 97°0'0"E 98°0'0"E
7
27°0'0"N
zZ
2
2
a
24°0'0"N 25°0'0"N
23°0'0"N
Fig. 3. Map showing the type locality of Oligodon catenatus
in Khasi Hills, India (solid dark circle); the nearest locality
outside India in Kachin Hills, Myanmar (solid dark triangle);
and the new locality in Mizoram, India (solid dark square).
The collection site (Fig. 4) is a wetland that 1s covered
by the Natural Wetland Conservation Programme
2006-2007 of the Government of India, in which
an area of 285 ha is protected for wetland functions
(Anon 2007). It is surrounded by tropical evergreen and
moist deciduous forest dominated by Schima wallichii,
Chukrasia tabularis, Gmelina arborea, Artocarpus sp.,
Dendrocalamus sp., Albizzia sp., Morus sp., and others.
From this wetland, new state reports of Protobothrops
mucrosquamatus (Lalremsanga et al. 2017) and
Leptolalax tamdil (Sengupta et al. 2010) were recently
described. This location is an important tourist attraction
and a holiday resort.
Acknowledgements.—We acknowledge DST-SERB,
New Delhi, Government of India for financial support
under EMR number EMR/2016/002391, and are grateful
to the Dean, School of Life Sciences, Mizoram University,
for providing the facilities necessary for the research
reported here. We thank Lalrinsanga, Lalmuansanga, H.
Laltlanchhuaha, Romalsawma, Michael Vanlalchhuana,
H.T. Decemson, Samuel Lallianzela, and Vanlalhrima
for their help in the field. Constructive comments for
this work, as well as specimen photographs by Annie
Lalrawngbawli, Melvin Selvan, and Nilanjan Mukherjee
are highly appreciated. The distribution map designed
by Binoy Kumar Barman is also acknowledged. The
present work is generated under the permission No.
A.33011/2/99-CWLW/225 issued by the Chief Wildlife
Warden, Environment, Forest, and Climate Change
Department, Government of Mizoram, India.
Literature Cited
Angel F. 1927. Liste des reptiles et des batracien
rapportés d’ Indo-Chine par M.P. Chevey. Description
d’une variété nouvelle de Simotes violaceus Cantor.
December 2020 | Volume 14 | Number 3 | e270
Lalbiakzuala and Lalremsanga
Fig. 4. View of the natural habitats of Oligodon catenatus in
Tam Dil National Wetland. Photo by H.T: Lalremsanga.
Bulletin du Muséum national d@’histoire naturelle 33:
496-498.
Angel F, Bourret R. 1933. Sur une petite collection de
serpents du Tonkin. Descriptions d’ espeéce nouvelles.
Bulletin de la Société zoologique de France 58:
129-140.
Anon. 2007. Conservation of Wetlands in India: a
Profile (Approach and Guidelines). Conservation
Division-1, Ministry of Environment and Forests,
Government of India, New Delhi, India. 56 p.
Blyth E. 1854. Notices and descriptions of various
reptiles, new or little known. The Journal of the
Asiatic Society of Bengal 23(3): 287-302.
Boulenger GA. 1914. Descriptions of new reptiles from
Siam. The Journal of the Natural History Society of
Siam 1: 67-76.
Das I. 2010. A Field Guide to the Reptiles of South-East
Asia. New Holland Publishers (UK) Ltd., London,
United Kingdom. 377 p.
Dowling HG. 1951. A proposed standard system of
counting ventrals in snakes. British Journal of
Herpetology 1: 97-99.
Gong SP, Markus A, Zhang YY, Zhong GF, Zeng
JD. 2007. A new record of Oligodon catenata in
Guangdong Province, China. Chinese Journal of
Zoology 42(6): 149-150.
Green MD. 2010. Molecular phylogeny of the snake
genus Oligodon (Serpentes: Colubridae), with
an annotated checklist and key. M.S. Thesis,
Department of Ecology and Evolutionary Biology,
University of Toronto, Toronto, Ontario, Canada.
169 p.
Lalremsanga HT, Sailo S, Chinliansiama. 2011.
Diversity of snakes (Reptilia: Squamata) and role
of environmental factors in their distribution in
Mizoram, Northeast India. Pp. 265—268 In: Advances
in Environmental Chemistry, September 2018.
Lalremsanga HT, ~~ Lalbiakzuala, — Lalrinsanga.
2017. Geographic distribution: Protobothrops
mucrosquamatus (Brown Spotted Pitviper).
Amphib. Reptile Conserv.
Herpetological Review 48(1): 131.
Leviton AE. 1953. A new snake of the genus Oligodon
from Annam. Journal of the Washington Academy of
Sciences 43(12): 422-424.
Mathew R. 2007. Reptilia. Pp. 545-577 In: Fauna
of Mizoram. Records of the Zoological Survey of
India, State Fauna Series, 14. Zoological Survey of
India, Kolkata, India. 691 p.
Pauwels OSG, Wallach V, David P, Chanhome L. 2002.
A new species of Oligodon (Serpentes, Colubridae)
from southern peninsular Thailand. Natural History
Journal of Chulalongkorn University 2(2): 7-18.
Pham AV, Nguyen SLH, Nguyen TQ. 2014. New
records of snakes (Squamata: Serpentes) from
Son La Province, Vietnam. Herpetology Notes 7:
771-777.
Sclater WL. 1891. Notes on a collection of snakes in
the Indian Museum, with descriptions of several
new species. The Journal of the Asiatic Society of
Bengal LX: 230-250.
Sengupta S, Sailo S, Lalremsanga HT, Das A, Das
I. 2010. A new species of Leptolalax (Anura:
Megophryidae) from Mizoram, North-eastern India.
Zootaxa 2406: 57-68.
Sharma V. 2019. Assam Kukri Snake (Oligodon
catenatus Blyth 1854). Available: = http://
indiansnakes.org/content/assam-kukri-snake
[Accessed: 24 July 2019].
Smith MA. 1943. The Fauna of British India, Ceylon
and Burma including the Whole of the Indo-Chinese
Sub-region, Reptilia and Amphibia. Volume 3
Serpentes. Taylor and Francis, London, United
Kingdom. 583 p.
Thy N, Nguyen TQ. 2012. Oligodon eberhardti. The
IUCN Red List of Threatened Species 2012:
e.T191932A2017150.
Uetz P, Freed P, Hosek J. (Editors). 2018. The Reptile
Database. Available: http://www.reptile-database.
org [Accessed: 23 July 2019].
Vassilieva AB. 2015. A new species of the genus
Oligodon Fitzinger, 1826 (Squamata: Colubridae)
from coastal southern Vietnam. Zootaxa 4058(2):
211-226.
Zhao EM. 2006a. The Snakes of China. Volume I. Anhui
Science and Technology Publishing House, Hefei,
China. 372 p. [in Chinese].
Zhao EM. 2006b. The Snakes of China. Volume II.
Anhui Science and Technology Publishing House,
Hefei, China. 280 p. [in Chinese].
Zhao EM, Huang MH, Zong Y. 1998. Fauna Sinica:
Reptilia, Volume 3. Squamata, Serpentes. Science
Press, Beijing, China. 570 p.
Ziegler T, Hendrix R, Thanh VN, Vogt M, Forster B,
Kien DN. 2007. The diversity of a snake community
in a karst forest ecosystem in the central Truong
Son, Vietnam, with an identification key. Zootaxa
1493: 1— 40.
December 2020 | Volume 14 | Number 3 | e270
Amphib. Reptile Conserv.
Oligodon catenatus in India
Lalbiakzuala is a Ph.D. scholar under the supervision of H.T. Lalremsanga in the Department
of Zoology, Mizoram University, India. Lalbiakzuala completed his M.Phil. degree in Zoology
from Mizoram University, with a thesis on the systematics and natural history of kraits in
Mizoram, northeast India. He is currently working as a Project Fellow in a DST-SERB Project
on the large-scale DNA barcoding of snakes in Mizoram, in the Indo-Myanmar Biodiversity
Hotspot.
H.T. Lalremsanga is a northeast Indian zoologist, whose Ph.D. work in amphibian biology
was completed at North Eastern Hill University (Shillong, Meghalaya, India) in 2011. He is
now working as an Associate Professor and Head of the Department of Zoology, Mizoram
University (Aizawl, Mizoram, India), and has described new species of frogs, eels, and snakes,
and a new genus of snake. He is interested in the systematics and biology of amphibians and
reptiles, and has established the Developmental Biology and Herpetology Lab in which he
guides his graduate students.
230 December 2020 | Volume 14 | Number 3 | e270
Official journal website:
amphibian-reptile-conservation.org
Amphibian & Reptile Conservation
14(3) [Taxonomy Section]: 231-250 (e271).
A reevaluation of records of Sandveld lizards, Nucras Gray,
1838 (Squamata: Lacertidae), from northern Namibia
1"Aaron M. Bauer, ‘Matthew Murdoch, and 2Jackie L. Childers
‘Department of Biology, Villanova University, 800 Lancaster Avenue, Villanova, Pennsylvania 19085, USA *Museum of Vertebrate Zoology,
University of California, Berkeley, California 94720, USA
Abstract.—Data relating to the Sandveld lizards (Nucras) occurring in Namibia, southwest Africa are reviewed.
In particular, we investigated records of N. holubi, a chiefly southeastern African species, and attempted to
identify recently collected material that could not be assigned to any species currently recognized in Namibia.
A phylogenetic analysis of Nucras based on three mitochondrial markers revealed a deep divergence between
Namibian Nucras holubi and two presumably conspecific clades from Limpopo Province, South Africa. In
addition, the coloration pattern and scalation of the Namibian material differ from those of the eastern forms,
supporting its recognition as a separate species. The name Nucras damarana Parker, 1936, long relegated to
the synonymy of N. holubi, is here resurrected for this apparently endemic northern Namibian species. Nucras
damarana is restricted to the Kunene, Omusati, Oshikati, Kavango, and Otjozondjupa regions of north-central
Namibia. A distinctive specimen of Nucras from near Ruacana in the Kunene Region was identified as allied
to Nucras broadleyi, a species recently described from southwestern Angola, on the basis of genetic data,
although it differs substantially in color pattern. With the addition of N. aff. broad/eyi and the resurrected N.
damarana to its fauna, as well as the removal of N. holubi from the nation’s species list, four species of Nucras
are confirmed to be present in Namibia. Although the conservation status of N. damarana, N. tessellata, and N.
intertexta is Least Concern, the uncertain taxonomic status of N. aff. broadleyi precludes a meaningful threat
assessment.
Keywords. Distribution, endemism, Nucras damarana, Nucras broadleyi, Nucras holubi, phylogeny, taxonomy
Citation: Bauer AM, Murdoch M, Childers JL. 2020. A reevaluation of records of Sandveld lizards, Nucras Gray, 1838 (Squamata: Lacertidae), from
northern Namibia. Amphibian & Reptile Conservation 14(3) [Taxonomy Section]: 231—250 (e271).
Copyright: © 2020 Bauer et al. This is an open access article distributed under the terms of the Creative Commons Attribution License [Attribution
4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction in any
medium, provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced, are
as follows: official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 10 September 2020; Published: 20 December 2020
Introduction specimen had been obtained by purchase in 1865 without
an indication of the collector. Indeed, this specimen is
part of a collection of specimens obtained from W.
Three species of Sandveld lizards, Nucras (Lacertidae), Stevens, all from Damaraland (BMNH 65.6.18.1—13,
are currently regarded as occurring in Namibia: N. 65.8.28.1-31). In fact, it is likely that none of this material
intertexta (Smith, 1838), N. tesse/lata (Smith, 1838), and originated in the area then referred to as Damaraland. In
N. holubi (Steindachner, 1882) (Branch 1998; Griffin addition to N. Jalandii, the collection included specimens
2003; Herrmann and Branch 2013). Paradoxically, the — of Afrogecko porphyreus (BMNH 65.6.18.11), which is
first species recorded from what is now Namibia was — endemic to the southern and southwestern portions of
a species that does not occur in the country. Boulenger —_ the Cape provinces; Philothamnus natalensis (BMNH
(1887) reported N. delalandii (= N. lalandii), from —_65.6.18.1) and P. hoplogaster (BMNH 65.6.18.2), which
“Damaraland,” an area corresponding to most of interior —_ are both limited to eastern southern Africa; and the types
central and northern Namibia. This record was repeated of Chamaeleon damaranum = Bradypodion damaranum
by Werner (1910), Boulenger (1910), and Sternfeld (BMNH 65.6.18.4—5), which is endemic to the south
(1911a), with the last author adding a second record from coast of the Western and Eastern Cape provinces.
Gobabis. However, both Hewitt (1910) and Boulenger Boulenger (1920) presented data for a specimen of
(1917) questioned the locality, the latter noting that the = N. delalandii from “Great Namaqualand,” but by the
Amphib. Reptile Conserv. 231 December 2020 | Volume 14 | Number 3 | e271
Sandveld lizards (Nucras) of Namibia
time of the subsequent genus revision, this species was
recognized as being restricted to the eastern portions of
the subcontinent (FitzSimons 1943).
Fischer (1888) first recorded N. tessellata from
between Aus and Bethanie, with further records given
by several authors: Boettger (1893, 1894: Bethanien,
Rehoboth, and environs), Werner (1910: Okahandja
and Kubub, 1915: Usakos), Sternfeld (1911la,b:
Deutsch Stidwest-Afrika), and Methuen and Hewitt
(1914: Kraikluft and between Nakeis and Groendoorn).
However, subsequent authors (e.g., Broadley 1972;
FitzSimons 1943; Mertens 1955) interpreted some of
these (Okahandja and Usakos) records as representing
other species. FitzSimons (1943) considered N.
tessellata to be widespread, although his knowledge
of it was based on the published German colonial
records noted above. Mertens (1955) likewise reported
older localities but noted that he knew the species with
certainty only from Rehoboth. Broadley (1972) accepted
the same southern Namibian localities as Mertens
(1955), i.e., as far north as the area around Rehoboth,
but added a record 20 km N of Rosh Pinah. The current
concept of the species limits its Namibian distribution
to the far south and southeast of the country, thereby
excluding most of the historical records (Branch 1998),
although Rehoboth area records were accepted by
Visser (1984) and Griffin (2003).
Hoesch and Niethammer (1940) first reported
Nucras intertexta from Namibia from the area of the
Waterberg. FitzSimons (1943) further recorded it from
Sandfontein near Gobabis, whereas Mertens (1955)
added Okahandja and Boettger’s (1893) record of N.
tessellata from Bethanie to the N. intertexta records.
Broadley (1972) added many records from northwestern
Namibia and considered N. intertexta to be widespread
across the northern half of Namibia (plus Bethanie),
most of Botswana, northern South Africa, southern
Zimbabwe, and southern Mozambique. The Bethanie
record has since been considered to be an error by
Branch (1998), but the northern Namibian records form
a diagonal from the Omaheke Region northwest to the
Angolan border in the Kunene Region (Branch 1998;
Visser 1984).
Nucras intertexta holubi was first recorded from
Namibia by FitzSimons (1943) based on Werner’s (1910,
1915) earlier records of N. tessellata from Okahandja
and Usakos, respectively, and new records from Outjo,
Kaoko Otavi, and Otjitondua. Mertens (1955) listed the
same records but called into question both the identity
of the specimens and the validity of the taxon. Broadley
(1972) included this form in his concept of N. taeniolata
ornata, with records from Kombat, Opuwo, Ombombo,
Oshakati, Kaoko Otavi, Otjitondua, Otjivakandu,
Outjo, and Sissekab, all in northern Namibia in
the current Kunene, Oshana, and Otjozondjupa
regions, in addition to a single southern record from
Stamprietfontein (2418AD, Hardap Region). Jacobsen
Amphib. Reptile Conserv.
(1989) subsequently elevated N. ornata to full species
and treated N. ¢t. holubi as subspecifically distinct
within taeniolata, and Bates (1996) later demonstrated
the specific validity of N. holubi, although neither of
them explicitly reevaluated the Namibian “holubi.”
Branch (1998) mapped the distribution in Namibia and
apparently treated the northern and western records as
referable to N. intertexta, but without comment. Visser
(1984) and Griffin (2003), however, recognized as valid
records from as far northwest as Opuwo.
A fourth taxon, N. intertexta damarana, was
described by Parker (1936) from Sissekab in north
central Namibia. It was considered a valid subspecific
form with a small area of endemism by both FitzSimons
(1943) and Mertens (1955, 1971). However, Broadley
(1972) included it, along with N. 7. holubi, in the
synonymy of N. taeniolata ornata. This nominal
taxon has not been accepted as valid since, nor has its
status been reevaluated, although Branch et al. (2019a)
suggested that the name damarana was applicable to
northern Namibian N. holubi, without commenting on
its validity.
As currently construed, both Nucras tessellata and
N. intertexta have broad distributions, the Namibian
portions of which are contiguous with the rest of their
respective ranges (Branch 1998; Visser 1984). However,
Nucras holubi is currently recognized as having a
disjunct distribution in southern Africa. The main area
of occurrence extends from about 31°S in the northern
Eastern Cape Province of South Africa, to the north and
east to include the central and northeastern provinces of
South Africa, Eswatini (formerly Swaziland), eastern
Botswana, Zimbabwe, southern Malawi, and almost
certainly parts of Mozambique; while the second area
is in north central Namibia (Bourquin 2004; Branch
1998; Burger 2014; De Waal 1978; Griffin 2003;
Jacobsen 1989). The large gap between these two areas
(> 900 km) has long suggested to herpetologists that
the status of the Namibian population required further
investigation
Here morphological and molecular data from
northern Namibian specimens of Nucras were used to
reevaluate the status of N. holubi and N. damarana in
the country. The possibility that a recently described
Angolan species might also occur in Namibian territory
was also investigated. The Nucras in southwestern
Angola had variously been referred to either WN.
tessellata (Bocage 1895), N. ¢. taeniolata (Boulenger
1910), or N. intetexta holubi (Boulenger 1917, 1920),
and was considered to represent a new species by
Broadley (1972; see review therein). Branch et al.
(2019a) stabilized the situation in Angola by describing
the species known from Namibe, Huila, and Cunene
provinces in southwestern Angola as Nucras broadleyi,
the southernmost record of which is from Donguena,
Cunene Province (-17.01667, 14.71667), only 42 km
north of the Namibian border.
December 2020 | Volume 14 | Number 3 | e271
Bauer et al.
Materials and Methods
Specimens. Standard institutional codes used in this
paper are: CAS (California Academy of Sciences,
San Francisco, California, USA), MCZ (Museum of
Comparative Zoology, Harvard University, Cambridge,
Massachusetts, USA), NHMUK (The Natural History
Museum, London, United Kingdom), NMB (National
Museum, Bloemfontein, South Africa), NMNW
(National Museum of Namibia, Windhoek, Namibia),
NMW_ (Naturhistorisches Museum Wien, Vienna,
Austria), PEM (Port Elizabeth Museum, Port Elizabeth,
South Africa), SAM (Iziko, South African Museum,
Cape Town, South Africa), DNMNH (Ditsong National
Museum of Natural History, Pretoria, South Africa), and
ZFMK (Zoologisches Forschungsmuseum Alexander
Koenig, Bonn, Germany). Additional tissue samples were
derived from the collections of Vincent Egan (LMH),
Marius Burger (MB/MBUR), Michael Cunningham
(MH), and Raymond B. Huey (RBH).
Morphology. The following mensural features were
recorded to the nearest 0.1 mm using digital calipers:
SVL (snout-vent length), TrW (trunk width), TailL (tail
length), TailW (maximum tail width), AGL (axilla-
groin length), HumL (humerus length), ForeL (forearm
length), FemL (femur length), CrusL (shank length from
knee to heel), PesL (pes length from heel to tip of 4"
toe), HeadL (head length), HeadW (head width), HeadD
(Head depth), CSn (collar-snout length), OrbD (eye
diameter = width of eye), NEye (nostril to eye distance),
EyeE (eye to ear distance), EarD (maximum height of ear
opening), and EarW (maximum width of ear opening).
Details of pholidosis including head scalation, as well as
femoral pore disposition, were also recorded. Except in
the case of MCZ R-190201 (see below), scalation and
pore data were collected unilaterally, for head scalation
from the right side of the body and femoral pores from
the left side of the specimen only. Morphological data
are presented in Table 1. Additional data for N. holubi
were derived from Broadley (1972) and Jacobsen (1989).
Comparisons were made with all other described species
of Nucras based on material listed in Bauer et al. (2019)
and from literature sources (e.g., Branch et al. 2019a;
Broadley 1972).
Molecular data. New sequence data were generated
for specimens of Nucras sp. (n= 1) and N. holubi from
South Africa (n = 4) and Namibia (n = 1), and were
combined with sequence data generated for a previous
phylogenetic study on South African Nucras (Bauer et
al. 2019) from 48 individuals of seven Nucras species
(N. boulengeri, N. holubi, N. intertexta, N. ornata, N.
lalandii, N. tessellata, and N. livida). Further data from
Branch et al. (2019a) were downloaded from GenBank
for additional sequences of N. intertexta (n = 3), N.
holubi (n = 1), N. taeoniolata (n = 2), N. tessellata (n =
Amphib. Reptile Conserv.
1), N. livida (n= 1), N. lalandii (n = 2), and N. broadleyi
(n = 2), and for five outgroup taxa belonging to the
southern African radiation of Eremiadinae (Engleder
et al. 2013): Australolacerta australis, Meroles knoxii,
M. suborbitalis, Pedioplanis laticeps, P. namaquensis,
and Heliobolus lugubris. All of the sequences combined
resulted in a final dataset of 73 individuals (see Table
2). Genomic DNA was extracted using the Qiagen
DNAeasy Kit from whole tissues consisting of tail tips,
liver, or skeletal muscle and stored in 95% ethanol.
PCR amplification was performed on an Eppendorf
Mastercycler gradient thermocycler using the primer
pairs METF1 (5’-AAGCTTTCGGGCCCATACC-3’)
(Macey et al. 1997) and COIRI1 (5’-AGRGTG
CCAATGTCTTTGTGRTT-3’) (Arevalo et ail.
1994) for ND2, ND4F(5’CACCTATGACTAC
CAAAAGCTCATGTAGAAGC-3’) and Leu
(5°-CATTACTTTTACTTGGATTTGCACCA-
3’) (Arevalo et al. 1994) for ND4, and 16Sa-l
(5’°-CGCCTGTTTATCAAAAACAT-3’) and = 16S-H
(5’-CCGGTCTGAACTCAGATCACGT-3’) — (Palumbi
et al. 1991) for 16S. PCR products were visualized
using 1.5% agarose gels before being purified with
the AMPure magnetic bead solution kit (Agencourt
Bioscience, Beverley, Massachusetts, USA). Cycle
sequencing was performed using the BigDye Terminator
v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster
City, California, USA) and then samples were purified
using the CleanSeq magnetic bead kit (Agencourt
Bioscience, Beverley, Massachusetts, USA). Sequences
were analyzed on an ABI 3730xl DNA analyzer and
subsequently assessed in Geneious Prime v2020.0.5,
where an initial sequence alignment was constructed
using the MUSCLE v3.8.31 alignment tool and then
manually adjusted by eye.
Phylogenetic analysis. Phylogenetic tree reconstruction
used 1,686 base pairs (bp) derived from three
mitochondrial markers (16S, ND2, and ND4). Variable
and parsimony informative sites were summarized
using the tool AMAS (Alignment Manipulation and
Summary) (Borowiec 2016). Maximum likelihood (ML)
and Bayesian inference (BI) analyses were performed on
the CIPRES Science Gateway v3.3 (Miller et al. 2010).
Analyses were performed on each individual gene and on
the concatenated set of mitochondrial genes. Each dataset
was partitioned using PartitionFinder v2.1.1 (Lanfear et
al. 2017), employing the partitioning schemes supported
by the Bayesian Information Criterion (BIC) score for
each analysis. The analysis resulted in three partitions
for the concatenated mtDNA analysis: (1) the first codon
position of ND2 and the third codon of ND4; (2) the
second codon position of ND2, the first codon position
of ND4, and the entire 16S gene; and (3) the third codon
position of ND2 and the second codon position of ND4.
All ML partitions were run under the GTR+I model of
evolution using RAxXML v8.1.24 (Stamatakis 2014) for
December 2020 | Volume 14 | Number 3 | e271
Sandveld lizards (Nucras) of Namibia
Table 1. Measurements and scale counts from Namibian specimens of Nucras damarana and N. aff. broadleyi. Scale counts are provided for the
right side of the body only and femoral pore counts from the left, except for MCZ R190201, which serves as the basis for the redescription of Nucras
damarana provided in this paper.
N. damarana N.damarana N.damarana N.damarana N.damarana _ N. aff. broadleyi
MCZ R190201 CAS 180421 CAS 193676 CAS 193807 CAS 193668 CAS 214642
SVL 57.6 41.6 31.8 42.6 38.8 58.2
TrW 9.4 6.5 3.8 6.7 5.5 9.7
TailL 107.0 101.0 67.5 89.0 95.0 120
TailW 5.0 3.3 2.2 3.3 3.4 4.7
AGL 32.0 20.8 14.7 24.7 20.0 31.5
HumL 5.0 47 32 46 4.4 5.8
ForeaL 5.5 48 Syt 339 3.8 iD
FemL ded 6.9 55 55 5.3 3
CrusL 8.5 74 5.5 6.2 6.5 8.2
PesL 12.2 12.4 9.8 11.3 11.0 12,2
HeadL 11.6 11.4 8.4 10.6 9.9 13.1
HeadW 7.6 6.7 43 5.3 5.5 2
HeadD 5:5 46 3.1 43 42 5.5
CSn 17.8 15.2 11.6 13.4 14.5 19.1
OrbD 2.0 2.0 h2 19 1.9 2.0
Neye 3.8 3.1 2.3 3.1 2.6 3.7
Eyee 4.5 3.9 2.4 3.6 3.8 5.0
EarH 22 1.9 1.3 LF 7 21
EarW 1.3 0.8 0.5 1.1 0.9 13
Chin Shields 4/4 4 4 4 4 4
Femoral pores (per thigh) 12/12 13 13 13 13 13
Supralabials 8/8 7 7 7 7 6
Infralabials 8/8 6 7 6 6 6
Supraoculars 4/4 4 4 4 4 4
Supraciliaries 7/8 7 7 7 7 7
Supraciliary granules 5/5 6 4 6 6 6
Supratemporals 2/3 2 3 2 3 4
Dorsal scale rows at midbody 36 40 ag 37 36 38
Ventral scale rows 8 8 8 8 8 8
Ventral scales in longitudinal series 33 28 28 28 29 34
Subdigital lamellae 9/9-14/13-18/18- 7-13-18-25-12 8-13-18-24-14 9-13-18-24-14 10-13-17-24-14 10-13-18-23-13
26/25-2/14
Amphib. Reptile Conserv. 234 December 2020 | Volume 14 | Number 3 | e271
Bauer et al.
cCCSOOOH
89S9P8DW
p9S9V8DIN
PSOLELLN
S1CSOODH
8LS9780W
LLSOV8DWN
C9S9V8OW
O8S9P8DINN
SSOLELLN
IL8S9CNIN
ESOLELLN
VON
v6lSO0ODH
L8S9vV8DINN
E8S9V8DWN
PL86E1LN
L81SO0OOH
L6S9V8DIN
96S978DIN
C8S9P8DINN
LOo99rsDIN
SL86E1. LN
OL8S9CNIN
698S9CNIN
EL86C1LWN
C099P8DW
elvecOHW
VNU SOI
CVS9V8DWNN
OSS9P8DIN
6S9LELLIN
8S9LEL LN
I99LE1LLIA
SIS9rV8DW
pEsopsOWN
CESOV8OWN
EESOV8OW
LSOLELLI
O99LE ILIA
9SOLELLIN
ElLS9r8DW
SIPeECcOHWN
VIVeECOHW
CON
Jaquinu UoIssasoR yURguan
4 IE LEoET
ACP. CL0CC
4.9 9S 8S06C
4.01 «80067
4.01 <8006€
AacES <OCo6C
4.07 OloCE
H..06.8 LoO€
H..06.8 LoO€
ACV 4 [ Co 6C
A.8C.VV06C
Hee I <VOoOE
4.6 LS. [Sov
4..60.S$CoTI
AOS. if Co€T
40. To I
AS O€ VISE
4.6 9C.1Co81
4.6 9C. 1781
opnyisuoT
S..01 4 I CoOL
SCO .6708T
S.6 if <O00VT
SS Dlo€T
SS Dlo€T
$..80 6 I oCC
S.LI LEoLT
S..8T 8 E07
S.8C.8 E07
Deo: IVoCC
SS <SVoCC
ScLV VSoVT
S«l 8 <6CoLI
$.90.80oP I
S.SC.LIovI
S.VI 6061
S$. 91 <600 10
S.9E VO.S00CE
S.9E VO.S00CE
opnyiyey]
UIDJUOJUSOWI'T Wey
asplIyoe[g Wey
aspo'_|
wey syevidsisg
wnyoog
wnyoog
DAIOSOY
ododunr’] eau,
DAIOSOY SUBD) SZNY YP
STIVJES
puernpny 19}e01H
STIVJES
puelnpny JoyeoIH
ouI[ag Wey
doyjAd wey
UldUOF ey We]
SPeOISSOID
eueoeny JO 7S Wy 09
osunonjy
uuey MS WY 88
efO'T M WY OT
qeluewiey JO A UY 6S
dwg s.ulapy
Aeg syiaquie’]
Aeg syiaquie’]
Aylpeso] SyToad¢
aded UOULION
aded UOuLION
ododum’]
ododun']
ododun']
ododun']
JeeN-NN7ZeMy
ododun’]
ododun']
ododun']
ododun']
ododun']
yesnug
oqiueN
oqiueN
suouny
BIL
ade ula}soM\,
ade ula}so\\,
UOISOY/IOULAOIg
ROLIW YINOS
ROLIV YINOS
ROLIV YING
ROLY YINOS
ROLF YINOS
ROLY YINOS
ROLIV YING
ROLYV YING
ROLY YINOS
ROLY YINOS
ROLY YINOS
ROLY YINOS
eIqruUeN
ejosuy
vjosuy
eIqIUeN
BIUBZUP
ROLY YINOS
ROLY YINOS
Ayunod
eslic YNaN
cS60¢ EW
£60000 HW'I
09c00 UNaN
cECOO MNAN
OcrdSa
LcO10 MNaN
T0010 MNaN
cles ENV
€6L8e4 ZOW
CLOILC AW
LE08 ENV
991 OV
810 DOV
S09 ENV
0c OW
COSNHSNM)
1OSNHSN
# ONssiy/PIeld
vIsccd Wad
€l8ccad Wad
Lv98 la Wadd
Oerl a Wd
SI9TTa ANN
El9TTa INN
6Sprsla
ZOW
8E1VET SVO
1l0cO61a
ZOW
LSlvcd Wad
S00vcad Wad
CY9VIT SVO
eLL9la Wad
Lo9l Ta GINN
9c9T TH GIN
uauloeds
DIXajsajul SPAINN
DIXajAajul SPAINN
DIXajAajul SPAINN
IQnjOy SDAINN
1QnJOYy SDAINN
IQnjOy SDAINN
1QnjOYy SDAINN
1QnJOYy SDAINN
IQnjOYy SDAINN
IQnJOYy SDAINN
1qnjOy SDAINN
1QnjOYy SDAINN
DUDADUDP SDAINN
1Aa]pVOlG SDAIN
1Aa]pvOolg SDAMNN
1a] pvodg
‘Ye spANN
1/a8Ua]nog SDAIN NE
SNIDIJUDAND SDAINN
SNIDIJUDAND SPDAINNE
OUICU UOXP],
‘SPOYIIFA] PUL S[VLIA}ZVIA, Ul PoTIeJop o1e SUOTILIADIQG” PIepPUL}S UOT}D9][09 UUUTDEdg “sJaqUINU UOISsad0R YURGUIH poye1sosse YIM sIsATeue oIJOUSsOAUd Je[NOsTOUW UI pasn sajdures *7 Iquy,
December 2020 | Volume 14 | Number 3 | e271
235
Amphib. Reptile Conserv.
Sandveld lizards (Nucras) of Namibia
VLS9V8DWN
ELS9V8DOW
OLS9V8DIN
ILS9V8DIN
CLSOV8DOWN
vcCcCSOODH
SccSOODH
81CSOODH
61 CSOO0ODH
I8S9p8DIN
vaN
C6S9V80OW
COS9V8DIN
6859780
06S978DINN
l6S9rps0INN
961S00DH
L61S000H
061S00D0H
161S00D5H
CO99PT8DIN
VN Sol
09S9P8DIN
91S9P8DIN
SVS9rsOW
97S9V8DWN
LVS9VsDOW
prs9rsoWN
8PS9r8OW
6vS9V8DWN
EvS9rsOW
ScS9V8OW
OrS9r8DINN
IpsorsDINN
CCN
Jaquinu UoIssao0R yURguaH
‘SpoyjIJA| PUB S[BLIJBIA] Ul PoIe}Op ae SUOTILIADIQGE PIepUL}S UONDIT[O9 UdUTDAdg ‘sJaquUINU UOIssadNe YUR_USH poyersosse YIIM sIsATeuR dT}OUASO]AYd Je;NdaToU UI pasn sadures ‘panuIyUod 7 3IqUy,
H.9E SPIT
AOS 8 I o9C
ALE .6Vo8TC
Au8E.6708C
A.8€.6708C
ACC. OS 08
Al. OS 08C
H..06.8 if o9C
H..06.8 109¢
ALO. €$o17
AalE.LSo€T
4.00. SCo€C
AVI LCoCC
AI V 80007
Fal V.SCo6C
4.68 9Co6C
opnysuo]
S.SV<60o0 I €
SS YEo I €
S.L0.CE0OE
$..80.CE0OE
$..80 <CEoOL
S.£0.€€00€
S.£0.€€00€
SCS .9€o I €
SuS YEo I €
S..67 <COoVE
S..VO LOoLT
SBC. VoLT
SCS LT oLT
ScSV IEo8T
SOL <COo€T
Sel C<COo€T
opnyiye']
[Pe LOsIOL JO Y UY C']
yooyssoquieg
wie “sioqsooquieg
ISP][IA JOAN IVON
OSvIIIA
ojoydoydis Jo M Wy |
ISvI[IA
ojoydoydis Jo M Wy |
OdvIIIA
ojoydoydig Jo § Wy |
OSeIIIA
ojoydoydigs Jo § Wy |
yooyssoquieg
ue “sioqsooquieg
sioqsooquieg UWdey
d[epsUsqioH
ASH UF TT
suoyuelepy
JO AS WT jNoQGV
pjoysuepy wey
N[eMsy],
WOodIo0y
eunle’T]
dura
SSOUJOPTIM vunleT
Aylyeso] oytoads
adey usayseq
adey ulayseq
adey usayseq
adey ulayseq
adey ulayseq
adey ulayseq
adey usayseq
adey usayseq
adey ulayseq
ade UId}SOM
ISOM\ YLION
adeg WoyION
adeg WIdyVION
aded UuIdyVION
ododur']
ododur']
UOISOY/IOULAOIg
ROLY YINOS
ROLY YINOS
ROLY YINOS
ROLYW YINoS
ROLYW YINoS
ROLY INOS
ROLY YINOS
ROLY YINOS
ROLY YINOS
ROLY YINOS
ROLW YINoS
ROLY YINOS
ROLY YINOS
ROLY YINOS
ROLY YINOS
ROLY YINOS
Aqunod
0SS00 UNaN
$8700 YNAaWN
cEPO0 UNAN
C100 UNaN
T1700 WNAN
$1700 YNAaN
vIv00 MUNaN
78700 UNaN
€8700 YNAN
c860¢ EAN
90VIC EN
88clc HN
LLcedsSa
O€0dSa
CL88E4 ZOW
IS88¢4 ZOW
# Onssiy/Pleald
618ccd Wad
818ccd Wad
L18ccd Wad
918ccd Wad
¢18ccd Wad
9COLCa Wad
ScOlcd Wad
po6ol a ANN
S901 cad Wad
8S60ca Wad
19981 a Wad
LSc8 lad Wad
CICVET SVO
C6lvEec SVO
uawitseds
LIPUDID] SDAINN
1IPUDID] SDAINN
LIPUDID] SDAINN
LIPUDD] SDAINN
LIPUDID] SDAINN
LIPUDID] SDAINN
LIPUDID] SOAINN
1IPUDID] SOAINN
IIPUuDID] SOAINN
LIPUDID] SDAINN
DIXajAsajul SDAINN
DIXajAajul SPAINN
DIXajAsajul SPDAINN
DIXajsajul SDAINN
DIXajsajul SDAINN
DIXajsajul SDAINN
SUICU UOXP],
December 2020 | Volume 14 | Number 3 | e271
236
Amphib. Reptile Conserv.
Bauer et al.
L€cSO00DH
O€cSOODH
9LSOV8DWN
SLS9V8OW
69S9P8DINN
LceCSOODH
vaN
OI CSOODH
80CSO0DH
S6S9V8DINN
p6s9rsoWNN
88S978DWN
00CSOO0DH
VN Sol
LesorpsoIN
9CSOV8OWN
CSSOV8DINN
IScsorpsDIN
LES9v8DWN
6cS9V8DOWN
81S978DWN
6ES9P8DWN
IcS9v8DOINN
OcS9V8DOINN
8ES9P8OWN
LES9V8DWN
61S9V8DN
9ES9P8DWN
SEsorsOWN
LIS9V8DIN
CCN
Jaquinu UoIssao0R yUuRguaH
‘SpOyIIA, PUL S[BLID}VIA] UT PoTejop ore suOTeIADIQge pJepuUe}s UOT9T[09 UdLUTDEdS ‘sJaquUNU UOISsad0R YUR_UaDH poyerdosse YIM sIsATeue sNoUadsO]AYd IJeyNdsjOU UT pasn sojdures *ponuyUod Z I[qeBI,
Aa lO.0S09C
ASC. C00CE
Au€C.690l €
4.80. £00C€
ALT .600C€
4.00. €00C€
4..00.€00C€
A.98 S LoCC
A8C.9CoPT
ACI SCotC
ASC .LCoVC
A.87.810€C
AVS 8CoET
4.87.8 1o€C
Hale. SLo€C
AVS 8CoET
HSS. Clolé
A.VP.VV06C
opnysuo |
S€0.690C€
S.SV VOLT
S«lLCE.S0oST
S.8€. I C09
SBS. 1S09T
SSS .VSo9T
SeSS VSo9T
SCT 600€€
S90 OSoCE
S.OS OSoCE
SaL€.[SoCE
S.8C. LODE
SLE .OT0€
S.8C.LO0E
ScLC.8000€
S.LEOL0E
S..0$ <CEoL
S..61 <600 I €
opnyiye’']
duieg 11eAN
uoIsos TuasI fuel
Jop1og pueyizems Jo N
TusTyo [yn yy
JO HS UY CT
d310H nynsy)
uoIsol TUdsTAUR/Y
uOIsol IUdSTAUR/Y
SIOQIOL], We]
ulajUOssorhepy Wey
ulaqUOysorhepy Wey
yooyinng wey
adoypoony wey
yooysorey We J
adoypoony wey
sinquopAs
JO MS UW pr~
yooyooiey We J
oosey OTH
UOISSTAT SSOID
AJOH{ ‘IU JOARYy NUIT
Aylyeso] oytoads
adeyg ulayseq
adey ulayseq
[eeN-nn7zeM yf
esuejewundpy
JeeN-nn7eM y
JeeN-Nn7ZeM y
[eeN-Nn7eMy
[eeN-N]n7zeMy
ade UIdISOM
adey ulayseq
adey ulayseq
adey ulayseq
oded UOuION
ode UIOUION
aded UOuION
aded UOyION
aded UOyION
ade Ula}so\\,
adey ulayseq
UOISOY/IOULAOIg
ROLIV YINOS
ROLYV YINOS
ROLYV YING
ROLIV YINOS
ROLIV YING
ROLIFV YINOS
ROLY YINOS
ROLY YINOS
ROLY YINOS
ROLY YINOS
ROLYV YING
ROLIV YING
ROLIV YINOS
ROLIW YINOS
ROLIW YINOS
ROLY YINOS
ROLY YINOS
ROLY YINOS
ROLY YINOS
Aqunod
I$cZH
S98 ENV
c9T1O MNaN
IScl0 MNaNn
O€clO UNaAN
69110 YNAN
£8900 UNaN
02900 UNaN
97900 UNaN
£900 UNAN
8eclc HN
O€clc HW
Scclc HW
9IcIlc EW
60cIc HN
120-80 HIM
# ONssiy/PIeld
0808 1a Wad
906Sa Wad
l6szla Wadd
09901 a GNN
6S90T a GANN
85901 FINN
LS901TH GANN
ec8ccd Wad
ccsccd Wad
Ic8ccd Wad
Oc8ccd Wad
9Tl6la Wad
8016la Wad
cOl6la Wad
7606 la Wad
£8061 a Wad
LVL81a Wad
LOL6Oa Wad
uawtseds
DID[OMaD] SDAINN
DID[OMaDV] SDAINN
DJOUAO SPAINNE
DJOUAO SPAINNE
DJOUAO SPAINNE
DIDUAO SDAINN
DIDUAO SDAINN
DIDUAO SDAINN
DPIAl] SOAINN
DPIAl] SOAINN
DPIAl] SOAINN
DPIAl] SOAINN
DPIAl] SOAINN
DPIAl] SOAINN
DPIAl] SOAINN
DPIAl] SOAINN
DPIAl] SOAINN
DPIAl] SOAINN
IIPUDID] SOAINN
SUICU UOXP],
December 2020 | Volume 14 | Number 3 | e271
237
Amphib. Reptile Conserv.
Sandveld lizards (Nucras) of Namibia
99S978DIN
S9S9V8DOW
9€S 1S6HH
6LS9V8DN
C9S9V8DIN
L9S9p8DIN
LOIIZ80d
STIIL80d
S8S9V8DW
9VIIL80d
IvIIZ80d
TrIIL80d
ZTSTIL8OG
p8S9P8OWN
LSS 1S6dH
66S978DIN
86S978DWN
pos9rsDW
ErOIL80d
L9OIL80d
9SS9P8DINN
8801 L80d
€80IL80d
P801L80d
P601L80d
vSS9V8DINN
8SS9P8DINN
EcSOV8OW
6SS9V8DN
SSS9rsOW
ESS9rsOW
CCSOV8DOIN
vCS9V8OWN
LOSOV8OWN =98S978DIN §=LSS9P8DI
VON
VN SOI
CCN
Joquinu UoIssao0R yURguUaH
‘SpoyIIJA| PUB S[RLID}VIA[ Ul PoyIejop ore SUOTeIADIQge PIepULIS UOTID9T[OD UsuTOAdS ‘sIaquINU UOISSad0R YURGUdDH poyeIdosse YIIM stsAyeue oNSUasOTAY IejNdajou UI pasn saydues ‘penunUOd 7 IIQBL
HaIV.9So91
AuVe.S€o6l
4..67.0$081
4.8 OV.CSo9I
4.96 8001
A.8C.ViV6C
Ae if v. €Cob 1
H.€€.00061
d 0¢ 6r 81
A.€6 .VE61
ACS .9C61
HCC. €€0CC
4 “cv. cVE oL |
4 ev. es oL |
4 «Ol cl oL |
4.97 1.17007
ce if ¢ «C006 I
opnysuoT]
SBS vl o8C
S.VE6CoCE
Sal if <SfoOE
SV I I <S 1067
S.LV.LE61
SCS SVoCT
S..61 <BCoLt
SEC .6€00€
S.BCS EOE
S€0.€€00€
S.8V.LC0E
S.VO<.CS 067
S67. I GoOE
S67. I CoOL
S..0OV Do8C
Sal “Gl <VCoIT
SLT 4 CSoOE
opnine’T
SUINY SPPOY ‘OTA
wey WwessuezZag
sueuey Wey
YOT[ON HOd
durea soy qefuewey
doyAg wey
JouOD yooysjayng
doyis0'77] wey
seuey Wey
SOISOIBN WI]
JOIALISIAGN9a'T Wey
adoy pooy wey
PUOWLOIALIUSOID
PUOUWILIOIALIUSOINH
wed
[euOneN pyeasioqyory
ed
JONUOISUBIT, Ipese[esy
weporyuod Wie]
Ayrpesoy oytoeds
aded WdYyVION
aded UIOULION
oded WdYyVION
oded UOULION
suouny
ododun']
ade Ula}so\\,
oded WIUION
oded WdyVION
aded WdyION
aded WIdYyVION
adeg WoYyION
odeg WoYyVION
adeg WOON
odeg UWIoYyION
odeg UWIsyVION
aded UIdyVION
UOISOY/IOULAOIg
ROLYW YINoS
ROLY INOS
ROLYW YINOS
ROLY YINoS
eiqIueN
ROLY YINOS
ROLY YINOS
ROLY YINOS
ROLY YINOS
ROLY YINOS
ROLY YINOS
ROLY YINOS
ROLY YINOS
BOLIV YINOS
BOLIFVY YINOS
ROLYW yINoS
BOLIPY YINOS
Ayunod
8SSv ENV
810 WSS
9690¢ EWN
6c9S ENV
OL8ZE4 ZOW
p6sLed ZOW
Teco HW
0S90¢ EW
L£890¢ EW
rect YNdN
coe] MNAN
1901c MNaN
p8Ss ANV
c8SS AINV
OLOS HINV
89re Hdd
vcLOc EW
# Onssiy/Pleld
€£000C SVO
CIcLT a Wad
8L69 Ta Wad
C8L90C SVO
LLcovs la
ZOW
6€1VET SVO
EL891a Wad
CL89 Ta Wad
vISITa €INN
Lov ila dINN
I8ZOla €NN
ScL90C SVO
EcLONT SVO
LI610¢C SVO
uautseds
sisuanbpupu
siuvjdoipad
sdao1jv]
siuvjdoipad
syjpjigsoqns
SaJOsaV
11IXOUY SaJOAOJVL
SIAGQNSN] SNJOGOLAH{
SIAQNSN] SNJOGOLaLT
S1JDAJSND
DIAQIDIO[DAISNP
DID[JASSa] SDAINN
DID[[ASSA] SDAINN
DID][[ASSA] SDAINN
DID][ASSA] SDAINN
DID][ASSA] SDAINN
DID[[ASSA] SDAINN
DID[[ASSA] SDAINN
DID[[ASSA] SDAINN
DID[[ASSA] SDAINN
DID]JASSA] SDAINN
OUICU UOXP],
December 2020 | Volume 14 | Number 3 | e271
238
Amphib. Reptile Conserv.
Bauer et al.
1,000 rapid nonparametric bootstrap replicates (BS),
with values greater than 70% considered to be indicative
of support. The BI PartitionFinder analysis resulted
in the same partitioning scheme recovered for the ML
analysis (Partitions 1—3 listed above) and were run using
the GTR+I+T (Partitions 1 and 2) and HK Y+T (Partition
3) models of evolution. MrBayes v3.2.7 (Ronquist et al.
2012) was used to perform the BI analysis, and it was
run for 50,000,000 generations sampling every 10,000
generations. Convergence of the Markov chains was
assessed by eye using Tracer v1.6 (Rambaut et al. 2014)
and the initial 25% of trees were discarded as burn-
in. Posterior probabilities (PP) greater than 0.95 were
considered to be indicative of support.
Results
Molecular phylogenetics. Final alignments for the three
mitochondrial markers were as follows: ND2, 403 bp
(226 variable, 193 parsimony informative); ND4, 732
bp (329 variable, 278 parsimony informative); and 16S,
551 bp (157 variable, 123 parsimony informative). There
were no conflicts in the tree topologies between the BI and
ML analyses and both analyses retrieved generally high
nodal support, with some notable exceptions, throughout
their respective trees (Fig. 1). Nucras boulengeri and
N. broadleyi (including our Nucras sp. from northern
Namibia) form a clade sister to all other Nucras species
(BS = 89%, PP = 0.92). Among the remaining named
taxa there are two major clades (although this split
received weak nodal support; BS = 46%, PP = 0.58): one
which includes N. holubi (BS = 100%; PP = 1.0), and
sister taxa N. intertexta and N. ornata (BS = 100%, PP =
0.99), and another which is comprised of all remaining
Nucras species. The latter includes N. aurantiacus,
which Is sister (BS = 99%, PP = 1.0) to a clade containing
N. livida which 1s itself sister (BS = 99%, PP = 1.0) to
a Clade (BS = 95%, PP = 0.99) containing N. tessellata
and N. taeniolata, with N. taeniolata appearing nested
within the broader N. tessellata clade (BS = 90%, PP =
0.92). Pairwise uncorrected ND4 distances between N.
taeniolata and sister N. tessellata samples (CAS 201917,
206723) were 0.45—6.08% (mean 3.26%).
Within N. holubi there appear to be three highly
divergent clades. The first is comprised of individuals
from the Limpopo and KwaZulu-Natal provinces of
South Africa (BS = 100%, PP = 1.0), which is sister
(BS = 100%, PP = 1.0) to a second clade comprised
of an individual from Namibia, which is sister (BS =
80%, PP = 0.89) to another set of specimens collected
from Limpopo, South Africa—thus rendering the South
African N. holubi paraphyletic with respect to the single
specimen collected in northern Namibia (MCZ R190201).
Pairwise uncorrected ND2 distances from the Namibian
N. holubi were 12.30-12.84% (mean 12.50%) to their
sister South African N. holubi, and 14.25—14.56% (mean
14.40%) to the remaining (outgroup) South African N.
Amphib. Reptile Conserv.
holubi. For 16S, there was a 19.14% mean difference
between the Namibian specimen and its sister clade of N.
holubi, a 12.83% difference from the other South African
N. holubi, and a 19.66% mean divergence between
the two South African N. holubi clades. Comparable
values for ND4 were 13.1%, 17.84%, and 15.58%. The
mean intraclade divergences for the sister clade to the
Namibian sample was 2.01% for ND2 (range 0.26—
3.42%). Divergences were 2.85% for ND4 and 1.09% for
16S for the only two samples available for these markers.
Pairwise uncorrected distances between the Angolan N.
broadleyi and its Namibian sister were 15.03—15.69%
and 8.24% for 16S and ND4, respectively, and there
was a 7.83% 16S difference between the two Angolan
samples (noting that no ND2 data were available for the
Angolan samples and ND4 was available only for PEM
R24157).
Morphology
Nucras damarana. The Namibian specimen genotyped
as a member of the N. holubi clade (MCZ R190201)
was compared to specimens of N. holubi from Limpopo
Province, South Africa, from which the original
syntype series was derived (Limpopo Valley, Transvaal;
Steindachner 1882). It was also compared to the type
material of N. intertexta damarana (Fig. 2). Parker
(1936) distinguished N. i. damarana from its congeners
by its small size (maximum 54 mm SVL) and the
shortening of the interparietal such that the parietals
form a suture behind it. Broadley (1972) recorded 24
specimens of Nucras taeniolata ornata from Southwest
Africa [=Namibia], all of which may be assumed to be
the same taxon described by Parker (1936). He further
demonstrated that one of Parker’s distinguishing features
for N. i. damarana, the contact of the parietals separating
the interparietal from the occipital, was not constant
among the Namibian material and that it also occurred
in other congeners.
However, Broadley (1972) did find that his Namibian
“ornata’ were smaller than all other members of the N.
tessellata group, except for N. taeniolata ornata (today
N. holubi) from Gaborone, Botswana, with no individuals
larger than 57 mm SVL. He also demonstrated that the
Namibian specimens had the lowest mean number of
transverse scale rows at midbody (39), with almost no
overlap between this group and his other populations
of N. ornata (= N. ornata + N. holubi). This group also
exhibited one of the lowest total numbers of femoral
pores (lowest minimum number of 21, and second only
in mean to the Kimberley District specimens [of N.
holubi| of < 26).
MCZ R190201 (Figs. 3, 4A) is only slightly larger
than the largest specimen recorded by Broadley (1972:
57.6 vs. 57 mm SVL), and has only 36 midbody scale
rows and a total of only 24 femoral pores. Four additional
specimens of Namibian “N. holubi’ examined here
December 2020 | Volume 14 | Number 3 | e271
Sandveld lizards
MH 0531| Australolacerta
100
1.0
100
100 1.0
1.0
98
0.96
100
100
1.0
0.2
CAS 206782
CAS 200033
PEM R17212
(Nucras) of Namibia
PEM R16978 | Meroles
| Pedioplanis
100) MOZ R184277 | rey
Heliobol
Tol CAS 234139: |elobolus
PEM R16773|N. boulengeri
CAS 214642 in aff. broadleyi
PEM R24005 ;
PEM R24157 N. broadleyi
PEM R17430
MB 21672 N. holubi (1)
PEM R22813| (Limpopo/KwaZulu-Natal)
PEM R22814
MCZ R190201| N. damarana
100[PEM R18647
MCZ R184459 .
1.0
CAS 234138 | N. holubi (2)
NMB R11613 | (Limpopo)
NMB R11615
N. ornata
N. intertexta
MB 20982|N./lalandii (Western Cape)
N.lalandii (Eastern Cape)
N. aurantiacus
PEM R18747
PEM R19103
PEM R19108
PEM R19087
PEM R19116
PEM R19094
PEM R22823
N.livida (Eastern Cape)
RBH 3468
NMB R10781
NMB R11497
NMB R11514
MB 20724
PEM R16872
PEM R16873
i CAS 201917
CAS 206725
2 |ICAS 206723
PEM R18080
HZ 251
1.0
99
1.0
N.livida
(Western/Northern Cape)
N.tessellata
N.taeniolata
Fig. 1. Concatenated mitochondrial RaxML phylogram of the genus Nucras and outgroups used in this study. Bootstrap support
(above) and posterior probabilities (below) are shown for the
species level and more inclusive nodes. Select nodes containing
individuals with identical or minor sequence divergence (less than 2%) from shared localities and from non-focal taxa have been
collapsed in order to condense overall tree size; but a full list of the specimens used in this study can be found in Table 1.
(CAS 180421, 193807, 193668, 193676) are likewise
consistent, with maximum counts of 40 midbody scale
rows and 26 femoral pores. Further, Parker’s (1936)
statement that the occipital scale was reduced in his new
taxon 1s also borne out by our specimens, two of which
have a small occipital scale and three of which have no
distinct occipital scale (Fig. 3C). These features separate
the disjunct Namibian “N. ho/ubi” from the southeastern
African N. holubi sensu stricto and, along with the large
genetic divergence and geographic disjunction between
them, support the resurrection of Nucras damarana
Parker, 1936 as a distinct taxon that is apparently endemic
to northern Namibia.
Parker’s (1936) description of Nucras intertexta
damarana was written at a time of great confusion
over species boundaries within Nucras. Indeed, despite
its obvious similarity to N. holubi and N. ornata, his
Amphib. Reptile Conserv.
240
comparisons were chiefly with N. intertexta. This
confusion still existed through the revisionary work
of Broadley (1972), who synonymized several taxa
now considered distinct from one another. Parker’s
(1936) diagnosis was brief and is now inadequate to
unambiguously distinguish the taxon among all of
its congeners. As a consequence, we provide a new
diagnosis for the taxon and a detailed description of
MCZ R190201.
Nucras damarana Parker, 1936
Nucras tessellata [part]: Werner (1910: 329).
Nucras intertexta damarana Parker, 1936: 135.
Syntypes;) NHMUK ~ 1946.8.6.17—24 [originally
1936.8.1.534—541]. Sessekab [=Sissekab], N.W. of Otavi,
1,300 m. Coll. Karl Jordan, 10-12 November 1933.
December 2020 | Volume 14 | Number 3 | e271
Bauer et al.
Fig. 2. Syntype series of Nucras intertexta damarana Parker, 1936 (NHMUK 1946. 1946.8.6.17—24) from Sissekab (-19.328645,
17.196238), Otjozondjupa Region, Namibia. The image has been modified to provide a uniform background and some extraneous
string has been deleted. Photo by A.M. Bauer.
Nucras intertexta holubi [part]: FitzSimons (1943: 320).
Nucras taeniolata ornata [part]: Broadley (1972: 13).
Nucras taeniolata holubi [part]: Jacobsen (1989: 453).
Nucras holubi. Bates (1996: 35) [by implication]; Branch
(1998: 169) [explicit for Namibian populations].
Referred material
Kunene _ Region: Otjivakundu = (-17.120881,
13.258644) DNMNH 38806—-07; 25 km N of Etengua
(-17.292402, 12.945191) DNMNH 49033; 15 km N
of Opuwo (-17.944228, 13.857124) DNMNH 48964—
65; Opuwo (-18.061608, 13.83867) NMW 35352,
DNMNH 24479, DNMNH 32352 [given as DNMNH
32351 by Broadley (1972)], DNMNH 33021, DNMNH
38911-14, DNMNH 71317; 57.9 km SW of Opuwo
on Opuwo-Orupembe Rd. (-18.25533, 13.50200) CAS
193807; Okamangudona (-18.264261, 13.513046)
DNMNH 71284: Hoarusib River, 92 km S of Opuwo
(-18.269277, 13.216553) DNMNH 51219; Kaoko Otavi
(-18.299656, 13.654006) SAM ZR-017494; Otjitundua
(-18.65000, 14.23333) SAM ZR-017535; 35 km W of
Amphib. Reptile Conserv.
Kamanjab on Kamanjab-Torrabaai Rd. (-19.57617,
14.59877) CAS 193668; Torrabaai Rd., 48.6 km W
of Farm Franken entrance (-19.63633, 14.38267)
CAS 180421; 59.3 km W of Kamanjab on Kamanyjab-
Torrabaai Rd. (-19.65167, 14.35558) CAS 193676;
Outjo (-20.116667, 16.15000) SAM ZR-017507;
Farm Kaokokroou [487] (-20.35948, 14.905159)
NMW 31109. Omusati Region: 60 km SE of Ruacana
crossroads (-17.48558, 14.86608) MCZ R190201;
Ombombo (-17.940000, 14.310000) SAM ZR-017519.
Oshana Region: Emono, 2 km SW of Onayena
(-17.775004, 15.678522) NMB R07448; Oshakati
(-17.785131, 15.698611) DNMNH 38613, DNMNH
45761. Oshikoto Region: Namutoni (-18.807768,
16.940231) ZFMK 18579-80; Chudop Waterhole
(-18.856125, 16.923499) NMNW 5482; DNMNH
57024—25; Halali, Etosha National Park (-19.033333,
16.466667) DNMNH — 56393. Otjozondjupa
Region: Sissekab (-19.328645, 17.196238) NHMUK
1946.8.6.17-24; Kombat (-19.713265, 17.710345)
DNMNH 30464. Note: Broadley (1972) listed
DNMNH 22225 from Stamprietfontein in the Hardap
December 2020 | Volume 14 | Number 3 | e271
Sandveld lizards (Nucras) of Namibia
Fig. 3. Nucras damarana (MCZ R-190201). (A) Whole body dorsum, (B) lateral view of head, and (C) dorsal view of head. Note
the single row of spots and dashes on each flank, and the absence of a discrete occipital scale. Photos by M. Murdoch.
Region (-24.33333, 18.40000), however, this specimen
is listed in the DNMNH database as being from
Opuwo, Kunene Region. Given the large geographic
disjunction between Stamprietfontein and all other
localities and the fact that there is another anomalous
specimen record from Stamprietfontein in the Ditsong
collection (Causus rhombeatus, DNMNH 22222), we
consider the record as dubious and have omitted it.
Diagnosis. A small Nucras (maximum 57.6 mm SVL)
with eight longitudinal series of enlarged ventral plates,
a series of small granules between the supraoculars and
supraciliaries, occipital scale reduced or absent, and
enlarged plates on the underside of the forearm. Adult
dorsal color pattern characterized by three distinct pale
longitudinal stripes extending from the nape to the tail
base, an additional pale stripe at ventrolateral margin
of flanks, flank markings comprise spots or horizontal
dashes typically in a single line, and tail not brightly
colored (Figs. 3A, 4A).
The new species may be distinguished from WN.
lalandii by the presence of enlarged plates under the
forearms and from N. /alandii and N. boulengeri by
the presence of a series of small granules between the
supraoculars and supraciliaries. In its color pattern (see
above), it is distinct from N. aurantiaca (no dorsal
markings), N. scalaris (dark crossbands), N. lalandii
(dark blotches or ocelli or both, forming transverse
bands, but never stripes), N. intertexta (pale dorsal
spots and/or irregular thin crossbands or reticulations),
N. livida (six stripes on nape), N. tesellata (two or
four stripes on nape, stripes generally not extending to
sacrum; tail and hindbody reddish), N. broadleyi (usually
four stripes on nape, see section on this taxon below), N.
taeniolata (8—11 stripes on nape), N. caesicaudata (5—7
pale dorsal stripes; tail pale blue), and Nucras ornata
Amphib. Reptile Conserv.
(vertebral line often lacking; markings on flanks oriented
vertically; tail reddish). Nucras damarana is most similar
to N. holubi, with which it has long been confused. Both
taxa share three prominent pale stripes and other basic
pattern elements. However, the former species is much
smaller, reaching only 57.6 mm SVL, whereas true N.
holubi may reach 73 mm SVL (Jacobsen 1989), and has
a lower number of midbody dorsal scale rows (34-42
(36—40 in our sample of five)) versus 41-65 in N. holubi
in the former Transvaal (Jacobsen 1989) and 44—58 in
Botswana (Broadley 1972). In addition, the vertebral
stripe in N. damarana does not typically have crisply
demarcated edges (Figs. 3A, 4A; vs. cleanly demarcated
by a dark brown border in N. holubi, Fig. 4B) and flank
markings in NV. damarana generally form a single line of
irregularly shaped pale spots, sometimes anteriorly the
spots are connected (vs. frequently forming two or rarely
more lines of irregularly shaped pale spots in N. holubi).
Description of MCZ R190201 (field number AMB
8037). Measurements are given in Table 1. Body
moderately slender and elongate (AGL/SVL 0.56), trunk
longer than hind limbs (AGL/[FemL + CrusL + PesL]
1.11), tail longer than SVL (TailL/SVL 1.86), moderately
slender and tapering. Limbs short, pes longer than shank
or femur (PesL/FemL 1.62; PesL/CrusL 1.47). Head
moderately large (HeadL/SVL 0.20), distinct from neck,
slightly elongate (HeadW/HeadL 0.66), not depressed
(HeadD/HeadL 0.47). Snout blunt, short (NEye/HeadL
0.33), almost twice eye diameter (NEye/OrbD 1.9).
Eye relatively large (OrbD/HeadL 0.17); lower eyelid
scaly, with four large translucent/semi-opaque scales
surrounded by arim of small granules. Eye to ear distance
more than 1.5 times diameter of eye (EyeE/OrbD 2.25).
Ear opening vertical, much taller than wide (EarH/
EarW 1.62), without projecting lobules, bordered
December 2020 | Volume 14 | Number 3 | e271
Bauer et al.
posteriorly by a series of tiny granules and anteriorly by
a series of slightly larger, elongate scales and anterior
to this a vertical row of enlarged juxtaposed scales;
tympanic shield narrow, three times the size of cheek
scales. Rostral approximately as wide as deep, strongly
gabled, separating supranasals for most of their length;
loreal region flat to very slightly concave. Supralabials
8R/8L; increasing in size posteriorly to the sixth right,
fifth left, which is largest; in subocular position and
possessing a strong longitudinal furrow running the
length of the scale in continuation with the contact
border between the anteriormost supralabial and loreal.
Infralabials 8R/8L, all much longer than wide.
Nostrils semicircular, surrounded by _ enlarged
supranasal, and two postnasals, each approximately one-
fourth the size of supranasal. Two loreal scales; anterior
loreal trapezoidal, bordered anteriorly by two postnasals,
dorsally by frontal and prefrontal, ventrally by second
supralabial (fully) and supralabials one and three (point
contact only); posterior loreal five-sided, posterior face
much taller than anterior, twice as long as anterior loreal,
bordered dorsally by prefrontal, posteriorly by first
(point contact only) supraocular, first supraciliary, three
preocular scales, and ventrally by supralabials three and
four. Supranasals in narrow contact with one another
posteromedially; frontonasal roughly hexagonal, wider
than long, with lateral apices projecting posteriorly,
gabled anteriorly; prefrontals in broad contact with one
another. Frontal scale approximately two times wider
anteriorly than posteriorly, lateral terminus of frontal-
frontoparietal suture lies posterior to border between
BAe E a
cS
we
a ee oe a Se
' ee #
| cat ioe . ah é
2 Cre 5 = x oie - e
i : Le BS ; a : A
‘ee eB ae mal eta Sd pies ="
‘Bas - ; : os bo utet
rs
a
a os seen, ;
Se ee mT aes
: “s aoeit
second and third supraoculars. Four supraocular scales
on both sides, second and third much larger than first and
fourth, 7R/8L supraciliary scales, smallest at midorbit,
where there is a row of five supraciliary granules
separating supraorbitals from main row of supraciliaries
on each side. Parietals five-sided, much longer than
wide, with slight forward projection wedged between
frontoparietal and fourth supraciliary. Interparietal scale
narrow and elongate, tapering to a point posteriorly,
separating posteriormost portion of frontoparietals from
one another and completely separating left and right
parietals; parietal window small but distinct; no clear
occipital scale present (Fig. 3C). 2R/3L supratemporal
scales, anterior narrow and elongate, posterior less than
half the size of anterior, but much larger than scales of
cheek region.
Mental roughly semicircular, broader than deep,
roughly same width as rostral, bordered posteriorly
by a pair of small chin shields in midline contact with
one another and bordering first and second infralabials.
Second set of chin shields larger and also in contact
with each other medially, extending dorsolaterally to the
margin of the jaw, resulting in a loss of contact between
second and third infralabials (condition not seen in other
specimens; Fig. 3B). Third pair larger still and also in
contact with each other medially, bordering third and
fourth infralabials. Fourth pair of chin shield pairs 1.5
times as large as third and widely separated from one
another medially, bordering infralabials 4-7. Indistinct
gular fold present, scales anterior to this roughly
hexagonal and becoming longitudinally elongate and
A ater
Saas a Sack < x2 ie
> Sears geese ne ed a een
Fig. 4. (A) Life photo of Nucras damarana (MCZ R-190201) from 60 km SE of Ruacana crossroads (-17.48558, 14.86608),
Omusati Region, Namibia. (B) Life photo of Nucras holubi from Alldays, Limpopo Province, Republic of South Africa. Note
differences in dorsal and lateral patterning. Photos copyright by Johan Marais.
Amphib. Reptile Conserv.
December 2020 | Volume 14 | Number 3 | e271
Sandveld lizards (Nucras) of Namibia
angled medially at approximately the level of the angle
of the jaws; scales between gular fold and collar enlarged
and rectangular. Twenty-seven scales between chin and
collar; collar border comprising a series of eight enlarged
scales, the largest in median position and rhomboidal in
shape, decreasing in size dorsolaterally and anteriorly.
Dorsal pholidosis homogeneous, 36 longitudinal rows
of small granules at midbody, becoming slightly larger
and more flattened on flanks. Eight longitudinal rows
of transversely widened ventral plates plus, lateralmost
considerably smaller than the rest. Thirty-three transverse
rows of ventral plates between axilla and groin.
Femoral pores extending to knee, 12 on each thigh, with
left and right series separated by a diastema of two scales
of roughly equal size. Scales in row immediately posterior
to femoral pore row oval, approximately half the size of
pore-bearing scales. Scales of rows anterior to pores much
larger, one (distal) to three (middle and proximal) rows
between pore-bearing scales and enlarged preaxial plates.
Large, roughly semicircular patch of precloacal plates
anterior to cloaca, constituent scales extremely large,
largest bordering posterior margin medially, bordered
laterally by one plate on each side, each one-sixth size
of median plate, and anteriorly by two scales, each half
the size of median plate, a semi-circular series of much
smaller scales bordering the precloacal plates laterally and
anteriorly.
Preaxial surface of forelimb covered with a series of
transversely enlarged scales; postaxial surface covered
by smaller, flattened juxtaposed scales. Scales on palms
small, flattened, juxtaposed to subimbricate. Manual
digits 4>3>5>2>1, all clawed. Preaxial aspect of thigh
with large transverse plates, continuing on to shank and
dorsum of pes, postaxial aspect with small, smooth,
subimbricate scales, granular on shank. Scales on the sole
small, smooth, granular to slightly elongate. Digits of pes
4>3>5>2>1, all clawed, bearing a series of smooth narrow
subdigital lamellae, lamellar formulae: (L) 9-14-18-26-[5"
toe missing], (R) 9-13-18-25-14.
Tail original, 107 mm in length, 22 elongate rectangular
scales per whorl at level of knee of adpressed hindlimb.
One row of dorsal scales for each ventral row. Basal
portion of tail with most scales smooth and only scattered
keeled scales, rapidly transitioning to keeled dorsal scales,
and most of the tail with all scales keeled.
Color in alcohol (Fig. 3). Dorsum medium brown with
three cream-colored longitudinal stripes, vertebral stripe
narrower than lateral stripes and with less well-defined
edges. Lateral stripes carry forward to the lateral edges of
the parietal scales and fade out on the posterior frontal,
adjacent to the posterior supraocular scales. Median stripe
continuous with an irregular whitish marking centered on
the interparietal scale. Flanks dark brown, bordered above
by dorsolateral cream stripe and below by a thicker cream-
colored stripe that is confluent with the white of the lateral
surface of the neck and extends to the hindlimb insertion.
Amphib. Reptile Conserv.
This stripe is bordered ventrally by a brown line that begins
inconspicuously behind the axilla and widens posteriorly
to include the lowest 2—3 rows of dorsal scales and the
edges of the lateralmost ventral plates, terminating at the
hindlimb insertion. Dark area of the flanks encompassing
a discontinuous longitudinal series of white dashes and
spots extending from the temporal region to the posterior
edge of the hindlimb insertion.
Anterior portion of head densely speckled with brown
pigment, fading on the ventral portion of the rostral and
supralabials; infralabials without dark pigmentation; rims
of eyelids with a narrow dark brown margin. Posterior
supraoculars dark brown, this coloration continuing
posteriorly along the dorsolateral margins of the head and
confluent with the dark surfaces of the flanks. Forelimbs a
mottled pale brown with darker posterior portions to most
scales and a series of diffuse whitish spots. Hindlimbs
with an irregular dark brown line running from the limb
insertion onto the postaxial surface of the foot; another
such line on the preaxial surface of the limb, passing over
the front of the knee and terminating at the flexure of the
ankle. The area between these lines occupied by a series of
partly joined white spots with diffuse margins. The central
cream stripe of the dorsum fades out on pygal portion
of tail, but the lateral stripes widen and fuse posterior to
this, yielding a more-or-less uniform pale brown dorsum
of the tail. The darker coloration of the flanks continues
as a diffuse stripe on the lateral surfaces of the proximal
half of the tail before fading entirely. All ventral surfaces
immaculate cream.
Color in life (Fig. 4A). Pattern as above. Dorsal ground
color dark brown. Middorsal stripe an orange-brown,
dorsolateral stripes off-white, ventrolateral stripes cream,
spots on flanks a pale yellowish-cream, with diffuse
orange-brown markings between some spots. Venter
immaculate white.
Distribution. Nucras damarana has a broad distribution
across northwestern Namibia, including the Kunene
Region (exclusive of the Namib and pro-Namib in the
west), as well as the Omusati, Oshana, and Oshikoto
Regions and in the northwest of the Otjozondjupa Region
(Fig. 5). Although unsupported by vouchers, it is likely to
be present in the Ohangwena Region and into the southern
Angolan Cunene Province.
Natural history. Parker (1936) recorded Nucras damarana
only from Sessekab, which he described as “open forest.”
The species occurs in several of the major landscape
divisions of Namibia, including the Kalahari Sandveld,
Kunene Hills, Cuvelai System, Central-western Plains, and
Kamanjab Plateau, and spans a broad annual precipitation
gradient from 150 mm in the west to approximately 500
mm in the east (Goudie and Viles 2015). Its distribution
falls entirely within the Tree and Shrub Savanna biome,
with the majority of localities within areas characterized
December 2020 | Volume 14 | Number 3 | e271
Bauer et al.
245
Altitude (m)
0 100 200
Kilometers
A ei 14° 16° Ge
17°S
1
23°
Zoe
27°
29°
20° 22° 24°
Fig. 5. Map of Namibia showing the distribution of Nucras damarana (green circles) and N. cf. broadleyi (blue triangle). Black
borders indicate regional boundaries. Regions mentioned in the text are: KU — Kunene, OH — Ohangwena, OM — Omasati, OS —
Oshana, OK — Oshikoto, and OT — Otjozondjupa. Map courtesy of Edward L. Stanley.
as woodland, but extending into areas of sparse shrubland
(Atlas of Namibia 2002). Nucras damarana is an
uncommonly encountered terrestrial species, usually
found in relatively mesic microhabitats in areas with at
least some vegetation as ground cover. Although the diet
has not been studied in this species, most congeners have a
broad diet of arthropods including various insects, spiders,
and centipedes (van der Meer et al. 2010), and this is likely
the case for N. damarana.
Conservation. Although this species, like many Nucras,
is not commonly encountered, it has a large extent of
occurrence (> 80,000 km/) and its entire range falls within
an area of relatively low human density. In Ovamboland,
localized agricultural activity may be a threat to this
terrestrial lizard, but it likely experiences minimal
disruption in other portions of its range, particularly in
the Kunene Region. It is protected in Etosha National
Park as well as several communal conservancies and is
of Least Concern.
Nucras aff. broadleyi. CAS 214642, from 48 km west
of Kamanjab on the road to Torra Bay (-19.65389,
Amphib. Reptile Conserv.
14.35083), in the Kunene Region, Namibia (Fig. 5), was
strongly supported as the sister to the two Angolan samples
sequenced and identified as Nucras broadleyi by Branch
et al. (2019a). There was a 15.03—15.69% divergence in
the 16S sequence between the Angolan and Namibian
specimens, compared to a 7.83% divergence between
the two Angolan samples. While these divergences are
relatively high, they are likely artificially inflated because
of ambiguities in base calls and alignment in part of the
sequences obtained. When compared with the diagnostic
features proposed for N. broadleyi, our specimen is
consistent with respect to scale characters, most notably
the presence of granules between the supraoculars and
supraciliaries, the well-defined occipital scale separating
the parietals posteriorly, and the absence of a distinct
parietal window in the interparietal scale (Fig. 6C). It is
also consistent in size (58.2 mm SVL vs. a maximum
of 63 mm) and falls within the range of all standard but
non-diagnostic features of scalation presented by Branch
et al. (2019a) for N. broadleyi. However, the specimen
differs significantly in color pattern. Branch et al. (2019a)
describe the diagnostic dorsal pattern as having a series
of longitudinal pale stripes, including four pale stripes
December 2020 | Volume 14 | Number 3 | e271
Sandveld lizards (Nucras) of Namibia
on the nape with the lateralmost of these forming a
light stripe that is continuous with the outer edges of
the parietals. In contrast, the Namibian specimen has a
pattern entirely lacking solid longitudinal stripes and
instead exhibits pale spots or dashes anteriorly and a
series of irregular transverse bars posteriorly (Figs.
6—7). This most closely resembles the pattern seen in
adult specimens of N. intertexta, which was, indeed, the
field identification given to the specimen by the senior
author. However, Namibian WN. intertexta are much larger
(up to 91 mm SVL) and have a larger number of dorsal
midbody scale rows (40-56 vs. 38-48 in Angolan N.
broadleyi and 38 in CAS 214642) and usually have the
parietals in contact posteriorly (comparative data from
Broadley 1972 and Branch et al. 2019a). The mismatch
in color is noteworthy, however, both N. intertexta and
N. broadleyi show significant variation in their patterns
(Branch et al. 2019a: Fig. 6; Broadley 1972: Pl. II),
with elements of the pattern of N. intertexta present
even in a paratype of N. broadleyi (PEM R24157,
Branch et al. 2019a). The recognition of species-
specific patterns has confounded Nucras systematics
since the time of Boulenger (1917, 1920). A possible,
though purely speculative, interpretation could be that
CAS 214642 represents mitochondrial introgression
of N. broadleyi into N. intertexta in northern Namibia.
Nuclear data for the Namibian sample would be needed
to test this hypothesis. Alternatively, it might represent
a new species allied to N. broadleyi or it could be
conspecific with Angolan N. broadleyi. Under the last
interpretation one would have to assume both that
color pattern is very highly variable and that more
(and more complete) sequence data would likely reveal
less pronounced genetic distances between samples. If
conspecific, this would represent a substantial range
extension southward and would expand the extent of
occurrence of N. broadleyi to over 117,000 km. Based
as uu
i
ae
ee
SSR grees se
on the present evidence, given that we have only a single
Namibian sample and very limited DNA sequence data,
we refer this single sample to N. aff. broadleyi.
Discussion
The pattern of relationships retrieved here for Nucras
was similar to other recent molecular results published by
Edwards et al. (2013), Bauer et al. (2019), and Branch et
al. (2019a). However, the recently described N. broadleyi
was recovered as the sister species to the East African N.
boulengeri, rather than as sister to the N. tessellata/N.
lalandii clade (Branch et al. 2019a). All patterns of
relationship within the main southern African clades, the
N. tessellata/N. lalandii clade, and the N. ornata/N. holubi
clade, are fully consistent with earlier findings, with the
exception of the placement of N. taeniolata. This taxon,
endemic to the Eastern Cape Province of South Africa,
was previously recovered as the sister to N. tessellata,
although with very shallow branch lengths subtending the
Species pair (Branch et al. 2019a; Edwards et al. 2013).
Here we recover N. taeniolata embedded deeply within
N. tessellata. Although two of our genetic markers (16S
and ND4) overlap with these other studies and many of
the same samples were used (see Table 1), our differing
results may nonetheless reflect the differences in either
genetic marker choice or taxon sampling, or both. The
difference in the placement of N. broadleyi relative to
Branch et al. (2019a) is likely due to the absence of any
nuclear markers in our dataset.
The finding that Nucras holubi as currently construed
is a species complex is novel, although results from
Branch et al. (2019a) did show a deep divergence
within the species. That the Namibian populations,
here resurrected as N. damarana, should be specifically
distinct is not surprising, given the large geographic
disjunction from N. holubi in southeastern Africa. The
Fig. 6. Nucras aff. broadleyi (CAS 214642). (A) Whole body dorsum, (B) lateral view of head, and (C) dorsal view of head. Note
the patterning resembling Nucras intertexta and the prominent occipital scale. Photos by M. Murdoch.
Amphib. Reptile Conserv.
December 2020 | Volume 14 | Number 3 | e271
Bauer et al.
14.35083), Kunene Region, Namibia. Photo by Randall Babb.
finding of two deeply divergent lineages of N. holubi in
South Africa is unexpected. The two clades correspond
to a clade north of the Soutpansberg and sister to WN.
damarana, and another clade represented by specimens
from Limpopo Province south of the Soutpansberg plus a
specimen from KwaZulu-Natal, at the extreme southeast
of the species range (Burger 2014). Without much more
extensive sampling, the ranges of these two lineages of
N. hobuli remain uncertain. The type locality given by
Steindachner (1882) is “aus dem Thale des Krokodilflusses
in Transvaal.” Based on Emil Holub’s travels (Holub
1881: 83), this would have been somewhere between the
confluence of the Marico and Crocodile rivers and the
junction of the Notwane River with the Limpopo River
along what is today the Botswanan border with western
Limpopo Province, South Africa. This location is well
to the west of any of our samples and warrants further
investigation, including topotypical genetic sampling
and a careful morphological comparison of the types with
specimens from throughout the range. In resurrecting N.
damarana, we were able to identify several features that
distinguish it from all N. holubi sensu stricto, but we did
not attempt to distinguish among the latter.
The identification of a Nucras allied to Nucras
broadleyi in northern Namibia was also surprising.
The specimen was field identified as N. intertexta,
Amphib. Reptile Conserv.
but was placed outside of all other southern African
Nucras in preliminary analyses. The inclusion of N.
broadleyi into our data set provided clear evidence that
our specimen is most closely related to N. broadleyi,
but there is a substantial difference in color pattern as
well as a large genetic distance between our Namibian
specimen and those reported by Branch et al. (2019a).
With the addition of our new data there are now
four Nucras species recognized in Namibia: N.
tessellata (widespread south of 22°N, except in the
Namib), N. intertexta (widespread in central and
western Namibia north of Windhoek, except in the
Namib), N. damarana (endemic to northwestern
Namibia), and N. aff. broadleyi (a single locality in
the southern Kunene Region). Our single WN. aff.
broadleyi was found essentially in sympatry with
N. damarana on the Kamanyjab Plateau, where N.
intertexta also occurs. Records of N. intertexta from
northern Namibian localities should be reexamined
given that our Namibian N. broadleyi demonstrates
that specimens phenotypically similar to N. intertexta
may, in fact, carry N. broadleyi DNA. Our record lies
approximately 275 km south of the reported range of
N. broadleyi (Branch et al. 2019a). While substantial,
this alone should not rule out some connectedness of
the Angolan and Namibian populations, given that
December 2020 | Volume 14 | Number 3 | e271
Sandveld lizards (Nucras) of Namibia
Nucras are relatively infrequently encountered and
that the intervening region remains poorly explored
herpetologically. A similar situation exists in the skink
Trachylepis laevis, described from Angola (Boulenger
1907) and many decades later found as far south as the
Kamanyjab area (Bauer et al. 1993; Steyn and Mitchell
1965); and also in Jomopterna ahli, which was
described as 7: damarensis from Khorixas, southern
Kunene Region and 15 years later was revealed to be
as widespread as 538 km to the northwest in Namibe
Province, Angola. Indeed, southwestern Angola shares
a high herpetofaunal similarity with northwestern
Namibia, and the Kunene Region in particular (Branch
et al. 2019b; Marques et al. 2018).
Acknowledgements.—We thank the permit issuing
authorities in South Africa and Namibia for allowing
the collection of specimens within their respective
Jurisdictions. Focal material reported on in this paper was
collected under a series of research/collecting permits
issued to AMB by the Ministry of Environment and
Tourism, Republic of Namibia over the period 1987-2014,
the most recent of which is Permit Number 1894/2014.
Curators and collection managers of the institutions cited
in Table 1 are thanked for their generous provision of tissue
samples and data. Marius Burger collected the greatest
portion of the tissue samples used in this study, and we are
especially grateful to him. Edward L. Stanley prepared the
map, and Johan Marais and Randall Babb kindly provided
life photographs. The manuscript was improved by the
constructive comments of Werner Conradie and Francois
Becker. AMB was supported by NSF grant DEB-1555968
and the Gerald M. Lemole Endowed Chair Funds. Patrick
Campbell and Jeff Streicher (The Natural History Museum,
London) kindly facilitated work by AMB in the NHMUK
collections. Matt Buehler helped to generate the ND4 and
16S data used herein.
Literature Cited
Arevalo E, Davis SK, Sites Jr JW. 1994. Mitochondrial
DNA sequence divergence and phylogenetic relation-
ships among eight chromosome races of the Scelopo-
rus grammicus complex (Phrynosomatidae) in central
Mexico. Systematic Biology 43: 387-418.
Atlas of Namibia Project. 2002. Atlas of Namibia.
Directorate of Environmental Affairs, Ministry of
Environment and Tourism, Windhoek, Namibia.
Available: http://209.88.21.36/Atlas/Atlas_web.htm
[Accessed: 2 June 2020].
Bates MF. 1996. New reptile distribution records for the
Free State Province of South Africa. Navorsinge van
die Nasionale Museum Bloemfontein 12: 1—47.
Bauer AM, Branch WR, Haacke WD. 1993. The
herpetofauna of the Kamanjab area and adjacent
Damaraland, Namibia. Madoqua 18: 117-145.
Bauer AM, Childers JL, Broeckhoven C, Mouton
Amphib. Reptile Conserv.
PLEN. 2019. A new Nucras Gray, 1838 (Squamata:
Lacertidae) from the Strandveld of the Western Cape,
South Africa. Zootaxa 4650: 149-163.
Boettger O. 1893. Katalog der Reptilien-Sammlung im
Museum der Senckenbergischen Naturforschenden
Gesellschaft in Frankfurt am Main. I. Teil
(Rhynchocephalen, Schildkroten, Krokodile,
Eidechsen, Chamdleons). Gebriider Knauer, Frankfurt
am Main, Germany. x + 140 p.
Boettger O. 1894. Aufzahlung der Arten [in Dr.
Eduard Fleck’s Reiseausbeute aus Stidwest-A frika.
II. Vorkommen und Lebensweise der Reptilien
und Batrachier, p. 83-93]. Bericht tiber die
Senckenbergische naturforschende Gesellschaft in
Frankfurt am Main 1894: 88-93.
Borowiec ML. 2016. AMAS: a fast tool for alignment
manipulation and computing of summary statistics.
PeerJ 4: e1660.
Boulenger GA. 1887. Catalogue of the Lizards in the
British Museum (Natural History). Ill. Lacertide,
Gerrhosauride, Scincide, Anelytropside, Dibamide,
Chamaeleontide. Trustees of the British Museum,
London, United Kingdom. xii + 575 p., pl. I-XL.
Boulenger GA. 1910. A revised list of the South African
reptiles and batrachians, with synoptic tables, special
reference of the specimens in the South African
Museum, and descriptions of new species. Annals of
the South African Museum 5: 455-538.
Boulenger GA. 1917. A revision of the lizards of the
genus Nucras, Gray. Annals of the South African
Museum 13: 195-216, pl. VI-VI.
Boulenger GA. 1920. Monograph of the Lacertidae,
Volume I. British Museum of Natural History,
London, United Kingdom. x + 352 p.
Bourquin O. 2004. Reptiles (Reptilia) in KwaZulu-
Natal: 1. Diversity and distribution. Durban Museum
Novitates 29: 57-103.
Branch WR. 1998. Field Guide to the Snakes and other
Reptiles of Southern Africa. Struik Publishers, Cape
Town, South Africa. 399 p.
Branch WR, Conradie W, Vaz Pinto P, Tolley KA.
2019a. Another Angolan Namib endemic species:
a new Nucras Gray, 1838 (Squamata: Lacertidae)
from south-western Angola. Amphibian & Reptile
Conservation 13(2) [Special Section]: 82—95 (e199).
Branch WR, Vaz Pinto P, Baptista N, Conradie W. 201 9b.
The reptiles of Angola: history, diversity, endemism,
and hotspots. Pp. 283—334 In: Biodiversity of Angola.
Science and Conservation: a Modern Synthesis.
Editors, Huntley BJ, Russo V, Lages F, Ferrand N.
Springer, Cham, Switzerland. 549 p.
Broadley DG. 1965. Some problems presented by the
sand lizards of the Nucras tessellata group. Journal
of the Herpetological Association of Africa 1: 18-23.
Broadley DG. 1972. A review of the Nucras tessellata
group (Sauria: Lacertidae). Arnoldia (Rhodesia)
5(20): 1-35.
December 2020 | Volume 14 | Number 3 | e271
Bauer et al.
Burger M. 2014. Nucras holubi (Steindachner, 1882)
Holub’s Sandveld Lizard. Pp. 167 In: Atlas and Red
List of the Reptiles of South Africa, Lesotho, and
Swaziland. Suricata 1. Editors, Bates MF, Branch
WR, Bauer AM, Burger M, Marais J, Alexander GJ,
de Villiers MS. South African National Biodiversity
Institute, Pretoria, South Africa. 485 p.
De Waal SWP. 1978. The Squamata (Reptilia) of the
Orange Free State, South Africa. Memoirs van die
Nasionale Museum 11: i111 + 1-160.
Edwards S, Tolley KA, Vanhooydonck B, Measey GJ,
Herrel A. 2013. Is dietary niche breadth linked to mor-
phology and performance in Sandveld lizards Nucras
(Sauria: Lacertidae)? Biological Journal of the Lin-
nean Society 110: 674-688.
Fischer JG. 1888. Uber eine Kollektion Reptilien von
Angra Pequenna. Jahrbuch der Hamburgischen Wis-
senschaftlichen Anstalten 5: 11-17.
FitzSimons VM. 1943. The lizards of South Africa.
Memoirs of the Transvaal Museum 1: i-xv + 1-528
p., 24 pl., 1 folding map.
Gouldie A, Viles H. 2015. Landscapes and Landforms of
Namibia. Springer, Dordrecht, Netherlands. xi + 173
p.
Griffin M. 2003. Annotated Checklist and Provisional
National Conservation Status of Namibian Reptiles.
Biodiversity Inventory. Namibia Scientific Society,
Windhoek, Namibia. [2] + 169 p.
Heinicke MP, Ceriaco LMP, Moore IM, Bauer AM,
Blackburn DC. 2017. Tomopterna damarensis (Anura:
Pyxicephalidae) is broadly distributed in Namibia and
Angola. Salamandra 53: 461-465.
Herrmann H-H, Branch WR. 2013. Fifty years of
herpetological research in the Namib Desert and
Namibia with an updated and annotated species
checklist. Journal of Arid Environments 93: 94-115.
Hewitt J. 1910. A key to the South African species
of Geckonidae, Scincidae, Gerrhosauridae, and
Lacertidae, together with some notes on the specific
characters and a brief summary of the known facts of
their distribution. Annals of the Transvaal Museum 2:
77-115.
Hoesch W, Niethammer G. 1940. Die Vogelwelt
Deutsch-Siidwestafrikas namentlich des Damara-
und Namalandes. Journal fiir Ornithologie 88
(Sonderheft): i-v + 1-404 p., 8 pl.
Holub E. 1881. Sieben Jahre in Siid-Afrika. Erlebnisse,
Forschungen und Jagden auf meinen Reisen von
den Diamantenfeldern zum Zambesi (1872-1879).
Band 1. Alfred Holder, Wien, Austria. xvi + 528 p.,
1 folding map.
Jacobsen NHG. 1989. A herpetological survey of the
Transvaal. Ph.D. Dissertation, University of Natal,
Pietermaritzburg, South Africa. 1,618 p.
Lanfear R, Frandsen PB, Wright AM, Senfeld T, Calcottt
B. 2017. PartitionFinder2: new methods for select-
ing partitioned models of evolution for molecular and
Amphib. Reptile Conserv.
morphological phylogenetic analyses. Molecular Bi-
ology and Evolution 34: 772-773.
Macey JR, Larson A, Ananjeva NB, Fang Z, Papenfuss
TJ. 1997. Two novel gene orders and the role of light-
strand replication in rearrangement of the vertebrate
mitochondrial genome. Molecular Biology and Evo-
lution 14: 91-104.
Marques MP, Ceriaco LMP, Blackburn DC, Bauer AM.
2018. Diversity and distribution of the amphibians
and terrestrial reptiles of Angola: atlas of historical
and bibliographic records (1840-2017). Proceedings
of the California Academy of Sciences 65(Supplement
II): 1-501.
Mertens R. 1955. Die Amphibien und Reptilien Sud-
westafrikas. Abhandlungen der Senckenbergischen
Naturforschenden Gesellschaft 490: 1-172.
Mertens R. 1971. Die MHerpetofauna Stidwest-
Afrikas. Abhandlungen der Senckenbergischen
Naturforschenden Gesellschaft 529: 1-110.
Methuen PA, Hewitt J. 1914. Records and descriptions
of the reptiles and batrachians of the collection
[The Percy Sladen Memorial Expedition to Great
Namaqualand, 1912-1913: Zoology]. Annals of the
Transvaal Museum 4: 118-145, pl. 14.
Miller M, Pfeiffer W, Schwartz T. 2010. Creating the
CIPRES Science Gateway for inference of large
phylogenetic trees. Pp. 1-8 In: Proceedings of the
Gateway Computing Environments Workshop (GCE).
IEEE, New Orleans, Louisiana, USA.
Palumbi SR, Martin A, Romano S, McMillan WO, Stice
L, Grabowski G. 1991. The Simple Fool’ Guide to
PCR, Version 2.0. Department of Zoology and Kewalo
Marine Laboratory, University of Hawaii at Manoa,
Honolulu, Hawaii, USA. 45 p.
Parker WW. 1936. Dr. Karl Jordan’s expedition to South-
West Africa and Angola: herpetological collections.
Novitates Zoologicae 40: 115-146.
Rambaut A, Suchard M, Xie D, Drummond A. 2014.
Tracer v1.6. Available: http://beast.bio.ed.ac.uk/
Tracer [Accessed: 2 June 2020].
Ronquist F, Teslenko M, Van Der Mark P, Ayres DL,
Darling A, Hohna S, Larget B, Liu L, Suchard MA,
Huelsenbeck JP. 2012. MrBayes 3.2: efficient Bayes-
ian phylogenetic inference and model choice across a
large model space. Systematic Biology 61: 539-542.
Stamatakis A. 2014. RAXML version 8: a tool for phy-
logenetic analysis and post-analysis of large phylog-
enies. Bioinformatics 30: 1,312-1,313.
Steindachner F. 1882. Uber eine neue Eremias-Art aus
dem Thale des Krokodilflusses in Transvaal. Sitzungs-
berichte der mathematisch-naturwissenschaftlichen
Classe der kaiserlichen Akademie der Wissenschaften,
Wien 86: 83-85, 1 pl.
Sternfeld R. 191la. Die Reptilien (auBer den Schlangen)
und Amphibien von Deutsch-Stidwestafrika. Fauna
der Deutschen Kolonien 4(2): 1-65, 1 folding map.
Sternfeld R. 1911b. Zur Herpetologie Stidwestafrikas.
December 2020 | Volume 14 | Number 3 | e271
Sandveld lizards (Nucras) of Namibia
Mitteilung aus dem Zoologischen Museum in Berlin
5: 393-411.
Steyn W, Mitchell AJL. 1965. A new scincid genus, and a new
record from South West Africa. Cimbebasia 12: 2-12.
van der Meer MH, Whiting MJ, Branch WR. 2010.
Ecology of southern African sandveld lizards (La-
certidae, Nucras). Copeia 2010: 568-577.
Visser J. 1984. Akkedis-familie van die Ou Wéreld.
Landbouweekblad 2 November 1984: 64—65, 67,
69.
Werner F. 1910. Reptilia et Amphibia. In:
Zoologische und anthropologische Ergebnisse
einer Forschungsreise 1m westlichen und zentralen
Stdafrika. Band IV, Systematik und Tiergeographie
Vertebrata B. Editor, Schultze L. Denkschriften der
medizinisch-naturwissenschaftlichen Gesellschaft
zu Jena 16: 279-370, pl. VI-XI.
Werner F. 1915. Reptilia und Amphibia. Pp.
323-376, pl. 7 In: Beitrdge zur Kenntnis
der Land- und _ SiiBwasserfauna Deutsch-
Siidwestafrikas. Ergebnisse der Hamburger
deutsch-stidwestafrikanischen Studienreise 1911.
Editor, Michaelsen W. L. Friedrichsen, Hamburg,
Germany.
Amphib. Reptile Conserv.
Aaron M. Bauer is Professor of Biology and the Gerald M. Lemole M.D. Endowed Chair of
Integrative Biology at Villanova University (Villanova, Pennsylvania, USA). His research
focuses on the systematics, biogeography, and evolutionary morphology of squamate
reptiles, chiefly in the Southern Hemisphere and in the Indian subcontinent. Aaron has
worked in southern Africa since 1987 (mostly Namibia, South Africa, and Angola) and has
described numerous new reptiles from across the subcontinent. He is also active in research
on the history, biography, and bibliography of natural history, especially as they relate to
natural history museums. Aaron is a former Chairman of the Herpetological Association of
Africa and past Secretary General of the World Congress of Herpetology.
Matthew Murdoch is currently finishing his Master’s thesis at Villanova University
(Villanova, Pennsylvania, USA). His work has covered the phylogeny and taxonomy of the
herpetofauna of Indochina, with an emphasis on species associated with limestone karst
habitats. Matthew’s current thesis work focuses on the biogeographic barriers found in
Myanmar and the phylogeography of the gecko genera of the region, with an emphasis on
Hemidactylus.
Jackie L. Childers is a Ph.D. Candidate in the Museum of Vertebrate Zoology at the
University of California, Berkeley, where she is currently working on African weaver birds
and the evolution of avian nest design. She previously completed a Master of Science
degree at Villanova University in 2015, and a Bachelor of Science at UC Berkeley in 2012.
Her undergraduate and graduate work both led her to field sites in southern Africa where she
has conducted several herpetofaunal research projects, with a special emphasis on lizards
in the family Lacertidae. Jackie’s research interests primarily include phylogeography,
phylogenetic systematics, natural history, and ecology, with a special passion for promoting
natural history collections and museum-based science.
250 December 2020 | Volume 14 | Number 3 | e271
Official journal website:
amphibian-reptile-conservation.org
Amphibian & Reptile Conservation
14(3) [Special Section]: i-xiii (e280).
Joe Mitchell — An Unfinished Life
Craig Hassapakis and the ARC team
Amphibian & Reptile Conservation, (amphibian-reptile-conservation. org), 3709 West Lilac Heights Drive, South Jordan, Utah 84095-5100, USA
Abstract.—Personal contributions on the life and career of Joseph Calvin Mitchell (1948-2019) by family
members and colleagues: Susan C. Walls, Susan Johnson, Jill A. Wicknick, Valorie Titus, Carola A. Haas, and
Kurt BuhImann.
Keywords. Influence, contributions, farewell, history, North American herpetology, researcher, turtles, Virginia
Citation: Hassapakis C. 2020. Joe Mitchell — An Unfinished Life. Amphibian & Reptile Conservation 14(3) [Special Section]: i—xiii (e280).
Copyright: © 2021 Hassapakis. This is an open access article distributed under the terms of the Creative Commons Attribution License [Attribution
4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction in any
medium, provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced, are
as follows: official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 30 December 2020; Published: 17 August 2021
I met Joe when the idea for creating a herpetology journal
devoted exclusively to conservation was just being
born, back in 1995. Joe was very supportive of the idea
and lent his prestigious name to our fledgling journal
as a member of the advisory board. I still remember
standing in a circle of professors at a conference a
quarter-century ago (1995), early in the development of
the journal, and their excitement that ARC was to be a
full-color scientific journal, since such a “luxury” was
exceedingly rare in those days. Joe’s paper was the first
scientific paper published in the journal:
Mitchell JC, Wicknick JA, Anthony CD. 1995.
Effects of timber harvesting practices on peaks of
Otter Salamander (Plethodon hubrichti) populations.
Amphibian & Reptile Conservation 1(1): 15-19 (e€3).
His submission of this article to ARC attests to Joe’s
willingness to help and risk his reputation by going with
a new journal with lofty ideals.
Joe continued to lend advice and review papers for
ARC over the years as the journal continued to grow in
prominence. One feature of Joe’s character that I could
always count on in my collaborations with him through
the journal was that no matter how busy his schedule
was, Joe always came through with very insightful and
helpful manuscript reviews, which always impressed
me and spoke to his commitment to conservation and
the journal as well.
Amphib. Reptile Conserv.
An example of one my may last communications
with Joe, which neatly summarizes his willingness
to help and the many responsibilities which must
invariably come with such openness, is his response to
a manuscript I had just sent him to review which was
packed full of behavioral field observation data:
Monday, February 11, 2019 4:45 PM
OK, Craig. I downloaded them all in a folder. Data-
rich is an understatement. I'll get to it as soon as I
can. Lots on my plate.
Joe
It was commented to the editorial team that Joe was
“one of our best reviewers for American reptiles and
amphibians!”
Joe left this world all too soon and he is sorely missed
by all who knew him. The entire ARC team wants to
thank Joe for all his dedication and help in getting
the journal Amphibian & Reptile Consevation started
and helping us to improve the submitted manuscripts
over more than two decades. We are forever grateful
and know that Joe’s spirit will continue on into the
future as he was an inspiration to all of us. While Joe’s
contributions to natural history and herpetology have
been reviewed in previous memorials, several of his
family members and colleagues have submitted some
more personal thoughts on their memories of knowing
and working with Joe over the years.
December 2020 | Volume 14 | Number 3 | e280
Joe Mitchell —An Unfinished Life
Susan C. Walls (Joe’s wife)
Fort White, Florida, USA
Tuesday, 2 July 2019, began like any other day for
Joe Mitchell. I left home early that morning, before he
awakened, to attend an out-of-town meeting. When I
got home in the late afternoon, though, it was easy to
reconstruct how his morning had unfolded. He had
cooked sausage for breakfast, and only had half a cup
of coffee—the other half would be waiting for him on
the kitchen counter when he got home. He only sent one
email that morning, and it was about an undergraduate
he was mentoring—clearly something that was important
to him since he tended to that before doing anything
else. He then loaded the bed of his pickup truck with
our recycling bins and made a run to the local recycling
center to drop it all off. On his return trip, he had planned
to stop at the local bank to deposit a check—the check
and a deposit slip were still on the passenger seat of his
truck when I retrieved it the next day from the tow yard.
At some point before leaving, he snapped a couple of
pictures on his cell phone of two of our dogs, curled up
in the new “fox hole” they had just dug in the yard. He
most likely was amused by their creative digging and he
would have chuckled as he shared the pictures with me
later that night when I got home. After getting the dogs
back in the house he left for the recycling center, only
“dummy locking” the gate—something we did out of
laziness when we knew we were just stepping out for a
moment. He obviously didn’t plan to be gone long and
was probably already thinking ahead to the next item on
his to-do list for the day. But Joe never made it back from
ail
the recycling center; something blew out of the bed of his
pickup on his return trip home. He pulled over and darted
out into the highway to get it. And, in the blink of an
eye, he was gone. The driver of a semi-truck approaching
from behind swerved at the last minute but couldn’t avoid
impact. What started out as just an ordinary day ended in
tragedy, loss, and grief for Joe’s family and friends, the
herpetological community, and me.
The herpetological community knew Joe for his stature
within, and contributions to, the field of herpetology. Joe
was a loyal member of The Herpetologists’ League, The
Society for the Study of Amphibians and Reptiles, The
American Society of Ichthyologists and Herpetologists,
and the Virginia Herpetological Society. He was our
esteemed colleague, a herpetologist extraordinaire, and a
gentle soul. But he was so much more. He was a loving
and devoted father and grandfather, brother, uncle, cousin,
brother-in-law, and husband. His family meant the world
to him, as did his colleagues, whom he once referred to as
his “tribe.” Joe was also a Marine—as he said frequently,
"once a Marine, always a Marine." He was very proud of
his military service during the height of the Vietnam War.
If he ever saw another Marine veteran when we were out,
he greeted them with "Semper Fi, brother. Semper Fi."
Joe was also a mentor to many young people, past and
present. Over the last several years he had thoroughly
enjoyed working with Jerry Johnston of the Santa Fe
College in Gainesville, Florida, and his students working
on turtles in the Santa Fe River system near our home
in Columbia County, Florida (Fig. 1). Jerry tells me that
Joe was actively mentoring many of them, and I am so
glad that these young people had the opportunity to get to
Fig. 1. Joe showing Santa Fe College students how to count growth rings in Pseudemys concinna as part of a long-term demographic
study of river turtles.
Amphib. Reptile Conserv.
December 2020 | Volume 14 | Number 3 | e280
Hassapakis
Fig. 2. Joe as a high school senior with his award-winning pair
of mahogany lamps and a pet Mole King Snake, Lampropeltis
calligaster.
know him and learn from him.
Joe had many interests outside of herpetology as
well. Since high school he had a strong interest in wood-
working. In his high school senior year, he made a pair of
mahogany lamps (among other pieces of furniture; Fig.
2). Their intricate and unique spiral design took seven
weeks to finish and involved lots of hand sanding and
finishing, but his efforts won him first place in the senior
wood turning class at the county and state industrial arts
shows. The summer after he graduated from high school,
he apprenticed with a furniture maker and intended to
Fig. 3. A portion of Joe’s herpetological book collection,
housed in barrister bookcases willed to Joe from Roger Conant.
The bookcases originally belonged to Roger’s father.
Amphib. Reptile Conserv.
pursue that career path but ended up joining the U.S.
Marine Corps on his 18" birthday in August, 1966. In the
recent few years before his death, Joe was starting to get
back into wood-working again in his home shop.
Joe was a true bibliophile. His expansive
herpetological library (Fig. 3) was admired by many, but
his literary interests were not limited to just herpetology.
In addition to his herpetological book, journal, and
reprint collections, Joe collected books on natural
history, military history, leadership, and Native American
culture and philosophy. Joe’s allegiance to the Marines
fueled his interest in military books and, from a young
age, he had been intrigued by Native American history
and culture. Joe was not a religious person but he was
very spiritual, and he aligned himself with many Native
American beliefs and philosophies. In his later years, Joe
developed a strong interest in leadership, and his library
holdings indicated that he studied a variety of leadership
approaches. In addition to books, Joe collected high-end
custom-made knives and baseball caps (especially those
bearing Marine Corps emblems), and he was passionate
about bluegrass music—the more energetic the banjo, the
better! Joe once took banjo and voice lessons with the
hopes that he could play bluegrass himself, but he never
became proficient enough to do so.
Joe described himself as being “product-oriented”
and he was a prolific writer. He also thoroughly enjoyed
the editorial process. At the time of his death, he was
co-editing Snakes of Arizona ae noe Holycross)
rs.
l hp .
- A i oa
Fig. 4. Joe at Sei at his desk with his bt canine friend, J ake,
close by.
‘ins
December 2020 | Volume 14 | Number 3 | e280
Joe Mitchell —An Unfinished Life
Fig. 5. Joe and Jake in 2011.
and he had a long list of planned book projects and
research articles lying in wait (most notably a book on
the herpetology of the Delmarva Peninsula with Roger
Conant). At age 70, Joe was far from ready to settle
into the more sedentary life one typically associates
with “retirement.” When he wasn’t working, he enjoyed
relaxing on his 6-acre wooded property in North Central
Florida with his best canine friend Jake, a rescued stray,
never far away (Figs. 4, 5).
Joe always cautioned me not to ruminate on things,
so I know that he would not want us to dwell on the
unspeakable tragedy of his loss. Joe cheated death ten
years earlier when he had a heart attack that required
bypass surgery; sadly, however, he wasn’t able to cheat
death a second time. Joe had told me once that, upon his
death, he wanted a party with lots of bluegrass music
rather than a morose funeral. I honored his request. And,
as hard as it is to do sometimes, I think that Joe would
prefer that we celebrate his life rather than mourn his
loss.
Semper F1, Joe.
Susan Johnson (Joe’s sister)
Mechanicsville, Virginia, USA
It was fun, and sometimes a bit crazy, growing up with
a future herpetologist...snakes and a few lizards were
always part of our family. (For some reason we could
not have a dog, but my parents OK’d the snakes!) At
one point, Joe’s bedroom had a cot in the center and was
surrounded by shelves of aquariums which contained
mostly snakes and a few lizards. Our den had a large
aquarium housing Joe’s Boa Constrictor while the utility
Amphib. Reptile Conserv.
room had a shelf of preserved snakes in large jars. Yes,
our family and friends thought this odd, and not just a
little bit crazy. The credit for inspiring Joe’s passion for
herpetology goes to our Uncle Cos, and kudos to our
parents for allowing Joe to follow that passion at a young
age. I really cherish the experience of handling and living
with snakes and other critters as I grew up. Joe taught me
to not fear them but to be in awe of them and the rest of
our natural world.
Jill A. Wicknick
University of Montevallo, Montevallo, Alabama, USA
A solid man, not tall, stood at the back of his pickup.
The Semper Fi sticker gave a hint at the physical exertion
of the upcoming field work. With a flash of his broad,
welcoming smile, Joe Mitchell was ready to get started.
The 16 km segment of the Blue Ridge Parkway where
Plethodon hubrichti, the Peaks of Otter Salamander, has
resided for five million years was my home for three
autumn seasons of field research on competition and
territoriality. Living ina 17’ travel trailer ina campground
that was devoid of other humans on weekdays, I shared
the area with a young black bear, a bobcat, and a park
ranger who was either a poor shot or didn’t have the heart
to kill a downed deer. This was the setting where I met
Joe Mitchell in his territory: Virginia. He was happy to
show it off, happy to mentor a graduate student, happy to
be in the field; ear-to-ear-grin, whole-face-alight happy.
Joe and I had already met at the herp meetings, but
this was our first time in the field together. We were in a
high-elevation valley nestled between two nearby peaks:
Sharp Top Mountain at 3,875 ft, and Flat Top Mountain
at 4,004 ft. I was just starting my dissertation project and
December 2020 | Volume 14 | Number 3 | e280
Hassapakis
Fig. 6. Joe’s presentation at an NEPARC meeting on the reptiles and amphibians of Virginia’s Civil War sites.
Joe had experience with the localities for my study. He
also knew that the area contained high quality timber
and was concerned about the effects of timbering on
this vulnerable endemic. He helped me to get my project
started, and he invited me to work with him examining
the effects of timber harvesting on P. hubrichti. In the
process, he nurtured my thinking about conservation.
While we worked at the Peaks of Otter, Joe showed
me how to select research sites on a map and how to
ground-truth them. Machete in control but flying, he
created transects and taught me field methods. I think of
him when I look at my own machete which hangs in my
Office.
Joe appears on my CV eight times, mostly from
1994-1997 and all related to Plethodon hubrichti. Our
timbering publication, with C.D. Anthony, appeared
in the inaugural issue of ARC which Joe was thrilled
to be a part of—enthusiastic about the new journal’s
conservation focus and eager to publish in it. He talked a
lot about publishing. He wanted to leave a herpetological
legacy through his publications but he has left so much
more. In addition to his manuscripts, he had a lifetime
of teaching others while sharing his enthusiasm, his
friendship, and his zest for life. The knowledge he passed
on still continues its journey.
Valorie Titus
Keystone College, LaPlume, Pennsylvania, USA
Though it’s been over a year, it is still hard to sit down
and write this. I first met Joe in 2003 at a Northeast
Partners in Amphibian and Reptile Conservation
Amphib. Reptile Conserv.
(NEPARC) meeting in West Virginia. I was a very green
grad student, in the middle of my Master’s degree work
on copperheads. He seemed quite amused by this young
female Yankee trying to figure out the behavior of these
snakes in Kentucky, and he was a very engaging and
supportive person from the start. (He later encouraged
me to submit the story of my first copperhead encounter
for publication, but that’s a story for another day! )
My next encounter with Joe was at the JMIH in
Norman, Oklahoma in 2004. This was my first big
meeting and my first ever presentation. He was so excited
to introduce me to many of the other herpetologists and
was just a networking encyclopedia. Since then, I had
always looked forward to seeing Joe at conferences and
meetings. My favorite ones were always the NEPARC
and SEPARC meetings, where we could take the time to
catch up over a good beverage. One NEPARC meeting
in Virginia particularly stands out. Joe was our keynote
speaker (Fig. 6), and he came in dressed like quite the
southern gentleman and talked (in a very pronounced
southern drawl) about the work he had done on various
Civil War sites (while joking that Virginia should be
considered a Southern state). He was always a joy to
watch when he made presentations.
Joe was always ready for a good story or to offer some
sage advice or encouragement. I knew that I could always
send him an email with a question and get a quick reply.
He was really integral in offering me support whenever
I was struggling with a chapter in my dissertation or a
publication. He always encouraged me to just keep on
plugging away and keep up my enthusiasm. If it wasn’t for
Joe’s influence, I would never have become so involved
with PARC--and for that alone, I am exceedingly grateful.
December 2020 | Volume 14 | Number 3 | e280
Joe Mitchell — An Unfinished Life
Now, at this point in my career, while I am not much of
a publishing academic, I have taken what I learned from
Joe and my other mentors, and am applying it to teaching
the next generation of undergraduates in the field of
wildlife studies. I often try to think about what my own
fears and trials were like—and what advice Joe would
have given me if I were in the position of my students
today. It gives me comfort knowing that his legacy will
live on through me as an educator and mentor. Rest easy,
Dr. Mitchell.
Carola A. Haas
Virginia Tech, Blacksburg, Virginia, USA
I first met Joe Mitchell in 1993, the year I arrived at
Virginia Tech. I can no longer remember the exact
circumstances, but I think Joe was in Blacksburg to
meet with someone else at the university or to meet
with Sue Bruenderman, who at that time was the Non-
Game Aquatics coordinator for the Virginia Department
of Game and Inland Fisheries (VDGIF). Someone must
have thought it would be a good idea to connect Joe with
anew faculty member who had an interest in amphibians,
so I think Joe looked me up or stopped by, and somehow,
we were introduced. I know that by then I’d heard his
name several times as someone I needed to connect with.
I had originally been hired by Virginia Tech to work on
non-game songbirds, but having landed in the southern
Appalachians, I was eager to expand my research to
include plethodontid salamanders, and an invitation to
participate in a silvicultural experiment by colleagues in
our Forestry Department had gotten me started on such a
project. It quickly became clear that there was a greater
need (and more funds) for research on the conservation
and management of amphibians and reptiles in Virginia
than for songbird work, and Joe was one of the few
people currently filling that niche. At the time he was
an adjunct faculty member at University of Richmond,
teaching Biology courses at night and doing independent
research and consulting work during the day.
Joe had been involved in the early studies of bog
turtles in southwest Virginia, and was very concerned
that conservation efforts for this species in the southeast
needed to increase. Based on discussions he had with Kurt
Buhlmann, he worked with Sue Bruenderman (VDGIF)
and Alison Haskell (USFWS) to negotiate support for
research on bog turtle movement and the importance
of streams as movement corridors between isolated
wetlands. I’m not sure how he managed to navigate the
process of obtaining the always scarce “Section 6” funds
before the species was listed, but Joe was often able to
find ways to get folks to address work that he saw as
urgent. The logistics of travelling from Richmond to
southwestern Virginia to do this work were daunting, and
so Joe approached me about collaborating on this project.
I protested that I didn’t know a thing about turtles, but
Amphib. Reptile Conserv.
Joe assured me that he’d teach me whatever I needed to
know about working with turtles and that my expertise
on movement behavior and corridors was the perfect fit
for the project. By that time Mike Pinder had replaced
Sue at VDGIF, and together we embarked on the bog
turtle research that ’ve continued on and off ever since.
Joe always welcomed me as a collaborator and
colleague, and he encouraged me in my shift to
herpetological work. As I was typing this just now, I
happened to notice his Reptiles of Virginia book out on
my side table, as I had been referring to it while working
on a bog turtle manuscript within the last couple of
weeks. I just looked to see what the inscription said, and
found his prophetic words from October 1994: “maybe
you are discovering that herps are just as exciting as
birds” (Fig. 7). It would have been easy for Joe to try to
stake out his territory, and treat me as a competitor rather
than a collaborator, especially because his financial
livelihood depended on continuing to get contracts for
work. But Joe was consistently open and encouraging.
I know he had plenty of conflicts over the years. Like
most of us, he certainly wasn’t immune to feeling like
his toes were being stepped on, that he was being taken
advantage of or snubbed, and there were plenty of people
that got irritated at Joe too. But besides being passionate
about the science, and the organisms, and the important
work getting done, Joe cared deeply about people and
was very invested in mentoring and supporting other
herpetologists. Every time I spoke with him while I was
Fig. 7. Joe’s inscription to me in my copy of his 1994 Reptiles
of Virginia book.
December 2020 | Volume 14 | Number 3 | e280
Hassapakis
untenured, he asked how my publications were coming
along, and reminded me to make publishing my priority.
He was a great mentor and source of support throughout
my career.
Joe was committed to seeing work through to
publication. Much of the contract work that Joe took
on did not require the publication of results, but Joe
was always adamant about collecting high-quality data
and making sure it was available to others through
peer-reviewed publications. His painstaking attention
to detail, recording all the morphological and natural
history information that he could, sometimes made field
work with him slow. (I remember becoming hypothermic
while sitting on the ground with him one February night at
Maple Flats measuring all the ambystomatid salamanders
that others were dipnetting!) He was dedicated to the
profession in other ways as well, serving as an officer
in local and national herpetological organizations, and
always being willing to help with education and outreach.
I know that Joe had plenty of struggles with mental
and physical health issues, many as a result of his military
service. He worked hard to overcome or manage these
struggles, and his willingness to acknowledge difficult
circumstances and discuss his struggles helped normalize
these challenges for others in the field. A driving force
for Joe was always his family. His deep love for all his
family members was so obvious from conversations with
a ~h
on A
-_
Fig. 8. Virginia Herpetological Society meeting, 1987.
Amphib. Reptile Conserv.
ee SES Re
>
vil
him. He was a staunch ally to family and friends alike.
It was an honor and a joy to have worked with Joe,
and I know that his contributions to herpetology and to
conservation will live on.
Kurt Buhimann
University of Georgia, Savannah River Ecology
Laboratory, Aiken, South Carolina, USA
Some personal remembrances of a great mentor and
friend, Joe Mitchell
I first heard the name, Dr. Joseph C. Mitchell, when I
began my literature search as a new MS graduate student
at Virginia Tech (VT, Blacksburg, Virginia), in the
Fall of 1983. I was going to conduct a survey of birds,
small mammals, amphibians, and reptiles in the newly
designated New River Gorge National River corridor in
West Virginia. I was just starting my search of the natural
history literature so I could understand the distributions
and state of knowledge of the herps I might encounter. I
had recently finished my B.S. in Environmental Studies
at Stockton State College in New Jersey (the state where
I grew up), thus I was new to Virginia. Given that I was
in the Fisheries and Wildlife Department at VT, it seemed
likely that I should have been able to be quickly pointed
in the right direction. However, in 1983, most wildlife
December 2020 | Volume 14 | Number 3 | e280
Joe Mitchell —An Unfinished Life
Fig. 9. Whit, Kurt, and Joe, Aiken, South Carolina, 1995.
departments, including VT’s which I loved being a part
of, had almost no emphasis on herps, being focused
primarily on game mammals and birds. However, one
day I picked up an issue of Virginia Wildlife (Vol. 35, No.
4, [April] 1974) and it included an article on the Snakes
of Virginia, with a fold-out color plate, written by Dr.
Mitchell. After reading the article, I realized that perhaps
this guy, who was associated with the University of
Richmond, might be able to help me to become familiar
with the herps of the Virginias. So, I wrote him a letter.
Soon after, I received a fat manila envelope from Joe
in the mail. It was filled with scientific reprints by him
and other biologists which were related to my search for
Virginia natural history knowledge.
Skipping forward a decade to the summer of 1985,
while doing fieldwork in the New River Gorge, I decided
that I should attend my first professional Herpetology
Conference, which was a joint SSAR/HL meeting held
at the University of South Florida, in Tampa. I drive
down from Blacksburg in my old Chevy truck. I recall
iy Aa
Fig. 10. Camping out in the old Shasta.
Amphib. Reptile Conserv.
viii
removing the tailgate so that I would get better gas
mileage, as I only had a few bucks for gas....
I met many herpetologists there for the first time, many
of whom have become lifelong colleagues and friends.
And I bumped into Joe for the first time. It was clear from
our first discussions that both of us were excited about
natural history, and in the fauna of Virginia in particular.
Before the end of that SSAR/HL meeting, Joe had invited
me to participate in his on-going Herp Survey project in
Virginia, which would lead to the eventual publication of
his Reptiles of Virginia (Mitchell 1994) book and many
papers.
Joe took an interest in me as a young exuberant
herpetologist in the making—and spent a great deal of
time over the next 35 years as a mentor, colleague, and
friend. Where I am going with this note is to provide a
personal remembrance. My intention here is to capture
memories and field trips, and to recognize Joe as the
fine mentor and friend that he was. In the year since
his passing, others have written tributes to Joe which
December 2020 | Volume 14 | Number 3 | e280
Hassapakis
thoroughly highlight his professional accomplishments,
and I cite those here for reference.
Several weeks after the 1985 Tampa meeting, Joe and
I met with fellow herpetologist Chris Pague, Carnegie
Museum scientists Ellen Censky and Jack McCoy,
and Dr. Richard Hoffman in the southwest corner of
Virginia to look for herps in the headwater streams of
the Tennessee River—including the Clinch, Holston,
and Powell Rivers, as well as a beautiful smaller stream
named Copper Creek. It was if I had been transported to
a different planet with the same basic types of animals,
but the species were all new. Here, I had my first hands-
on experiences with Hellbenders, Mudpuppies, Spiny
Softshells, Striped Musk Turtles, Cumberland Sliders,
Black Kingsnakes, and Zigzag Salamanders—all
within a 3-day period! Now, I soon realized there was a
downside to all this work with Joe. Joe was very mucha
student of museum series collections at the time, as were
our Carnegie colleagues, and I was schooled in the value
of series collections, but had a hard time handing over
my catch knowing it was going into formaldehyde.
One of those afternoons, while turning rocks for
Hellbenders in Copper Creek, I lifted a big flat rock,
waited a second for the water to clear, and then my senses
realized that I was looking at a beautiful greenish striped
Common Map Turtle—the first ’'d ever seen. My hand
shot down into the water and closed around its shell, my
right shoulder and the side of my face in the water. Joe
was nearby and asked, “Did you see something?” I nearly
hollered and lifted the little jewel to the surface, but then
just froze and lowered it back to the stream bottom and
stared down at it. “No, Joe, I thought I saw something,
but I lost it in the current,” I said. I just could not bring
that turtle up—my first of the species—knowing what its
fate would be. I think it was perhaps sometime in the
early 2000s—about 20 years later—when I confessed this
story to Joe ©. That was also long after Joe had stopped
Fig. 11. Building silt fences for Bog Turtles in New Jersey,
2003.
making series collections himself, and although both of
our pickup trucks always contained jugs of formalin;
they were used only for road kills that we refused to see
otherwise wasted.
After the southwest Virginia trip in summer 1985, I
don’t think a month passed between then and 1992 in
which I was not meeting Joe somewhere in the field in
Virginia to look for herps—Mt. Rogers in the Blue Ridge
to find Yonalossee and Shovelnose Salamanders, winter
Fig. 12. PARC Habitat Management Guidelines course eisuEht at Arnold Air Force Base, Tennessee, 2007. Joe in center in front of
tree. Photo by Mark Bailey.
Amphib. Reptile Conserv.
December 2020 | Volume 14 | Number 3 | e280
Joe Mitchell —An Unfinished Life
tax
‘at 4
Fig. 13. Accepting the Paul Moler Conservation Award, for the PARC Habitat Management Guidelines (left to right: Mark Bailey,
Kurt, Jeff Holmes, Paul Moler, and Joe).
visits to a pond along the New River to find breeding
Jefferson’s Salamanders, my introduction to the Virginia
Herpetological Society and its members, looking for
the Shenandoah Salamander on talus cliffs on a foggy
night in Shenandoah National Park, searching for the
elusive Chicken Turtles in Virginia Beach, or building
drift fences at Prince William Forest Park just south of
Washington, D.C. Joe gave me a set of maps for each
county in Virginia so that I could accurately plot the
locations of my herp finds, such as “3.2 miles South of
Floyd on Rd. 8.” To this day, you could drop me on any
little country road in Virginia, and I can quickly figure out
where I am. Joe not only taught me Virginia herps, but
I learned about Virginia natural history, physiographic
regions, and culture.
On a return trip to southwestern Virginia, in 1986 I
think, I recall asking Joe if he could pay for my gas or
mileage or something. Joe responded that the grant from
the Virginia Department of Game and Inland Fisheries
did not have that much, but he would pay for the food
on all the field trips. That sounded like a good deal to a
starving grad student. Subsequently on that same trip, I
got us thrown out of an all-you-can eat buffet restaurant,
and I think Joe might have regretted the work-for-food-
only idea after that. We joked about that incident for the
next 30 years.
I graduated from VT with my Master’s in Wildlife
Sciences in 1986 (with my thesis on River Cooters)
and then had a few short-term wildlife jobs in Virginia,
West Virginia, and New Jersey over the next year.
These jobs included hacking bald eagles, radio-tracking
snow-shoe hares, banding woodcock, and trapping wild
turkeys, several of which were arranged by my major
advisor at VT, Dr. Mike Vaughan. In early 1987 I had
just written a proposal to work on Rio Grande Cooters
in New Mexico with Charlie Painter, the New Mexico
Amphib. Reptile Conserv.
State Herpetologist, and Joe called me. He thought he
might get a grant from the US Forest Service to study
the distribution of Cow Knob Salamanders in the George
Washington National Forest—was I interested? It would
be a for-hire job. Although I was sorry to turn down the
project in New Mexico, the Cow Knob Salamander work
with Joe would determine the trajectory of my career.
Joe and Chris Pague, Bob Glasgow, David Young, and
I got to work building drift fences at high elevations in
the George Washington National Forest. I recall going up
there in April 1987 and promptly getting my truck stuck
in snow. OK, so the salamanders were not out yet. But on
12 May 1987, we found our first one. We surveyed for
salamanders for two years, and when Joe came up, we
would camp out in my little Shasta trailer. I think together,
Joe and I (with our academic backgrounds) learned how
to interact with land management agencies and our
survey work eventually resulted in the designation of the
Shenandoah Mountain Crest Special Biological Area on
the George Washington National Forest—a conservation
victory that I know Joe was rightfully proud of.
While heading up the Cow Knob Salamander work,
Joe included me on trips to the Blue Ridge Parkway to
work with him on identifying Bog Turtle habitats along
the parkway. We would meet at the sites, and find and
mark turtles with a notching system that continues today.
When we went to Seashore State Park in Virginia
Beach, Joe allowed me to have the newspaper story credit
for trapping the Chicken Turtles. It was Joe’s project,
but he let me have the spotlight and be interviewed for
our work. Joe was always happy to help promote others,
while he was often willing to remain in the background.
And that generosity is a unique quality.
Joe also sent me with his colleague, Richard Hoffman
(another great natural historian of Virginia), out to an
unusual series of sinkhole ponds where we found an
December 2020 | Volume 14 | Number 3 | e280
Hassapakis
Fig. 14. Tracey, John Byrd, and Joe at SEPARC, 2010.
isolated population of Tiger Salamanders.
In the winters of 1988-1989, I worked for Joe in his
sprawling steampipe distribution room in the bowels of
the Biology building at the University of Richmond. One
night on my way back to Richmond from visiting friends
in Blacksburg, a white-tailed deer and my 1972 Chevelle
had an encounter near the site of General Lee’s surrender
(during the US Civil War) in Appomattox. I loaded the
deer into the trunk and made frequent water stops because
of my leaking radiator, but I made it to Richmond. In
Joe’s basement lab, I proceeded to butcher the deer that
night. Joe arrived at 7 AM the next morning to find me
with a disemboweled deer all over his lab floor. Although
he did say some expletive like, WTF!, he then spent the
rest of the morning showing me how to properly butcher
a deer. We enjoyed many stews and roasts that winter at
Joe’s family home, and he helped me get a legal tag for
the deer from the Game Department.
My work with Joe, and the education he provided
about Virginia natural history, led me to successfully land
my first “real” job with The Nature Conservancy and the
Virginia Division of Natural Heritage in 1989. I know
Joe had some behind-the-scenes influence which resulted
in me obtaining that job, but it suited me perfectly. I
knew Virginia well because of Joe, and I was eager to
learn about other groups of animals too: like dragonflies,
freshwater mussels, moths, and cave biota.
While working for the Natural Heritage Program, Joe
and I continued to investigate the isolated, and rather
weird, population of Chicken Turtles in Virginia Beach. I
put radio trackers on the turtles and we learned that they
leave the ponds and spend the winter buried in forested
sand dunes. That work led me to contact Dr. Whit Gibbons
at University of Georgia’s Savannah River Ecology
Laboratory (SREL). Joe was always encouraging me
Amphib. Reptile Conserv.
xi
to continue my education and often pressed me about
when I might go back for my Ph.D. I greatly enjoyed
the Natural Heritage Program and believed strongly in
its mission, but was always fascinated by those Chicken
Turtles.
Joe started talking with Whit, and in 1992 Whit offered
me an assistantship at the University of Georgia and the
opportunity to study the Chicken Turtles and wetland
conservation on the Savannah River Site. I should note
here that Whit 1s another one of my career mentors and
friends, on par with Joe. So, I left Virginia, and moved to
near the Georgia/South Carolina border. However, about
a year after I had begun my Ph.D. work at Georgia, Joe
visited SREL. During a conversation among Whit, Joe,
and myself, Whit said to Joe: “the main reason I accepted
Kurt was so that you [Joe] would stop calling me and
bugging me about him.” Well, apparently, I clearly owed
my Ph.D. opportunity to Joe as well, and I hope he knew
that I really appreciated it.
I was busy through most of the 1990s at SREL. Joe
and I did not get together as often as we used to, although
he came to SREL several times and volunteered his
expertise training graduate students and technicians on
proper preservation techniques for road-killed snakes
and other herps. This was greatly appreciated and it was
purely voluntary on Joe’s part, but I’m sure that some
of our other SREL colleagues reading this here will
recall our “herp pickling parties.” However, Joe and I
did manage a road trip together in 1993 to attend a turtle
meeting held in Purchase, New York. Having grown-up
in New Jersey, I wanted to show Joe some ecological
highlights of the state. Joe had never been there and joked
that, as a Virginia native, he really was not comfortable
north of the Mason-Dixon line. We detoured through the
Jersey Pine Barrens, stopping to swim/soak in the tannin-
December 2020 | Volume 14 | Number 3 | e280
Joe Mitchell —An Unfinished Life
stained Batsto River, and we found some Red-bellied
Turtles and looked at Pine Snake habitat—a species that
was only legendary in Virginia, as neither of us had ever
seen one there.
I should note here that Joe did not know how to swim.
So, I spent some time teaching him—having spent my high
school summers teaching swimming and lifeguarding.
I think my efforts helped him gain confidence in the
water—at least he knew that the lifeyacket was going to
keep him afloat, when he was wearing it.
In 1999, a meeting held at the Atlanta Airport
established the Partners in Amphibian and Reptile
Conservation (PARC). Joe and I were there. Those who
are familiar with the Habitat Management Guidelines
(HMG) series also recognize that Joe was pivotal
to the brainstorming that went into the creation of
those publications. Joe co-authored the Southeast and
Northeast HMGs, as we call them, and helped to co-edit
the Northwest and Southwest equivalents. Joe considered
the PARC HMGs to be one of the most important
herpetological conservation contributions of his career,
and he said so in his Smithsonian autobiography.
In 2000, I began a position with Conservation
International (CI) and my wife, Tracey Tuberville, and
I moved back to Virginia. Joe came to our house with
a new mailbox and post as a house-warming present.
(Although we no longer live in Virginia that mailbox and
post are now at our current house in South Carolina). The
position with CI required that I understand the politics
of international conservation. And while I struggled
some, Joe was there to offer support. During a freak
opportunity of obtaining 7,000 confiscated Asian turtles
for conservation, a now historic assemblage of people
volunteered a week of their time over Christmas 2001 to
Amphib. Reptile Conserv.
xii
the New Year in 2002 to process, measure, and provide
supportive care to these turtles outside of Miami, Florida.
Joe was there to help, after driving down from Virginia.
He helped to coordinate the measuring and marking
of most of those animals. That event has been widely
recognized as a pivotal moment in the formation of the
Turtle Survival Alliance (TSA).
Joe and I have both done some _herpetological
consulting work. He operated Mitchell Ecological
Service, LLC and he helped me establish Buhlmann
Ecological Research and Consulting, LLC. I had several
projects on National Wildlife Refuges which provided
opportunities to manage rare turtles and their habitats. I
asked Joe to help me with those, and together we traveled
back up to New Jersey to the Wallkill Refuge—and
brought my old camper from the Cow Knob Salamander
days. Joe helped me build silt fences to trap bog turtles
and we spent time surveying the herpetofauna there for
the Refuge staff. And I finally got to pay Joe for his time.
In a surprise twist, I also had the opportunity to work
on the Bosque del Apache Refuge in New Mexico. Joe,
Whit, Tracey, Justin Congdon, and I met Charlie Painter
there, and we finally got to play with New Mexico turtles
and all together as a group. It was great fun.
Joe moved to Florida in the early 2000s, and with his
new wife, Susan Walls, they set up home near Gainesville.
I think Joe struggled some with the relocation to Florida
after a lifetime career in Virginia, and getting into
herpetological consulting there was a bit hard for him.
Joe had a heart attack in late 2009. I went down to
Florida from South Carolina to help get him home from
the hospital after bypass surgery and, along with Susan,
to help make his house easily traversable during his
recovery. As one would expect, Joe had amassed a large
December 2020 | Volume 14 | Number 3 | e280
Hassapakis
library of books and teetering files, along with a knife
collection, in his home office. So, it was a hazardous
place for a guy shuffling around after heart surgery, but
Susan took good care of him and he recovered fully.
Several years later, Joe was enjoying working on the
Santa Fe River, near Gainesville, helping colleagues
Jerry Johnston and others with turtle surveys. I attended
one snorkeling trip in 2017 and was looking forward to
another trip when we lost Joe.
I’m actually not sure how to end this tribute. I know
I can keep slipping into other adventures, although I’ve
probably over-described enough of them and _ hinted
at others. If it is not clear by now, it should be—Joe
was a great friend, an excellent mentor, and selflessly
volunteered his time and resources to help young and
upcoming herpetologists, and he strove to turn them into
conservation biologists.
In working on this tribute, I have been amazed by
how many adventures I had with Joe—and I enjoyed
every one of them. I appreciate the time he spent with
me, and I’m sure there are others who feel the same way.
Herpetology and herpetological conservation have lost a
real champion with Joe’s passing. And I hope that the
investments he made in me and others help us to be able
to pick up and carry the torch from where he left it...
Submitted with love and respect,
Kurt Buhlmann
Final note: I chose to make this tribute personal, and so
I did not detail Joe’s professional accomplishments and
contributions. However, the following tributes published
in the last year have addressed his global contributions
to the herpetofaunal and biodiversity conservation
communities.
Dodd CK Jr. 2019. Joseph Calvin Mitchell (1948-2019).
natural historian, turtle enthusiast, Marine, Virginian.
Herpetological Review 50(4): 889-893.
Hilton EJ, Bauer AM, Buhlmann KA, Dodd CK Jr. 2020.
Joseph C. Mitchell (1948-2019): herpetologist and
natural historian of the Old Dominion. Copeia 108(1):
188-194.
Mitchell JC. 2019. Biographical Sketch and Bibliography
of Joseph C. Mitchell. Smithsonian Herpetological
Information Service, No. 155. Smithsonian Institution,
Washington, DC, USA. 39 p.
Roble SM. 2019. Joseph C. Mitchell (1948-2019).
Banisteria: A Journal Devoted to the Natural History
of Virginia 52: 52-73.
Amphib. Reptile Conserv.
xiii
UNITED S/ATES ('
F
|
a
Gy
as ED se fe ' , \ | SS
Fig. 16. Joe with a Suwannee Cooter, Ichnetucknee Springs,
Florida, 2017. Photo by Jerry Johnston.
Walls SC, Buhlmann KA, Nickerson MA. 2020.
Dedication: Joseph C. Mitchell. 16 August 1948-2
July 2019. Pp. vii—xi In: Snakes of Arizona. Editors,
Holycross AT, Mitchell JC. ECO Publishing, Rodeo,
New Mexico, USA. 837 p.
Some sources of Joe’s older publications:
¢ Virginia Wildlife. Joe published many popular
articles in this magazine, which can be accessed
at the Library of Virginia website (https://www.
Iva. virginia. gov/).
¢ Banisteria. Joe took great pride in writing and
publishing about the natural history of Virginia,
and a trove of information about Virginia natural
history, much of it written or edited by Joe, can be
accessed at: https://virginianaturalhistorysociety.
com/banisteria/banisteria.htm.
¢ Catesbeiana. Joe was active in the Virginia
Herpetological Society and published in its journal,
Catesbeiana (http://virginiaherpetologicalsociety
.com/catesbeiana).
December 2020 | Volume 14 | Number 3 | e280