‘Published inthe UnitedStates of America
ee 2021 * VOLUME 19 *-NUMBER 2
ALBEAN & REPTILE
SERVATION
- a
a. - ty = F *, qi i wy F
=, *
oo F &
= # ‘ i x = c
“5 ai 7 ; _ om 4
A] & =
= | n fs
i uw = gle 5 it = ‘
i ' RP &,
a - 7
rl =
3 * °
i ‘ a F ‘
a oe F %
: Soi i. c
’ i = ee r = =
is ‘| i F f i *
vy 7, Pa a all i = i. #
a FoF % J re I -
‘ * - - : ee : i
a Z ‘Pi i
P ' -
f f i
eT
eo L
a oh ail 4 ix? _ F- ss =
“ ; nat Se, ee .
. - ' “ ¢ 7 "/ ’ 4 ‘ im, a. ©
am i ; a p a Es : he
Z Se a rae oy Me BS Te ae ee
a “ 7] 2 7 i . ao 1 th = -
rf ? ‘ —— ee i ae Sed *
Ea Pe amphibian-reptile-conservation.org
foe” ASSN: 4083-446 X46" | Se &_ elSSN2152549153
i —_
am
ae Vy * oy,
tk Sy ot 4
Re A
oe
a
= , ad
7 eee Us x
ne,
ay Py eS A nad
Front cover: This 2020 image of a Mexican Horned Pit Viper (Ophryacus undulatus [Jan, 1859]) was taken in the photographer’s favorite
locale in the biodiversity paradise of Oaxaca, Santa Catarina Lachatao, located in the Sierra Madre de Oaxaca (Sierra de Juarez), Mexico. The
residents of this Zapotecan indigenous village use a figure of this snake as a component of their cultural identity; their oral tradition says this
species is a guardian of the sacred places within their territory. Each year, the people of Santa Catarina Lachatao celebrate the Festival of Tierra
Caliente, as part of a pacifist resistance movement struggling against the mining concessions operating on their lands. This exquisite reptile is in
the high vulnerability category with an EVS of 15, and its IUCN status is Vulnerable. It belongs to an endemic Mexican genus in the mountains
of southern Mexico revised in 2015 by Griinwald, Jones, Franz-Chavez, and Ahumada-Carrillo, in Mesoamerican Herpetology 2(4). 387-416.
Photo by Eli Garcia-Padilla.
Official journal website:
amphibian-reptile-conservation.org
Amphibian & Reptile Conservation
15(2) [General Section]: 1-9 (e277).
os
Ry
Sa KS
ptile-cons®
Abundance and microhabitat use of the Endangered toad
Rhinella yanachaga (Anura: Bufonidae) in the cloud forest of
Yanachaga Chemillen National Park, Peru
12Shirley Huaman-Trucios, *Vladimir Camel, ‘Edith Orellana Mendoza, *Marcela V. Pyles,
and **Rudolf von May
‘Facultad de Ciencias Forestales y del Ambiente, Universidad Nacional del Centro del Peru, Huancayo, PERU ?Servicio Nacional de Areas
Naturales Protegidas por el Estado - SERNANP, Lima, PERU 2Universidad Cientifica del Sur, Lima, PERU ‘Biology Institute, Sector of Ecology
and Conservation, Federal University of Lavras (UFLA), Minais Gerais, BRAZIL °Biology Program, California State University Channel Islands,
Camarillo, California, USA
Abstract.—The arboreal toad Rhinella yanachaga is an endemic species of the cloud forest of central Peru,
and is categorized as Endangered according to the International Union for Conservation of Nature. The core
habitat of this species is within the Yanachaga-Chemillen National Park, but the status of its populations
remains unknown. Obtaining quantitative data based on field surveys is essential for conserving this species
in the park. In this study, the abundance, size, and microhabitat use of R. yanachaga were examined across
an elevational gradient. Individuals with snout-to-vent length (SVL) 2 20 mm were sampled in four transects
between 2,400 and 2,800 m, in the wet and dry seasons. Using night surveys, individual data were recorded
on sex, SVL, microhabitat, geographic location, relative humidity, and temperature. The abundance of females
and males varied among transects in dry and wet sampling periods. We recorded more individuals in the dry
season and observed that frogs distributed at higher elevations tend to have a larger body size than those at
lower elevations. Most individuals appear to prefer microhabitats composed of leaves and ferns. Additionally,
we observed sexual dimorphism in size, as females were larger than males. These findings contribute to
amphibian conservation programs in Peru.
Keywords. Amphibian, population status, elevational gradient, endemic species, habitat, South America.
Resumen.—El sapo arboreo Rhinella yanachaga es una especie endeémica del bosque nuboso del centro del
Peru y esta clasificada como En Peligro segun la Union Internacional para la Conservacion de la Naturaleza.
El habitat principal de esta especie se encuentra dentro del Parque Nacional Yanachaga-Chemillen, pero el
estado de sus poblaciones es desconocido. La recopilacion de datos cuantitativos de estas poblaciones es
esencial para conservar la especie en el parque. En este estudio, se examino la abundancia, tamano y el uso
de microhabitat de R. yanachaga en un gradiente de elevacion. Se muestreo individuos con longitud de hocico-
cloaca (LHC) 2 20 mm en cuatro transectos distribuidos entre 2,400 y 2,800 msnm, en la estacion humeda
y seca. Mediante monitoreos nocturnos, registramos datos individuales sobre sexo, LHC, microhabitat,
ubicacion geografica, humedad relativa y temperatura. Observamos que la abundancia de hembras y machos
vario entre los cuatro transectos en ambos periodos de muestreo. Registramos mas individuos a mayor altitud
y en la estacion seca, ademas observamos que los individuos distribuidos a mayor elevacion tienden a ser
mas grandes que individuos distribuidos a de elevaciones mas bajas. La mayoria de los individuos parecen
preferir el microhabitat compuesto de hojas y helechos. Ademas, observamos dimorfismo sexual en tamano,
en donde las hembras fueron mas grandes que los machos. Estos hallazgos contribuyen a los programas de
conservacion de anfibios en Peru.
Palabras clave. Anfibio, estado poblacional, bosque de neblina, gradiente de elevacién, especie endémica, habitat,
América del Sur.
Citation: Huaman-Trucios S, Camel V, Orellana Mendoza E, Pyles MV, von May R. 2021. Abundance and microhabitat use of the Endangered toad
Rhinella yanachaga (Anura: Bufonidae) in the cloud forest of Yanachaga-Chemillén National Park, Peru. Amphibian & Reptile Conservation 15(2)
[General Section]: 1-9 (e277).
Copyright: © 2021 Huaman-Trucios et al. This is an open access article distributed under the terms of the Creative Commons Attribution License
[Attribution 4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction
in any medium, provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced,
are as follows: official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 6 February 2021; Published: 22 July 2021
Correspondence. *[email protected] (RVM), [email protected] (SHT), [email protected] (VC), [email protected]
(EOM), [email protected] (MVP)
Amphib. Reptile Conserv. 1 July 2021 | Volume 15 | Number 2 | e277
Rhinella yanachaga in Peru
Introduction
The cloud forests of Yanachaga-Chemillén National
Park (YCNP), located in the eastern region of the central
Andes of Peru, are considered a hotspot of biodiversity
(Young 2007; Myers et al. 2000). The park is the core
of the larger Oxapampa-Ashaninka-Yanesha Biosphere
Reserve, which aims to maintain cultural and biological
diversity, ecosystem function, and sustainable use of
natural resources in the region (Griesinger 2019). The
YCNP and the buffer zone surrounding the park protect
the habitat of over 40 species of amphibians (Chavez et
al. 2012; Angulo et al. 2016). Most of these species are
known from a small geographic area and are vulnerable
to habitat loss and disease (Aguilar et al. 2010; Chavez
et al. 2012; Jarvis et al. 2015). Conservation of key
areas within the YCNP and its buffer zone is a priority,
because they contain the only known populations of these
endemic amphibians (Lehr and von May 2004; Boano et
al. 2008; Angulo et al. 2019). Obtaining quantitative data
based on field surveys is essential for the monitoring and
protection of the species living in the YCNP.
One of these endemic species is Rhinella yanachaga
Lehr, Pramuk, Hedges, and Cordova, 2007, an arboreal
toad (Bufonidae) distributed from 1,814 to 2,900 m asl
in the cloud forest of YCNP (Lehr et al. 2012). Rhinella
yanachaga is a medium-sized toad with nocturnal habits,
reaching a maximum snout-to-vent length (SVL) of 45.7
mm (Lehr etal. 2007). The species is currently categorized
as Endangered according to the International Union for
Conservation of Nature (IUCN) Red List of Threatened
Species (IUCN 2018), and is currently known from only
two localities—one inside the YCNP and one in the
buffer zone (outside) of the YCNP (Chavez et al. 2012).
75°36'W 75°24'W
Md ri {
Atlantic
Ocean
10°36'S
10°48'S
Pacific
Ocean
75°48'W 75°24'W
Amphib. Reptile Conserv.
2
Surveys of threatened amphibians such as R. yanachaga
are a priority for the park’s biodiversity monitoring
program, and population status assessments conducted
every 10 years are a priority for global assessments (The
Rules of Procedure for IUCN Red List Assessments
2017-2020; IUCN 2016). Therefore, it is necessary to
have data on the abundance and microhabitat use of this
species.
Here, we present data on the abundance and
microhabitat use of R. yanachaga across an elevational
gradient ina cloud forest in the YCNP. Additionally, given
that seasonality may affect the activity and abundance of
a species, we compared the relative abundance and size of
R. yanachaga between the wet and dry seasons along the
elevational gradient. Whether the number of individuals
and size of R. yanachaga vary across elevation, and
whether seasonality in temperature affects the habitat use
of this species were also assessed. This work provides
data that can be used to further understand the effects of
environmental variables on the distribution of threatened
amphibian populations in the Tropical Andes (Larsen et
al. 2012).
Materials and Methods
Study Area
This study was carried out in the cloud forest sector of
San Alberto within the Yanachaga-Chemillén National
Park, Oxapampa Province, Pasco Department, Peru (Fig.
1). The study area is within the tropical montane forest
ecoregion, locally known as Selva Alta as defined by
Brack (1986). Additionally, the area includes three life
zones as defined by the Holdridge system (ONERN 1976
75°12'W 75°0'W
Legend
Protected Natural Areas
Elevation (m)
ME < 2.500
MO 2,500- 3,500
(7) 3,500 - 4,500
4,500 - 5,500
5,500 - 6,500
75°O'W
75°12'W
Fig. 1. (A) Map of the study area. The white circle indicates the location of the study site (San Alberto) within Yanachaga-Chemillén
National Park, Oxapampa, Pasco; (B) lateral view, (C) ventral view, and (D) dorsal view of Rhinella yanachaga in life. Map by
Vladimir Camel (A), photos by Shirley Huaman-Trucios (B—D).
July 2021 | Volume 15 | Number 2 | e277
Huaman-Trucios et al.
[ONERN = Oficina Nacional de Evaluacion de Recursos
Naturales]). Very Humid Low Montane Tropical Forest,
Low Montane Tropical Rain Forest, and Low Montane
Tropical Humid Forest.
In the study area, in the dry season the level of humidity
is 89.1% + 5.16 and the average temperature 1s 11.7 °C
+1.55, while the wet season has lower humidity levels
(80.3% + 4.57) and a higher average temperature (14.2 °C
+ 1.87).
Data Collection
Four linear transects of 1,550 m x 2 m (length < width)
were established. Each transect was located at one of
the following elevational bands (in m): 2,400—2,500,
2,500-2,600, 2,600—2,700, and 2,700—2,800. Data were
collected using visual encounter surveys at night (1900
to 0000 h) during both the wet season (January—March)
and the dry season (June—July) in 2018. Each transect
was surveyed three times per season. Standard biosafety
protocols were followed to avoid the introduction and
spread of pathogens (Angulo et al. 2006). Protocols
included the disinfection of gloves with 70% ethyl
alcohol after measuring the morphological characteristics
of each individual. Additionally, the field equipment,
including boots, was disinfected in a solution of 4%
sodium hypochlorite (4 mL) diluted in 1 L of water.
Likewise, field instruments, such as the GPS, vernier,
and flashlights, were disinfected with 70% ethyl alcohol.
Three observers participated in each night survey,
and captured the individuals of R. yanachaga observed
in each transect. For each individual of R. yanachaga =
20 mm SVL, the sex, SVL, and elevation were recorded
following the methodology proposed by Lips and Reaser
(1999). The sex of each individual was determined by
examining external characters (Lehr et al. 2007): males
have hypertrophied forearms and females have slim
forearms; the cloaca in males is more protuberant and
ventrally oriented than in females. The following data
were recorded at each capture point: transect location,
coordinates, and microhabitat type (leaves, bromeliads,
ferns, orchids, or moss).
With regards to forest microhabitat categories, the
types considered were arboreal, shrub, and herbaceous
vegetation. The main groups of epiphytes were recorded,
including orchids and bromeliads, as well as ferns and
moss. The orchids evaluated included Epidendrum
sp., and epiphytic bromeliads included Guzmania
jaramilloi, Guzmania melinonis, Aechmea zebrina, and
Tillandsia sp. Ferns included Elaphoglossum sp. and
Campyloneurum sp., and the moss microhabitat included
Sphagnum magellanicum.
Data Analysis
First, the frequency distribution of individuals (males
and females) was visually assessed according to four
Amphib. Reptile Conserv.
altitudinal classes (2,400—2,500, 2,500—2,600, 2,600-
2,700, and 2,700—2,800 m). Subsequently, Generalized
Additive Models (GAM) were used to examine the
relationship between abundance and elevation. The
numbers of male and female individuals found in the
two seasons (dry and wet) were grouped. Subsequently,
Generalized Linear Mixed Models (GLMM) were used to
examine how size varies as a function of four explanatory
variables (microhabitat, elevation, sex, and season)
and three interaction effects (elevation-microhabitat,
microhabitat-sex, and sex-season). Given the possible
lack of independence between the individuals sampled,
the transects and the sampling time were considered as
random factors. The variance homogeneity was verified
by means of residual graphs. Differences in size with
respect to seasons, sex, and microhabitat were accessed
by Tukey’s post hoc tests. A Gamma distribution function
with log link was used to fit the model of size. The effects
and significance of each variable on R. yanachaga size
were accessed from a multi-model inference approach
based on Akaike’s Information Criterion with a
correction for small sample size (AICc) (Burnham and
Anderson 2002). Competing models with delta AICc < 2
were used in conditional model averaging, and averaged
parameter estimates were presented as the final result of
the modeling.
Results
During the study, 226 individuals of R. yanachaga were
recorded, including 103 individuals found in the wet
season and 123 individuals in the dry season. The highest
abundance in the wet season was recorded in the elevation
range of 2,700 to 2,800 m, while the highest abundance
in the dry season was recorded at elevations of 2,600 to
2,700 m (Fig. 2). In both seasons, the lowest abundance
of R. yanachaga was recorded at lower elevations (Fig.
2C). Overall, more males (171) than females (54) were
found during this study (Fig. 2). Additionally, larger
individuals (>32 mm) were less frequent than small
and mid-sized individuals. Most male individuals had
recorded SVL ranging between 24 and 28 mm, whereas
females presented a higher frequency within the range of
28 to 32 mm (Fig. 3).
Individuals of R. yanachaga were found to have
a higher preference for ferns and leaves of shrubs
compared to bromeliads (Table 1). Both females and
males were found to use similar microhabitats, and there
were no significant differences in the abundance between
dry and wet periods (Appendix 2). The abundance
of individuals of both sexes did vary as a function of
elevation. Likewise, the regression analysis showed that
elevation has a positive effect on the size of R. yanachaga
individuals (Table 2), particularly when considering sex
as a determining factor (Table 2). The females tended to
be larger at higher elevations (r? = 0.34, p = 0.01), but
male body size was not correlated with elevation (r? =
July 2021 | Volume 15 | Number 2 | e277
Rhinella yanachaga in Peru
Dry season
A) Mi Female B) i Female
Hi Male @ Male
o 75 55.3% o 75
oO o
s s
3 3
2 2
os os
= £
= =
is) te)
= i
i) @®
2 2
£ £
= =
z z
2,400-2,500 2,500-2,600 2,600-2,700 2,700-2,800
Elevation classes (m asl)
Wet season
2)
a
Oo
.
o
63.1% @ r2 = 0.40; P= 0.002
w
So
Number of individuals
s s
o
2,400-2,500 2,500-2,600 2600-2700 2,700-2,800 2,400 2,500 2,600 2,700 2,800
Elevation classes (m asl)
Elevation (m asl)
Fig. 2. Number of Rhinella yanachaga individuals per transect, Tl = 2,800-—2,700 m, T2 = 2,700—2,600 m, T3 = 2,600—2,500 m,
and T4 = 2,500-2,400 m, according to the elevation gradient for both sexes, in (A) dry season and (B) wet season. (C) Correlation
between the abundance of Rhinella yanachaga and elevation for both sexes and seasons. The grey band indicates the 95% confidence
limits.
0.003, p = 0.41) (Fig. 4).
Moderate variation in body size of R. yanachaga was
observed between seasons (Fig. 5A—B). Overall, females
(= 31.31 mm + 0.82) tend to be larger than males (=
26.22 mm + 0.50, Fig. 5C). Lastly, average body size of
R. yanachaga varied among microhabitats; individuals
found on bromeliads were larger than those on leaves or
ferns (Fig. 5D).
Discussion
The results support our prediction that relative abundance
and microhabitat use of Rhinella yanachaga vary across
an elevational gradient in the cloud forest of central
Peru. Given that this ecosystem is characterized by high
humidity, provided by fog and rainfall throughout the
year, it supports unique habitats and microhabitats used
by endemic amphibian species (Duellman and Lehr
2009). However, to date, the ecological drivers affecting
the distribution of the genus Rhinella have remained
unclear.
=
ao
o
~l
a
Number of individuals
N oa
wn o
20-24
24-28 28-32 32-36 36-40
Length classes (mm)
Sex HJ Female J male
40-44 44-48
Fig. 3. Numbers of individuals according to sex and length
(SVL) ranges of Rhinella yanachaga in four transects, Tl =
2,800—2,700 m, T2 = 2,700—2,600 m, T3 = 2,600-—2,500 m, and
T4 = 2,500—2,400 m, according to the elevation gradient in the
wet and dry seasons.
Amphib. Reptile Conserv.
The results suggest that relative abundance of R.
yanachaga does not vary across seasons. Several studies
have shown that anurans are more abundant during
the wet season, as higher precipitation favors their
development and reproduction (Arroyo et al. 2003;
Ceron et al. 2020; Linause et al. 2020; Ortega et al.
2011; Narvaes et al. 2009; Zaracho and Lavilla 2015).
For example, in Venezuela, during the high precipitation
season, Hyalinobatrachium duranti showed increased
abundance in a cloud forest (Villa et al. 2019). However,
we found no significant differences between seasons.
This probably reflects the constant presence of mist and
cloudiness, which results in reduced solar radiation,
mesic temperatures, and increased relative humidity
variables that favor amphibian activity throughout the
year (Segev et al. 2012). Similar patterns have been
observed in terrestrial breeding frogs in the genus
Pristimantis (P. miyatai, P. douglasi, and P. merostictus)
in another Andean cloud forest (Arroyo et al. 2003).
45| @ r?=0.34; P=0.01
@ r2= 0.003; P= 0.41 e
Size of R. yanachaga(mm)
2,600 2,650
Elevation (m asl)
2,700 2,750
Sex @Female @ Male
Fig. 4. Correlations between the elevation and size of Rhinella
yanachaga according to sex. The model presents correlation
factors of r?= 0.34; p = 0.01 for females and r? = 0.003; p =
0.41 for males. The colors indicate sex (blue for males and red
for females) and the shaded areas indicate the 95% confidence
limits.
July 2021 | Volume 15 | Number 2 | e277
Huaman-Trucios et al.
Table 1. Microhabitat use by Rhinella yanachaga in the cloud
forest of Yanachaga-Chemillén National Park, Peru.
Number of Numberof Number of
Microhabitat — individuals females males
Leaf (shrub) 110 24 86
Fern 96 22 74
Bromeliad 16 5 11
The different proportions of female and male
individuals across the elevational gradient, particularly
those observed between 2,600 and 2,800 m at both
times of the year, could be related to the availability
of reproductive sites. However, further work (e.g.,
mark-recapture study) is needed to determine whether
R. yanachaga exhibits site fidelity (to reproductive or
retreat sites) at these elevations.
Our results agree with the study of Lehr et al. (2007),
and provide evidence that R. yanachaga exhibits sexual
dimorphism in body size, with females being larger than
males. Sexual dimorphism in body size has phenotypic
importance in the reproductive periods, particularly
because bigger females tend to produce larger eggs or
increased numbers of eggs, and because they may lay eggs
more than once during a reproductive season (Rodrigues
da Silva and Feres 2010). Our data also suggest that the
frequency and size of R. yanachaga individuals increases
at higher elevations. A similar trend has been observed in
terrestrial-breeding frogs in the tropical Andes (von May
et al. 2018; Santa-Cruz et al. 2019). This pattern supports
the prediction of Bergmann’s rule, in which organisms
tend to be larger in colder environments than in warmer
environments (Mayr 1956). The elevation gradient is
one of the most important factors for life that is globally
associated with air temperature, and low temperatures
have an effect on species traits (Korner 2007).
Some plants, such as bromeliads, were found to
support larger individuals of R. yanachaga, on average,
than other plant structures (e.g., leaves or ferns). Climbing
vegetation up to 1.5 m above ground is common in many
anurans (Duellman 1978; Toft and Duellman 1979;
Chavez et al. 2012). Individuals using different plant
structures often remain inactive during the day and
Table 2. Statistical data on the relationship between elevation
and size of Rhinella yanachaga according to GLMM.
Asterisks indicate the level of significance: “*” p < 0.05; “**”
p<0.01; and “***” p< 0.001.
Interaction Estimate Std.error zvalue Pr (> |z|)
(Intercept) 2.652 0.846 3.133 0.001 wee
Sex 0.232 0.745 0.312 0.754
Elevation 0.001 0.0002 2.016 0.043
Elevation = 4991 ~—-0,000009 66.296 ~=-<0,.001.—s*##
Sex
exhibit reproductive activity at night, and this behavior
is similar to that of R. yanachaga with the exception
that male individuals were found on herbaceous or
shrubby vegetation. Additionally, individuals found on
bromeliads were larger than individuals found on other
plants, in both seasons (Table 3, Fig. 5D). Bromeliads
provide a suitable microhabitat for the survival and
breeding of amphibians with predominantly terrestrial
habits (Garcia et al. 2005; Jiménez-Robles et al. 2017).
In summary, to our knowledge, this 1s the first study
reporting the population status and microhabitat use of
R. yanachaga at different elevations in the YCNP. We
found that the relative abundance and body size of this
Species vary across both elevations and seasons. We
confirm that R. yanachaga presents sexual dimorphism
in size, with females larger than males. Our findings
show that the abundance and size of R. yvanachaga
tend to increase at higher elevations. The increased
frequency of both females and males at 2,600—2,800 m
could be attributed to the terrestrial reproduction mode
of R. yanachaga. The abundance of amphibians changes
along the elevation gradient as influenced by the thermal
tolerance of ectothermic species in narrow altitudinal
ranges (Bernal and Lynch 2008; Jiménez-Robles et al.
2017). In addition, we found that R. yanachaga more
frequently uses microhabitats such as leaves and ferns,
but the largest individuals settle in bromeliads. Our data
also indicate that 2,400—2,500 m represents the lower
elevational range limit of R. yanachaga. Finally, given
that R. yanachaga exhibits limited geographic and
elevational distributions, this species could be used in
Table 3. Comparisons of the sizes of individuals of Rhinella yanachaga. Asterisks represent significant differences in the parameters
with the Tukey test after GLMM: “*” p < 0.05; “**” p < 0.01; and “***” p <0.001.
Variable Estimate Std. error t value Pr (> |z|)
Wet season 31.9 2/3 47.86 < 0.001 sa
Females
Dry season 28.8 2.06 -3.405 0.001 sh
Wet season 26 0.585 144.75 < 0.001 cee
Males
Dry season Dhid 0.613 1723 0.084
g Female 31.309 0.824 130.798 < 0.001 ne,
ex.
Male 26.225 0.502 -6.931 < 0.001 nee
Bromeliad 31.319 1.442 74.784 < 0.001 al
Microhabitat Fern 27.145 0.618 -3.013 0.003 ai
Leaf 27.187 0.615 -3.071 0.002 a
Amphib. Reptile Conserv. 5 July 2021 | Volume 15 | Number 2 | e277
Rhinella yanachaga in Peru
>
ord
a
oa
Average size (mm)
= = NO NO wo
i=] oa o ol So
a
Wet season
Dry season
Female sex
C) 35
a
Average size (mm)
= pas No ho
o oi —] a
o
Female Male
Sex
Average size (mm)
a
O
=—
w
a
Average size (mm)
Ww
NO ow
oi oO
No
=]
=
Oo
o
Dry season Wet season
Male sex
a
wo
Oo
NO
a
No
i=)
=k
ai
—_
o
o
Bromeliad Fern Leaf
Microhabitats
Fig. 5. Comparisons of the sizes of Rhinella yanachaga individuals. (A) Differences in size of females in dry and wet seasons. (B)
Differences in size of males in dry and wet seasons. (C) Differences in size between males and females. (D) Differences in the size
of individuals with respect to microhabitats. The different letters indicate significant differences at p < 0.05 according to the Tukey
test after GLMM. Error bars represent standard errors.
further studies on local adaptation in relation to thermal
physiological limits.
Acknowledgements.—We are grateful to the Servicio
Nacional de Areas Naturales Protegidas (SERNANP)
and the Direction of Yanachaga Chemillén National
Park, especially to Salomé Antezano Angoma and
Rolando Becerra, for providing logistical support and
access to facilities used in this study. We thank park
rangers Elvis Camavilca Rueda, Humberto Cristobal
Espinoza, Alejandro Westreicher Sebastian, and Erick
Medina for providing access to the study area and for
providing support in the field. We thank Dayanne Vilela
Navincopa and Milthon Ninahuanca Chupayo for
providing support during field research and for sharing
their passion for conservation. We also thank Edgar
Lehr, Jifi Moravec, Nelson Rufino de Albuquerque, and
one anonymous reviewer for providing constructive and
helpful comments on the manuscript.
Amphib. Reptile Conserv.
Literature Cited
Aguilar C, Ramirez C, Rivera D, Siu-Ting K, Suarez J,
Torres C. 2010. Anfibios andinos del Perti fuera de
Areas Naturales Protegidas: amenazas y estado de
conservacion. Revista Peruana de Biologia 17: 5-28.
Angulo A, Rueda-Almonacid J, Rodriguez-Mahecha J,
La Marca E. 2006. Técnicas de Inventario y Monitoreo
para los Anfibios de la Regibn. Serie Manuales de
Campo N° 2. Conservacion Internacional, Bogota,
Colombia. 299 p.
Angulo A, von May R, Icochea J. 2019. A reassessment
of the extinction risk of the Critically Endangered
Oxapampa Poison Frog, Ameerega _ planipaleae
(Dendrobatidae). Oryx 53(3): 557-560.
Arroyo S, Jerez A, Ramirez Pinilla M. 2003. Anuros
de un Bosque de Niebla de la Cordillera Oriental de
Colombia. Zoologia 25(1): 153-167.
Bernal M, Lynch JD. 2008. Review and analysis of
July 2021 | Volume 15 | Number 2 | e277
Huaman-Trucios et al.
altitudinal distribution of the Andean anurans in
Colombia. Zootaxa 1826: 1-25.
Berven K, Thaddeus A. 1990. Dispersal in the Wood Frog
(Rana sylvatica): implications for genetic population
structure. Evolution 44(8): 2,047—2,056.
Boano G, Mazzotti S, Sindicato R. 2008. A new
peculiar frog species of the genus Pristimantis from
Yanachaga-Chemillén National Park, Peru. Zootaxa
1674: 51-57.
Brack A. 1986. Gran Geografia del Pern: Naturaleza y
Hombre. (Volume 2). Editorial Manfer-Mejia Baca,
Bercelona, Spain and Lima, Peru. 319 p.
Burnham KP, Anderson DR. 2002. Model Selection
and Multimodel Inference: a Practical Information-
Theoretic Approach. Springer, New York, New York,
USA. 488 p.
Ceron K, Santana DJ, Lucas EM, Zocche JJ, Provete
DB. 2020. Climatic variables influence the temporal
dynamics of an anuran metacommunity in a
nonstationary way. Ecology and Evolution 10(11):
4,630-4,639.
Chavez G, Cosmopolis CH, Lujan L. 2012. Annotated
checklist and ecological notes of anurans from the
southern region of Yanachaga-Chemillen National
Park, Central Andes of Peru. Herpetropicos 81(1—2):
23-38.
Duellman W. 1978. The biology of an equatorial
herpetofauna in Amazonian Ecuador. Miscellaneous
Publications of the University of Kansas 65: 1-352.
Duellman W, Lehr E. 2009. Terrestrial Breeding Frogs
(Strabomantidae) in Peru. Nature und Tier-Verlag
GmbH, Munster, Germany. 386 p.
Garcia RJ, Castro HF, Cardenas HH. 2005. Relacion
entre la distribucion de anuros y variables del habitat
en el sector La Romelia del Parque Nacional Natural
Munchique (Cauca, Colombia). Caldasia 27(2): 299-
310.
Griesinger VV. 2019. Interaction between global
biosphere research and local resource management:
a social network of global and local knowledge in
the Biosphere Park Oxapampa-Ashaninka- Yanesha
(Peru). Master's Thesis. University of Natural
Resources and Life Sciences, Vienna, Austria. 102 p.
Heyer W. 1994. Variation within the Leptodactylus
podicipinus-wagneri complex of frogs (Amphibia:
Leptodactylidae). Smithsonian Contributions _ to
Zoology 546: 1-124.
IUCN Standards and Petitions Subcommittee. 2020.
Guidelines for using the IUCN Red List Categories
and Criteria. Version 14. IUCN, Gland, Switzerland.
Available: http://www. iucnredlist.org/documents/
RedListGuidelines. pdf [Accessed: 19 June 2020].
Jarvis L, Angulo A, Catenazzi A, von May R, Brown JL,
Lehr E, Lewis J. 2015. A re-assessment of priority
amphibian species of Peru. 7ropical Conservation
Science 8(3): 623-645.
Jiménez-Robles O, Guayasamin JM, Ron SR, De la Riva
Amphib. Reptile Conserv.
S. 2017. Reproductive traits associated with species
turnover of amphibians in Amazonia and its Andean
slopes. Ecology and Evolution 7: 2,489—2,500.
Korner C. 2007. The use of “altitude” in ecological
research. Trends in Ecology and Evolution 22(11):
569-574.
Larsen T, Gunnar B, Navarrete H, Franco P, Gomez H,
Mena JL, Morales V, Argollo J, Blacutt L, Canhos V.
2012. Desplazamientos de los rangos de distribucion y
extinciones impulsados por el cambio climatico en los
Andes Tropicales. Pp. 57-74 In: Cambio Climatico y
Biodiversidad en los Andes Tropicales. IAI Scope,
Sao José dos Campos, Brazil. 410 p.
Lehr E, von May R. 2004. Rediscovery of Ayla
melanopleura Boulenger, 1912 (Amphibia: Anura:
Hylidae). Salamandra 40(1): 51-58.
Lehr E, Movarec J, Cusi J. 2012. Two new species of
Phrynopus (Anura, Strabomantidae) from high
elevations in the Yanachaga-Chemillén National Park
in Peru (Departamento de Pasco). ZooKeys 235: 51—
TA.
Lehr E, Pramuk JB, Hedges SB, Cordova HJ. 2007. A
new species of arboreal Rhinella (Anura: Bufonidae)
from Yanachaga-Chemillén National Park in central
Peru. Zootaxa 1662: 1-14.
Linause TM, Pereira-Ribeiro J, Cozer J, Ferreguetti
AC, Bergallo H, Frederico D, Roccha C. 2020.
Anurans associated with streams and riparian zones
in a Brazilian Atlantic Forest remnant: diversity,
endemism, and _ conservation. Herpetological
Conservation and Biology 15: 306-317.
Lips K, Reaser J. 1999. El Monitoreo de Anfibios
en América Latina - Un Manual para Coodinar
Esfuerzos. Yhe Nature Conservancy, Arlington,
Virginia, USA. 42 p.
Myers N, Muittermeier R, Mittermeier C. 2000.
Biodiversity hotspots for conservation priorities.
Nature 403: 853-858.
Narvaes P, Bertoluci J, Rodrigues MT. 2009. Composicao,
uso de habitat e estacdes reprodutivas das espécies de
anuros da floresta de restinga da Estacéo Ecologica
Juréia-Itatins, sudeste do Brasil. Biota Neotropica
9(2): 117-123.
ONERN. 1976. Mapa Ecoldgico del Peru: Guia
Explicativa. Oficina Nacional de Evaluacion de
Recursos Naturales, Lima, Peru.
Ortega-Andrade M, Tobar-Suarez C, Arellano M. 2011.
Tamafio poblacional, uso del habitat y relaciones
interespecificas de Agalychnis spurrelli (Anura:
Hylidae) en un bosque himedo tropical remanente del
noroccidente de Ecuador. Papeis Avulsos de Zoologia
51: 1-19.
Pough H, Andrews R, Cadle J, Crump M, Savitzky A,
Wells K. 1998. Herpetology. Prentice-Hall, Upper
Saddle River, New Jersey, USA. 577 p.
Rodrigues da Silva FR. 2010. Seasonal variation in body
size of tropical anuran amphibians. Herpetology
July 2021 | Volume 15 | Number 2 | e277
Rhinella yanachaga in Peru
Notes 3: 205—209.
Santa-Cruz R, von May R, Catenazzi A, Whitcher C,
Lopez -Tejeda E, Rabosky DR. 2019. A new species of
terrestrial-breeding frog (Amphibia, Strabomantidae,
Noblella) from the Upper Madre de Dios Watershed,
Amazonian Andes, and lowlands of southern Peru.
Diversity 11: 145.
Segev O, Andreone F, Pala R, Tessa G, Vinces M.
2012. Reproductive phenology of the tomato frog,
Dyscophys antogili, in an urban pond of Madagascar
cast coast. Acta Herpetologica 7(2): 331-340.
Toft C, Duellman W. 1979. Anurans of the lower Rio
Llullapichis, Amazonian Peru: a preliminary analysis
of community structure. Herpetologica 35: 71-77.
ecosystems.
environment, and biodiversity.
(UFLA), Minas Gerais, Brazil.
biodiversity conservation.
Amphib. Reptile Conserv.
Villa PM, Pérez-Sanchez AJ, Nava F, Acevedo A,
Cadenas DA. 2019. Local-scale seasonality shapes
anuran community abundance in a cloud forest of the
tropical Andes. Zoological Studies 58: 1-13.
von May R, Lehr E, Rabosky D. 2018. Evolutionary
radiation of earless frogs in the Andes: molecular
phylogenetics and habitat shifts in high-elevation
terrestrial breeding frogs. PeerJ 6: e4313.
Young B. 2007. Endemic Species Distributions on
the East Slope of the Andes in Peru and Bolivia.
NatureServe, Arlington, Virginia, USA. 91 p.
Zaracho VH, Lavilla EO. 2015. Diversidad, distribucion
espacio-temporal y turnos de vocalizacion de anuros
(Amphibia, Anura) en un area ecotonal del nordeste de
Argentina. [heringia. Serie Zoologia 9(2): 199-208.
Shirley Melanny Ross Huaman-Trucios is a Forestry Engineer at the Universidad Nacional del
Centro del Peru and master’s student of Forest Resources Conservation at the Universidad Nacional
Agraria La Molina, Lima, Peru. Currently, Shirley is an official park ranger for the National Service
of Natural Protected Areas, Peru. Her main research interests are biodiversity conservation and
amphibian behavioral ecology in tropical Andes forests.
Vladimir Camel is a Forestry Engineer and is currently pursuing doctoral studies in Biological
Science and Engineering at the Universidad Nacional Agraria La Molina, Lima, Peru. His research
interests include the molecular physiology of plants and conservation of high Andean forest
Edith Orellana Mendoza is a Forestry Engineer and professor in the Area of Biodiversity and
Forest Management at the Faculty of Forestry and Environmental Sciences, Universidad Nacional
del Centro del Peru. Her areas of interest are environmental pollution, the risks of toxics in the
Marcela V. Pyles is a Forestry Engineer who is currently pursuing doctoral studies in Applied
Ecology at the Biology Institute, Sector of Ecology and Conservation, Federal University of Lavras
Rudolf von May is an Assistant Professor in the Biology Program at California State University
Channel Islands, Camarillo, California, USA. His fields of interest include evolutionary ecology and
July 2021 | Volume 15 | Number 2 | e277
9160 £90 8s0 LLE0 Jeoy
960 LLS0 6850 8Ee0 uwloJ qeuot
10 Sr9'l ZES0 9L8°0 perpowiorg g
=y
9160 590 go0 LLE0 JeoT 5
p9S 0 LLS 0 S850 80 wa A OF
10 Sr9'I ZES0 9L8°0 perawog
E50 8790 LI€0 6610 Aq
gyeulay
wee 1000 > Eve S- IpZ0 997 I- JOM &
€S0 879'0- LI€0 6610" Ald S
STN
wee 1000 > Epes 1pZ0 997'I TOM
(|z| <) 1d ONIBA Z 10119 "pis IVUIS| S[UNPIAIPUI JO AIquIN
sIojowesed yuoIayjIp APUROYIUSIS JUSSOIdOI SYSLOIsY ‘(Jeoy puew “UOJ “peljauolq) Jeyqeyosor pue (AIp
pue 1am) UOsedS YOvA UI DsHYyoDUHA VIJaUIYY JO S[eNprAIpur JO Jaquinu oy} JO suOsIIedWOD ‘7 xIpusddy
July 2021 | Volume 15 | Number 2 | e277
Huaman-Trucios et al.
L100 p9IT by IBS I16TI 876 1E9- El + + + 790'0- + + 6£9'€
0Z0'0 Or6€ LSTI6TI 600'PE9- I] + + S00'0 + + EES'E
1Z0'0 ZOL'E SLOI6TI SZ0'SE9- Ol + + + + E9C'€
7Z0'0 EpPL'€ O90 16ZI 9I10'SE9- Ol + + 900'0 + + EES'E
€Z0'0 EPO'E 096 06ZI 996'PE9- Ol + + 600'0 + + Ors'€
970'0 PLEE 1690671 9ZL'EEI- I] + + + + + 109'€
8Z0'0 Z6L'E 6080671 Sed EED- I] + + S00'0 + + €6S'€
8£0'0 Or9'T LS668TZI SOP PE9- Ol + + €Z0'0 + + 87S'€
8£0'0 ZTI9T ©—6TH68TI_—« LEN 9E9- 8 + 800'0 + ESSE
0S0'0 9V0'T E9E68TI E97 SED- 6 + + + + Ips'€
790'0 6LS1 9688871 6Z0'SE9- 6 + 600'0 + + EES'E
LLO‘0 C611 OIS 8871 IPl'EE9- Ol + + + + L6S'€
L800 7960 [87 88ZI €88°9¢9- L + + ESc'€
Orl'0 0000 LIEL8ZI szEseo- 8 + + + pEs'€
X9S X9S = 1G | X9S = 1G | ITN
WysIOM =— YO IOIV YYVTSO] Jp ark Oe Share ork wae aa X9§ = ic TIN BIS ydao.19}U]
‘JOPOU! SY} Ul POPNIOUT SI S[QVIIVA [COTIOSI}O YIM UOOVIOJUI/JIQULICA SY} Jey} O}BOIpU
SUBIS SHI OY], WHS} UOTJOBIOIUI = x “SJYSIOM OYIVYY = 1M -[OPOU! }Sdq OY} JO JY} PUL [OPOU! UDAIS B JO IDTV 9} Ud9MJOq SOUSIOLIP = IOTVV ‘Wlopsel} JO SaoIsOp = Jp *x9s
= XO§ ‘UONBADY = IF JeUQeyoIO = IP “WOSKdS = BIS ‘SUOTICIADIQQGY (WW) DsNYoDUHK D]JaUIYY JO IZIS 1OJ S[ApOW p{ do} dy} Jo YOR UI popnyoUT so[qelivA ‘[ xipusddy
Amphib. Reptile Conserv.
Official journal website:
amphibian-reptile-conservation.org
Amphibian & Reptile Conservation
15(2) [Taxonomy Section]: 10—22 (e278).
of
Ry
ptile-cons*
urn:lsid:zoobank.org:pub: D8B4BDF6-C656-460B-83F9-321A8F75E77A
A new lizard of the Liolaemus montanus group that inhabits
the hyperarid desert of southern Peru
‘*Pablo Valladares-Faundez, ?Pablo Franco Leon, *?Cesar Jove Chipana, *Marco Navarro Guzman,
?Javier Ignacio-Apaza, ‘César Caceres Musaja, °Robert Langstroth, **Alvaro Aguilar-Kirigin,
7Roberto C. Gutierrez, and ®°Cristian S. Abdala
'Laboratorio de Zoologia Integrativa, Departamento de Biologia, Facultad de Ciencias, Universidad de Tarapaca, General Velasquez 1775, Arica,
CHILE *Direccion de Investigacion, Universidad Jorge Basadre Grohmann, Avenida Miraflores S/N, Ciudad Universitaria, Tacna, PER U 3Servicio
Nacional Forestal y de Fauna Silvestre, Ministerio de Agricultura y Riego, Tacna, PERU ‘Departamento de Biologia, Facultad de Biologia y
Microbiologia, Universidad Nacional Jorge Basadre Grohmann, Tacna, PERU “Area de Herpetologia, Coleccion Boliviana de Fauna, Campus
Universitario de Cota Cota, Facultad de Ciencias Puras y Naturales, Universidad Mayor de San Andrés, La Paz, Estado Plurinacional de Bolivia,
BOLIVIA °Red de Investigadores en Herpetologia, La Paz, Estado Plurinacional de Bolivia, BOLIVIA ’Museo de Historia Natural, Universidad
Nacional de San Agustin de Arequipa, PERU *Consejo Nacional de Investigacion Cientificas y Técnicas (CONICET) - Unidad ejecutora Lillo
(UEL) - Facultad de Ciencias Naturales e Instituto Miguel Lillo (IML), Universidad Nacional de Tucuman, San Miguel de Tucuman, ARGENTINA
Abstract.—A new lizard of the genus Liolaemus is described from the Tacna region of southern of Peru. This
species belongs to the L. montanus group and was initially thought to be L. poconchilensis and L. insolitus.
However, a series of diagnostic characters differentiate it consistently from these two species and all other
species of the genus. To determine the taxonomic status of these lizards, their phylogenetic relationships were
analyzed, as well as their morphological and ecological characteristics. The results of the analysis support
the conclusion that this population of lizards represents a new species to science, and that the new species
is related to L. nazca and L. chiribaya. The new species has sexual dimorphism and is known from elevations
of ca. 1,000 m above sea level in the hyperarid Pacific deserts, which are populated by scattered Ephedra
americana and Poissonia sp. Due to its highly restricted range and observed habitat loss, we recommend this
species be categorized as Critically Endangered.
Keywords. Tacna, Liolaemidae, reptiles, South America, systematics, taxonomy.
Resumen.—Una nueva especie de lagarto del géenero Liolaemus es descrita para la Region Tacna, sur de Peru.
Esta especie pertenece al grupo L. montanus, la que fue inicialmente confundida con L. poconchilensis y L.
insolitus. Sin embargo, una serie de caracteres diagnosticos la diferencian consistentemente de estas y otras
especies del género. Para determinar su estatus taxonomico, nosotros analizamos sus relaciones filogenéticas,
asi como sus Caracteristicas morfologicas y ecologicas. Nuestros resultados sustentan la conclusion que esta
poblacion es una nueva especie para la Ciencia, e indica que esta nueva especie esta relacionada a L. nazca
and L. chiribaya. La nueva especie presenta dimorfismo sexual, y es conocida en elevaciones cercanas a los
1,000 m sobre el nivel del mar, en el hiperarido desierto del Pacifico con matorral de Ephedra americana y
Poissonia sp. Debido a su distribucion restringida y la pérdida de habitat observada, nosotros proponemos
que sea incluida en la lista de especies amenazadas como En Peligro Critico.
Palabras clave. Tacna, Liolaemidae, lagartos, reptiles, sistematica, taxonomia.
Citation: Valladares-Faundez P, Franco-Leén P, Jove Chipana C, Navarro Guzman M, Ignacio-Apaza J, Apaza JI, Caceres Musaja C, Langstroth R,
Aguilar-Kirigin A, Gutierrez RC, Abdala CS. 2021. A new lizard of the Liolaemus montanus group that inhabits the hyperarid desert of southern Peru.
Amphibian & Reptile Conservation 15(2) [Taxonomy Section]: 10-22 (e278).
Copyright: © 2021 Valladares-Faundez et al. This is an open access article distributed under the terms of the Creative Commons Attribution License
[Attribution 4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction
in any medium, provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced,
are as follows: official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 5 November 2020; Published: 12 August 2021
Correspondence. *[email protected] (PVF), [email protected] (PFL), [email protected] (CJC), mnavarro@serfor.
gob.pe (MNG), [email protected] (JIA), [email protected] (CCM), [email protected] (RL), [email protected]
(AAK), [email protected] (RCG), [email protected] (CSA)
Amphib. Reptile Conserv. 10 August 2021 | Volume 15 | Number 2 | e278
Valladares-Faundez et al.
Introduction
The richness of reptile species in Peru has been quantified
as 365 species (Carrillo de Espinoza and Icoechea 1995).
However, since that date many new species have been
described for the country (Lehr et al. 2019), particularly
members of the genus Liolaemus (Laurent 1998; Lobo
et al. 2007; Aguilar-Putriano et al. 2013, 2019; Gutiérrez
et al. 2018; Villegas et al. 2020; Chaparro et al. 2020;
Huamani-Valderrama et al. 2020), a group that is very
widespread between central Peru and Tierra del Fuego
of Chile and Argentina. In addition, some Liolaemus
species described from northern Chile have subsequently
been documented for Peru, such as L. poconchilensis
(Langstroth 2011), ZL. chungara, and L. pleopholis
(Valladares et al. 2021).
Lizards from the desert of the Pacific slope of northern
Chile and southern Peru are generally characterized by
the “phrynosaurine” morphotype (Valladares 2004),
and they are recovered in the L. reichei clade in the
phylogeny of Abdala et al. (2020). For example, L.
audituvelatus, L. balagueri, L. chiribaya, L. insolitus, L.
nazca, L. poconchilensis, L. reichei, L. stolzmanni, and
L. torresi present eyelids with a conspicuous comb, eye
diameter greater than length between anterior borders
of eye and rostral, tail shorter than snout-vent length,
head scales poorly differentiated, isognathus jaws, loreal
region depressed and dorsal scales imbricate, smooth,
and with small accompanying scales (1.e., heteronotes).
In Peru, there are known to be four species of the L.
reichei clade: L. balagueri, L. insolitus, L. nazca, and L.
poconchilensis. Males of L. balagueri and L. nazca have
a unique coloration pattern, with ocelli and green scales
on both side of the body, while males of L. chiribaya, L.
poconchilensis, and L. insolitus have blue and orange-
to-red scales, and pronounced sexual dimorphism. They
inhabit sandy or slightly rocky areas, and are associated
with small and restricted vegetation patches. These species
all inhabit coastal desert ecosystems of Chile and Peru with
extreme aridity, very pronounced thermal fluctuations, and
very scant precipitation (Hartley et al. 2005).
During a survey of the biodiversity of arid ecosystems
in southern Peru, a small population of lizards with
particular morphological characteristics was found.
Initially they were thought to be L. poconchiliensis and
L. insolitus, however their large size and color pattern
indicated that this population constitutes a new species
of Liolaemus. In the present paper, these lizards from the
arid coastal desert of southern Peru are described as a
new species, based on a detailed comparison with other
species of the LZ. montanus group and their phylogenetic
relationships, taxonomic position, and conservation
status are then discussed.
Materials and Methods
Phylogenetic analyses. Phylogenetic analyses were
performed using the morphological matrix of Abdala et al.
Amphib. Reptile Conserv.
11
(2020), which includes 329 characters and 105 terminals
(including Ctenoblepharys adspersa and Phymaturus
palluma as outgroup, and 103 terminals of the Liolaemus
montanus group). Parsimony was used as the optimality
criterion, only selecting the shortest trees or those with
the fewest homoplasies. TNT 1.5 (Tree Analysis Using
New Technology, version 1.5; Goloboff et al. 2003)
was used to generate the phylogenetic hypotheses.
Continuous characters were analyzed following Goloboff
et al. (2006) and were standardized using mkstandb.run.
For this analysis, the value of two was considered as the
highest transformation cost. Heuristic search was used to
find the shortest trees or those with the smallest number
of steps. The matrix was analyzed under equal weight
or under implied weight, and K values from three to 20
were used. One thousand replications were performed
for each search, and 20 trees were saved per replicate.
Symmetric resampling was used to obtain support values
for the results obtained, with 500 replications and using a
deletion probability of 0.33.
Morphology. The morphological characters traditionally
used in Liolaemus taxonomy were examined in this
study, including those of Laurent (1985), Cei (1986,
1993), Etheridge (1993, 1995, 2000), Lobo (2001),
Abdala (2002, 2003, 2007), and Abdala et al. (2019,
2020). The terminology of Smith (1946) was followed
for descriptions of squamation, and that of Frost (1992)
for descriptions of neck-folding. Descriptions of body-
color patterns follow Lobo and Espinoza (1999), Abdala
(2007), and Abdala et al. (2020).
Measurements and scale counts were recorded from
specimens fixed in 10% formalin and preserved in 70%
ethanol. Body and scale measurements were taken with
digital calipers to the nearest 0.02 mm. A binocular
dissecting microscope (10-40X) was used to count and
characterize the scales. Where bilateral, scale count and
measurement data were taken from the right side of the
lizards.
The holotype and paratypes were compared with
other species from the L. montanus group (sensu
Etheridge 1995 and Abdala et al. 2020). Specimens were
measured (Table 1) and compared with other members
of the L. reichei group from adjacent regions (Table 2).
Descriptions of color in life for the new species were
based on observations of freshly collected animals and
photographs taken at the time of capture.
Ecology. The niche study for the new species was
carried out by means of predictive modeling using the
MaxEnt v3.4.1 software, which employs algorithms that
predict the potential distribution of a species in relation
to their environmental conditions (Phillips et al. 2006).
It is considered one of the most efficient programs for
assessing the potential niche of any species (Elith et
al. 2006). The coordinates of the collected individuals
were used along with nine other environmental variables
(Table 3). The AUC statistic was used to validate the
August 2021 | Volume 15 | Number 2 | e278
A new Liolaemus species from Peru
Table 1. Morphological measurements (in mm) of four specimens of Liolaemus basadrei sp. nov. Specimen HP20CBT corresponds
to the proposed holotype.
HP20CBT
Sex Male
Body length 90.6
Tail length 68
Head length 20.4
Head width 18.2
Forelimb length 28.4
Hindlimb length 43.2
Supralabials 10
Infralabials 6
Lorilabials 13
Scales around midbody 79
Scales of the body length 92
Precloacal pores 6
ecological niche model, where values of 0.5—0.7 indicate
low confidence, values of 0.7-0.9 demonstrate a useful
application in the model, and values greater than 0.9
suggest high confidence (Lobo et al. 2007). Likewise,
the Jackknife test was applied, which allows assessment
of the contribution of each variable individually
(Shcheglovitova and Anderson 2013).
Conservation status. The conservation status of
the species has been defined based on the variables
considered in the Conservation Priority Index (CPI)
of Cofré and Marquet (1999) and those of the JUCN
Red List of Threatened Species. Some of the key
HP21CBT HP22CBT HP23CBT
Male Female Female
88.2 63.6 78.7
78.1 53.6 45.1
21 14 15.8
16 10.9 13:9
31 Zoe, 26.6
42 35.7 40.8
8 9 9
7 6 ah
13 1] 13
82 79 74
89 88 86
3 0 0)
variables considered in the CPI were: (a) number of
different ecoregions where the species is found, taken
as indicative of the degree of habitat specialization; (b)
area of geographic distribution of the species (km/”);
(c) average local abundance (individuals/km’); (d)
endemism, based on the number of countries where the
species 1s present; (e) taxonomic singularity, based on the
degree of monotypy at the levels of genus and family;
(f) body mass; (g) effect of human activities; and (h)
degree of protection, based on the percentage of area of
the ecoregion inhabited by the species which lies within a
protected area (such as national parks, national reserves,
and natural monuments).
Table 2. Morphological measurements (in mm) of six Liolaemus species. The sequence of numbers corresponds to minimum, average (in
parentheses), and maximum values found in the body measurements.
Body length
Tail length
Head length
Head width
Forelimb length
Hindlimb length
Supralabials
Infralabials
Lorilabials
Scales around
midbody
Scales of the body
length
Precloacal pores
L. basadrei sp. nov.
ae)
63.6 (80.3) 90.6
45.1 (61.2) 78.1
14 (17.8) 21
10.9 (14.8) 18.2
23.2 (27.3) 31
35.7 (40.4) 43.2
8 (9) 10
6 (6.5)7
11 (12.5) 13
74 (78.5) 82
86 (88.8) 92
0 (2.3) 6
Amphib. Reptile Conserv.
L. insolitus
67.7
61.9
16.2
14.6
31.4
44.1
9
9
62
63
L. poconchilensis
(n=4)
47.17 (51.7) 53.83
42.66 (47.2) 53.65
11.34 (13.1) 14.16
9.51 (10.9) 11.53
22.2 (24.8) 27.5
31.15 (34.1) 32.62
12
8
14
62
64
4
L. chiribaya
(n=9)
49.6 (53.3) 68.8
13 (14.8) 16.3
11.4 (12.8) 11.4
20.4 (23.4) 25.8 26.3 (28.8) 30.5
30.9 (33.4) 34.8 38.6 (40.1) 42.2
7 (8.6) 10
55 (61.7) 66
52 (57.4) 61
2 (3.7)5
L. torresi
(n=8)
53.8 (58.1) 64
58.8 (57.4) 74
13 (13.6) 14.5
10.3 (11.02)
11.7
10
7:
L. reichei
(n= 3)
41.5 (47.7) 50.8
35.7 (39.5) 43.1
10 (10.9) 11.5
8.3 (8.5) 9.7
21.4 (22.6) 24.4
30.1 (31.7) 33.4
9(9)9
6 (6.7) 8
8 (8.7) 9
43 (45) 47
50 (51.7) 54
4
August 2021 | Volume 15 | Number 2 | e278
Valladares-Faundez et al.
Table 3. Environmental variables and their contributions to the
model of Liolaemus basadrei sp. nov. distribution, obtained
using the MaxEnt algorithm.
Variables Contribution to the
model (%)
Precipitation 0.6
Average temperature 25
Climatic classification 48
Physiography 46.3
Slope 0.3
Geomorphology 0.4
Humidity 0)
Soil type 0.8
Life zone 21
Images and maps. Photographs were taken of live
specimens using a Canon EOS Rebel T71 digital camera.
The distribution map was elaborated in QGIS free
software, using the coordinates from the authors’ own
records, which were taken with a GPS device (datum
WGS84), Garmin inReach Explorer.
Results
Phylogeneticanalyses. The morphological phylogenetic
analysis indicated that the new species belongs to the
Liolaemus reichei clade of the L. montanus group,
nested within a monophyletic subgroup that includes L.
audituvealtus, L. balagueri, L. chiribaya, L. insolitus,
L. nazca, L. poconchilensis, L. reichei, and L. torresi
(Fig. 1).
Twenty trees were saved by each replicate. All resulting
phylogenetic trees showed the same clades as observed
in Fig. 1, and are supported by 25 synapomorphies, six
continuous characters, and 21 discrete characters. All
analyzes showed the new species as sister to the clade (L.
nazca + L. chiribaya), and this clade is supported by 24
all continuous synapomorphies. This clade is at the same
time a basal branching (according to Krell and Cranston
2004) of two large clades, one formed by species that
inhabit Chile and the other by those that inhabit Peru
(except for L. balagueri, which is sister species to the
entire clade). These results were obtained in all trees with
values of k = 3-20. Phylogenetic evidence indicates that
the new species has no direct relationship with L. insolitus.
The new species has a total of 26 autapomorphies, of
which 13 are continuous and 13 are discrete.
Taxonomy
Liolaemus basadrei sp. nov.
(Fig. 2A—D)
urn:lsid:zoobank.org:act:08DE BE00-8856-445A-BBD5-CD2A8D3EC45B
Amphib. Reptile Conserv.
Holotype. HP20CBT, an adult male (Fig. 2A—B) from
the east slope of an unnamed hill east of Locumba
Valley, 17°44°38’S, 70°45’41”W; 897 m, Jorge Basadre
Province, Tacna Region, Peru; collected on 25 January
2019, Pablo Franco, Pablo Valladares-Faundez, Cesar
Chipana, Marco Navarro and Javier Ignacio collectors.
Allotype. HP21CBT, an adult female (Fig. 2C-—D),
from the east slope of an unnamed hill east of Locumba
Valley, 17°45’21”S, 70°45’51”W; 761 m, Jorge Basadre
Province, Tacna Region, Peru; collected on 25 January
2019, same collectors.
Paratypes. Two adults: HP22CBT and HP23CBT,
from the east slope of an unnamed hill east of Locumba
Valley, one male and one female. From the high voltage
tower to the Pan-American highway, on a steep slope
(17°44’50”S, 70°46’06”W); 970 m, same collectors.
Diagnosis. Liolaemus basadrei sp. nov. belongs to the
L. montanus group (sensu Etheridge 1995; Abdala et
al. 2020). This species differs from the species of the L.
boulengeri group of the L. montanus group series by the
absence of a patch of enlarged scales on the posterior
thigh of the hind limb in the new species (Etheridge
1995; Abdala 2007). In relation to the L. montanus
group, L. basadrei sp. nov. differs from L. andinus, L.
annectens, L. cazianae, L. chlorostictus, L. dorbignyi,
L. duellmani, L. eleodori, L. erguetae, L. erroneus, L.
etheridgei, L. evaristoi, L. fabiani, L. famatinae, L.
fittkaui, L. forsteri, L. foxi, L. gracielae, L. griseus, L.
hajeki, L. halonastes, L. huacahuasicus, L. huayra, L.
inti, L. islugensis, L. jamesi, L. juanortizi, L. lenzi, L.
melanogaster, L. montanus, L. molinai, L. multicolor, L.
nigriceps, L. orko, L. ortizi, L. pachecoi, L. pantherinus,
L. patriciaiturrae, L. pleopholis, L. poecilochromus, L.
polystictus, L. pulcherrimus, L. puritamensis, L. galaywa,
L. robertoi, L. robustus, L. rosenmanni, L. ruibali, L.
schmidti, L. scrocchii, L. signifer, L. tajzara, L. thomasi,
L. vallecurensis, L. victormoralesii, L. vulcanus, and L.
williamsi by possessing isognathus jaws and tail shorter
than Snout- Vent Length (SVL). Of the remaining species,
L. basadrei sp. nov. are robust lizards (SVL = 88.2 mm)
differing from L. andinus, L. anqapuka, L. audituvelatus,
L. balagueri, L. cazianiae, L. chiribaya, L. duellmani,
L. eleodori, L. erguetae, L. erroneus, L. etheridgei, L.
evaristoi, L. fabiani, L. famatinae, L. fittkaui, L. foxi,
L. gracielae, L. griseus, L. hajeki, L. halonastes, L.
huacahuasicus, L. islugensis, L. molinai, L. montanus,
L. multicolor, L. nazca, L. orko, L. omorfi, L. ortizi, L.
pantherinus, L. poconchilensis, L. poecilochromus,
L. porosus, L. pulcherrimus, L. reichei, L. robertoi, L.
rosenmanni, L. ruibali, L. smidthi, L. stolzmanni, L.
tajzara, L. thomasi, L. torresi, L. vallecurensis, and L.
williamnsi which are smaller (SVL between 50-80
mm). The dorsal scales on the body are smooth and
subimbricate in Liolaemus basadrei sp. nov., differing
August 2021 | Volume 15 | Number 2 | e278
A new Liolaemus species from Peru
Liolaemus chlorostictus clade
Liolaemus
montanus
group
Liolaemus foxi clade
Liolaemus andinus clade
Liolaemus multicolor clade
Liolaemus poecilochromus clade
Liolaemus ortizi clade
Liolaemus huacahuasicus clade
Liolaemus robustus clade
Liolaemus forsteri clade
Liolaemus arnectens clade
Liolaemus jamesi clade
—— Liolaemus dorbignyi clade
L.poconchiliensis
L.reichei
L.audituvelatus
L.torresi
L.torresiRioLoa
L.afftorresil
93
90
L.balagueri
L.basadrei sp. nov.
L.nazca
L.chiribaya
L.affinsolitus6
L.affinsolitusS
—— L.affinsolitus7
61 L.affinsolitus4
L.affinsolitus2
L.affinsolitus3
L.affpoconchiliensis
L.insolitus
42
40
50
Liolaemus reichei clade
Fig 1. Phylogenetic tree obtained for the new species.
from species that have dorsal scales with an evident keel:
L. aymararum, L. etheridgei, L. famatinae, L. fittkaui,
L. griseus, L. huacahuaicus, L. montanus, L. orko, L.
oritizi, L. polystictus, L. pulcherrimus, L. galaywa, L.
signifer, L. tajzara, L. thomasi, L. victormoralesi, and L.
williamsi. Liolaemus insolitus is the most similar among
these lizards to the new species, but it differs principally
by the number of scales along the dorso-thoracic region
(scales between occiput and anterior border of thigh, 63
in L. insolitus versus 86—89 in the new species), number
of ventral scales (70-78 in L. insolitus versus 79-85 in
the new species), and the dorsal pattern in L. insolitus has
fewer dark red scales and more sky-blue scales.
Phylogenetic results indicate that L. basadrei belongs
to the clade of L. reichei (Abdala et al. 2020). L. basadrei
sp. nov. differs from L. angapuka, L. audituvelatus,
L. balagueri, L. chiribaya, L. insolitus, L. nazca, L.
poconchilensis, L. reichei, L. stolzmanni, and L. torresi
because the latter have a smaller size (< 70 mm SVL)
and the new species is over 88 mm. Liolaemus basadrei
sp. nov. also differs from L. balagueri, L. chiribaya, L.
insolitus, L. nazca, L. poconchilensis, L. reichei, and L.
torresi by having a greater number of scales around the
body (74-82 vs. < 72) and a greater number of dorsal
Amphib. Reptile Conserv.
scales on the body (84—92 vs. < 80). The number of ventral
scales is greater than in L. balagueri, L. chiribaya, L.
insolitus and L. nazca (79-85 vs. < 79). The presence of
blue scales on the body also differentiates it from species
that do not have them: L. audituvelatus, L. balagueri, L.
nazca, L. reichei, and L. torresi.
Description of the holotype. Medium-sized lizard,
robust body, limbs short and robust, head triangular and
short, distinct from neck, widest across temporal region,
0.89 times wider (as measured across widest part of
temporal region) than long (as measured from inferior
apex of external auditory meatus to anterior surface of
rostral). Snout short (as measured from tip of snout to
anterior corner or orbit), 0.26 times head length, orbit
(as measured along its greatest horizontal length) short,
0.17 times head length. Nasal region slightly swollen,
convex in profile, rostral narrow, 2.8 times wider than
high, bordered by three postrostrals, semirectangular
and pentagonal, external ones of greater size. Rostral
scale in contact with a lorilabial and a supralabial scale
on each side. Four hexagonal, irregular, and elongated
internasals, external pair meeting nasals. Five medium
and irregular scales between postrostral and internasal.
August 2021 | Volume 15 | Number 2 | e278
Valladares-Faundez et al.
Fig. 2. Dorsal (A) and ventral (B) views of holotype specimen collected in Valle de Locumba, Jorge Basadre Province, Region
Tacna, Peru. Dorsal (C) and ventral (D) views of allotype specimen collected in Valle de Locumba, Jorge Basadre Province, Region
Tacna, Peru.
Nasal scales larger, in contact with one postrostral, one
lorilabial, one internasal, and two irregular postnasals,
and a medium scale between internasal and postrostral.
Nasal is separated from rostral and anterior supralabials
by anterior lorilabials. Posterior nasal rounded and
its anterior part is angled. Nostril oriented postero-
laterally. Dorsal head scales larger, differentiated,
convex; frontonasal region convex in profile. Twenty-
one irregular scales in frontonasal region, five irregular,
convex and smooth prefrontals. Frontals and postfrontals
fragmented and irregular. Two postfrontals meet to
interparietal, which is slightly smaller than adjacent
parietals, irregular, bordered by eight scales, with a
distinct “eye” that corresponds to pineal organ (Fig. 3A).
Elongated, convex and irregular parietals, posterior to
interparietal. Supratemporal region smooth, irregular,
and convex. Temporals larger, convex, juxtaposed, 11
between postocular and anterior margin of ear, 0.43 times
head length. External auditory meatus large, rounded, 2
times higher than wide, bordered by irregular scales,
smaller anteriorly, one largest on the upper side and
not differentiated from posterior temporals, with small
interstitial granules. Orbitals 0.17 times head length.
Supraocular regions large, scales medium size, eight on
each side, 4—5 in a horizontal line across widest part of
supraocular region between superciliaries and frontals.
Fifteen scales form an irregular circum-orbital semicircle.
Seven superciliaries larger, not keeled, four anterior, two
posterior, and one interciliar. Palpebrals small, smooth,
convex and juxtaposed, 11 inner rectangular ciliaries,
outer ciliaries of lower lid 12, outer ciliaries of upper lid
11, third ciliary and three posterior ciliaries triangular, but
not as projecting as those of lower lid, those in middle of
lid more nearly rectangular, not projecting. One preocular
wider than subocular, pentagonal, preceded anteriorly
Amphib. Reptile Conserv.
by a large canthal. Subocular elongated, about 8 times
longer than high and postocular elongate but shorter
than preocular and subocular. Eleven lorilabials, a row
of small scales between the subocular and lorilabials
that start from the loreal scales. Anterior lorilabials
rectangular, posteriors irregular and convex. Six irregular
loreals. Ten supralabials, equal in size to lorilabials. No
supralabials in contact with subocular, and one lorilabial
in contact with subocular (Fig. 3B). Mental large, 1.1
times as wide as rostral, bordered by two infralabials and
two postmentals, not in contact with anterior sublabials.
Four postmentals on each side, infralabials six, gulars
medium size, smooth, semitriangular, convex, imbricate
(Fig. 3C). Ventral scales triangular, similar in size to
dorsal scales, imbricate and smooth. Pectoral scales
imbricate and triangular, on the sides are quadrangular.
Posterior abdominal scales semirectangular. Scales of
precloacal region imbricated and rounded, but wider than
long. Six orange precloacal pores. Dorsal scales of neck
small, smoothly overlapping, slightly concave, smooth
and triangular, with interstitial granules. Dorsal scales
of body larger, rounded or semicircular, smooth and
subimbricate, similar to the lateral scales. Scales around
midbody 79. Middorsal scales from occiput to point even
with anterior margin of thigh 92. Lumbar scales wider
than long, similar in size but less imbricated than dorsal
scales and with interstitial granules. On the sides of the
body, scales are quadrangular.
Lateral nuchal skin folds well-developed and
complex. Two short folds, one originating at superior and
other at inferior margin of auditory meatus, converging
posteriorly to forma V-shaped fold, continuing posteriorly
as longitudinal neck fold, intercepted by oblique neck
fold and antehumeral fold, which reaches half of body.
A fold born in the armpit, projects to the groin. Scales
August 2021 | Volume 15 | Number 2 | e278
A new Liolaemus species from Peru
Fig. 3. Dorsal (A), ventral (B), and lateral (C) views of the head
of holotype HP20CBT.
of lateral neck flat or slightly concave, nonoverlapping.
Below the fold, triangular scales are slightly imbricate,
similar in size to the dorsal neck. Limbs robust and
short. Adpressed hindlimbs reach only middle of body.
Forelimbs 0.32 times SVL and hindlimbs 0.52 times
SVL. Scales of the base of the arm similar to those of the
neck. Brachial scales smooth, triangular and imbricate,
larger in size than dorsal body scales. Antebrachials
tend to be semirectangular and smooth. Elbow scales
semitriangular, and wider than long. Preantebrachials
Amphib. Reptile Conserv.
flat, smaller, rounded, and juxtaposed, with interstitial
granules. Suprafemorals and _ postfemorals larger
and triangular, smooth and imbricate. Prefemorals
small, smooth, convex, juxtaposed. Supratibials and
pretibials longer than wide, imbricate, with interstitial
granules. Infratibials smooth, larger, triangular, and
imbricated. Supratarsals large, smooth, triangular, and
imbricate. Subdigital lamellae of fourth toe 25, with
distal margin slightly tridentate, claws long and slender.
Supracarpals large, smooth, imbricate, wide than longer.
Infracarpals imbricate, somewhat projecting, mucronate,
supradigitals imbricate, keeled and triangular, subdigital
lamellae of fourth finger 19, with distal margin slightly
tridentate, claws long and slender. Tail short and robust,
slightly thickened at the base and somewhat depressed.
The rest is thick and rounded distally. Tail 0.75 times
body length. Dorsal and lateral caudal scales tend to
be irregular, rectangular, with interstitial granules and
imbricate; wider than long, rugose and slightly imbricate
on middle third of tail. Ventral caudal scales triangular on
middle third of tail, but then are rectangular and strongly
imbricate, longer than wider. Autotomic region with 12
scales on dorsal and lateral tail, and eight ventral scales.
Coloration. The holotype has a dark red head and dorsal
body color. Each side of the temporal region and body has
sky blue scales that reach laterally to the tail. Ventrally
there is a heavily variegated coloration, more intense on
the lateral side and throat, ventral side color yellow with
sandy brown spots, a pattern repeated on fore and hind
limbs, and until the end of tail. Dorsal tail dark orange.
Throat predominantly yellow, with sky blue scales and
some red scales.
Variation in morphological measurements and scaling.
Variations based on four specimens, two males and two
females, collected from the same site as the holotype, are
presented in Table 1. The females present a sandy brown
colored head, similar to the sand on which they live. On
the dorsal neck are two medium black spots which are
in parallel along to the dorsal body, where they become
larger and reach to the first part of the tail. Scapular area
shows a short black spot subsequently followed by a
white spot, a pattern which is along the dorso-thoracic
region. Ventrally there is a slightly variegated pattern,
more intense on the throat, ventral side color white with
light gray spots, a pattern repeated on fore and hind limbs,
and until the end of the tail. Female has dorsal scales well
defined, not fragmented, circumorbital semicircles well-
defined, large, and unfragmented subocular, parietals
large, pentagonal, and well-defined. Differences are
mainly in the form of interparietal, which in both females
is hexagonal, while in the males it is irregular. Variation
in the number and form of the scales: temporals eight
between postocular and anterior margin of ear, 13
lorilabials, without a row of small scales between the
subocular and lorilabials, eight supralabials, middorsal
August 2021 | Volume 15 | Number 2 | e278
Valladares-Faundez et al.
70°55'0"W
17°30'0"S
8
MOQUEGUA
17°40'0"S 17°35'0"S,
17°45'0"S,
PACIFIC
OCEAN
17°50'0"S
17°S5'0"S.
PACIFIC
OCEAN
18°0'0"S
70°55'0"W
Hill fe Sampling (GQ Ecological niche
70°50'0"W 70°45'0"W 70°40'0"W 70°35'0"W 70°30'O"W 70°25'0"W 70°20'0"W
17°30'0"S
17°350"S
JORGE BASADRE
PROVINCE
17°450"S 17°40'0"S
17°50'0"S
TACNA
PROVINCE
17°55'0"S
18°0'0"S
70°50'O"W 7O°45'0"W 7o°40'0"W 70°35'0"W 70°30'0"W 7O°25'0"W 70°20'0"W
Legend
Main roads GZ, Agricultural valleys (~} Provinces
Fig. 4. Current (star) and potential (in gray) distributions of Liolaemus basadrei in the Jorge Basadre Province, Tacna, Peru,
obtained from the MAxEnt algorithms.
scales from occiput to point even with anterior margin
of thigh 88. Elbow scales semitriangular and wider than
long, but lightly keeled. The tail has a spotted pattern.
Forelimb with small dark spots, and hindlimbs variegated
with black and dark brown spots.
The dorsal area of the female is light brown or
pinkish, and the head has dark brown and gray spots with
an irregular shape and order. Lateral area of the head
with dark brown spots that cross the muzzle transversely.
Back of neck and body of the same color as the head,
with large brown spots, arranged two on each side,
bordered by a row of small white scales, a pattern that
is repeated throughout the entire body. Paravertebral
region with small brown spots, while in the lumbar area
a greater number of white scales are observed. Along the
tail, the dorsal pattern is lost and dark brown spots are
observed in an irregular manner and shape, both dorsally
and laterally. Forelimb and hindlimb with light brown
spots irregular in shape and arrangement. Lateral area of
the neck and body white, accompanied by irregular dark
spots. Gular area with gray bands directed towards the
mid-ventral area. Chest with small and very faint gray
spots, white or slightly pink belly, ventral area of the
fore and hind limbs without spots. Ventral area of the tail
white or slightly pink.
Ecology. The knowledge of this species is very poor.
Amphib. Reptile Conserv.
Apparently, its distribution is restricted to the Ephedra
americana and Poissonia sp. desert scrub formation of the
northern Tacna Region, collected in the Locumba valley,
64.5 km north of Tacna (17°45’21”S; 70°45°51”W)
(Fig. 4). Their activity was noted in the morning and
afternoon, and this species thermoregulates at midday by
seeking shade under rocks, cacti, or bushes. Reproductive
phenology, as well as diet and distribution, are unknown.
The new species shares its habitat with a species of
Microlophus, currently under description, of similar
size and mass, and the two species have been observed
utilizing the same cacti as refugia (Fig. 4). While there
are other localities in southern Peru where Liolaemus
and Microlophus can be observed in close proximity,
elsewhere the Microlophus is of larger size and mass
than the Liolaemus. The new species is the largest and
most robust known species of the L. reichei clade and
also the only one known to be associated with cacti. It
is possible that the large size of the new species reflects
its evolution in a resource-rich environment relative to
the other species that are typically found in absolute
desert areas with extremely sparse vegetation. The cacti
likely provide food, water, refuge, and a reduced cost of
thermoregulation. Examination of hawk and owl pellets
from the Locumba Valley has yielded evidence that both
species of lizards are important elements of the local
trophic web (Valladares et al. 2021).
August 2021 | Volume 15 | Number 2 | e278
A new Liolaemus species from Peru
a ae |S ie a! oa Rie
The ecological niche modeling yielded an AUC of 0.988,
indicating a high level of statistical confidence. The most
informative variables for the current ecological niche
of L. basadrei sp. nov. were physiography, the annual
average temperature, and the type of life zone, followed
by the type of climate, precipitation, and slope (Table
3). The remainder of the variables had little intervention
in the model according to the Jackknife test. The area
of the ecological niche of L. basadrei sp. nov. is only
79.76 km?, with distribution exclusively in the Jorge
Basadre and Tacna provinces, specifically in the districts
of Locumba and Inclan, respectively, with a predicted
altitudinal range of 650 to 1,125 m asl (Fig. 4).
Conservation status. According to the CPI variables
considered by Cofré and Marquet (1999), Liolaemus
basadrei sp. nov. 1s a species that inhabits only a
single ecoregion (absolute desert), with an extreme
specialization: known range does not exceed 100 km7,
with an abundance of 7 individuals/km; inhabits only
southern Peru; presents a low taxonomic singularity
(Liolaemus have around 300 species); this species 1s
large, considering both the generic and specific level of
the L. reichei clade (see Table 2); and it has anthropogenic
pressure, because it lives near an interstate highway and
agricultural areas, its habitat area includes high voltage
towers, and its distribution is not within any protected
Amphib. Reptile Conserv.
Fig. 5. Terra typica of Liolaemus basadrei. Valle de Locumba, 897 m, Jorge Basadre Province, Region Tacna, Peru.
aes * igs a =
= <A, See ae
wild areas. All the variables analyzed here indicate that
L. basadrei is a species that should be considered as
Endangered based on the CPI approach. Regarding the
IUCN Red List criteria for evaluating whether a taxon
belongs in a “threatened” category (IUCN 2012, 2019),
we estimate the area of occupancy of L. basadrei to be
less than 10 km?in a single location with ongoing threats
to the extent and quality of its habitat, and we estimate its
population size to be fewer than 250 mature individuals.
Thus, we recommend the category of Critically
Endangered B2ab(ii1); C2a(ii). We have sampled
localities broadly throughout southern Peru and northern
Chile for more than 20 years, and we are confident that
L. basadrei is restricted to an extremely small geographic
area. Over the course of a year, we visited each of the
areas identified as potentially suitable habitat in Fig. 4
and found the species only in the area which includes
the type locality. As summarized in Table 4, all species
of the L. reichei clade assessed to date by the IUCN
are categorized as either Endangered (four species) or
Vulnerable (one species), while five species of the clade
remain to be assessed.
Etymology. We dedicate this species to Jorge Basadre
Grohmann (1903-1980), a distinguished Peruvian
historian and native of Tacna who wrote important works
on the culture and history of Peru. Currently the National
August 2021 | Volume 15 | Number 2 | e278
Valladares-Faundez et al.
Table 4. IUCN conservation status of the species of the L. reichei clade (Abdala et al. 2020).
Species IUCN category IUCN criteria Reference
L. poconchilensis Endangered Blab(iil) Ruiz de Gamboa et al. 2017
L. reichei* Endangered Blab(iii,v) Ruiz de Gamboa and Valladares 2017
L. stolzmanni** Not Evaluated — —
L. audituvelatus Vulnerable Blab(iii); D2 Nufiez et al. 2017
L. torresi Endangered Blab(iii,v) Espejo et al. 2017
L. insolitus Endangered Blab(iii,1v) Aguilar et al. 2017
L balagueri Not Evaluated - -
L. nazca Not Evaluated — =
L. chiribaya Not Evaluated — =
L. anqapuka Endangered*** B HRCA iv) Huamani-Valderrama et al. 2020
L. basadrei sp. nov. Endangered*** B2ab(iil); C2a(il) This work
*The 2017 assessment of L. stolzmanni 1s now applicable to L. reichei, a species which was subsequently resurrected by Valladares
et al. (2018).
**The type locality of L. stolzmanni was restricted to the “transect between Antofagasta and Meyjillones, Chile” by Troncoso-
Palacios and Escobar-Gimpel (2020), who limited its known range to only as far north as Hornitos, approximately 23 NE
of Mejillones.
*** Recommended by the authors of the species.
University of Tacna bears his name, as does one of the
regional provinces of southern Peru.
Discussion
The description of this new species of lizard indicates
that the taxonomy of Liolaemus is still poorly known in
southern Peru, and it is highly probable that additional
species will continue to be discovered (Aguilar-Putriano
et al. 2019; Abdala et al. 2020). Indeed, while Gutiérrez
et al. (2018) indicated that there are a total of 15 species
of the Liolaemus montanus group in Peru, Aguilar-
Putriano (2016, 2019) described five new species of
this group and Valladares et al. (2021) incorporate L.
pleopholis as an element of the Peruvian fauna. Just
recently, Villegas et al. (2020), Chaparro et al. (2020),
and Huamani-Valderrama et al. (2020) described L.
balagueri, L. galaywa, and L. anqapuka, respectively, so
with the addition of L. basadrei sp. nov., the number of
the L. montanus group species in Peru has now reached
Zo
The Liolaemus lizards inhabiting the desert and
sandy areas of the lower Pacific slope of northern Chile
and southern Peru are: L. audituvelatus, L. balagueri,
L. chiribaya, L. etheridgei, L. insolitus, L. nazca, L.
reichei, L. poconchilensis, L. stolzmanni, and L. torresi,
some of which have the “phrynosaurian” morphotypes,
and they are distributed from the Atacama (Chile) to
the Arequipa-Ica regions (Peru), and from sea level to
over 3,500 m. Most of these species have scales of very
striking colors, such as sky-blue, red, and yellow, with a
strong sexual dimorphism. Although L. basadrei sp. nov.
Amphib. Reptile Conserv.
inhabits a lowland desert zone and presents characters
of this morphotype, it is larger in size and more robust.
In general, this group of species does not present major
taxonomic controversies and their nomenclatures have
remained stable, perhaps with the exception of L. reichei
and L. stolzmanni (Langstroth 2011; Valladares-Faundez
et al. 2018; Troncoso-Palacios and Escobar-Gimpel
2020). However, Aguilar-Puntriano et al. (2018) found
the phrynosaurian Liolaemus to be paraphyletic within
the L. montanus group when analyzed using only
molecular data.
Regarding the phylogenetic position of the new
species, two clades were recovered within the L. reichei
clade, one composed mainly of lizards that inhabit the
Chilean desert, such as L. poconchilensis, L. reichei, L.
audituvelatus, and L. torresi, and another composed of
lizards living in the Peruvian desert, such as L. balagueri,
L. nazca, L. chiribaya, L. insolitus, and L. basadrei.
Recently L. angapuka (Huamani- Valderrama et al. 2020)
was described as a new species with molecular data. It is
noteworthy that both cladograms, based on molecular or
morphological data, coincide with the two subgroups of
the L. reichei clade, with the same species composition.
From the evolutionary perspective, these species
demonstrate adaptations to the extreme conditions of the
desert; however, the biology and ecology of these lizards
remain unstudied beyond the limited observations made
at the time of collection. While we continue to improve
our taxonomic knowledge, we still lack much of the
important information needed for the conservation of
these species, such as genetic diversity, reproductive
biology, and factors that determine their distribution and
August 2021 | Volume 15 | Number 2 | e278
A new Liolaemus species from Peru
abundance in spatial and temporal perspectives.
Acknowledgements——We thank the Universidad
Nacional Jorge Basadre Grohmann of Tacna, Peru, for
the financing of our research with mining royalty funds.
We also thank the University of Tarapaca, through the
projects FFUTA1799 and UTA Mayor de Investigacion
Cientifica 4723-19. Finally, we thank SERFOR for
issuing the collection permits (AUT-IFS-2019-024) for
scientific research purposes.
Literature Cited
Abdala CS. 2002. Nuevo Liolaemus (Iguania:
Liolaemidae) perteneciente al grupo boulengeri de
la provincia de Neuquén, Argentina. Cuadernos de
Herpetologia 16(1): 3-13.
Abdala CS. 2003. Cuatro nuevas especies del género
Liolaemus (Iguania: Liolaemidae) perteneciente
al grupo boulengeri de la Patagonia, Argentina.
Cuadernos de Herpetologia 17(1—2): 3-32.
Abdala CS. 2007. Phylogeny of the L. boulengeri
group (Iguania: Liolaemidae, Liolaemus) based on
morphological and molecular characters. Zootaxa
1538: 1-84.
Abdala CS, Aguilar-Kirigin AJ, Semhan RV, Bulacios AL,
Valdés J, Paz MM, Gutiérrez RC, Valladares-Faundez
P, Langstroth R, Aparicio J. 2019. Description and
phylogeny of a new species of Liolaemus (Iguania:
Liolaemidae) endemic to the south of the Plurinational
State of Bolivia. PLoS ONE 14(12): e225815.
Abdala CS, Quinteros AS, Semhan RV, Bulacios-Arroyo
AL, Schulte J, Paz MM, Ruiz-Monachesi MR,
Laspiur A, Aguilar-Kirigin AJ, Gutiérrez-Poblete R,
et al. 2019a. Unravelling interspecific relationships
among highland lizards: first phylogenetic hypothesis
using total evidence of the Liolaemus montanus group
(Iguania: Liolaemidae). Zoological Journal of the
Linnean Society 114: 1-29.
Aguilar-Puntriano C, Wood Jr PL, Cusi JC, Guzman
A, Huari F, Lundberg M, Mortensen E, Ramirez C,
Robles D, Suarez J, et al. 2013. Integrative taxonomy
and preliminary assessment of species limits in the
Liolaemus walkeri complex (Squamata, Liolaemidae)
with descriptions of three new species from Peru.
ZooKeys 364: 47-91.
Aguilar-Puntriano C, Wood Jr PL, Belk M, Duff MH, Sites
Jr JW. 2016. Different roads lead to Rome: integrative
taxonomic approaches lead to the discovery of two
new lizard lineages in the Liolaemus montanus group
(Squamata: Liolaemidae). Biological Journal of the
Linnaean Society 120: 448-467.
Aguilar-Putriano C, Quiroz Rodriguez A, Pérez J. 2017.
Liolaemus insolitus. The IUCN Red List of Threatened
Species 2017: ¢.T48442648A48442655.
Aguilar-Puntriano C, Avila LJ, De la Riva I, Johnson L,
Morando M, Troncoso-Palacios J, Sites Jr JW. 2018.
Amphib. Reptile Conserv.
The shadow of the past: convergence of young and old
South American desert lizards as measured by head
shape traits. Ecology and Evolution 8: 11,399-11,409.
Aguilar-Puntriano C, Ramirez C, Castillo E, Mendoza
A, Vargas VJ, Sites Jr JW. 2019. Three new lizard
species of the Liolaemus montanus group from Peru.
Diversity 11: 161-180.
Carrillo de Espinoza N, Icochea J. 1995. Lista
taxonomica preliminar de los reptiles vivientes del
Pert. Publicaciones del Museo de Historia Natural
U.N.M.S.M (A) 47: 1-27.
Chaparro JC, Quiroz AJ, Mamani L, Gutiérrez RC,
Condor P, De la Riva I, Herrera-Juarez G, Cerdefia J,
Arapa LP, Abdala CS. 2020. An endemic new species
of Andean lizard of the genus Lio/aemus from southern
Peru (Iguania: Liolaemidae) and its phylogenetic
position. Amphibian & Reptile Conservation 14(2)
[General Section]: 47-63 (e238).
Cei JM. 1986. Reptiles del Centro, Centro-oeste y Sur
de la Argentina. Herpetofauna de las Zonas Aridas
y Semidridas. Monograph 4. Museo Regionale di
Scienze Naturali di Torino, Torino, Italy. 527 p.
Cei JM. 1993. Reptiles del Noroeste, Nordeste y Este de la
Argentina. Herpetofauna de las Selvas Subtropicales,
Puna y Pampas. Monograph 14. Museo Regionale di
Scienze Naturali di Torino, Torino, Italy. 949 p.
Cofré H, Marquet P. 1999. Conservation status, rarity,
and geographic priorities for conservation of Chilean
mammals: an assessment. Biological Conservation
88: 53-68.
Elith J, Graham C, Anderson R, Dudik M, Ferrier S,
Guisan A, Hijmans R, Huettmann F, Leathwick J,
Lehmann A. 2006. Novel methods improve prediction
of species distributions from occurrence data.
Ecography 29: 129-151.
Espejo P, Lobos G, Marambio Y, Mella J, Nufiez H, Ruiz
de Gamboa M, Valladares P. 2017. Liolaemus torresi.
The IUCN Red List of Threatened Species 2017:
e.T56154558A56154669.
Etheridge R. 1993. Lizards of the Liolaemus darwini
complex (Squamata, Iguania, Tropiduridae) in
northern Argentina. Bolletino del Museo Regionale di
Scienze Naturali (Torino) 11(1): 137-199.
Etheridge R. 1995. Redescription of Ctenoblepharys
adspersa Tschudi, 1845, and the taxonomy of
Liolaeminae (Reptilia: Squamata: Tropiduridae).
American Museum Novitates 3142: 1-34.
Etheridge R, Espinoza RE. 2000. Taxonomy of the
Liolaeminae (Squamata: Iguania: Tropiduridae)
and a semiannotated bibliography. Smithsonian
Herpetological Information Service 126: 1-64.
Frost DR. 1992. Phylogenetic analysis and taxonomy
of the Tropidurus group of lizards (Iguania:
Tropiduridae). American Museum Novitates 3033:
1-68.
Goloboff PA, Farris JS, Kallersjo M, Oxelman B,
Ramirez MJ, Szumik CA. 2003. Improvements to
August 2021 | Volume 15 | Number 2 | e278
Valladares-Faundez et al.
resampling measures of group support. Cladistics
19: 324-332.
Goloboff PA, Mattoni CI, Quinteros AS. 2006.
Continuous characters analyzed as such. Cladistics
22: 589-601.
Gutiérrez RC, Chaparro JC, Vasquez MY, Quiroz AJ,
Aguilar-Kirigin A, Abdala CS. 2018. Descripcion
y relaciones filogenéticas de una nueva especie de
Liolaemus (Iguania: Liolaemidae) y notas sobre
el grupo de L. montanus de Pert. Cuadernos de
Herpetologia 32(2): 81-99.
Hartley AJ, Chong G, Houston J, Mather AE. 2005.
150 million years of climate stability: evidence from
the Atacama Desert, northern Chile. Journal of the
Geological Society 162: 421-424.
Huamani-Valderrama L, Quiroz AJ, Gutiérrez RC,
Aguilar-Kirigin A, Huanca-Mamani W, Valladares-
Faundez P, Cerdefia J, Chaparro JC, Santa Cruz R,
Abdala CS. 2020. Some color in the desert: description
of a new species of Liolaemus (Iguania: Liolaemidae)
from southern Peru, and its conservation status.
Amphibian & Reptile Conservation 14(3) [Taxonomy
Section]: 1-30 (e250).
Krell FT, Cranston PS. 2004. Which side of the tree is
more basal? Systematic Entomology 29: 279-281.
Langstroth RP. 2011. On the species identities of a
complex Liolaemus fauna from the Altiplano and
Atacama Desert: insights on Liolaemus stolzmanni,
L. reichei, L. jamesi pachecoi, and L. poconchilensis
(Squamata: Liolaemidae). Zootaxa 2809: 20-32.
Laurent RF. 1985. Segunda contribucion al conocimiento
de la estructura taxonomica del género Liolaemus
Wiegmann (Iguanidae). Cuadernos de Herpetologia
1: 1-37.
Laurent RF. 1998. New forms of lizards of the subgenus
Eulaemus of the genus Liolaemus (Reptilia: Squamata:
Tropiduridae) from Peru and Northern Chile. Acta
Zoologica Lilloana 44: 1-26.
Lehr E, Moravec J, Lundberg M, Kohler G, Catenazzi
A, Smid J. 2019. A new genus and species of arboreal
lizard (Gymnophthalmidae: Cercosaurinae) from the
eastern Andes of Pert. Salamandra 55(1): 1-13.
Lobo F. 2001. A phylogenetic analysis of lizards of the
Liolaemus chiliensis group (Iguania: Tropiduridae).
Herpetological Journal \1: 137-150.
Lobo F, Espinoza RE. 1999. Two new cryptic species of
Liolaemus (Iguania: Tropiduridae) from northwestern
Argentina: resolution of the purported reproductive
bimodality of Liolaemus alticolor. Copeia 1999:
122-140.
Lobo JM, Jiménez-Valverde A, Real R. 2007. AUC:
a misleading measure of the performance of
predictive distribution models. Global Ecology and
Biogeography 17(2): 145-151.
Amphib. Reptile Conserv.
Nufiez H, Mella J, Ruiz de Gamboa M. 2017. Liolaemus
audituvelatus. The IUCN Red List of Threatened
Species 2017: e.T56050827A56050948.
Phillips SJ, Anderson RP, Shapire RE. 2006. Maximum
entropy modeling of species geographic distributions.
Ecological Modelling 190: 231-259.
Ruiz de Gamboa M, Valladares P. 2017. Liolaemus
stolzmanni. The IUCN Red List of Threatened Species
2017: ¢.T98580281A69942142.
Ruiz de Gamboa M, Nufiez H, Valladares P, Lobos
G, Mella J. 2017. Liolaemus poconchilensis.
The IUCN Red List of Threatened Species 2017:
e.T56086313A56086315.
Shcheglovitova M, Anderson R. 2013. Estimating
optimal complexity for ecological niche models:
a jackknife approach for species with small sample
sizes. Ecological Modelling 269: 9-17.
Smith HM. 1946. Handbook of Lizards: Lizards of the
United States and of Canada. Comstock Publishers,
Ithaca, New York, USA. 557 p.
Troncoso-Palacios J, Escobar-Gimpel V. 2020. On the
taxonomy of the desert lizard Liolaemus stolzmanni
(Steindachner, 1891): a third point of view (Squamata:
Liolaemidae). Zootaxa 4763(1): 138-144.
Valladares-Faundez P. 2004. Nueva especie de lagarto del
género Liolaemus (Reptilia: Liolaemidae) del norte
de Chile, previamente confundido con Liolaemus (=
Phrynosaura) reichei. Cuadernos de Herpetologia
18: 41-51.
Valladares-Faundez P, Etheridge R, Abdala CS. 2018.
Resurrection and redescription of Liolaemus reichei,
proposal of a neotype to stabilize its taxonomy.
Revista Mexicana de Biodiversidad 89: 393-401.
Valladares-Faundez P, Leon PF, Chipana CJ, Navarro
M, Apaza JI, Caceres C. 2021. Primer registro
de Liolaemus chungara Quinteros et al., 2014 y
Liolaemus pleopholis Laurent, 1998 para Peru
(Reptilia, Liolaemidae). Cuadernos de Herpetologia
35(1): 245-249.
Valladares-Faundez P, Ramirez K, Rojas-Barretas A,
Igreda-Paredes F, Alvarez-Henriquez N, Aragon G,
Franco-Leon P. 2020. Comparacion de la dieta de
Geranoaetus polyosoma en dos localidades desérticas
del sur de Pert y norte de Chile. In: 7épicos en
Biodiversidad Transfronteriza Chile, Peru y Bolivia.
Universidad de Tarapaca y Ministerio de Educacion
de Chile, Arica, Chile. [In Press].
Villegas L, Huamani-Valderrama L, Luque-Fernandez
C, Gutiérrez RC, Quiroz AJ, Abdala CS. 2020. Una
nueva especie de Liolaemus (Iguania: Liolaemidae)
perteneciente al grupo L. montanus en las lomas
costeras del sur de Pert. Revista de Biologia Tropical
68(1): 69-86.
August 2021 | Volume 15 | Number 2 | e278
A new Liolaemus species from Peru
Pablo Valladares-Fatindez is a biologist who graduated from the Austral University of Chile, and obtained a Ph.D.
from the University of Chile. Pablo is currently an academic in the Department of Biology, Science Faculty, University
of Tarapaca, in northern Chile. He is interested in the study of vertebrates from arid and high Andean ecosystems,
particularly lizards of the genera Liolaemus and Microlophus, and is developing studies on their taxonomy, systematics,
ecology, and conservation. Pablo is also developing a herpetological collection of northern Chile.
Pablo J. Franco is a Peruvian biologist, a registered researcher at the National Science and Technology Council
(CONCYTEC), and a faculty member at Jorge Basadre Grohmann National University (UNJBG) in Tacna, southern
Peru. He received his degree in Biology at San Agustin National University (UNSA) and holds a Ph.D. Degree in
Environmental Sciences from Santa Maria Catholic University (UCSM), both in Arequipa, Peru. He has authored
or co-authored several peer-reviewed articles on high Andean ecosystems. Pablo currently serves as director of the
General Research Institute of the Jorge Basadre Grohmann National University in Tacna, Peru. He has developed
several research projects on the ecology and biodiversity of high Andean and desert ecosystems in southern Peru.
Cesar A. Jove is a Peruvian biologist who graduated from Jorge Basadre Grohmann National University (UNJBG) in
Tacna, Peru. With experience in managing research and environmental projects, he has participated in research projects
on the flora and fauna associated with high Andean forests and wetlands. He currently works as a research assistant at
the National University of Moquegua (UNAM) in Peru.
_ Marco Alberto Navarro Guzman is a Peruvian biologist who graduated from the Jorge Basadre Grohmann National
; University of Tacna, Peru, as a specialist in biodiversity and conservation. He is interested in the study of arid and high
, Andean ecosystems, particularly in the modeling of ecological niches and habitats of wild flora and fauna species,
| in order to improve their conservation strategies. Marco also works in conservation management in the Regional
Management of Natural Resources and Environmental Management of the Regional Government of Tacna, Peru.
Javier Ignacio-Apaza is a Peruvian who obtained a Bachelor’s Degree from the Jorge Basadre Grohmann National
University, Tacna, Peru. Javier has supported various efforts in the field in evaluations of flora and fauna in the regions
of Tacna and Moquegua, Peru.
Cesar N. Caceres M. is a biologist who graduated from the Jorge Basadre Grohmann National University, with a
Master’s Degree in Tropical Botany from the National University of San Marcos in Peru. He is a specialist in flora and
desert ecosystems, and a member of the Takana-Tacna Herbarium.
~~ Robert Langstroth is a herpetologist, biogeographer, and environmental professional with an M.S. from the University
— of California, Davis (USA) and a Ph.D. from the University of Wisconsin, Madison (USA). His work focuses on the
biogeography and taxonomy of South American lizards, the biogeography of the South American open formations, and
| the application of biodiversity mainstreaming and safeguards to enhance the sustainability of economic development.
* Robert is an associate researcher of the Coleccion Boliviana de Fauna, and currently serves as an IUCN Red List
Taxonomic Authority for the Liolaemidae and as a senior biodiversity and environmental safeguards specialist at a
multilateral development bank in Washington, DC, USA.
’ Alvaro Aguilar-Kirigin is a Bolivian biologist who graduated from the Universidad Mayor de San Andrés, La Paz,
« Bolivia. He has been a researcher at the Coleccién Boliviana de Fauna specializing in herpetology since 2002, and is a
& member of the Bolivian Network of Researchers in Herpetology. He carried out two research internships, in Argentina and
Uruguay, focusing on the systematics and phylogeny of Liolaemus and the latitudinal patterns of seasonal changes in fat
—- body size in 59 species of lizards. He has authored over 35 publications (18 peer-reviewed), 10 book chapters, and seven
- technical cards as part of book chapters, including the descriptions of three species of Liolaemus. Alvaro is interested in
| integrative taxonomy, especially in the genus Liolaemus, because of its phenotypic plasticity in the Andean region. As a
line of research, he is making progress with linear models in the study of classical comparative morphometry. He is also
linked to conservation efforts for the wildlife that inhabit the Amazonian forest in the Department of Beni in Bolivia.
Roberto C. Gutiérrez is a biologist who graduated from the National University of San Agustin de Arequipa of
Peru. Roberto is currently the Curator and Principal Researcher of the Herpetological Collection, Museo Nacional de
Historial Natural, Universidad Nacional de San Agustin, Arequipa, Peru, and Vice President and Founding Member
of the Herpetological Association of Peru (AHP). He is interested in the herpetofauna of the tropical Andes and the
coastal desert, with a special focus on lizards of genus Liolaemus, and is developing studies in the systematics of
amphibians and reptiles, ecology, and conservation. Roberto has conducted several biodiversity inventories, biological
assessments, and biodiversity monitoring programs, and is currently working at the Natural Protected Areas Service of
the Peruvian Ministry of Environment.
Cristian S. Abdala is an Argentinian biologist, a researcher at CONICET, and a professor at the Universidad Nacional
de Tucuman (UNT) in Argentina. Cristian received his Ph.D. degree from UNT, and is a herpetologist with extensive
experience in the taxonomy, phylogeny, and conservation of Liolaemus lizards. He has authored or co-authored over 90
peer-reviewed papers and books on herpetology, including the descriptions of 58 recognized lizard species, mainly in
genus Liolaemus. One species, Liolemus abdalai, has been named in his honor. He has conducted several expeditions
through Patagonia, the high Andes, Puna, and the salt flats of Argentina, Chile, Bolivia, and Peru. From 2016 to 2020,
Cristian has been the president of the Argentine Herpetological Association.
Amphib. Reptile Conserv. 22 August 2021 | Volume 15 | Number 2 | e278
Official journal website:
amphibian-reptile-conservation.org
Amphibian & Reptile Conservation
15(2) [General Section]: 23-30 (e279).
New records of the Endangered Szechwan Rat Snake,
Euprepiophis perlaceus (Stejneger, 1929) (Squamata:
Colubridae: Coronellini), from Shaanxi, China
'Shi-Yi Tang, 7?Chen-Liang Li, ‘Yu-Li Li, and '**Bao-Guo Li
'Shaanxi Key Laboratory for Animal Conservation, College of Life Sciences, Northwest University, Xi'an 710069, CHINA *Hubei Broad Nature
Technology Service Co., Ltd., Wuhan 430079, CHINA ?CAS Center for Excellence in Animal Evolution and Genetics, Chinese Academy of Sciences,
Kunming, 650223, CHINA
Abstract.—The Szechwan Rat Snake (Euprepiophis perlaceus Stejneger, 1929) is an Endangered species that is
endemic to China. Previous documentation indicates that it is only distributed in narrow mountainous regions
in Sichuan. However, some recent sighting records indicate the existence of another population located in the
Mts. Qinling, Shaanxi, more than 470 km NW from the original known locality. Here, we report the morphological
details of a live-captured individual of Euprepiophis perlaceus, and provide information on its taxonomy,
distribution, ecology, and conservation implications, along with references to the published literature from
Chinese sources.
Keywords. Asia, conservation, morphology, Qinling Mountains, range extension, Reptilia
Citation: Tang SY, Li CL, Li YL, Li BG. 2021. New records of the Endangered Szechwan Rat Snake, Euprepiophis perlaceus (Stejneger, 1929)
(Squamata: Colubridae: Coronellini), from Shaanxi, China. Amphibian & Reptile Conservation 15(2) [General Section]: 23-30 (e279).
Copyright: © 2021 Tang et al. This is an open access article distributed under the terms of the Creative Commons Attribution License [Attribution
4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction in any
medium, provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced, are
as follows: official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 2 August 2020; Published: 29 August 2021
Introduction
The Szechwan Rat Snake (also called Pearl-banded Rat
Snake) was first described by the American herpetologist
Leonhard Stejneger as Elaphe perlacea, based on a
male specimen obtained in Yachow (Ya’an Prefecture),
Szechwan, China, in 1928 (Stejneger 1929), and there
had been no further studies on its distribution from then
until the early part of this century (Zhao 2006; Hu et
al. 2002). This snake was once considered extinct, or
regarded as a sub-species or even just a morphological
variation of the Mandarin Rat Snake, Elaphe mandarina
(Schulz 1989; Zhao 2006), since the location of its type
species is in the areas where Elaphe mandarina is found,
and there are many morphological similarities between
the two species (Schulz 1989, 1996).
The debate over its status as a distinct species has
diminished since three new specimens of Elaphe
perlacea were recorded between 1980 and 1988, from
Wolong National Nature Reserve, Wenchuan County
in Aba Tibetan-Qiang Autonomous Prefecture, and
Hailuogou National Glacier Forest Park, Luding County,
Ganzi Tibetan Autonomous Prefecture (Deng and Jiang
1989). Zhao (1990) reexamined the morphological
characters of the newly found specimens and argued that
Elaphe perlacea should be considered as a valid species
due to some distinctive features compared to Elaphe
mandarina. Schulz (1996) supported this assumption, and
Elaphe perlacea appears on the list of his A Monograph
of the Colubrid Snakes of the Genus Elaphe. Chen et
al. (2014) used multi-locus data obtained from tissue
samples of three Euprepiophis perlaceus (synonym of
Elaphe perlacea) individuals and used coalescent model-
based approaches to clarify the species validity and
explore phylogenetic relationship between this species
and others. The results showed that: “Euprepiophis
perlaceus is a distinct species sister to Euprepiophis
mandarinus (synonym of Elaphe mandarina).” The
genus Euprepiophis contains three species (Euprepiophis
mandarinus, Euprepiophis perlaceus, and Euprepiophis
conspicillata), and has also been recently separated from
the other rat snake lineages (Utiger et al. 2002; Chen et
al. 2014).
Based on the collection of more specimens, the
distribution of Euprepiophis perlaceus was found to
be broader, including two counties in Ya’an Prefecture
(Shimian County and Baoxing County) and another two
counties in Leshan Prefecture (Mabian County and E’ bian
Correspondence. ! [email protected] (SYT), [email protected] (CLL), [email protected] (YLL), *[email protected] (BGL)
Amphib. Reptile Conserv.
August 2021 | Volume 15 | Number 2 | e279
Szechwan Rat Snake in Shaanxi, China
County) (Hu et al. 2002; Zhou et al. 2012; Ding et al.
2017). All these sites are within a narrow area in western
Sichuan (Fig. 1, Zhou et al. 2002; Chen et al. 2014).
However, a photograph taken during a field survey by
Northwest Agriculture and Forestry University in 2013
raised the question as to whether Euprepiophis perlaceus
is also located in Ningshan, Ankang Prefecture, Shaanx1,
China (Ding et al. 2017). This would extend its known
distribution by about 470 km NW from the localities
previously reported, and if this is the case, more sighting
records of Euprepiophis perlaceus should be obtained
through extensive surveys in this area. Five years after
the 2013 record, one of the authors confirmed another
record based on a video recording taken during a field trip
on 18 May 2018, at Zhouzhi, Xi’an Prefecture, Shaanx1,
China (Table 1). Nevertheless, no voucher specimen
was available until an extensive search was conducted
during summer 2019, in which the authors obtained a
live individual in Foping County, Hanzhong Prefecture,
Shaanxi Province, China.
Thus, in this study, the morphological characters of
a live Euprepiophis perlaceus individual captured in
Shaanxi are described, followed by an assessment of
all the encounter records recently reported in Shaanxi,
including some unpublished records. In addition, a
preliminary assessment of its distribution, ecology,
and conservation are also discussed based on sources
published in the Chinese literature.
Materials and Methods
The specimen was encountered at 1117 h (GMT + 8)
from a pile of dead leaves at the base of a cliff, near a
cement road, in a valley of Foping County, Hanzhong
Prefecture, Shaanxi, China, on 23 June 2019 (elevation:
1,650 m asl). The surrounding habitat was secondary
deciduous broadleaf forest consisting of high arbors and
shrubs (Fig. 3). The photo of the specimen was taken
with a digital Nikon D810 camera with an AF-S Micro
NIKKOR 60 mm F2.8G lens, and the specimen was
then kept in the Shaanxi Key Laboratory for Animal
Conservation, Northwest University, Xi’an, Shaanxi,
China. The equipment used in taking the measurements
included a caliper (to the nearest 0.1 mm), a measuring
tape (to the nearest | mm for snout-vent lengh (SVL)
and tail length (TL)), and a piece of soft rope. The
total body length, SVL (from the snout to the posterior
margin of the anal plate), and tail length (TL) were
firstly marked on the soft rope and then measured with
the measuring tape. Sex was determined via a Rapti-
zoo SEOO1 Snake sex probe speculum following the
method of Blanchard and Finster (1933) and Fitch
(1960).
Additional visual records of Euprepiophis
perlaceus were collected through browsing local
social media (e.g., “WeChat”) for the snake’s images
and the published records in Chinese sources. We also
interviewed the witnesses or photographers taking the
photos to obtain more information on the locations and
times the photos were taken. The elevations where the
Euprepiophis perlaceus were encountered in Shaanxi
are provided in Table 1, and were obtained according to
location landmarks with Google Earth Pro 7.3.0.3832
(64-bit), when information on the exact locations could
be obtained.
Results and Discussion
This species is characterized by a moss-green color with
paired black bands (1—2 widths of the dorsal scale row)
mixed with yellow-green edges on the dorsum and tail.
The snout and forehead have two black strips extending
through the nostrils and eyes, respectively, both ending
on the supralabials, with a second strip separated into
two branches beneath the eyes. Posterior to the strips,
there are three black V-shaped patterns aligned on the
upper surface of head, occiput, and back. The belly is
greyish white with dark gray blotches. The snout is
obtuse. There is no distinct separation between head
and neck. The eyes are entirely black. Anal is divided
into two parts. Along with the external morphological
characters given in Fig. 2 and Table 2, the description
and measurements of the captured individual are
consistent with those taken by Zhao (1998, 2006) and
Table 1. New distributional records of Euprepiophis perlacea in Shaanxi, China.
Location Month and year
Ningshan, Ankang Prefecture July 2020
Huxian, Xi’an Prefecture May 2020
Ningshan, Ankang Prefecture July 2019
Foping, Hanzhong Prefecture June 2019
Ningshan, Ankang Prefecture June 2019
Zhouzhi, Xi’an Prefecture August 2018
Zhouzhi, Xi’an Prefecture May 2018
Ningshan, Ankang Prefecture June 2017
Ningshan, Ankang Prefecture June 2016
Ningshan, Ankang Prefecture June 2013
Amphib. Reptile Conserv. 24
Elevation (m asl) Reference
- pers. comm.
- pers. comm.
1,520 pers. comm.
1,650 this study
1,422 Wuet al. 2019
1,790 pers. comm.
1,440 this study
- pers. comm.
- pers. comm.
1,610 Ding et al. 2017
August 2021 | Volume 15 | Number 2 | e279
Tang et al.
104°E 108°E
38°N 38°N
34°N 34°N
30°N 30°N
Legends
A Previous records
A New localities
==: Province Border
104°E 108°E
Fig. 1. New locations where Euprepiophis perlaceus was found in Shaanxi, including Ningshan, Foping, Zhouzhi,
and Huxian. The previous distribution localities of the species in Sichuan include Ya’an, Wenchuan, Luding, Shimian,
Baoxing, Mabian, and E’bian.
Fig. 2. Dorsal view of Euprepiophis perlaceus captured in Foping County, Hanzhong Prefecture, Shaanxi Province,
China. Photo by Shi-Yi Tang.
Amphib. Reptile Conserv. 25 August 2021 | Volume 15 | Number 2 | e279
Szechwan Rat Snake in Shaanxi, China
Fig. 3. View of the Euprepiophis perlaceus habitat in
Foping, Shaanxi Province, China. Photo by Bin Yang.
Ding et al. (2017) (Table 3).
Records of Euprepiophis mandarinus were also
reported in various plots around our research area
(Wang and Song 2000; S.Y. Tang et al., pers. comm.).
However, Euprepiophis mandarinus has a greater
body length (largest measured specimen: 1,425 mm)
compared with Euprepiophis perlaceus (largest
measured specimen: 1,244 mm) (Zhao 1998). The
upper body and tail are purplish gray or yellowish
brown with conspicuous yellow spots edged by black
diamond circles, which were distinct from Euprepiophis
perlaceus (see the description above). The temporals of
Euprepiophis mandarinus were 2+3, which is different
from Euprepiophis perlaceus and Euprepiophis
conspicillata (temporals: 1+2) (Table 3; Zhao 1998).
The number of dorsal scale rows for Euprepiophis
mandarinus is 23-23-19 (for the number of dorsal scale
rows counted: behind the head-middle ventral-before
the tail), which is different from Euprepiophis perlaceus
(19-19-17) (Table 3). Euprepiophis conspicillata is
endemic to the Japanese archipelago, which has no
distributional overlap with the other two species in the
genus Euprepiophis (Stejneger 1907).
Preliminary research on the range and ecology of
Euprepiophis perlaceus in Sichuan indicated that the
preferred habitats are deciduous broadleaf forest and
mixed evergreen deciduous broad-leaved forest in
temperate mountains with elevations of 1,600—2,800
Amphib. Reptile Conserv.
m asl (Gan et al. 2017; Ding et al. 2017). The habitat
where Euprepiophis perlaceus was found in Shaanxi is
very similar to those reported in Sichuan. Considering
the topography, climate, mountain range alignment,
and the spatial pattern of vegetation types in Southern
Shaanxi, Northern Sichuan, and Southeastern Gansu,
suitable habitats for Euprepiophis perlaceus might be
widely distributed in this area (Zhang 2010; Cheng and
Wang 2019; Fig. 1). As this snake 1s constantly being
encountered by humans in different counties within
the Mts. Qinling (a major mountain range in Southern
Shaanxi, where all the sighting records of Euprepiophis
perlaceus were reported; Fig. 1, Table 1), we believe
the actual distribution areas in Shaanxi are broader than
previously known. In fact, populations of Euprepiophis
perlaceus in the two neighboring provinces may
form a continuous range. This proposition could be
physically confirmed by conducting extensive surveys
to the areas with deciduous broadleaf forests in the
Mts. Qinling. Additional surveys should focus on the
western part of this mountain range, where there are
gaps between the known locations of the neighboring
provinces. Further studies on the morphological and
molecular components, and comparisons with other
species in the same genus, are needed in order to fully
understand the phylogenetic relationships between
the two populations, or sub-populations in varying
geographic scopes (e.g., between sub-populations in
the southern and northern slopes of the Mts. Qinling).
As the main body of the Mts. Qinling, the southern
Shaanxi is famous for its global biodiversity hotspots
and refugia and for many endangered mammals and
birds, particularly during the last glaciation (Wang
et al. 2013). The Chinese Government has invested a
great deal of manpower in the conservation of “four
precious species in the Mts. Qinling” (Giant Panda,
Ailuropoda melanoleuca;, Golden Snub-nosed Monkey,
Rhinopithecus roxellana, Crested Ibis, Nipponia
nippon, and Takin, Budorcas taxicolor). Euprepiophis
perlaceus has been listed as Endangered on the JUCN
Red List of Threatened Species (Zhou et al. 2012), and
the new distribution records in southern Shaanxi caught
our attention for the conservation of this species, as
well as other Threatened or Endangered amphibians
and reptiles in this area. It is necessary to raise the
issues of a conservation strategy for this snake species,
in addition to carrying out further surveys and studies
on its ecology, behavior, and dietary selection. At the
moment, what we know about its conservation status
is that like most other ophidian species, the most likely
threats to Euprepiophis perlaceus could include road
accidents (traffic 1s heavy in the areas), habitat loss,
poaching (for bushmeat), intentional killing due to the
fear of snakes in the local culture, natural disasters
(such as floods), and predation by other animals (Zhou
et al. 2019). Although a series of natural reserves has
been established in the Mts. Qinling, rapid tourism
August 2021 | Volume 15 | Number 2 | e279
Tang et al.
Table 2. Morphological information and pholidosis data of the Euprepiophis perlacea specimen used in this study.
Parameter
Collection locality
Elevation
Sex
Date of collection
Collector
Total body length
Snout to vent length
Tail length
Head length
Head width
Diameter of eye
Eye-nose"
Number of ventrals
Pairs of subcaudals
DORI”
DOR2™
DOR3”™
Number of temporals
Number of supralabials
Number of supralabials
touching the eyes
Number of infralabials
Number of loreals
Number of pre-oculars
Number of post-oculars
Value or information
Foping, Hanzhong Prefecture, Shaanxi, China
1,650
male
23 June 2019
Shi- Yi Tang
907 mm
725 mm
182 mm
18.1 mm
13.6 mm
3.6mm
6.6 mm
225
66
3" and 4
— — CO
2
* Eye-nose: distance from center of the eye to posterior border of the nostril.
**T)OR1: number of dorsal scale rows at one head-length behind the head; DOR2: number of dorsal scale rows at the
position of the middle ventral; DOR3: number of dorsal scale rows at one head-length before the tail.
development would inevitably lead to the expansion
of roads and other artificial constructions, while
increasing human disturbance in this area.
Overharvesting for the pet trade may be another
major challenge to the conservation of Euprepiophis
perlaceus (Zhou et al. 2019). A preliminary
investigation into the underground pet market showed
this snake had become one of the most sought-
after species for reptile collectors. It sells for about
US$400-1,000, probably due to its rarity, mild-temper,
and attractive appearance (Zhou et al. 2019; S.Y. Tang
et al., pers. comm.). To avoid the risk of increased
poaching activity, as suggested by Ngo et al. (2019),
we did not provide the exact localities where the
Euprepiophis perlaceus population was found in this
paper.
In summary, the distribution of Euprepiophis
perlaceus is broader than previously reported.
Unfortunately, this Endangered species has received
Amphib. Reptile Conserv.
very little attention, since no conservation plan or
effort has been proposed so far. Thus, we argue that
appropriate conservation strategies and management
are necessary, and scientific studies on its life-history,
behavior, reproduction, and population genetics are
needed, as proposed by Gan et al. (2017), Ding et al.
(2017), and Zhou et al. (2019). A monitoring system
on the dynamic population profiles of this species
should be established, so that emergency strategies
for its conservation could be applied if a significant
population decline was detected. On the other hand,
more technical programs for captive breeding are also
required (Chen et al. 2017).
Acknowledgements.—We are grateful to Qinglin
Research Station of Endangered Animals, located in
the Foping and Shaanxi Longcaoping Forestry Bureau,
for permission to carry out this study and providing
logistic support. Special thanks to Prof. Fa-Dao Tat,
27 August 2021 | Volume 15 | Number 2 | e279
Szechwan Rat Snake in Shaanxi, China
Table 3. Morphological information and pholidosis data of the three recognized species in the genus Euprepiophis:
Euprepiophis perlaceus, Euprepiophis mandarinus, and Euprepiophis conspicillata.
Species
Distribution
Threat level (UCN)
Number of ventrals
Pair of subcaudals*
DORI”
DOR2™
DOR3”
Number of temporals
Number of supralabials
Number of supralabials
Euprepiophis perlaceus
China (Sichuan Province
and Shaanxi Province)
Endangered
224-231
57-69
1+2 (1+3 in rare cases)
7
Euprepiophis mandarinus
China (nearly all central and southern
provinces), northeastern Indo-Chinese
Peninsula
Least Concern
181-237
53-75
23
23
19
2+3
7 (6 or 8 in rare cases)
Euprepiophis conspicillata
Japanese archipelago
Least Concern
200-227
60-76
Dit
1+2 (2+2 in rare cases)
7 (6 or 8 in rare cases)
34 and 4"
9
1 (lacking in one side in rare
cases)
2
1
divided (undivided in rare
rd th rd th
touching the eye Seance earn
Number of infralabials 7-9 9
Number of loreals l 1 (lacking in one side in rare cases)
Number of post-oculars 2 2 (1, 3 or lacking in one/both sides in
rare cases)
Number of pre-oculars 1 1
Anal divided divided
Stejneger 1929; Zhao 1998;
References This study; Zhou et al. Zhao 1998; Ji et al. 2012
2012
* The terminal scute had been excluded.
cases)
Stejneger 1907; Borkin et
al. 2017
** TXOR1: number of dorsal scale rows behind the head; DOR2: number of dorsal scale rows at the position of
the middle ventral; DOR3: number of dorsal scale rows before the tail. For DOR1 and DOR3, the positions of
scale rows counting are different, and for Euprepiophis perlaceus, we counted the scale rows at one head-length
behind the head for DOR1 and at one head-length before the tail for DOR3. Zhao (1998) used similar criteria in
describing Euprepiophis mandarinus, but the scale rows were counted at two head-lengths behind the head (for
DOR1), or before the tail (for DOR3).
*** Stejneger (1907) only generally described number of scale rows of Euprepiophis conspicillata as 21, without
documenting the positions where the scale rows had been counted.
Mr. Bin Yang, Mr. Hai-Tao Zhao, Mrs. Rui Hu, Mr. Yi-
Fei Gao, Mr. Bo Tan, Mr. Yan-Bo Ma, and Mr. Qiang
Cao for their help with artificial feeding, morphological
measurements, and sharing valuable information about
additional localities of the species in Shaanxi. Deepest
regards to Prof. Ru-Liang Pan, Dr. Chang-Cao Wang,
and two anonymous reviewers for their valuable
comments on the original manuscript. This research
was supported by the Postdoctoral Science Foundation
of Northwest University, the National Science
Foundation for Young Scientists of China (31800318),
and the National Key Programme of Research and
Development, Ministry of Science and Technology
(2016YFC0503200). All the works reported here
adhered to the laws of People’s Republic of China on
the protection of wildlife, and our field surveys were
conducted with the approval of Northwest University.
Amphib. Reptile Conserv.
28
References
Blanchard FN, Finster EB. 1933. A method of marking
living snakes for future recognition, with a discussion
of some problems and results. Ecology 14(4): 334—
347.
Borkin L, Kidera N, Ota H. 2017. Euprepiophis
conspicillata. The IUCN Red List of Threatened
Species 2017: e.T47755805A47755812.
Chen X, Jiang K, Guo P, Huang S, Rao DQ, Ding L,
Takeuchi H, Che J, Zhang YP, Myers EA, et al. 2014.
Assessing species boundaries and the phylogenetic
position of the rare Szechwan Rat Snake, Euprepiophis
perlaceus (Serpentes: Colubridae), using coalescent-
based methods. Molecular Phylogenetics and
Evolution 70: 130-136.
Chen ZN, Gan SX, Ding L, Zhou CQ, Mao XT, Zhao
August 2021 | Volume 15 | Number 2 | e279
Tang et al.
KL. 2017. The experimental captive breeding for the
Euprepiophis perlacea. Journal of Sichuan Forestry
Science and Technology 38(2): 55-58. [In Chinese].
Cheng K, Wang JL. 2019. Forest type classification
based on_ integrated spectral-spatial-temporal
features and random forest algorithm—a case study
in the Qinling Mountains. Forests 10: 559. [In
Chinese].
Deng QX, Jiang YM. 1989. The Elaphe perlacea in
China. Journal Sichuan Teaching College 10(2):
120-122. [In Chinese].
Ding L, Gan SX, Shi JS, Huang YH, Li SB, Liu JB, Zhou
SY, Zhou CQ. 2017. A supplementary description of
Euprepiophis perlacea (Stejneger, 1929) by means
of a new distribution record in Shaanxi Province.
Journal of Sichuan Forestry Science and Technology
38(2): 36-39. [In Chinese].
Dowling HG. 1951. A proposed standard system of
counting ventrals in snakes. British Journal of
Herpetology 1(5): 97-99.
Fitch HS. 1960. Criteria for determining sex and
breeding maturity in snakes. Herpetologica 16(1):
49-51.
Gan SX, Ding L, Yang HZ, Zhou CQ, Zhao KL. 2017.A
preliminary study of selecting key ecological factors
of the suitable habitats for Euprepiophis perlacer.
Journal of Sichuan Forestry Science and Technology
38: 40-44. [In Chinese].
Hu J, Li YH, Li C, Hu JC, Wang HJ. 2002. The present
status of Transverse-banded Racer. Sichuan Journal
of Zoology 21(3): 184-185. [In Chinese].
Ji X, Wang Y, Guo P. 2012. Euprepiophis mandarinus.
The IUCN Red List of Threatened Species 2012:
e.T192138A2045703.
Ngo HN, Le TQ, Pham ML, Nguyen TQ, Le MD, van
Schingen M, Ziegler T. 2019. First record of the
Cat Ba Tiger Gecko, Goniurosaurus catbaensis,
from Ha Long Bay, Quang Ninh Province, Vietnam:
microhabitat selection, potential distribution,
and evidence of threats. Amphibian & Reptile
Conservation 13(2) [General Section]: 1-13 (e183).
Schulz KD. 1989. Die hinterasiatischen Kletternattern
der Gattung Elaphe. Teil XVI: Elaphe perlacea,
Stejneger, 1929. Sauria 11(2): 15-16.
Schulz KD. 1996. A Monograph of the Colubrid Snakes
Amphib. Reptile Conserv.
of the Genus Elaphe Fitzinger. Koeltz Scientific
Books, Havlickuv Brod, Czech Republic. 439 p.
Steyneger L. 1907. Herpetology of Japan and adjacent
territory. Bulletin of the United States National
Museum 58: 1-577.
Steyjneger L. 1929. A snake from China. Proceedings of
the Biological Society of Washington 42: 129-130.
Utiger U, Helfenberger N, Sechatti B, Schmidt C, Ruf
M, Ziswiler V. 2002. Molecular systematics and
phylogeny of Old and New World ratsnakes, Elaphe
auct., and related genera (Reptilia, Squamata,
Colubridae). Russian Journal of Herpetology 9(2):
105-124.
Wang B, Jiang JP, Xie F, Li C. 2013. Phylogeographic
patterns of mtDNA variation revealed multiple
glacial refugia for the frog species Feirana
taihangnica endemic to the Qinling Mountains.
Journal of Molecular Evolution 76(3): 112-128.
Wang TJ, Song MT. 2000. A study on the species
diversity of amphibians and reptiles in Foping
National Nature Reserve. Cultum Herpetologica
Sinica 8: 109-115. [In Chinese].
Wu YQ, Wang KF, Ren JL. 2019. A new province record
in Shanxi, Euprepiophis perlacea. Sichuan Journal
of Zoology 38(6): 672. [In Chinese].
Zhang W. 2010. The analysis of vegetation-environment
correlation in West Qinling Mountains. M.S. Thesis,
Nanjing Normal University, Nanjing, China. [In
Chinese].
Zhao EM. 1990. The validity of Elaphe perlacea, a
rare endemic snake from Sichuan province, China.
Asiatic Herpetological Research 3: 101-103. [In
Chinese].
Zhao EM, Huang MH, Zong Y. 1998. The Fauna of
China, Reptilia. Science Press, Beijing, China. [In
Chinese].
Zhao EM. 2006. Snakes of China. Anhui Science and
Technology Press, Hefei, China. [In Chinese].
Zhou Y, Wang KF, Yang K, Liu W, Ding L, Huang Y.
2019. Preliminary exploration of morphological
characters of Euprepiophis perlacea. Sichuan
Journal of Zoology 38(2): 157-162, [In Chinese].
Zhou Z, Guo P, Jiang J. 2012. Euprepiophis perlacea.
The IUCN Red List of Threatened Species 2012:
e.T192132A2044734.
August 2021 | Volume 15 | Number 2 | e279
Amphib. Reptile Conserv.
Szechwan Rat Snake in Shaanxi, China
Shi- Yi Tang has been involved in specimen collection, photography, and behavioral studies
of insects, amphibians, reptiles, and birds since childhood. His research interests lie largely
with taxonomy, distribution, behavioral ecology, and conservation of wild animals across
diverse taxa. Shi-Y1 Tang finished his Ph.D. in 2017 at Wuhan University, China, majoring
in avian behavioral ecology. He spent nearly 20 months in total at various field research
sites in the Qinghai-Tibetan plateau between 2008 and 2016, and had been appointed as a
visiting Ph.D. student in Cornell University (Ithaca, New York, USA) from September 2012
to June 2013. Shi-Yi Tang is currently working as a post-doctoral fellow at Shaanxi Key
Laboratory for Animal Conservation, College of Life Sciences, Northwest University, Xi’ an,
China, where he is involved in several research programs on the ecology and biodiversity
conservation of endangered animal species in Mts. Qinling.
Chen-Liang Li is a herpetologist currently working as the director of Hubei Board Nature
Technology Service Co., Ltd. He obtained his doctoral degree in 2016 at the College of Life
Sciences, Central China Normal University, where he majored in animal behavioral ecology
and conservation. His research interests include the taxonomy, distribution, behavioral
ecology, and conservation of amphibians and reptiles, as well as threatened animal species 1n
other taxa. Chen-Liang Li is currently conducting several projects related to environmental
education for wildlife in China, while promoting a habitat conservation plan for the Critically
Endangered Baer’s Pochard, Aythya baeri.
Yu-Li Li is currently working on her Ph.D. degree under the supervision of Professor Bao-
Guo Li at Shaanxi Key Laboratory for Animal Conservation, College of Life Sciences,
Northwest University (Xi’an, China). Yu-Li finished her M.A.Sc. degree in 2011 at the
Northwest Agriculture and Forestry University. Her work focuses on the ecology, population
genetics, and conservation of endangered animal species in the Mts. Qinling.
Bao-Guo Li is a professor at Shaanxi Key Laboratory for Animal Conservation, College of
Life Sciences, Northwest University (Xian, China). He guides the research of Ph.D. students
as well as M.Sc. students. He graduated in 1982 from the Shaanxi Normal University with
a B.S. in Zoology, and then obtained his M.S. from Northwest University (China) in 1985.
He had been appointed as a visiting professor in Kyoto University (Japan) from May 2001
to April 2002, and a visiting professor in Massey University (New Zealand) in 2007. His
research interests are mainly on the social behavior and conservation biology of endangered
animals in Mts. Qinling. He has been supervising projects supported by NSFC, Pro-Natura
Fund of Japan, COSMO Oil Eco Card Foundation of Japan, Primate Conservation Inc.,
and the Zoological Society of San Diego (California, USA). Prof. Bao-Guo Li has received
many accolades for his contributions to wildlife research and biodiversity conservation in
China.
30 August 2021 | Volume 15 | Number 2 | e279
Official journal website:
amphibian-reptile-conservation.org
Amphibian & Reptile Conservation
15(2) [General Section]: 31-39 (e281).
Description of the tadpole and natural history notes of
Incillus spiculatus (Mendelson, 1997), an Endangered toad
endemic to the Sierra Madre de Oaxaca, Mexico
‘Medardo Arreortua, ‘Carlos A. Flores, ‘Pablo Rogelio Simon-Salvador, ‘Hermes Santiago-Dionicio,
and 2’Edna Gonzalez-Bernal
Instituto Politécnico Nacional, CIIDIR Unidad Oaxaca, Laboratorio de Ecologia de Anfibios (ECA), Hornos 1003, Col. Noche Buena, 71230,
Santa Cruz Xoxocotlén, Oaxaca, MEXICO *CONACYT-Instituto Politécnico Nacional, CIIDIR Unidad Oaxaca, Laboratorio de Ecologia de
Anfibios (ECA), Hornos 1003, Col. Noche Buena, 71230, Santa Cruz Xoxocotlan, Oaxaca, MEXICO
Abstract.—Amphibian populations are declining rapidly around the world. However, new amphibian species
keep being discovered, reflecting the still expanding state of our knowledge of this group. Similarly, there is
a lack of information regarding life cycles, particularly among those species that have indirect development
with a free-living larval stage. Many amphibian larvae are still unknown or undescribed, thus impeding a proper
understanding of the biology and habitat use of many species. In this paper, we describe the tadpole of the
Endangered bufonid anuran /ncilius spiculatus, a member of a clade known as forest toads. Also described
are the amplexus behavior of this species observed in nature, and aspects of the natural history of the adult
stage. A tadpole identification key is provided for the forest toad clade of Mexico and Central America. This
information contributes to the understanding of the life history of /. spiculatus, in addition to its diet and
distributional patterns. This article highlights the importance of knowing the complete life cycle of a species
in order to establish effective conservation plans, particularly for those species with limited distributions in
highly managed ecosystems.
Keywords. Anura, forest toads, valliceps group, amplexus, stream breeding, scorpion predation
Citation: Arreortua M, Flores CA, Simén-Salvador PR, Santiago-Dionicio H, Gonzalez-Bernal E. 2021. Description of the tadpole and natural
history notes of Incilius spiculatus (Mendelson, 1997), an Endangered toad endemic to the Sierra Madre de Oaxaca, Mexico. Amphibian & Reptile
Conservation 15(2) [General Section]: 31-39 (e281).
Copyright: © 2021 Arreortua et al. This is an open access article distributed under the terms of the Creative Commons Attribution License [Attribution
4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction in any
medium, provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced, are
as follows: official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 22 August 2020; Published: 26 August 2021
Introduction
In recent years, the continuing discovery of new
amphibian species (Canseco-Marquez et al. 2017;
Jiménez-Arcos et al. 2019; Parra-Olea et al. 2020) and
larval phases (Downie et al. 2015; Kaplan and Heimes
2015; Kohler et al. 2015) has revealed the limited state of
our knowledge regarding amphibians, which are currently
the vertebrate group with the highest risk of extinction
(Beebee and Griffith 2005; IUCN 2020; Scheele et al.
2019; Stuart et al. 2008).
A similar situation is the lack of information that
exists regarding life cycles, in particular for those species
that exhibit indirect development with a free-living larval
stage. These species usually inhabit different habitats
throughout their life cycle and play different ecological
roles in relation to their development stages. For example,
most tadpoles contribute to maintaining healthy water
bodies by consuming algae and breaking down organic
material (Cortés-Gomez et al. 2015), while transferring
energy between aquatic and terrestrial habitats (Flecker
et al. 1999; Kupferberg 1997; Regestert et al. 2008). As
adults, these organisms usually prey on invertebrates,
thus controlling their populations, while at the same time
acting as prey for other organisms (Duellman and Trueb
1994; Stewart and Woolbright 1996). This duality also
means that each life-history stage is exposed to different
risk factors. Thus, when aiming to conserve a species
with a biphasic life cycle, it is essential that we have
thorough knowledge of both life-history stages.
Toads of the genus J/ncilius are anurans with a
biphasic life cycle which inhabit the Americas. Their
geographical distribution ranges from the southern edge
of the United States to northern Colombia (Mendelson
et al. 2011). Currently the genus contains 40 recognized
species, of which 23 have a distribution within Mexico
(AmphibiaWeb 2020; Wilson et al. 2013; Schachat et al.
2016). Among these are the so-called forest toads, a clade
that groups various species that inhabit wet forests and
are sensitive to habitat transformation as detected in their
Correspondence. *“[email protected] (EGB), [email protected] (MA), [email protected] (CAF), rogeliosimon-
[email protected] (PRSS), [email protected] (HSD)
Amphib. Reptile Conserv.
August 2021 | Volume 15 | Number 2 | e281
Incilius spiculatus in Oaxaca, Mexico
adult stage (Mendelson et al 2011). Despite this known
sensitivity, information on the larval stages of these toads
is incomplete. The forest toad group is composed of 10
species: Incilius aucoinae, I. melanochlorus, I. cristatus,
I. macrocristatus, I. cavifrons, I. spiculatus, I. tutelarius,
I. aurarius, I. leacomyos, and I. campbelli, among which
the larvae of only seven species have been described
(Mendelson et al. 2012; Segura-Solis and Bolafios
2008). The larvae of 1. melanochlorus, I. campbelli, and
I. spiculatus are unknown, reflecting the fact that even
though the description of anuran tadpoles from Latin
America is increasing, there are still many Neotropical
species whose larval stage remains to be described
(Downie et al. 2015; Kaplan and Heimes 2015; Kohler
et al. 2015).
During recent surveys in the northern slopes of the
Sierra de Juarez in Oaxaca, we found an amplectant
pair of Jncilius spiculatus, an endemic species of
southeast Mexico that is restricted to the highlands of
the physiographic sub-province of the Sierra Madre de
Oaxaca (Mendelson 1997; Ortiz-Pérez et al. 2004). This
species occurs mainly in montane cloud forests and is
listed as Endangered (EN) according to the IUCN (IUCN
2020). It was originally described from adult specimens
deposited in scientific collections; however, its breeding
behavior has not been recorded nor has the tadpole been
described, despite extensive fieldwork conducted in the
region (Caldwell 1974; Caviedes-Solis et al. 2015; Delia
etal. 2013; Lips et al. 2004; Mendelson 1997). In addition,
many aspects of the natural history and reproductive
biology of /. spiculatus are still unknown, probably due
to taxonomic confusion of this species with J. cristatus
and I. valliceps, as well as its restricted distribution and
lack of field observations (Mendelson 1997).
In this paper, the tadpole of 7. spiculatus is described
and information on breeding sites, amplexus type, and
clutch size are documented. An identification key for the
tadpoles of the forest toad clade (Mendelson et al. 2011)
in Mexico and Central America is provided, in addition
to observations on adult J spiculatus with comments
on conservation implications that might allow this
endangered toad to persist in the region.
Materials and Methods
Surveys were conducted at San Pedro Yolox
(17.589359°N, -96.551790°W; datum WGS84) and
Santa Cruz Tepetotutla (17.739446°N, -96.558292°W),
both located on the northern slopes of the Sierra Juarez,
Oaxaca, Mexico, within the sub-physiographic province
Sierra Madre de Oaxaca (Ortiz-Pérez et al. 2004).
In February 2019, a pair of 1. spiculatus was found in
amplexus and laying eggs at Rio Coyul, San Pedro Yolox
(17.64015°N, -96.4306°W, 645 m asl). The species was
identified according to the reported distribution and
morphological characteristics described by Mendelson
(1997), particularly the presence of cranial crests,
spiculate tubercles on the limbs, and pale fingertips.
The female body temperature and clutch temperature
Amphib. Reptile Conserv.
32
were taken with an infrared thermometer. Seventy
eggs were collected from the egg clutch without
disturbing the adult toads (permit FAUT-0074) and
taken to the Amphibian Ecology Laboratory at Centro
Interdisciplinario de InvestigacioOn para el Desarrollo
Integral Regional Unidad Oaxaca (CIIDIR-Oaxaca).
The eggs were kept in glass tanks with aerated water.
The water was partially replaced every two weeks
and tadpoles were fed boiled spinach and lettuce ad
libitum. The room temperature ranged from 23 to 30
°C. Tadpoles were euthanized with 5% lidocaine and
preserved in 10% formalin.
A total of 34 tadpoles at stages 26 to 37 (Gosner
1960) were examined using a microscope (Carl Zeiss
2000-C) and photographed (Canon Powershot GX5)
for their subsequent measurements. For tadpole
morphology, the terminology of Altig (1970, 2007)
was followed. Measurements were made with tpsUtil
and tpsdig2 software (Rohlf 2017, 2019). Photographs
of the oral apparatus were taken specifically at Gosner
stages 24 and 37. The oral formula followed Altig and
McDiarmid (1999). Live coloration and codes were
described following Kohler (2012). All specimen series
were deposited in the Museo de Zoologia Facultad de
Ciencias (MZFC35365, MZFC35366, MZFC35367)
at the Universidad Nacional Autonoma de México.
Larval development time under laboratory conditions
was measured by recording the progress between the
46 Gosner stages until full metamorphosis was reached.
Clutch size. The approximate total number of eggs in
the clutch was calculated by multiplying the average
number of eggs in 10 cm sections of the egg string
(counted at five different sections) by the total length
of the egg string. The total length was an approximate
measurement to avoid disturbing the clutch. In addition,
air and water temperatures were taken, and the river
width was measured with a flexometer.
Adult diet. In order to identify items in the diet, six
adult toads were collected in the field and kept in
plastic boxes with access to water until they defecated,
after which they were released. The fecal samples
were preserved in 70% alcohol and examined with
a microscope (Leica model EZ4 stereoscopic). Food
items or structures were identified with specialized
insect keys (Palacios-Vargas et al. 2014; Rios-
Casanova 2014; Vélez and Vivallo 2018).
Results
Tadpole Description
Average measurements (mm) for Gosner stage
35: body length 13.28, tail length 21.68, tail muscle
height 3.41, maximum tail height 6.09, total length
34.96, tail muscle width 3.31, internarial distance 1.66,
interorbital distance 4.70; measurements for other
Gosner stages are presented in Table 1. The body is
August 2021 | Volume 15 | Number 2 | e281
Arreortua et al.
Table 1. Measurements of the tadpole of /ncilius spiculatus by Gosner stage (averages in mm). Body length (BL), Tail length (TAL),
Tail muscle height (TMH), Maximum tail height (MTH), Total length (TL), Tail muscle width (TMW), Internarial distance (ID),
Interorbital distance (IOD).
Lateral view
Stage BL TAL TMH MTH
26 6.25 9.87 1.38 2.85
27 6.08 9.15 1353 2.84
28 6.61 9.84 152 ee:
29 8.04 11.20 1.82 3.91
30 8.95 12.12 I.95 4.26
3] 8.63 11.77 1.75 4.16
32 8.51 12.80 2A 4.38
33 9:03 13.61 2.74 4.63
34 8.79 13.60 2.14 4.59
3D 13.28 21.68 3.41 6.09
36 12.89 2176 329 390
37 13.90 2218 3.44 6.29
ovoid in dorsal view, widest at about the middle point
and narrower near the tail; depressed in lateral view.
Snout nearly semicircular in dorsal profile, rounded at
the tip in lateral profile. Spiracle sinistral with inner
wall free from body. External nares ovoid situated
nearer to eyes than to snout. Eyes dorsal. Vent tube
medial. Tail rounded at the tip. Caudal musculature
highest at base, gradually tapering to a pointed tip;
dorsal fin reticulated (Fig. 1).
Oral disk small; labial tooth row formula 2(2)/3,
Al slightly longer than other rows; A2 gap narrow,
approximately width of 3—8 teeth, Pl and P2 equal
in length, P3 being the longest posterior row; labial
papillae restricted to lateral portions of oral disc
disposed in two interposed series (Fig. 1A). At stage
24, the larvae show an elongation of the oral apparatus
that protrudes from the body (Fig. 2D—E).
In life, the color of the body is uniformly
Cinnamon Brown (color 43 in Kohler 2012), except
for the ventral part of the mouth where the color
becomes paler. The venter is slightly transparent, with
a counter-clockwise coiled intestine visible. Around
Gosner stage 35, small Cream Yellow (82) dots
appear throughout the body and the iris (Fig. 2G). The
tail fins are transparent with large Cinnamon Brown
(43) pigment granules forming a reticulate pattern on
the dorsal fin. Around Gosner stage 37, the ventral
parts of the limbs are pale Cinnamon Brown (43)
with Cream Yellow (82) dots and dark brown bars
dorsally. In preservative, the tadpole body and the tail
musculature are Natal Brown (49), while the ventral
part of the body is slightly translucent.
Tadpole development required approximately 35
days to complete metamorphosis under laboratory
conditions (Fig. 2H). Three days after collection (8
February 2019), embryonic development reached
Gosner stage 12. Three days later, the embryos
had reached stage 18, and four days after that had
developed into stage 25 tadpoles.
Amphib. Reptile Conserv.
33
Dorsal view
TL TMW ID IOD
16.12 1.00 0.92 1.87
1523 1.10 0.92 V.79
16.45 127 LETS 2.25
19.25 1.38 1.15 2.26
21.07 LS 1.26 2sSu
20.40 1.45 1.28 2.50
21.31 152 1.32 2.49
22.63 1.68 1.28 2.69
22,39 1.66 | 2,62
34.96 3.31 1.66 4.70
34.66 2.81 159 412
36.63 3.05 1.70 4.84
Adult Breeding Behavior
In February 2019, an amplecting pair of Incilius spiculatus
was observed at 640 m asl in the shallower margins of a
river (Rio Coyul), where the water current was slowed
by the presence of rocks and aquatic vegetation. The Rio
Coyul is a permanent river with an average width of 8.19
m at the site where the amplexus was observed (Fig. 2F).
The toads used vegetation and material on the bottom
of the river to maintain their position in the water during
the amplexus. Mating was observed during the day and
the amplexus was axillary (Fig. 2A—B). At the time of the
observations (1250 h GST), the water temperature was
19.6 °C. The species exhibited an ovipositional string
mode with a double row of eggs arrangement (Altig and
McDiarmid 2007). The estimated clutch size was 4,500
eggs, and the clutch was attached to aquatic vegetation
on rocks at the river margins at about 35 cm depth (Fig.
2C). Amplectant behavior was observed from the time of
encounter until the toads separated (approximately 2.67
h). The female body temperature was 21.0 °C, SVL 85.5
mm, and the clutch temperature was 21.0 °C. In addition
to the amplectant pair, a second male toad was observed
in the water at a distance of 1.0 m. A second egg clutch
was observed in another pool located 3.70 m away; but
the toads that laid this clutch were not observed.
Adult Diet
Fecal samples indicated that Hymenoptera were the
dominant prey (15 individuals, 48.3%), followed by
Coleoptera (7, 22.5%), Scorpiones (6, 19.3%), Orthoptera
(2, 6.4%), and Blattodea (1, 3.2%).
Extension of Elevational Range
Previously, the elevational range reported for /. spiculatus
was from 800—1,689 m asl (Mendelson 1997). During
this survey, two juvenile individuals were observed at
August 2021 | Volume 15 | Number 2 | e281
Incilius spiculatus in Oaxaca, Mexico
Fig. 1. Tadpole of Jncilius spiculatus. (A) Oral disc at Gosner
stage 37, (B) lateral view at Gosner stage 35, and (C) dorsal
view at Gosner stage 35.
Santa Cruz Tepetotutla, Oaxaca, Mexico, in a patch of
primary cloud forest vegetation at an elevation of 1,758
m asl (17.71862°N, -96.55911°W) datum WGS84, in
addition to three individuals in San Pedro Yolox at 682
m asl (17.63622°N, -96.42735°W), 643 m asl (17.64001
°N, -96.43061°W), and 642 m asl (17.64013°N,
-96.43056°W). With these records, the altitudinal range
of this species is now extended as including from 642 to
1,758 m asl.
Discussion
The observations reported here confirm that Jncilius
spiculatus 1s a stream breeder, and that its reproduction
occurs during the dry season, as in the other species in
the forest toad group (Mendelson et al. 2011). With this
description, the number of known forest toad tadpoles is
increased to eight; the only species yet to be described
are [. melanochlorus and I. campbelli (Altig 1970, 1987;
Korky and Webb 1973; Mendelson et al. 1999, 2012;
Segura-Solis and Bolafios 2009; Shannon and Werler
1955). Among the tadpoles of this group, /. tutelarius,
I. macrocristatus, I. leuacomyos, and I. spiculatus share
the oral formula 2 (2) /3, as does I. valliceps (Korky and
Webb 1973; Limbaugh and Volpe 1957; McCranie and
David 2000; Mendelson et al. 1999). Although /. valliceps
is not a forest toad, it is included in the identification key
here because it is sympatric with 1. spiculatus and the two
could be easily confused due to similar morphology. The
difference between the two species is that 1. spiculatus has
an A2 gap that is 3-8 teeth wide, and it has a reticulated
pattern only on its dorsal fin.
Amphib. Reptile Conserv.
34
A peculiar morphological characteristic of J.
spiculatus present at Gosner stage 24 is an oral apparatus
that protrudes from the body (Fig. 2D—E). As far as we
know, this feature has not been reported for any other
species of anurans. A limiting factor for comparison with
other species is that most descriptions are made from
tadpoles at developmental stages beyond Gosner stage
25, so larval development in earlier stages is generally
unknown. The closest related species for whicha complete
larval development description (from fertilization to
metamorphosis) could be found is /. valliceps, and it
does not have this oral morphology type (Limbaugh and
Volpe 1957). Descriptions of earlier tadpole development
stages should be encouraged because they have proven
to be useful for differentiating species in groups where
the morphological variations of larvae in advanced
stages (beyond Gosner stage 34) are almost non-existent
(Laufer et al. 2013). In addition, we consider that these
observations can contribute to the understanding of
larval ecology. As mouth shape 1s known to be associated
both with habitat type and diet in other amphibians (Altig
and McDiarmid 1999; Van-Buskirk 2009), we suspect
that this structure might be either an adaptation to life in
flowing water that prevents tadpoles from being washed
away (by allowing them to attach to fixed material) or
a foraging adaptation in early development that changes
in the later stages. The diet type at this stage should be
investigated to further elucidate its function.
In relation to breeding behavior, the findings reported
here confirm that /. spiculatus uses lotic systems during
the dry season to reproduce, a consistent pattern among
the forest toad group (Mendelson et al. 1999). With this
new data, the information on reproduction sites for the
ten species of this group is now complete (Mendelson
2011). Reproduction in lotic environments during the
dry season may be related to the flow conditions of the
streams, since this 1s the time when these systems have
slower currents and are shallower. Thus, the eggs are not
washed away and the drying of water bodies does not
represent a risk for the larvae (Kam et al. 1998; Wells
2007).
Based on these field observations, /. spiculatus is
opportunistic and largely insectivorous in its feeding
habits. The feeding strategy of this species is that of a
sit-and-wait predator. Even though the sample size for
the adult diet analysis was small, 1t represents the first
data on the diet of this species, which is composed
of arthropods, including ants, beetles, crickets, and
scorpions. Probably the most noteworthy observation
is the evidence of scorpion consumption, which is
poorly documented in amphibians. While basically
restricted to the Neotropics, all reports of scorpions in
anuran diets are limited to eight species within three
families (Bufonidae, Hylidae, and Leptodactylidae):
Leptodactylus pentadactylus, Leptodactylus bolivianus,
Leptodactylus fuscus, Osteopilus septentrionalis, Boana
pugnax, Peltophryne peltocephalus, Rhinella marina
(Botero-Trujillo 2006; Florez and Banco-Torres 2010),
and Rhinella icterica (Jared et al. 2020). The recent
report of R. icterica as a natural predator of the Yellow
Scorpion (Zityus serrulatus) is interesting, as_ this
scorpion is known for a significant number of poisoning
August 2021 | Volume 15 | Number 2 | e281
Arreortua et al.
Fig. 2. Breeding behavior of /ncilius spiculatus. (A-B) Amplexus (axillary type) and oviposition, (C) egg string staggered in
unilayered tube, (D—E) dorsal and ventral views of the tadpole head at Gosner stage 24 showing the “elongated mouth,” (F) Rio
Coyul, San Pedro Yolox; (G) lateral view of tadpole at Gosner stage 39, and (H) lateral view of metamorphic individual.
incidents involving humans in Brazil (Jared et al. 2020).
A broader dietary analysis of 1 spiculatus should be
undertaken in order to compare possible differences
between ages and sexes, with the aim of determining
different roles in the ecosystem as proposed for other
toad species. For example, preferred prey size is related
to body size and age in /. cristatus: juveniles consume
smaller prey than adults, while females, being larger in
size, consume larger prey items, suggesting different
predator-prey interactions according to age (Gelover et
al. 2001; Oropeza-Sanchez et al. 2018).
Despite the fact that the elevational distribution of
this species is now extended from 642-1,758 m asl,
potential reproductive streams are located at lower
elevations. As lowlands present warmer climates,
fertile soil, and less slope, they are usually attractive for
agriculture and human settlements (Price and Butt 2000;
Slik 2005), which results in clearing and deterioration
of vegetation cover, especially in riparian areas. These
activities contribute to connectivity loss between forest
habitat and breeding sites, creating a habitat split that
is particularly problematic and risky for amphibians
with aquatic larvae (Becker et al. 2007; Price and Butt
2000; Velasco-Murguia et al. 2014). As in other species,
this has several implications for the conservation of /.
spiculatus. First, reproductive adults and metamorphic
individuals emerging from the river are forced to
migrate between forested areas and lotic environments
via disturbed sites, increasing the risks of desiccation
Amphib. Reptile Conserv.
and predation (Oropeza-Sanchez et al. 2018; Todd et al.
2009; Walston and Mullin 2008). Additionally, tadpoles
developing in the river have higher exposure to the
chemicals used in agriculture and other human activities,
such as the extraction of sand and water (Adlassnig et
al. 2013; Sparling et al. 2001). These aspects provide
additional stress factors to the already vulnerable
situation of amphibians, such as J. spiculatus, which
have small distribution areas, aquatic reproduction, and
larval development in lotic systems, making them more
susceptible to habitat transformation and increasing their
risks of population decline or extinction (Becker et al.
2007; Nowakowski 2017).
Increased efforts to describe anuran larval stages
are needed 1n order to complete our knowledge of the
biology of threatened amphibian species. Firstly, this
is necessary to understand the habitat requirements
of a species, and possibly differential stressor factors
throughout the life cycle. Secondly, because tadpoles
remain in water bodies for long time periods, they are
often the only evidence for the presence of amphibians
at many sites, making this life-history stage highly
relevant to rapid inventories that aim to accurately
assess the geographic distribution of this group. For
this reason, the morphological description of tadpoles
allows detection of species that are more difficult to
detect in their adult phase, while reducing the costs
and technical complications of inventories that involve
molecular techniques such as bar coding (Grosjean et al.
August 2021 | Volume 15 | Number 2 | e281
Incilius spiculatus in Oaxaca, Mexico
Key to the tadpoles of the forest toads of Mexico and Central America
la. A2 Gap present...
1b. A2 Gap absent..
2a. Tail fin colotation Variable: known fiom Mexico.
2b. Tail fins light brown with widely dispersed dark brown dots; known from western Costa Rica and Panama............
3a. Known from Sierra Madre Oriental of Veracruz and Puebla,
3b. Known only from Sierra de los Tuxtlas Veracruz,
4a. Tail fins transparent... ccc ccceceeeeeeeees
4b. Tail fins uniformly dark brown..........000.0000000000..
5a. Tail musculature black.....0....c cc ecccceeeeeeeees
5b. Tail musculature brown..........00....cccccccccceccccceeeeeeeeees
6a. Tail musculature partially black with scattered pale areas.
Guatemala...
....L. aucoinae
MexICOt 4... es oe I. cristatus
MEXICO...... 00... cee cece ce essetetsteeeeeel, Cavifrons
5 OE Cia Sd Lee i Ne leh TE ee, Ne See I. tutelarius
Known from southern Mexico to western
1. macrocristatus; I. aurarius
6b. Tail musculature black. Tail fins reticulated and flecked with black. A 22 gap » width about 2 labial teeth. Known only
from north-eastern Honduras..............00... 000 ccc ce cece eens
FERN ee Gil See SO coe. Rn Le I. leucomyos
7a. Dorsal fin has large Cinnamon Brown (43) granules forming a reticulation. A-2 gap width equal to
3-8 labial teeth. Known only from Sierra Madre de Oaxaca...
1. spiculatus
7b. Dorsal and ventral fins with yellow reticulation. A-2 gap wide, width ‘equal to. 10- 15 labial teeth.
Widely distributed across
2015). In addition, morphological data will be useful and
complementary to new and powerful techniques, such as
environmental DNA, for biodiversity inventories in the
coming decades (Beng and Corlett 2020).
A report by the IUCN (IUCN SSC 2020) states that
I. spiculatus is not distributed within protected areas.
However, in our study area, the local community conserves
large areas of the montane cloud forest that is habitat for
I. spiculatus (9,570 ha in the case of the municipality of
San Felipe Usila) under the Indigenous and Community
Conserved Areas (ICCAs) mechanism. ICCAs are areas
governed by indigenous or local communities where
collective action focuses on the governance of common
resources at multiple scales (Bray et al. 2012; Pazos-
Almada and Bray 2018). These social actions contribute
to the maintenance of optimal habitat where the
species can still survive. Communication with the local
community to share findings on reproductive behavior
should increase the chances of improving habitat quality
at lower elevation sites, promote connectivity between
aquatic and terrestrial habitats, and ensure the survival
of this species.
Acknowledgements.—The field work for _ this
publication was funded by CONACYT México through
the project Ciencia Basica #256071. We would like
to thank the authorities of Santa Cruz Tepetotutla and
San Pedro Yolox for their authorization to work in
their community. We also thank Pedro Osorio, Marcial
Hernandez, and Paola Velasco for their support during
Amphib. Reptile Conserv.
southern Mexico and Central AMmMefrica..........0000..0 ccc ceccccceeeeeceeeeeeeeed
valliceps
fieldwork; Camilo Julian and Mayra Miguel for the
scientific illustration of the tadpole; Emilio Martinez
and Eufemia Cruz for allowing us to take tadpole
pictures in their laboratory; and Joseph Mendelson
and Michael Crossland for their helpful comments
on the manuscript. Eggs were collected under permit
FAUT-0074 issued to Fausto Méndez de la Cruz. We
are grateful for comments from Gunter Kohler and an
anonymous reviewer that improved the manuscript. In
memory of Eugui Roy Martinez Pérez.
Literature Cited
Adlassnig W, Sassmann S, Grawunder A, Puschenreiter
M, Horvath A, Koller PM. 2013. Amphibians in
metal-contaminated habitats. Salamandra 49: 149-
158.
Altig R. 1970. A key to the tadpoles of the continental
United States and Canada. Herpetologica 26: 180-
207.
Altig R. 1987. Key to the anuran tadpoles of Mexico.
The Southwestern Naturalist 32(1): 75-84.
Altig R, McDiarmid RW. 1999. Body plan: development
and morphology. Pp. 24—51 In: Tadpoles: the Biology
of Anuran Larvae. Editors, McDiarmid RW, Altig R.
University of Chicago Press, Chicago, Illinois, USA.
444 p.
Altig R, McDiarmid RW. 2007. Morphological
diversity and evolution of egg and clutch structure
August 2021 | Volume 15 | Number 2 | e281
Arreortua et al.
in amphibians. Herpetological Monographs 21(1):
1-32.
AmphibiaWeb. 2020. AmphibiaWeb. Available: https://
amphibiaweb.org/ [Accessed: 11 August 2020].
Becker CG, Fonseca CR, Haddad CFB, Batista RF,
Prado PI. 2007. Habitat split and the global decline of
amphibians. Science 318: 1,775—1,777.
Beebee TJ, Griffiths RA. 2005. The amphibian decline
crisis: a watershed for conservation biology?
Biological Conservation 125: 271-285.
Beng KC, Corlett RT. 2020. Applications of environ-
mental DNA (eDNA) in ecology and conservation:
opportunities, challenges, and prospects. Biodiversity
and Conservation 29: 2,089-2,121.
Botero-Trujillo R. 2006. Anuran predators of scorpions:
Bufo marinus (Linneo, 1758) (Anura: Bufonidae) first
known natural enemy of Tityus nematochirus Mello-
Leitao, 1940 (Scorpiones: Buthidae). Revista [bérica
de Aracnologia 13: 199-202.
Bray DB, Duran E, Molina-Gonzalez OA. 2012. Beyond
harvests in the commons: multi-scale governance
and turbulence in indigenous/community conserved
areas In Oaxaca, Mexico. International Journal of the
Commons 6(2): 151-178.
Caldwell JP. 1974. Tropical tree frog communities:
patterns of reproduction, size, and utilization of
structural habitat. Ph.D. Dissertation, University of
Kansas, Lawrence, Kansas, USA. 197 p.
Canseco-Marquez L, Ramirez-Gonzalez C, Gonzalez-
Bernal EL. 2017. Discovery of another new species of
Charadrahyla (Anura, Hylidae) from the cloud forest
of northern, Oaxaca, México. Zootaxa 4329: 64—72.
Caviedes-Solis IW, Vazquez-Vega LF, Solano-Zavaleta
I, Pérez-Ramos E, Rovito SM, Devitt TJ, Heimes P,
Flores-Villela OA, Campbell JA, Nieto Montes de
Oca A. 2015. Everything’s not lost: recent records,
rediscoveries, and range extensions of Mexican hylid
frogs. Mesoamerican Herpetology 2: 230-241.
Cortés-Gomez AM, Ruiz-Agudelo CA, _ Valencia-
Aguilar A, Ladle JR. 2015. Ecological functions
of Neotropical amphibians and reptiles: a review.
Universitas Scientiarum 20: 229-245.
Delia JRJ, Whitney JL, Burkhard T. 2013. Rediscovery
of ‘lost’ treefrogs from the Oaxacan highlands of
Mexico. Biodiversity and Conservation 22(6—7):
1,405—1,414.
Downie JR, Nokhbatolfoghahai M, Lyndsay C. 2015.
The tadpole of the Glass Frog, Hyalinobatrachium
orientale tobagoense (Anura: Centrolenidae), from
Tobago, West Indies. The Herpetological Bulletin
131: 19-21.
Duellman WE, Trueb L. 1994. Biology of Amphibians.
Johns Hopkins University Press, Baltimore, Maryland,
USA. 670 p.
Flecker AS, Feifare BP, Taylor BW. 1999. Ecosystem
engineering by a tropical tadpole: density-dependent
effects on habitat structure and larval growth rates.
Copeia 1999(2): 495-500.
Florez D, Blanco-Torres A. 2010. Registros de
escorpiones incluidos en la dieta de anuros en la costa
atlantica colombiana. Revista Ibérica de Aracnologia
18: 105-106.
Amphib. Reptile Conserv.
37
Gelover A, Altamirano T, Soriano M. 2001. Habitos
alimenticios de Bufo valliceps bajo distintas
condiciones; con aportacion al conocimiento de
la ecologia alimenticia de Bufo marinus y Bufo
marmoreus. Revista de Zoologia 12: 28-32.
Gosner KL. 1960. A simplified table for staging anuran
embryos and larvae with notes on identification.
Herpetologica 16(3): 183-190.
Grosjean S, Ohler A, Chuaynkern Y, Cruaud C, Hassanin
A. 2015. Improving biodiversity assessment of
anuran amphibians using DNA barcoding of tadpoles.
Case studies from Southeast Asia. Comptes Rendus
Biologies 338(5): 351-361.
IUCN. 2020. The IUCN Red List of Threatened Species.
Version 2020-2. Available: https://www.iucnredlist.
org [Accessed: 11 August 2020].
IUCN SSC Amphibian Specialist Group. 2020. Jncilius
spiculatus. The IUCN Red List of Threatened Species
2020: e.T54762A53950866.
Jared C, Alexandre C, Mailho-Fontana PL, Pimenta DC,
Brodie ED, Antoniazzi MM. 2020. Toads prey upon
scorpions and are resistant to their venom: a biological
and ecological approach to scorpionism. 7oxicon 178:
4-7,
Jiménez-Arcos WH, Calzada-Arciniega RA, Alfaro-
Juantorena LA, Vazquez-Reyes LD, Blair C, Parra-
Olea G. 2019. A new species of Charadrahyla (Anura:
Hylidae) from the cloud forest of western Oaxaca,
Mexico. Zootaxa 4554: 371-385.
Kam YC, Chen TC, Yang JT, Yu FC, Yu KM. 1998.
Seasonal activity, reproduction, and diet of a riparian
frog (Rana swinhoana) from a subtropical forest in
Taiwan. Journal of Herpetology 32(3): 447-452.
Kaplan M, Heimes P. 2015. The tadpole of the Mexican
Tree Frog Charadrahyla taeniopus (Anura: Hylidae).
Caldasia 37(2): 393-396.
Kohler G. 2012. Color Catalogue for Field Biologists.
Herpeton, Offenbach, Germany. 49 p.
Kohler G, Trejo-Pérez RG, Canseco-Marquez L,
Méndez de la Cruz L, Schulze A. 2015. The
tadpole of Megastomatohyla pellita (Duellman,
1968) (Amphibia: Anura: Hylidae). Mesoamerican
Herpetology 2: 146-152.
Korky J, Webb RG. 1973. The larva of the Mexican toad
Bufo cavifrons Wiegmann. Journal of Herpetology
7(1): 47-49.
Kupferberg SJ. 1997. The role of larval diet in anuran
metamorphosis. American Zoologist 37(2): 146-159.
Laufer G, Pereyra LC, Akmentins MS, Borteiro C. 2013.
A comment on the oral dermal flaps of Elachistocleis
Parker, 1927 (Anura: Microhylidae) larvae. Zootaxa
3710(5): 498-500.
Limbaugh BA, Volpe EP. 1957. Early development of the
Gulf Coast Toad, Bufo valliceps Wiegmann. American
Museum Novitates 1842: 1-32.
Lips KR, Mendelson III JR, Mufioz-Alonso A, Canseco-
Marquez L, Mulcahy DG. 2004. Amphibian population
declines in montane southern Mexico: resurveys of
historical localities. Biological Conservation 119(4):
555-564.
McCranie JR, Wilson LD. 2000. A new species of High-
Crested Toad of the Bufo valliceps group from North-
August 2021 | Volume 15 | Number 2 | e281
Incilius spiculatus in Oaxaca, Mexico
Central Honduras. Journal of Herpetology 34(1):
21-31.
Mendelson III JR. 1997. A new species of toad (Anura:
Bufonidae) from Oaxaca, México, with comments
on the status Bufo cavifrons and Bufo cristatus.
Herpetologica 33: 268-286.
Mendelson III JR, Ustach PC, Nieto Montes de Oca A.
1999. Description of the tadpole of Bufo tutelarius,
natural history notes on the Bufo valliceps group,
and a key to the tadpoles of the group. Journal of
Herpetology 33(2): 324-328.
Mendelson JR, Mulcahy DG, Williams TS, Sites Jr JW.
2011. A phylogeny and evolutionary natural history
of Mesoamerican toads (Anura: Bufonidae: /ncilius)
based on morphology, life history, and molecular data.
Zootaxa 3138: 1-34.
Mendelson JR, Mulcahy DG, Snell S, Acevedo ME,
Campbell JA. 2012. A new Golden Toad (Bufonidae:
Incilius) from northwestern Guatemala and Chiapas,
Mexico. Journal of Herpetology 46(4): 473-479.
Nowakowski AJ, Thompson ME, Donnelly MA,
Todd BD. 2017. Amphibian sensitivity to habitat
modification is associated with population trends
and species traits. Global Ecology and Biogeography
26(6): 700-712.
Oropeza-Sanchez M, Pineda E, Luria-Manzano R.
2018. Population characteristics, habitat, and diet
of the Large-crested Toad Uncilius cristatus; Anura:
Bufonidae): a Critically Endangered species endemic
to Mexico. Herpetological Conservation and Biology
13(3): 558-568.
Ortiz-Pérez MA, Hernandez-Santana JR, Figueroa-
Mah-Eng JM. 2004. Reconocimiento fisiografico
y geomorfologico. Pp. 43-54 In: Biodiversidad de
Oaxaca. Editors, Garcia-Mendoza AJ, Ordofiez MJ,
Briones-Salas M. Universidad Nacional Autonoma de
México, México D.F., Mexico. 605 p.
Palacios-Vargas JG, Mejia-Recamier BE, Oyarzabal A.
2014. Guia Ilustrada para los Artrépodos Edaficos.
UNAM Facultad de Ciencias Press, México, Mexico.
87 p.
Parra-Olea G, Garcia-Castillo MG, Rovimo SM, Maisano
JA, Hanken J, Wake DB. 2020. Descriptions of five
new species of the salamander genus Chiropterotriton
(Caudata: Plethodontidae) from eastern Mexico and
the status of three currently recognized taxa. PeerJ 8:
©8800.
Pazos-Almada B, Bray DB. 2018. Community-based
land sparing: territorial land-use zoning and forest
management in the Sierra Norte of Oaxaca, Mexico.
Land Use Policy 78: 219-226.
Price MF, Butt N. 2000. Forests in Sustainable Mountain
Development: a State of Knowledge Report for 2000.
CABI International, Wallingford, United Kingdom.
590 p.
Regester KJ, Whiles MR, Lips KR. 2008. Variation in the
trophic basis of production and energy flow associated
with emergence of larval salamander assemblages
from forest ponds. Freshwater Biology 53(9): 1,754—
1,767.
Rios-Casanova L. 2014. Biodiversidad de hormigas en
México. Revista Mexicana de Biodiversidad 85: 392—
Amphib. Reptile Conserv.
398.
Rohlf J. 2017. tpsdig2. Version 2.31. State University
of New York, Department of Ecology and Evolution,
Stony Brook, New York, USA.
Rohlf J. 2019 tpsUtil. Version 1.78. State University of
New York, Department of Ecology and Evolution,
Stony Brook, New York, USA.
Schachat SR, Mulcahy DG, Mendelson JR. 2016.
Conservation threats and the phylogenetic utility
of IUCN Red List rankings in Jncilius toads.
Conservation Biology 30: 72-81.
Scheele BC, Pasmans F, Skerratt LF, Berger L, Martel A,
Beukema W, Acevedo AA, Burrowes PA, Carvalho T,
Catenazzi A, et al. 2019. Amphibian fungal panzootic
causes catastrophic and ongoing loss of biodiversity.
Science 363: 1,459-1,463.
Segura-Solis S, Bolafios F. 2009. Desarrollo embrionario
y larva del sapo Incilius aucoinae (Bufonidae) en
Golfito, Costa Rica. Revista de Biologia Tropical
57(Supplement 1): 291-299.
Shannon FA, Werler JE. 1955. Notes on amphibians of the
Los Tuxtlas Range of Veracruz, México. 7ransactions
of the Kansas Academy of Science 58(3): 360-386.
Slik JWF. 2005. Assessing tropical lowland forest
disturbance using plant morphological and ecological
attributes. Forest Ecology and Management 205:
241-250.
Sparling DW, Fellers GM, McConnell LL. 2001.
Pesticides and amphibian population declines in
California, USA. Environmental Toxicology and
Chemistry 20(7): 1,591—1,595.
Stewart M, Woolbright L. 1996. Amphibians. Pp. 273-
320 In: The Food Web of a Tropical Rainforest.
Editors, Reagan D, Waide R. The University of
Chicago Press, Chicago, Illinois, USA. 623 p.
Stuart SN, Hoffmann M, Chanson JS, Cox NA,
Berridge RJ, Ramani P, Young BE. 2008. Threatened
Amphibians of the World. Lynx Edicions, Barcelona,
Spain; IUCN, Gland, Switzerland; Conservation
International, Arlington, Virginia, USA. 758 p.
Todd BD, Luhring TM, Rothermel BB, Gibbons JW.
2009. Effects of forest removal on amphibian
migrations: implications for habitat and landscape
connectivity. Journal of Applied Ecology 46: 554—
561.
Van-Buskirk J. 2009. Getting in shape: adaptation and
phylogenetic inertia in morphology of Australian
anuran larvae. Journal of Evolutionary Biology 22(6):
1,326-1,337.
Velasco-Murguia AM, Duran EM, Rivera R, Barton D.
2014. Cambios en la cobertura arbolada de comunidades
indigenas con y sin iniciativas de conservacion en
Oaxaca, México. Investigaciones Geogrdaficas-UNAM
83: 55-73.
Vélez D, Vivallo F. 2018. Sinopsis de las especies del
subgénero Centris (Ptilotopus) (Hymenoptera: Apidae)
en Colombia. Biota Colombiana 19(2): 46-63.
Walston LJ, Mullin SJ. 2008. Variation in amount of
surrounding forest habitat influences the initial
orientation of juvenile amphibians emigrating from
breeding ponds. Canadian Journal of Zoology 86:
141-146.
August 2021 | Volume 15 | Number 2 | e281
Arreortua et al.
Wells KD. 2007. Movements and orientations. Pp. 230— Wilson LD, Johnson JD, Mata-Silva V. 2013. A
267 In: The Ecology and Behavior of Amphibians. conservation reassessment of the amphibians of
Editor, Wells KD. The University of Chicago Press, Mexico based on the EVS measure. Amphibian &
Chicago, Illinois, USA. 1,161 p. Reptile Conservation 7(1): 97-127 (69).
Amphib. Reptile Conserv.
Medardo Arreortia is a Mexican herpetologist interested in the ecology and
conservation of amphibians and reptiles of Mexico. He is currently a postgraduate
student studying the movement ecology and habitat use in amphibians 1n relation to
habitat disturbance. He is a member of the group Ecologia para la Conservacion de
Anfibios (ECA) in Oaxaca, Mexico.
Carlos A. Flores is a biologist currently pursuing a Master’s degree in Conservation
Sciences at CIIDIR-Oaxaca, Mexico. His research focuses on understanding the
effects of introduced exotic fish on native tadpoles, and the implications of invasive
Species introductions for amphibian conservation.
Pablo Rogelio Simén-Salvador is interested in the ecology, natural history, and
conservation of amphibians and reptiles from Mexico. For his Bachelor’s degree,
he designed a method for the collection, storage, and cryopreservation of semen
from snakes from the genus Crotalus. During his Master’s degree, he evaluated the
effect of anthropogenic disturbance on three species of endemic anurans from cloud
forests. His interests include conservation and wildlife photography.
Hermes Santiago Dionicio is currently finishing his Bachelor’s thesis at Instituto
Politecnico Nacional (IPN) CIIDIR-Oaxaca, Mexico. His research is mostly focused
on evaluating shifts in amphibian shelter quality due to habitat disturbance in a
cloud forest. Hermes is interested in the conservation of herpetofauna in general.
Edna Gonzalez-Bernal is the Head of the Amphibian Ecology Lab (ECA) at
CIIDIR-Oaxaca, IPN, Mexico. Her research focuses on amphibian ecology and
biological invasions, with a special interest in the roles that human activities play
in their occurrence.
39 August 2021 | Volume 15 | Number 2 | e281
Official journal website:
amphibian-reptile-conservation.org
Amphibian & Reptile Conservation
15(2) [General Section]: 40—49 (e282).
Trends in ovarian development, plasma vitellogenin, and
steroid hormones in female Malaclemys terrapin (Schoepff,
1793) from coastal Louisiana
1.2* Jordan Donini, *“Will Selman, **Steven Pearson, and *’Roldan A. Valverde
'Department of Biological Sciences, Southeastern Louisiana University, 808 North Pine Street, Hammond, Louisiana 70401, USA *Department of
Pure and Applied Sciences, Florida Southwestern State College, 7505 Grand Lely Drive, Naples, Florida 34113, USA *Rockefeller Wildlife Refuge,
Louisiana Department of Wildlife and Fisheries, 5476 Grand Chenier Highway, Grand Chenier, Louisiana 70643, USA *Biology Department,
Millsaps College, 1701 North State Street, Jackson, Mississippi 39210, USA *Louisiana Department of Wildlife and Fisheries, 646 Cajundome
Boulevard, Lafayette, Louisiana 70503, USA °New York State Department of Environmental Conservation, 625 Broadway, Albany, New York 12233,
USA ‘Sea Turtle Conservancy, 4581 NW 6th Street, Gainesville, Florida 32609, USA
Abstract.—The timing of reproductive cycles in reptiles is often linked to environmental correlates, including
temperature and photoperiod. The Diamondback Terrapin (Malaclemys terrapin) is a wide-ranging species that
occurs across multiple climatic regions over the eastern and Gulf coastal areas of the United States. Therefore,
the species may show variation in reproductive cycles according to latitude. To assess the reproductive cycles
of M. terrapin and to improve our understanding of their range-wide variations, terrapins were sampled in the
state of Louisiana during the known nesting seasons from May—August (peak and late nesting period) and
outside of the typical nesting season during the month of October (fall pre-wintering period). Terrapins were
sampled via ultrasonography to assess the development of ovarian follicles and eggs. Blood samples were
collected, and the egg yolk protein vitellogenin and the steroids testosterone and estradiol were measured.
Large pre-ovulatory class follicles were present during the peak nesting season, though the animals showed
fewer (or lacked) follicles in the later portion of the reproductive season. Pre-wintering samples in the fall
showed pre-ovulatory class follicles. Vitellogenin varied significantly across sampling periods, with peak
values occurring during the early portions of the nesting season before decreasing in the late nesting season,
followed by increases in the fall pre-wintering period. The testosterone concentration did not vary over any
of the sampling periods, while estradiol varied significantly across sampling periods, with peak values in
the fall pre-wintering period. These results suggest that M. terrapin in Louisiana likely follow a post-nuptial
reproductive pattern, similar to conspecifics and other emydid turtle species at more northern latitudes.
Keywords. Diamondback Terrapin, vitellogenesis, ovarian cycle, estradiol, testosterone, reproductive cycle
Citation: Donini J, Selman W, Pearson S, Valverde RA. 2021. Trends in ovarian development, plasma vitellogenin, and steroid hormones in female
Malaclemys terrapin (Schoepff, 1793) from coastal Louisiana. Amphibian & Reptile Conservation 15(2) [General Section]: 40-49 (e282).
Copyright: © 2021 Donini et al. This is an open access article distributed under the terms of the Creative Commons Attribution License [Attribution
4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction in any
medium, provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced, are
as follows: official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 1 December 2020; Published: 24 August 2021
Introduction Kuchling 1999a). Gonadal steroid hormones are largely
responsible for driving major changes in the reproductive
Reproductive cycles in ectothermic organisms are
largely seasonal and often initiated by environmental
cues, including changes in temperature, photoperiod,
and rainfall (Noeske and Meier 1977; Horseman et al.
1978; Whitter and Crews 1987). Turtles, like other
ectotherms, have reproductive cycles that follow similar
cues (Lewis et al. 1979; Kuchling 1982; Mendonca
and Licht 1986; Kennett 1999) and typically fall under
one of two major categories, depending on whether
gametes are produced prior to (prenuptial cycle) or after
(postnuptial cycle) the reproductive season (Licht 1982;
cycle, with reproductive hormones serving as key
components of gonadal recrudescence, ovulation, and
other reproductive activities (Callard et al. 1976, 1978;
Huot-Daubremont et al. 2003; Al-Habsi et al. 2005).
Non-steroid molecules, such as calcium and the egg yolk
protein vitellogenin (Vtg), may also serve as indicators
of reproductive functions (Rostal et al. 2001; Saka et al.
2011). Specifically, the production of Vtg may be used
as an indicator of reproductive status and reproductive
potential in the female reproductive cycle (Ho et al.
1982; Currylow et al. 2013; Myre et al. 2016).
Correspondence. |*:*[email protected], ** [email protected], *° Steven. [email protected], |" [email protected]
Amphib. Reptile Conserv.
August 2021 | Volume 15 | Number 2 | e282
Donini et al.
Though reproductive cycles have been described
in many species of reptiles in terms of both gonadal
recrudescence and hormonal profiles, gaps in the
available information remain for several species, some
which are of conservation concern (Graham et al. 2015).
Diamondback Terrapins (Malaclemys terrapin) are
one such species of conservation interest (Roosenberg
et al. 2019) and there are descriptions of gonadal and
endocrine cycles (Holliday et al. 2018). Terrapins occupy
coastal estuarine habitats across the United States from
mid-coastal Texas, along the northern and eastern Gulf of
Mexico, and up the Atlantic coastline to Massachusetts
(Carr 1952; Ernst and Lovich 2009). Given their
expansive range, populations at different latitudes
may experience varied seasonal and environmental
conditions. Throughout much of their distribution,
Terrapins are exposed seasonally to low temperatures
(Akins et al. 2014), which may serve as a cue for the
production of gametes, similar to other chelonian species
(Ganzhorn and Licht 1983; Mendonca 1987). Following
emergence from winter dormancy, Terrapin nesting is
often observed in the spring through summer (Seigel
1980a; Feinberg and Burke 2003; Harden and Willard
2012). Active breeding and courting, however, have been
observed in both the early fall and during the spring and
summer (Siegal 1980b; Estep 2005).
Along the Northern Gulf of Mexico (NGoM),
Terrapins appear to typically nest from late April to
August (Mann 1995; Borden and Langford 2008:
Coleman et al. 2014; Pearson and Wiebe 2018), and
they likely are exposed to variable thermal conditions
compared to their northern conspecifics, especially in
southern latitudes, where they may experience a shorter
period of inactivity in the winter. Recent studies in the
NGoM have investigated habitat use and reproductive
output (Coleman 2011; Pearson and Wiebe 2018), as
well as some potential threats (Drabeck 2014; Coleman
et al. 2014) to populations in Louisiana, Mississippi, and
Alabama. However, endocrine and gonadal cycles have
never been described in wild Terrapins from this region.
In Louisiana, and throughout their range, Terrapins
have been impacted both historically and in recent
years due to direct human involvement, with some
populations experiencing notable declines (Gibbons
et al. 2001). These impacts include harvesting for food
and the pet trade (Enge 2005; Converse et al. 2017),
habitat destruction and fragmentation, and accidental
by-catch (Wood and Herlands 1997; Lovich et al. 2018).
Therefore, the objective of this study was to investigate
the reproductive cycle of Terrapins in Louisiana, by using
ultrasound and blood sampling, to document ovarian
activity with regard to vitellogenin and sex hormone
concentrations. An improved understanding of the
reproductive physiology of Terrapins in this region could
be valuable for informing stakeholders and conservation
agencies in their decision making towards conservation
goals. Because most known strategies in temperate
Amphib. Reptile Conserv.
41
chelonians exhibit post-nuptial reproductive cycles, we
suspect that Terrapins in Louisiana will exhibit this same
pattern, with peaks in hormonal and vitellogenin contents
showing elevated concentrations during the nesting
period, then declining as the season progresses before
increasing again in the pre-wintering period in the fall.
Materials and Methods
Study Sites
Terrapins sampled for this study came from two
subpopulations in Louisiana. The first population sampled
was at Rockefeller Wildlife Refuge, with sampling
occurring in both early and late May 2015 and again in
October 2015. A second population was sampled from
June-August 2015 in Terrebonne Parish during nesting
surveys. Primary habitat in these Louisiana study sites
consisted of Smooth Cordgrass (Spartina alterniflora)
and Saltgrass (Distichlis spicata) marshes, as described
by Selman and Baccigalopi (2012) and Selman et al.
(2014), and pocket shell hash beaches in bay estuaries, as
described by Pearson and Wiebe (2018). Terrapins across
the state of Louisiana show similar genetic structure
throughout the region (Petre et al. 2015), and the
populations sampled are at similar latitudes. Thus, data
for the two populations were combined during analyses.
Sample Collection
Terrapins were sampled using three methods: (1)
manual surveys from airboats for locating mud burrows
and mobile Terrapins, (11) using single lead fyke nets
stretched across tidal bayous of saltmarshes (Selman
and Baccigalopi 2012, 2014), and (111) opportunistic
hand capture along nesting beaches. Four females which
were captured and held by a local fisherman for sale and
aquacultural purposes were sampled in August, but it is
unknown how long they had been in captivity. The keeper
provided no information on light or temperature cycles,
but the animals were observed in large Rubbermaid
stock tanks in a storage room with artificial lighting.
According to the keeper, all animals were readily feeding
on invertebrates and fish.
Once captured, females were then bled from the
subcarapacial sinus or dorsal coccygeal vein within
five minutes of handling (to minimize stress response)
using a heparinized 22-gauge needle and 3 ml syringe.
A 0.5—1.5 ml sample of blood was collected from each
individual, depending on its size. Some Terrapins were
bled after a minimum period of 12 h contained in fyke
nets, and the parameters were compared between these
individuals and those sampled by active methods to
assess any stress effects on the hormone values. Whole
blood was immediately placed on ice and centrifuged at
3,000 rpm within 3 h of collection. Plasma was kept on
dry ice while in the field, before storage at —80 °C.
August 2021 | Volume 15 | Number 2 | e282
Female reproductive cycle in Malaclemys terrapin
Fig. 1. Examples of various follicular size classes from different sampling periods of Diamondback Terrapins. (A) Class IT and IV
follicles from late May. (B) Class I follicles from August samples. (C—D). Class II and III follicles from October samples.
Ultrasound
A portable ultrasound (TITAN, Sonosite Inc., Bothell,
Washington, USA) with a 5-8 MHz microconvex
transducer was used to examine ovarian development
and the presence of follicles/eggs in a subset of captured
females. Ovarian follicle diameter was measured to the
nearest 0.1 cm using digital software calipers or using the
program ImageJ (Schneider et al. 2012). Follicles were
assigned to one of four size classes: Class I (< 0.6 cm),
Class IT (0.6—1.0 cm), Class III (1.1-1.6 cm), or Class
IV (> 1.6 cm), adapted from similar classifications by
Lahanas (1982) and Mitchell (1985) (Fig. 1). No follicles
were detected in four of the female Terrapins (n = 2 in
July and n= 2 in August), so these four individuals were
excluded from subsequent follicle analysis.
Hormone and Vitellogenin Concentrations
A modified version of the in-house Vtg enzyme-
linked immunosorbent assay (ELISA) was used as
described by Smelker et al. (2014), using antibodies
developed against Trachemys scripta Vtg. This
antibody exhibits cross reactivity with turtles of the
family Emydidae, including M. terrapin (Donini
et al. 2018). A high-sensitivity commercial ELISA
kit (Enzo Life Sciences, Farmingdale, New York,
USA) was used for measuring both testosterone
(T) and estradiol (E,). Hormone kits were validated
Amphib. Reptile Conserv.
42
for this species via parallelism tests of M. terrapin
plasma. Samples were run in triplicate, at extraction
volumes from 50—400 ul depending on season and
assay. Hormone extractions were performed via
the methods described by Myre et al. (2016) and
Smelker et al. (2014) using double ether extractions.
Predicted hormone values were corrected for the
amount of plasma used for extraction and buffer
used for reconstitution prior to analysis. Animals
with hormone concentrations below detectable limits
(BDL) were assigned a concentration of 50% of the
lowest detectable limit for the assays (0.007 ng/ml for
E, and 0.0013 ng/ml for T), as has been used in other
assays and experiments of similar design (Flewelling
et al. 2010). Sample sizes varied for analyses of
hormone and Vtg concentrations, due to variations in
available plasma volume from each sample.
Statistical Analysis
A two way Multivariate-Analysis of Variance
(MANOVA) was used to determine whether there were
any effects on the results due to variations in sampling
location, and additionally for capture type (hand vs. trap
capture) to account for potential stress effects on the
hormones. Sampling periods were combined based on
the period in the known nesting season. Samples from
May and a single June sample were categorized as peak
nesting period, while July and August samples were
August 2021 | Volume 15 | Number 2 | e282
Donini et al.
grouped together as late nesting season, and October
samples were categorized as pre-wintering. Levene’s
and Shapiro-Wilk’s tests were used to assess normality
and homogeneity of variance among sampling periods
for the variables (average follicle diameter, Vtg, T, and
E,). Follicle diameter and T data met all parametric
assumptions with no transformations required and
were analyzed using an analysis of variance (ANOVA).
However, Vtg and E, data did not meet the assumptions
of normality and homogeneous variances, and their
skewedness was not within proper parameters to
proceed with normal parametric analysis. As a result,
non-parametric Kruskal-Wallis analyses with a post-
hoc Dwass-Steel-Chritchlow-Fligner test were used
to determine variations of Vtg and E, across sampling
periods. All analyses were performed with SYSTAT
13.0 and all graphical figures were generated using
Sigmaplot 14.0.
Results
Validation of sampling sites and methods. All Terrapins
sampled were adult females, and were captured during the
nesting season (May—August, n = 30) as well as during
periods outside of the known nesting season (October,
n = 9). There was no significant interaction between
season and sampling location (P > 0.05), providing
additional support for treating both sampling regions as
single populations for the analysis, and thus independent
ANOVA were used for each variable. Analysis of
hand captured and trap captured Terrapins determined
there were no significant differences between T and E,
concentrations with regard to capture type (/', ,, = 3.010
P=0.102 and F’ ,, = 3.179 P = 0.084, respectively).
Ultrasound. A subset of 29 females were sampled
via ultrasound. The average follicle diameter did not
significantly vary throughout the sampling periods
(F,4; = 2.234, P = 0.128). Mean follicle size during
the peak nesting period was 1.23 + 0.09 cm, and all
four size classes were observed in May and June. In
the late nesting period samples, individuals either had
very small Class I or II follicles, or they lacked follicles
completely (mean follicle size: 0.714 + 0.05 cm). Mean
follicle size in the October pre-wintering sample was
1.08 + 0.11 cm, again with multiple size classes present
(Fig. 2). No evidence of atretic follicles was observed
in any sampling period. Calcified eggs were visualized
in both peak and late nesting periods, but not in the fall
pre-wintering periods.
Hormone and vitellogenin concentrations. Thirty-
nine individuals were sampled for Vtg, while 21 were
sampled for T, and 34 for E,. The average Vtg intra-assay
coefficient of variation (CV) was 4.9% and the inter-assay
CV was 14.4%. The average T intra-assay CV was 8.66%
and the inter-assay CV was 10.58%. The average intra-
Amphib. Reptile Conserv.
43
2.5
e
2.0
=e
=
S15
o
S
&
ra
a
r 1.0
ic _——
0.5
0.0 a x ie
g ©) &
s had or
s SS °°
a = oo
5 ; ;
RS 2 cS Pk e RS)
we NS we ev ae
a? @
Q? Vv Q
Fig. 2. Ovarian follicle diameter throughout sampling periods
of female Diamondback Terrapins captured in Louisiana.
Dashed lines within each box indicate the mean of the data,
bold lines within each box indicate the median of the data, and
the upper and lower edges of the boxes represent the 75% and
25% quartiles. T bars represent the minimum and maximum
values. Solid black circles represent outliers. Note n = 4 for late
nesting period, but only two samples were used in the analysis
as the others lacked any detectable follicles. The mean and
median overlap in some categories, so both lines may not be
visible.
assay CV for E, was 9.74% and the inter-assay CV was
12.3%. Samples from Louisiana were run concurrently
with the Florida samples reported in Donini et al.
2018, explaining the similar CV results reported in
both papers. Terrapins had detectable concentrations
of Vtg during all sample periods, ranging from 0.97—
71.95 mg/ml, and significant differences in Vtg were
observed across sampling periods (¥ 7.724; P
= 0.021; df = 2; Fig. 3A). The highest values were
observed during the peak nesting season (28.7 + 3.06
mg/ml for May and June) with a drop occurring in
the late nesting period (July and August, 14.9 + 7.65
mg/ml). There was no significant difference observed
between the late nesting season and pre-wintering
samples (October, 17.47 + 1.04 mg/ml). Likewise,
there was no significant difference in T concentrations
between sampling periods (Ff ,, = 2.541 P = 0.127,
Fig. 3B). Mean T values were 119.53 + 34.04 pg/ml in
the peak nesting period, and 47.61 + 13.90 ng/ml the
pre-wintering sampling periods. Samples from July
and August had low plasma volumes, which prevented
their inclusion in the analysis of T for the late nesting
period. There was significant variation in E, values
across sampling periods (77 = 6.567; P = 0.037; df
= 2; Fig. 3C), with a decrease from the peak nesting
period (4.90 + 1.67 ng/ml) to the late nesting period
(1.06 + 1.06 ng/ml), followed by an increase in the
pre-wintering period (21.48 + 9.07 ng/ml). Data are
summarized in Table 1.
August 2021 | Volume 15 | Number 2 | e282
Female reproductive cycle in Malaclemys terrapin
Discussion
Seasonal follicular cycle. All stages of follicles (I-IV)
and calcified eggs were present through the majority
of the peak nesting period in May and June. Despite
being gravid, females either lacked follicles or showed
only Class I or I follicles during the late nesting
season. Fall pre-wintering samples showed Class I-III
follicles. However, no significant differences between
average follicle size existed among sampling periods.
This general trend in follicular changes throughout the
season is indicative of the post-nuptial cycle observed
in most temperate turtle species, where large follicles
are more common in the early nesting periods, before
being ovulated and/or reabsorbed as the nesting season
concludes, with gonadal recrudescence occurring in the
months following final oviposition (Lewis et al. 1979).
In the late nesting season samples, no females showed
° large preovulatory class follicles, suggesting that their
reproductive output for the season had likely ended.
The small Class I follicles in two of the August samples
likely represent the beginning of the development of
the following year’s clutch, similar to patterns in other
temperate species (Gibbons 1968; Ernst 1971; Robinson
and Murphy 1978; Ganzhorn and Licht 1983).
Vitellogenin (mg/ml)
300
Testosterone (ng/ml)
Seasonal vitellogenin concentrations. The Vtg
concentrations were found to be higher in the peak nesting
0 :
jovial sil season (early May—July) and began to drop as the nesting
s > ae season concluded. Though not statistically significant, the
“3 (*) ‘ t * . é :
Ro ss © increasing pre-winter Vtg concentrations 1s suggestive
Ss be > o> ' ; ;
. PM ¢ of fall follicular proliferation. This apparent “rise” in
S : .
s pas s of the fall, along with the previously presented follicular
increase in size, suggested that follicular recrudescence
likely begins in the transition period between summer
and fall, with the Vtg concentration increasing at this
time, allowing for follicular growth. In Louisiana, we
expected the Vtg trends to resemble those of northern
turtle populations, as Vtg should be highest during the
peak of the reproductive season, before decreasing as the
season concludes. Indeed, this trend is similar to those
reported in Chrysemys picta (Duggan et al. 2001; Gapp
et al. 1979) and in Terrapins in New Jersey (Wolfe 2014)
as the nesting season reached its end in late summer.
An important factor to consider is that the four
individuals sampled in August of the late nesting period
were collected by commercial fishermen and retained
for a potentially extended period of time. It is not known
how long these individuals were in captivity, but they
were confirmed to have been captured during the same
sampling year. Nonetheless, these individuals may have
Estradiol (ng/ml)
Fig. 3. Concentrations of vitellogenin (A), testosterone (B), and estradiol (C) throughout sampling periods of female Diamondback
Terrapins captured in Louisiana. Dashed lines within each box indicate the mean of the data, bold lines within each box indicate the
median of the data, the upper and lower edges of the boxes represent the 75% and 25% quartiles, and bars represent the minimum
and maximum values. Solid black circles represent outliers, and different letters indicate significant differences (P<0.05) between
sampling periods. The mean and median overlap in some categories, so both lines may not be visible.
Amphib. Reptile Conserv. 44 August 2021 | Volume 15 | Number 2 | e282
Donini et al.
skewed our data for this period. Because these individuals
either lacked or had only small previtellogenic or
Class I or II follicles upon ultrasound examination,
this coincided with the decrease in circulating Vtg.
However, reabsorption of developing follicles has
been documented in wild pleurodire species, such as
Psuedemydura umbrina, when brought into captivity
(Kuchling and Bradshaw 1993). The stressors that the
collected terrapins experienced could have potentially
altered their natural cycles. At least two of the individuals
in the fisherman’s possession were captured on nesting
beaches and showed retained eggs. The retention of
eggs and dystocia (egg binding) have both been linked
to environmental and captivity stressors (Buhlman et al.
1995; Kuchling 1999b; Innis and Boyer 2002), which
may have influenced the natural vitellogenic cycles of
these animals. However, as noted by Kuchling (1999b),
some species of turtles are less prone to have altered
reproductive output under captive stress. Close relatives
of the Terrapins (e.g., Chrysemys picta and Trachemys
scripta) along with dissimilar species, like Sternotherus
odoratus, are resilient species and capable of producing
eggs in captivity, even after removal from the wild
(Mendonga and Licht 1986; Bowden et al. 2001). The
lower concentrations of Vtg observed here in August and
the fall corresponded with the findings of Wolfe (2014),
who also found that Terrapins exhibited a quiescent
period in the late summer/fall as nesting was completed.
Therefore, while potentially impaired due to captivity,
we believe the values from captive individuals likely
mimic the natural cycle, as they did not deviate from the
values reported in other studies.
Seasonal sex hormone concentrations. Testosterone
was found in relatively high concentrations in both the
early nesting season and pre-wintering sampling periods,
corresponding to large steroidogenic follicles that were
detected during the same time. However, there was no
significant difference in the T concentrations between
periods. Winters et al. (2016) noticed a distinct decline
in the T concentration of female Terrapins as the nesting
season progressed in New Jersey, something our data was
unable to capture given the lack of plasma available for
assays and sample size as a whole. Lee (2003) showed
peak T values occurring in April, before decreasing in
May and June, in a population of Terrapins in South
Carolina. Lee (2003) also documented basal values of T
from July to August, before the T concentration increased
steadily from September to October. Other temperate
species, such as Graptemys flavimaculata, also exhibited
increased T in the fall and spring, before it decreased in
late summer (Shelby and Mendonca 2001). Terrapins
from Louisiana may exhibit a similar pattern, but our
missing sampling points during the late nesting season
prevented confirmation of this pattern.
Estradiol was found in low concentrations during the
early nesting period, and even lower (near the detectable
Amphib. Reptile Conserv.
45
limit) during the late nesting season (two samples in
July). These concentrations are drastically lower than
those reported for similar periods in Florida Terrapins
(Donini et al. 2018). The concentrations then increased
to peak values in the fall pre-wintering period. This
hormonal trend is further suggestive of a postnuptial
cycle initiated in fall, with females beginning follicle
development for the following nesting season, similar to
the observations of Lee (2003) in South Carolina. It is also
possible that the low concentrations of E, observed could
be explained by the difference in sampling methods, as
some of the Terrapins in this study were captured via
fyke nets, making it difficult to know capture time prior
to sampling. Thus, the low concentration of reproductive
steroids observed may be explained by stress artifacts,
as glucocorticoids may affect the concentrations of other
hormones in reptiles (Mahmoud et al. 1989; Elsey et al.
1991). However, when these trap-captured samples were
compared to those that were hand captured, no significant
difference existed between the two groups. Further, the
high concentrations of T in similar sampling periods
indicated that stress may not have altered the estradiol
concentrations observed in trap-captured animals.
Additionally, some vertebrates release sex hormones in
brief periods and small concentrations. For instance, only
a single large peak of E, was observed in G. flavimaculata
at a similar latitude in the middle of their known nesting
season (Shelby et al. 2001). E, specifically is only needed
in small doses to initiate vitellogenesis via exogenous
injections (Ho et al. 1981), so it is possible that the
concentrations detected were sufficient to stimulate
vitellogenesis for a subsequent clutch. This possibility is
further supported by peak concentrations of Vtg during
the same time period, indicating that vitellogenesis was
at its peak. Additionally, it is possible that T was still
in the process of aromatization at the time of sampling
in these individuals. Aromatization of T into E, is a
known pathway in the endocrine cycles of turtles (Tsai
et al. 1994: Crews et al. 1996), and the peak estradiol
concentration may have been missed. This differs from
the observations in Donini et al. (2018) for Terrapins from
south Florida, in which E, and T concentrations remained
elevated simultaneously during the nesting season,
coinciding with confirmed multiple clutch productions.
Despite following the same overall method of post-
nuptial reproduction, this may indicate some differences
in reproductive timing in the Terrapins between these
two latitudes, though this is only speculative given
the gaps in sampling data from earlier spring. The low
concentrations of E, in two of the Terrapins sampled in
the late nesting period samples from July coincided with
a lack of follicles, supporting the idea that these animals
had finished producing clutches for the season and were
entering a quiescent phase.
It is legal to harvest Terrapins in Louisiana during a
limited season from 15 April—16 June, but only if the
Terrapins have a carapace length of 6 in (15.2 cm) or
August 2021 | Volume 15 | Number 2 | e282
Female reproductive cycle in Malaclemys terrapin
greater (Louisiana Fishing Regulations 2020). However,
this harvest window overlaps with the major reproductive
periods described herein, so it puts reproductively
active females at the greatest risk of collection given the
timing and harvest size requirements. Consequently, it
may be prudent to revisit this law given the findings of
this paper and other researchers concerning Terrapin
reproduction along the NGoM to ensure the future
survival of this species in the state.
Conclusions
This study is one of very few which quantifies
the endocrinological and ovarian dynamics of the
reproductive cycle in M. terrapin, and it provides novel
data for the species in the NGoM. Overall, the data
presented here suggest a brief late summer quiescent
phase before ovarian recrudescence begins in the fall,
with vitellogenesis occurring into the spring, resulting
in the production of at least one clutch of eggs with the
potential for more. Information gaps still remain in our
knowledge of the endocrine and ovarian cycles of M.
terrapin in this data set, and for the species as a whole.
However, based on the results from this study, we now
have baseline data that suggest a temperate pattern for
the post-nuptial cycle in female Terrapins in the NGoM.
It is possible that conspecifics at higher latitudes follow
similar trends, but additional sampling in these regions,
as well as during more sampling periods, is necessary
to complete a full description of the reproductive cycle
of this species. Though limited, the data presented here
do provide some clarity on the reproductive season and
activity of M. terrapin in Louisiana, and may prove useful
in the potential amendment of collection laws regarding
the size and timing of collection in Louisiana.
Acknowledgments.—We thank Gary Childers and the
SELU Microbiology lab for access to their plate reader,
and Michael Garafolo of ENZO Chemicals for providing
a discounted rate on EJA kits. Funding for this project
was provided by grants through the Diamondback
Terrapin Working Group, The Minnesota Herpetological
Society, the Southeastern Louisiana University Biology
Department Development Fund, and the Rockefeller
Trust Fund. We thank Ryan Chabot, Jacquelyn Coppard,
Gody Godwin, and Lisa Rodriguez for reviewing early
drafts of the manuscript. Research activities for this
project were approved by the Southeastern Louisiana
University IACUC committee (Protocol #30). All
captures and sampling of Terrapins were approved by the
Louisiana Department of Wildlife and Fisheries.
Literature Cited
Akins CD, Ruder CD, Price SJ, Harden LA, Gibbons
JW, Dorcas ME. 2014. Factors affecting temperature
variation and habitat use in free-ranging Diamondback
Amphib. Reptile Conserv.
Terrapins. Journal of Thermal Biology 44: 63-69.
Al-Habsi AA, AlKindi AYA, Mahmoud IY, Owens DW,
Khan T, Al-Abri A. 2006. Plasma hormone levels in
the Green Turtles (Chelonia mydas) during the peak
period of nesting at Ras Al-Hadd-Oman. Journal of
Endocrinology 191: 9-14.
Borden JA, Langford GJ. 2008. A simple pitfall trap
for sampling nesting Diamondback Terrapins.
Herpetological Review 39(2): 188-190.
Bowden RM, Ewer MA, Lipar JL, Nelson CE. 2001.
Concentrations of steroid hormones in layers and
biopsies of chelonian egg yolks. General and
Comparative Endocrinology 121: 95-103.
Buhlman KA, Lynch TK, Gibbons JW, Greene JL. 1995.
Prolonged egg retention in the turtle Deirochelys
reticularia in South Carolina. Herpetologica 51: 457—
462.
Callard IP, Callard GV, Lance V, Eccles S. 1976.
Seasonal changes in testicular structure and function
and the effects of gonadotropins in the freshwater
turtle, Chrysemys picta. General and Comparative
Endocrinology 30(3): 347-356.
Callard IP, Callard V, Salhanick AR, Barad D. 1978.
The annual ovarian cycle of Chrysemys_picta:
correlated changes in plasma steroids and parameters
of vitellogenesis. General and Comparative
Endocrinology 35(3): 245-257.
Carr AF. 1952. Handbook of Turtles. Comstock
Publishing Associates, Ithaca, New York, USA. 542 p.
Coleman AT. 2011. Biology and conservation of the
Diamondback Terrapin, Malaclemys terrapin pileata,
in Alabama. Ph.D. Dissertation, University of
Alabama, Birmingham, Alabama, USA.
Coleman AT, Roberge T, Wibbels T, Marion K, Nelson D,
Dindo J. 2014. Size-based mortality of adult female
Diamond-backed Terrapins (Malaclemys_ terrapin)
in blue crab traps in a Gulf of Mexico population.
Chelonian Conservation and Biology 13(2): 140-145.
Converse PE, Kuchta SR, Hauswaldt JS, Roosenburg
WM. 2017. Turtle soup, prohibition, and the
population genetic structure of Diamondback
Terrapins (Malaclemys terrapin). PLoS ONE 12(8):
e181898.
Crews D, Cantu AR, Rhen T, Vohra R. 1996. The relative
effectiveness of estrone, estradiol-178, and estriol
in sex reversal in the Red-eared Slider (7rachemys
scripta), a turtle with temperature-dependent
sex determination. General and Comparative
Endocrinology 102(3): 317-326.
Currylow AF, Tift M, Meyer J, Crocker D, Williams
RN. 2013. Seasonal variations in plasma vitellogenin
and sex steroids in male and female Eastern Box
Turtles (Zerrapene carolina carolina). General and
Comparative Endocrinology 180: 48—S5.
Donini J, Lechowicz C, Valverde R. 2018. Comparisons
of summer and winter patterns in ovarian development,
plasma vitellogenin, and sex steroids in female
August 2021 | Volume 15 | Number 2 | e282
Donini et al.
Diamondback Terrapins (Malaclemys _ terrapin)
in Southern Florida. Chelonian Conservation and
Biology 17(2): 227-235.
Drabeck DH, Chatfield MW, Richards-Zawacki C. 2014.
The status of Louisiana’s Diamondback Terrapin
(Malaclemys terrapin) populations in the wake
of the Deepwater Horizon oil spill: insights from
population genetic and contaminant analyses. Journal
of Herpetology 48: 125-136.
Duggan A, Paolucci MA, Tercyak A, Gigliotti M, Small
D, Callard I. 2001. Seasonal variation in plasma lipids,
lipoproteins, apolipoprotein A-I, and vitellogenin in
the freshwater turtle, Chrysemys picta. Comparative
Biochemistry and Physiology. Part A 130(2): 253-
269.
Elsey RM, Lance VA, Joanen T, McNease L. 1991. Acute
stress suppresses plasma estradiol levels in female
Alligators (A//igator mississippiensis). Comparative
Biochemistry and Physiology. Part A 100(3): 649-
65
Enge KM. 2005. Commercial harvest of amphibians and
reptiles in Florida for the pet trade. Pp. 198—211 In:
Amphibians and Reptiles: Status and Conservation
in Florida. Krieger Publishing Company, Malabar,
Florida, USA. 317 p.
Ernst CH. 1971. Sexual cycles and maturity of the turtle,
Chrysemys picta. The Biological Bulletin 140(2):
191-200.
Ernst CH, Lovich JE. 2009. Malaclemys terrapin,
Diamond-backed Terrapin. Pp. 344-363 In: Turtles
of the United States and Canada. Johns University
Press, Baltimore, Maryland, USA. 827 p.
Estep RL. 2005. Seasonal movement and habitat use
patterns of a Diamondback Terrapin (Malaclemys
terrapin) population. Ph.D. Dissertation, Graduate
School of the College of Charleston, Charleston,
South Carolina, USA.
Feinberg JA, Burke RL. 2003. Nesting ecology and
predation of Diamondback Terrapins, Malaclemys
terrapin, at Gateway National Recreation Area, New
York. Journal of Herpetology 37(3): 517-526.
Flewelling LJ, Adams DH, Naar JP, Atwood KE,
Granholm AA, O’Dea SN, Landsberg JH. 2010.
Brevetoxins in sharks and rays (Chondrichthyes,
Elasmobranchi) from Florida coastal waters. Marine
Biology 157(9): 1,937-1,953.
Ganzhorn D, Licht P. 1983. Regulation of seasonal
gonadal cycles by temperature in the Painted Turtle,
Chrysemys picta. Copeia 1983: 347-358.
Gapp DA, Ho SM, Callard IP. 1979. Plasma levels
of vitellogenin in Chrysemys picta during the
annual gonadal cycle: measurement by specific
radioimmunoassay. Endocrinology 104(3): 784-790.
Gibbons JW. 1968. Reproductive potential, activity, and
cycles in the Painted Turtle, Chrysemys picta. Ecology
49(3): 399-409.
Gibbons JW, Lovich JE, Tucker AD, FitzSimmons
Amphib. Reptile Conserv.
NN, Greene JL. 2001. Demographic and ecological
factors affecting conservation and management of
the Diamondback Terrapin (Malaclemys terrapin) in
South Carolina. Chelonian Conservation and Biology
4: 66-74.
Graham SP, Ward CK, Shelby Walker J, Sterrett S,
Mendonca MT. 2015. Sexual dimorphism and
seasonal variation of reproductive hormones in the
Pascagoula Map Turtle, Graptemys gibbonsi. Copeia
103: 42-50.
Harden LA, Williard AS. 2012. Using spatial and
behavioral data to evaluate the seasonal bycatch risk
of Diamondback Terrapins, Malaclemys terrapin, in
crab pots. Marine Ecology Progress Series 467: 207—
ZUR
Ho SM, Danko D, Callard IP. 1981. Effect of exogenous
estradiol-17B on plasma _ vitellogenin levels in
male and female Chrysemys and its modulation
by testosterone and progesterone. General and
Comparative Endocrinology 43(4): 413-421.
Ho SM, Kleis S, McPherson R, Heisermann GJ, Callard
IP. 1982. Regulation of vitellogenesis in reptiles.
Herpetologica 38: 40-50.
Holliday DK, Day RD, Owens DW. 2018. Environmental
toxicology. Pp. 161—183 In: Ecology and Conservation
of the Diamond-Backed Terrapin. Editors, Roosenburg
WM, Kennedy VS. Johns Hopkins University Press,
Baltimore, Maryland, USA. 277 p.
Horseman ND, Smith CA, Culley Jr DD. 1978. Effects
of age and photoperiod on ovary size and condition in
Bullfrogs (Rana catesbeiana). Journal of Herpetology
12(3): 287-290.
Huot-Daubremont C, Bradshaw SD, Bradshaw FJ,
Kuchling G, Grenot CJ. 2003. Variation of plasma sex
steroid concentrations in wild and captive populations
of Hermann’s Tortoise (7estudo hermanni hermanni)
in southern France. General and Comparative
Endocrinology 130(3): 299-307.
Innis CJ, Boyer TH. 2002. Chelonian reproductive
disorders. Veterinary Clinics of North America: Exotic
Animal Practice 5(3): 555-578.
Kennett R. 1999. Growth models for two species of
freshwater turtles, Chelodina rugosa and Elseya
dentata, from the wet-dry tropics of northern Australia.
Journal of Zoology 247(4): 457-473.
Kuchling G. 1982. Effect of temperature and photoperiod
on spermatogenesis in the tortoise, 7estudo hermanni
hermanni Gmelin. Amphibia-Reptilia 2: 329-341.
Kuchling G, Bradshaw SD. 1993. Ovarian cycle and
ege production of the Western Swamp _ Tortoise,
Pseudemydura umbrina (Testudines: Chelidae) in
the wild and in captivity. Journal of Zoology 229(3):
405-419.
Kuchling G. 1999a. Gonadal cycles and gamete
production. Pp. 31-67 In: The Reproductive Biology
of the Chelonia. Springer, Berlin, Germany. 229 p.
Kuchling G. 1999b. Reproductive cycles and
August 2021 | Volume 15 | Number 2 | e282
Female reproductive cycle in Malaclemys terrapin
environment. Pp. 91-106 In: The Reproductive
Biology of the Chelonia. Springer, Berlin, Germany.
229 ip.
Lahanas PN. 1982. Aspects of the life history of the
Southern Black-knobbed Sawback, Graptemys
nigrinoda delticola. M.S. Thesis, Auburn University,
Auburn, Alabama, USA.
Lee MA. 2003. Reproductive biology and season
testosterone patterns of the Diamondback Terrapin,
Malaclemys terrapin, in the estuaries of Charleston,
South Carolina. M.S. Thesis, College of Charleston,
Charleston, South Carolina, USA.
Lewis J, Mahmoud IY, Klicka J. 1979. Seasonal
fluctuations in the plasma _ concentrations of
progesterone and oestradiol-17B in the female
Snapping Turtle (Chelydra serpentina). Journal of
Endocrinology 80: 127-131.
Licht P. 1982. Endocrine patterns in the reproductive
cycle of turtles. Herpetologica 38: 51-61.
Louisiana Fishing Regulations. 2020. Reptiles and
Amphibians. Louisiana Department of Wildlife and
Fisheries, Baton Rouge, Louisiana, USA. Available:
http://www.eregulations.com/louisiana/fishing/
reptiles-amphibians [Accessed: 25 May 2020].
Lovich JE, Thomas M, Ironside K, Yackulic C, Puffer
SR. 2018. Spatial distribution of estuarine Diamond-
backed Terrapins (Malaclemys terrapin) and risk
analysis from commercial Blue Crab (Callinectes
sapidus) trapping at the Savannah Coastal Refuges
Complex, USA. Ocean and Coastal Management
157: 160-167.
Mahmoud IY, Guillette LJ, McAsey ME, Cady C.
1989. Stress-induced changes in serum testosterone,
estradiol-17B, and progesterone in the _ turtle,
Chelydra serpentina. Comparative Biochemistry and
Physiology. Part A 93: 423-427.
Mann TM. 1995. Population surveys for Diamondback
Terrapins (Malaclemys terrapin) and Gulf Salt Marsh
Snakes (Nerodia clarkii clarkii) in Mississippi.
Mississippi Museum of Natural Science Technical
Report 37: 1-75.
Mendon¢a MT. 1987. Photothermal effects on the ovarian
cycle of the Musk Turtle, Sternotherus odoratus.
Herpetologica 43: 82-90.
Mendonga MT, Licht P. 1986. Seasonal cycles in gonadal
activity and plasma gonadotropin in the Musk Turtle,
Sternotherus odoratus. General and Comparative
Endocrinology 62(3): 459-469.
Mitchell JC. 1985. Female reproductive cycle and life
history attributes in a Virginia population of Painted
Turtles, Chrysemys picta. Journal of Herpetology
19(2): 218-226.
Myre BL, Guertin J, Selcer K, Valverde RA. 2016.
Ovarian dynamics in free-ranging Loggerhead Sea
Turtles (Caretta caretta). Copeia 104(4): 921-929.
Noeske TA, Meier AH. 1977. Photoperiodic and
thermoperiodic interaction affecting fat stores and
Amphib. Reptile Conserv.
48
reproductive indexes in the male Green Anole, Anolis
carolinensis. Journal of Experimental Zoology 202:
97-102.
Pearson SH, Wiebe JJ. 2018. Considering Diamond-
backed Terrapin (Malaclemys terrapin) nesting
habitat and reproductive productivity in the restoration
of Gulf of Mexico coastal ecosystems. Ocean and
Coastal Management 155: 8-14.
Petre C, Selman W, Kreiser B, Pearson SH, Wiebe JJ.
2015. Population genetics of the Diamondback
Terrapin, Malaclemys terrapin, in _ Louisiana.
Conservation Genetics 16(5): 1,243-1,252.
Robinson KM, Murphy GG. 1978. The reproductive
cycle of the Eastern Spiny Softshell Turtle (7rionyx
spiniferus spiniferus). Herpetologica 34(2): 137-140.
Roosenburg WM, Baker PJ, Burke R, Dorcas ME, Wood
RC. 2019. Malaclemys terrapin. The IUCN Red List
of Threatened Species 2019: e.T12695A507698.
Rostal DC, Grumbles JS, Palmer KS, Lance VA, Spotila
JR, Paladino FV. 2001. Changes in gonadal and
adrenal steroid levels in the Leatherback Sea Turtle
(Dermochelys coriacea) during the nesting cycle.
General and Comparative Endocrinology 122(2):
139-147.
Saka M, Tada N, Kamata Y. 2011. The annual ovarian
cycle of the Reeves’ Pond Turtle Chinemys reevesii
(Reptilia: Geoemydidae) based on seasonal variations
in the serum vitellogenin level and follicular growth.
Current Herpetology 30(2): 103-110.
Schneider CA, Rasband WS, Eliceir1 KW. 2012. NIH
Image to ImageJ: 25 years of image analysis. Nature
Methods 9(7): 671-675.
Seigel RA. 1980a. Nesting habits of Diamondback
Terrapins (Malaclemys terrapin) on the Atlantic coast
of Florida. Transactions of the Kansas Academy of
Sciences 83(4): 239-246.
Seigel RA. 1980b. Courtship and mating behavior of
the Diamondback Terrapin, Malaclemys terrapin
tequesta. Journal of Herpetology 14: 420-421.
Selman W, Baccigalopi B. 2012. Effectively sampling
Louisiana Diamondback Terrapin (Malaclemys
terrapin) populations, with description of a new
capture technique. Herpetological Review 43(A4):
583-588.
Selman W, Baccigalopi B, Baccigalopi C. 2014.
Distribution and abundance of Diamondback
Terrapins (Malaclemys terrapin) in southwestern
Louisiana. Chelonian Conservation and Biology 13:
131-139.
Selman W, Pearson SH, Wiebe JJ. 2019. Comparisons of
population structure and morphology of a saltmarsh
keystone species (Malaclemys terrapin) across coastal
Louisiana. Estuaries and Coasts 42(4): 1,138-1,148.
Shelby JA, Mendonca MT. 2001. Comparison of
reproductive parameters in male Yellow-blotched
Map Turtles (Graptemys flavimaculata) from a
historically contaminated site and a reference site.
August 2021 | Volume 15 | Number 2 | e282
Donini et al.
Comparative Biochemistry and Physiology. Part C barriers in Barnegat Bay, New Jersey. General and
129(3): 233-242.
Comparative Endocrinology 235: 136-141.
Smelker K, Smith L, Arendt M, Schwenter J, Rostal D, |= WolfeSA.2014. Plasma vitellogenin intwo Diamondback
Selcer K, Valverde R. 2014. Plasma vitellogenin in Terrapin populations (Malaclemys terrapin). M.S.
free-ranging Loggerhead Sea Turtles (Caretta caretta) Thesis, Southeastern Louisiana University, Hammond,
of the northwest Atlantic Ocean. Journal of Marine Louisiana, USA.
Biology 2014: 1-10. Wood RC, Herlands R. 1997. Turtles and tires: the impact
Tsai PS, Hayes TB, Licht P. 1994. Role of aromatization of road kills on northern Diamondback Terrapin,
in testosterone-induced inhibition of luteinizing Malaclemys terrapin terrapin, populations on the
hormone secretion in female turtles, Trachemys Cape May Peninsula, southern New Jersey. Pp. 46—53
scripta. Biology of Reproduction 50(10): 144-151. In: Conservation, Restoration, and Management of
Winters JM, Carruth WC, Spotila JR, Rostal DC, Avery Tortoises and Turtles-An International Conference.
HW. 2016. Endocrine indicators of a stress response Editor, Abbema JV. New York Turtle and Tortoise
in nesting Diamondback Terrapins to shoreline Society, New York, New York, USA. 494 p.
Amphib. Reptile Conserv.
Jordan Donini is a Professor of Biology at Florida Southwestern State College in Naples, Florida, USA.
Jordan received his B.S. in Biology from Florida Gulf Coast University (Fort Myers, Florida, USA) and his
M.S. from Southeastern Louisiana University (Hammond, Louisiana, USA). His research focuses on the life
history and reproductive ecology of the herpetofauna in the coastal states of the Gulf of Mexico.
Will Selman is an Assistant Professor of Biology at Millsaps College in Jackson, Mississippi, USA.
Will received his B.S. from Millsaps College and his Ph.D. from the University of Southern Mississippi
(Hattiesburg, Mississippi, USA). The research that he and his undergraduate students pursue focuses on
turtle life history and ecology in the southeastern United States, and the distribution and population status
of herpetofauna in Mississippi and the region. He is a member of the IUCN Tortoise and Freshwater Turtle
Specialist Group, on the Board of Advisors for the American Turtle Observatory, and the Chelonian Section
Co-Editor for Herpetological Conservation and Biology. Will also co-edited a recent issue of Chelonian
Conservation and Biology dedicated to the conservation and biology map turtles and sawbacks of the genus
Graptemys. Photo by Sophie Wolf.
Steven Pearson is an Ecologist with an interest in the anthropogenic impacts on plant and animal communities.
He completed his Bachelor of Science in Environmental Studies from the Richard Stockton College of New
Jersey (Galloway, New Jersey, USA), and worked for several years as a seasonal biologist with plants,
raptors, mammals, and reptiles before attending Drexel University (Philadelphia, Pennsylvania, USA) for his
Ph.D. At Drexel, Steven studied spatial resource use and dietary overlap between the non-native Trachemys
scripta elegans and the other members of the turtle community. After completing his Ph.D., he worked with
the Louisiana Department of Wildlife and Fisheries studying Malaclemys terrapin population and nesting
ecology, and determining the short-term and long-term impacts of oil and gas spills on aquatic environments
and organisms. Steven currently resides in New York, where he works with the New York Department of
Environmental Conservation as a Research Scientist, focusing on studying the abundance, distribution, and
management of aquatic invasive species.
Roldan A. Valverde is a Professor of Biology at Southeastern Louisiana University (Hammond, Louisiana,
USA) and Scientific Director of the Sea Turtle Conservancy. Roldan received his B.S. in Marine Biology at
the Universidad Nacional of Costa Rica, and his Ph.D. at Texas A&M University (College Station, Texas,
USA). He conducted post-doctoral training at the University of Michigan (Ann Arbor, Michigan, USA).
His current interests include the stress and reproductive endocrinology of sea turtles. Through his research,
Roldan collaborates with researchers in several parts of the USA, Latin America, and Europe.
49 August 2021 | Volume 15 | Number 2 | e282
Official journal website:
amphibian-reptile-conservation.org
Amphibian & Reptile Conservation
15(2) [General Section]: 50—58 (e283).
Effect of anthropogenic habitat disturbance on the nesting
ecology of the Wood Turtle (Glyptemys insculpta)
12,*Alexandra VIk, ‘Elizabeth Bastiaans, ‘Daniel Stich, and ‘Donna Vogler
'Department of Biology, State University of New York-College at Oneonta, 108 Ravine Parkway, Oneonta, New York, 13820 USA *Department of
Biology, Randolph-Macon College, 114 College Avenue, Ashland, Virginia, 23005 USA
Abstract.—In species that lack parental care beyond nesting, the fitness of the mother depends on the
selection of a high-quality nest site. Unfortunately, given the importance of nest site selection, anthropogenic
habitat degradation continues to decrease the availability of high-quality nest sites. This study focuses on
nest-site selection by a population of Endangered Wood Turtles (Glyptemys insculpta) in a disturbed site with
a high amount of human activity and invasive plant species. Logistic regression was used to examine nest-
site microhabitat characteristics such as soil composition, moisture, temperature, slope, vegetation type and
cover, canopy cover, and distances to water and vegetation. Wood Turtle nest site microhabitat characteristics
were also characterized in a protected site and compared to those of the disturbed site using a series of t-tests
and x? tests. Soil composition and a slight slope were the most important factors for Wood Turtle nest-site
selection at the disturbed site. Turtles at the disturbed site preferred a high amount of sand and small gravel,
with little or no larger gravel or clay. The disturbed site had a higher maximum temperature overall, with an
average of 35 °C versus 28 °C at the protected site. The turtles at both sites nested in sandy habitat, while the
nests at the protected site had higher moisture content than those at the protected site and lacked gravel. Since
is it common for Wood Turtles to use anthropogenic habitat, identifying, protecting, and managing nesting
sites are essential to Wood Turtle conservation efforts. To enhance the overall nesting success of these turtles
in disturbed areas, artificial nest sites could be judiciously placed and used by the turtles. Artificial nest sites
could be managed to improve the nesting success of this Endangered turtle species and, also, potentially
reduce adult loss by modifying the upland movements of adult females during the nesting season.
Keywords. Connecticut, Emydidae, fragmentation, habitat management, human disturbance, New York, USA
Citation: VIkA, Bastiaans E, Stich D, Vogler D. 2021. Effect of anthropogenic habitat disturbance on the nesting ecology of the Wood Turtle (Glyptemys
insculpta). Amphibian & Reptile Conservation 15(2) [General Section]: 50-58 (e283).
Copyright: © 2021 Vik et al. This is an open access article distributed under the terms of the Creative Commons Attribution License [Attribution
4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction in any
medium, provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced, are
as follows: official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 22 September 2020; Published: 24 August 2021
Introduction
Investment in parental care varies across taxa, with
some animals watching over and defending their young
for many years, while other animals have minimal
interactions with their offspring after birth (Gross 2005).
Clutton-Brock (1991) defines parental care as any type
of parental investment in the offspring after eggs have
been deposited or young have been born. For species
that do not provide direct parental care to their offspring,
strategies to increase the survival of the hatchlings may
include allocating energy to eggs in the form of lipid
reserves (Nagle et al. 2003; Kamel and Mrosovsky 2005)
or selecting a high-quality nest environment (Kolbe and
Janzen 2002). Habitat characteristics associated with
nest sites, such as temperature (Weisrock and Janzen
1999), can have direct effects on offspring survival and
phenotypes (Kolbe and Janzen 2002). Because turtles
are long-lived animals which require many years to
reach sexual maturity and have high egg and hatchling
mortality with no parental care beyond nesting, nest site
selection may be important for population persistence
since the nest site may directly influence nest success
(Lovich et al. 1990; Congdon et al. 1993; Horne et al.
2003). Unfortunately, given the importance of nest site
selection by turtles, anthropogenic habitat degradation
continues to decrease the availability of high-quality nest
sites, which could cause turtles to delay nesting and/or
nest in an unfavorable habitat (Walde et al. 2007). Due
to habit losses caused by anthropogenic disturbances,
reptiles are declining globally (Gibbons et al. 2000).
Turtles are particularly threatened by the increasing
Correspondence. *v/[email protected] (AV), Elizabeth. [email protected] (EB), [email protected] (DS),
Donna. [email protected] (DV)
Amphib. Reptile Conserv.
August 2021 | Volume 15 | Number 2 | e283
Vik et al.
pressures of anthropogenic disturbances (Williams
1999). The International Union for Conservation of
Nature (IUCN) lists 148 of the 356 turtle species as
either Vulnerable, Endangered, or Critically Endangered
(Turtle Conservation Coalition 2018).
This study compares Wood Turtle (G/yptemys
insculpta) nest site selection between an anthro-
pogenically altered nesting site and a protected nesting
site. The Wood Turtle is currently under review for
protection under the Endangered Species Act (U.S. Fish
and Wildlife Service, 2019) and listed as Endangered by
the IUCN (IUCN 2016). The Wood Turtle is particularly
vulnerable to habitat loss and fragmentation because it is
a long-lived animal that displays low vagility and high
site fidelity (Garber and Burger 1995). Since the Wood
Turtle prefers open canopy forested areas, Kaufmann
(1992) speculated that this species might benefit from the
increased habitat openings created by humans. However,
anthropogenically generated habitat openings are often
the sites of other human impacts, which may reduce the
survival of Wood Turtle eggs laid there (Saumure 2004).
Wood Turtles require a variety of habitats (Arvisais
et al. 2004). Studies in Pennsylvania (Kaufmann 1992)
and Ontario (Foscarini 1994) showed that Wood Turtles
selected their habitat nonrandomly relative to availability
(Arvisais et al. 2004). They are known as an “edge
species” according to Kaufmann (1992), with a strong
selection of riparian habitat within 300 m of streams
(Arvisais et al. 2004). Wood Turtles often use forested
areas with openings in the canopy to allow for foraging
on herbaceous undergrowth and/or slugs (Lee 1999).
During the reproductive season, turtles require additional
areas of habitat. For example, gravid females travel
hundreds of meters seeking nest sites, hatchlings migrate
from nests to water, and males may travel in search of a
mate (Bol 2007).
Depending on latitude, the Wood Turtle nesting
season occurs between late May and mid-July (Arvisais
2002). Females construct nests on sandy beaches, railway
embankments, agricultural fields, and gravel quarries;
selecting for well-drained, sloped, and exposed areas
close to a water source (Harding and Bloomer 1979;
Foscarini 1994; Walde et al. 2007). The turtles spend a
few hours to several days exploring suitable nest sites
(A. VIk, pers. obs.). The time investment in finding a
nest site indicates that females are selective about where
they lay their eggs, likely to increase hatchling success
(Hughes et al. 2009). Unlike some other turtles, Wood
Turtles have genetic sex determination rather than
temperature-dependent sex determination (Ewert and
Nelson 1991). This suggests that females select nesting
locations based on maximizing hatchling survival rather
than balancing the sex ratio of the clutch (Hughes et al.
2009). Therefore, identifying, protecting, and managing
nesting sites are essential to Wood Turtle populations
because female Wood Turtles are highly sensitive to
disturbance prior to the initiation of egg laying (Walde et
Amphib. Reptile Conserv.
54
al. 2007). Furthermore, our lack of knowledge about the
nesting ecology and reproductive behavior of this species
hinders conservation efforts (Bury 2006; McCallum
and McCallum 2006). The goal of this study was to
locate and characterize Wood Turtle nesting habitat at
two Wood Turtle occupied sites, one disturbed and one
protected, to increase our knowledge of the usefulness of
anthropogenic sites and better inform the management of
these areas.
Materials and Methods
Study sites. The disturbed study site, located in the
Susquehanna watershed, was a park used for recreation
activities such as hiking, soccer, softball, picnics, and
angling. The forest consisted of mixed deciduous Oak-
Maple-Birch-Sycamore (Quercus, Acer, Betula, and
Platanus). The floodplains were mainly composed
of Spotted Knapweed (Centaurea), Common Lady’s
Thumbprint (Persicaria), Mugwort (Artemesia), and
Goldenrod (Solidago). A highly invasive plant species
native to Asia, Japanese Knotweed (Fallopia japonica),
dominated the floodplains and forests forming dense
stands that excluded most other vascular plants and
shrubs. Litter invaded the Wood Turtle habitat and
vegetation in the park was periodically mowed (A. VIk,
pers. obs.). On the other side of the creek, across from the
park, was a field that was mowed periodically for hay and
included a building supply store which provides masonry
products to the public. Daily uses of the supply store
include the operation of boom trucks, tractor trailers, box
trucks, and concrete mixers.
The protected site was located in the Great Swamp
Wildlife Management Area (WMA), Putnam County,
Connecticut, bordering New York. This area is managed
by the New York State Department of Environmental
Conservation, with an emphasis on habitat preservation
and restoration for the benefit of native species (NYS
DEC 2021). This WMA covers 444 acres of the Great
Swamp, which encompasses natural Wood Turtle nesting
habitat that is monitored by the staff, and free from
anthropogenic disturbances.
The exact study location of each site has been omitted
from this article to prevent illegal collection of the Wood
Turtles, but is available upon request at the authors’
discretion.
Data collection. At both the disturbed and protected
sites, Wood Turtles were captured along the shoreline in
the spring and summer of 2017 and 2018. The individual
adult and juvenile turtles captured were weighed, sexed
based on plastron concavity, and aged by counting
growth annuli on dorsal scutes (Harding and Bloomer
1979). Measurements (+ 0.01 mm) of the carapace
and plastron lengths were taken using calipers. Turtles
smaller than 180 mm were considered juveniles (Walde
1998). To establish a unique identification for each turtle,
August 2021 | Volume 15 | Number 2 | e283
Nesting ecology of Glyptemys insculpta
Table 1. List and descriptions of covariates that were used in
the first subset of Wood Turtle nesting habitat selection models.
Covariate Covariate descriptions
Soil composition large gravel (> 5 cm), small gravel
(<2 mm), sand, clay
Temperature (°C) Average, maximum
notches were filed using a Dremel tool along the edge
of the scutes with notch codes provided by New York
Department of Environmental Conservation (DEC) and
Connecticut Department of Energy and Environmental
Protection (DEEP). Each turtle weighing at least 400 g
was fitted with a radio transmitter (Advanced Telemetry
Systems, Isanti, Minnesota, USA), which was glued
with epoxy gel to the rear marginal scutes of the
carapace. The transmitter weighed approximately 16 g
and never exceeded 5% of body mass. All procedures
were reviewed and approved by the SUNY Oneonta
Institutional Animal Care and Use Committee (IACUC
#2018-25), DEC (DEC Scientific permit #2136), and
DEEP (DEEP Scientific permit # 1718008).
In May—August, the spring and summer active
season of the turtles, 14 turtles at the disturbed site were
located by radiotelemetry every other day during the
pilot season in 2017. In 2018, 17 Wood Turtles were
tracked. Turtles were located between 0800 and 2000
h (most of the location events were during 0800-1400
h). Beginning on 26 May 2018, excursions were made
between 1700 and 2030 h to observe any nesting female
behavior (Ernst et al. 1994; Walde et al. 2007). The first
signs of nesting occurred on 28 May 2018 at 2000 h. The
turtle was sniffing and throwing dirt on her carapace,
which indicates nesting behavior (Harding and Bloomer
1979). Because Wood Turtles are known to start nest
activity at approximately 1700 h or later (Walde et al.
2007), radio tracking began every day from 1200-1500
h to locate turtle nesting grounds and avoid disturbing
nesting females. In the evening, once nesting females
were located, observations were made from concealed
locations to prevent the females from abandoning their
nests. If a Wood Turtle stayed in the nesting ground past
2030 h, observations continued until the turtle retreated
to the stream (Walde et al. 2007).
Eighteen Wood Turtles were tracked at the protected
site every other day during the nesting season by one of
the Great Swamp biologists. Known nesting sites were
checked daily during 1900-2100 h beginning 26 May,
while 30 May marked the beginning of the nesting
season at this site. Once the nesting season was initiated,
the same protocols were followed for observations at the
disturbed and protected sites.
At both sites, after a female was done nesting, the
turtle eggs were excavated, and microhabitat variables
were measured (Tables 1 and 2). The eggs at the disturbed
site were placed in vermiculite in an incubator at 28 °C,
and were then used in another study (Janzen and Morjan
Amphib. Reptile Conserv.
52
Table 2. List and descriptions of landscape nest covariates
that were used in second subset of Wood Turtle nesting habitat
selection models.
Covariate Covariate descriptions
Vegetation bare, herbaceous, woody
Canopy open, partial, full
Vegetation nest cover none, partial, full
2002), while the eggs at the protected nest site were left in
the ground with an exclosure placed over the nest. Many
of the nests at the unprotected site were found by digging
in suitable Wood Turtle nesting habitat, which included
floodplains with sand and/or small gravel present with
little vegetation or canopy cover. Soil samples (445 g)
were collected at approximately 10 cm depths from all
nests to measure grain size and moisture content (Hughes
et al. 2009). A sieve was used to separate 400 g of soil
into three different categories of large gravel (> 5 cm),
small gravel (< 2 mm), and sand (Table 1). Clay was
separated from the sand by adding water to the sample,
mixing the contents, and leaving it sit for two days to
allow separation. The amount of soil in each category
was expressed as a percentage. To determine moisture
content, 45 g of the sand separated out from the soil
sample was placed in a small tin, which was placed 1n an
Isotemp Programmable Muffle Furnace 650-750 Series
(Fisher Scientific, Dubque, Iowa, USA) for two weeks
at 110 °C (Hughes et al. 2009). After two weeks, the soil
samples were weighed again to determine how much
moisture weight was lost.
When all observed nesting activity ceased on 27 June,
waterproof iButton (ButtonLink, LLC, Whitewater,
Wisconsin, USA) temperature dataloggers were placed 15
cm deep at the site of each nest, which is the approximate
nest depth of Wood Turtles (Foscarini 1994; Walde 1998;
Compton 1999; this study). To prevent disturbance of
the eggs at the protected site, temperature loggers were
placed approximately 10 cm from the clutch and 15 cm
deep. Temperatures were recorded at 4-hour intervals
during the incubation period until 20 August when all
hatchlings had hatched. The dataloggers were placed in
15-inch PCV pipes and waterproofed by cementing a
coupler to each end of the PCV pipe.
Other microhabitat variables recorded in a radius of 1
m (around the nest) included: slope, canopy cover, nest
cover, vegetation type, and distances to nearest vegetation
and aquatic habitat (Table 2). At the disturbed site, habitat
was measured both at the nest location and at a nearby
randomly selected unused nest habitat with availability
at the same place and time, based on a random compass
bearing and a random distance selected uniformly from
~0.3—17 m (Compton 2002; Dragon 2014).
Data Analysis
Disturbed site. To estimate the probability of Wood
Turtles using specific nesting microhabitat in the
August 2021 | Volume 15 | Number 2 | e283
Vik et al.
Table 3. Candidate model selection statistics for Wood Turtle nesting choice first subset. K is the number of parameters in each of
the models. AICc is the AIC score corrected for sample size. AAIC is the difference in AICc between the best model and each of the
other models. AIC wt is the probability that a given model is the best model in the candidate set.
Model
Soil PC 1 + soil PC 2
Soil PC 2
Soil PC 1
Average
Maximum temperature
Moisture
Maximum temperature + average
Maximum temperature + average + soil PC 1 + soil PC 2 + moisture
disturbed site, logistic regression in the Ime4 (Bates et al.
2015) package in R (R Core Team 2013) was used based on
a binary response (1 = used, 0 = random). A set of models
were fit using maximum likelihood estimation. A total of
16 models were constructed using a priori combinations
of explanatory variables. The explanatory variables were
divided into two subsets used to make models: (1) nest
characteristics, including soil composition, moisture
content, and temperature (Table 3); and (2) landscape
features, including slope, canopy cover, amount of nest
cover, type of vegetation and distances from the nearest
vegetation and aquatic habitat (Table 4).
Due to the small sample size of nesting turtles and the
soil variables being intercorrelated, a Principal Component
Analysis (PCA) was used on the soil variables to reduce
the dimensionality. The four soil variables (large gravel,
small gravel, sand, and clay) were grouped into two PC
axes that explained 81% of the variation combined in soil
composition (Table 5). The logistic regression model for
the nest characteristics subset was constructed using 10
paired nest locations due to the loss of two temperature
loggers in a flash flood. The landscape model consisted
of 12 paired nest locations. Akaike’s Information Criterion
(AIC) was used to rank each competing model using the
AlICcmodavg package (Mazerolle 2017). The model with
the lowest AIC score was considered the best supported
(Burnham and Anderson 2002).
Comparisons of the disturbed and protected sites. To
determine if nest site microhabitat characteristics differed
K AICe AAIC AIC wt
3 DI23 0.00 0.54
2 26.68 1.44 0.26
2 29.26 4.03 0.07
2 29:99. 4.76 0.05
2 30.61 5.38 0.04
2 31.89 6.66 0.02
3 32.77 7.53 0.01
6 34.32 9.09 0.01
between the disturbed and protected sites, a series of
t-tests and y? tests were conducted in jamovi (Jamovi
Project 2018). The statistical tests were conducted only
using actual turtle nests. Multiple t-tests were used to
identify differences in the variables: “temperature,”
“slope,” “distance vegetation,” “distance water,” “soil
composition,’ and “moisture” between the disturbed
and protected sites. The variables “distance vegetation”
and “distance water” were log-transformed due to the
violation of normality and equal variances. Since moisture
and soil microhabitat variables were correlated, a second
PCA analysis comparison was performed between the
two sites that grouped the four soil explanatory variables
and moisture together on habitat that was used for nesting
(Table 6). The variables with an eigenvalue above one
were then used in a ¢-test to compare soil compositions
of the two nest sites. Chi-square tests were performed on
the categorical variables “vegetation,” “canopy,” and “nest
cover” to determine whether the frequency of various
categories differed between disturbed and protected sites.
Since multiple statistical tests were performed, Bonferroni
correction was used to adjust the p-value to 0.003 to
minimize type I errors.
Results
Twelve nests were observed at the disturbed nest site and
seven at the protected nest site. The number of eggs in each
nest ranged from one to 16 (8.3 + 4.84) at the disturbed site
and eight to nine at the protected site (7.67 + 0.70). Most
Table 4. Candidate model selection statistics for Wood Turtle nesting choice second subset. Variable definitions are as indicated in Table 3.
Model
Slope degree
Slope degree + vegetation
Vegetation
Nest cover
Distance vegetation
Distance water
Canopy
Slope degree + vegetation + distance vegetation + canopy + nest
cover + distance water
Amphib. Reptile Conserv.
53
K AICce AAIC AIC wt
2 32.21 0.00 0.48
4 33:25 1.04 0.29
3 34.81 2.60 0.13
2 37.59 5.38 0.03
2 37.64 5.43 0.03
2 37.83 5.62 0.03
4 40.40 8.19 0.01
10 53.63 21.43 0.00
August 2021 | Volume 15 | Number 2 | e283
Nesting ecology of Glyptemys insculpta
Table 5. Loading matrix from a Principal Component Analysis
(PCA) of four microhabitat variables measured at N = 10
disturbed Wood Turtle nest sites and N = 10 random paired
locations.
Covariate PC1 PC2
Large gravel -0.98 0.12
Small gravel 0.42 0.79
Sand 0.85 -0.50
Clay 0.57 0.37
female turtles started nest construction at approximately
1930 h, corresponding to sunset, and completed their
nests 2—3 hours later. Warm humid rainy days stimulated
nesting activity from multiple turtles at the same time (A.
Vik, pers. obs.).
Disturbed site. In 2018, 12 Wood Turtle nest sites were
located at the disturbed site. In 2017 and 2018, Wood
Turtle nesting began on 28 May and ended approximately
19 June. For the nest characteristics subset, “soil PC
2” was the most important predictor of nesting habitat
selection based on its inclusion in both top models. The
best model indicated significant effects of both “soil PC
1” (GLM: ¥°7, = 4.23, P = 0.03) and “soil PC 2” (GLM: y’,
= 6.82, P = 0.009) (Table 3). This model suggested that
the likelihood of Wood Turtles using habitat increased
when there was a high amount of small gravel and sand
along with lower amounts of large gravel and clay. Turtles
were more likely to use habitat with high values of “soil
PC 1,” which corresponded to minimal amounts of large
gravel and a higher amount of sand in addition to small
gravel and clay. The second-best model contained the
explanatory variable “soil PC 2.” This model indicated
that there was a higher probability of use when there was
a high amount of small gravel and no clay present.
The presence of a slope, which ranged from 7—50°,
was the most significant predictor variable of nesting
habitat selection for the landscape subset of models
(GLM: y= 5.63, P = 0.01) (Table 4). The use of nesting
habitat was reduced when zero slope was present. The
second-best model contained the explanatory variables
“slope” and “vegetation.” Slope in combination with
herbaceous vegetation resulted in a higher likelihood of
Wood Turtles selecting for that particular habitat. The
turtles were least likely to select nesting habitat with no
vegetation or slope present.
Comparisons of Disturbed and Protected Sites
Soil composition and moisture. In the overall
comparison between selected nest habitat at the disturbed
and protected nest sites, soil composition and moisture
principal component variables were _ significantly
different (¢ = 3.72, df = 15, P = 0.002). The principal
component variable revealed that at the protected site,
turtles were more likely to select sandy habitat with
Amphib. Reptile Conserv.
Table 6. Loading matrix from a Principal Component Analysis
(PCA) of five microhabitat variables measured at N = 10
disturbed Wood Turtle nest sites and N = 7 protected Wood
Turtle nest sites.
Covariate PC1 PC2
Large gravel -0.94 0.0019
Small gravel -0.78 0.34
Sand 0.97 -0.21
Clay 0.45 -0.76
Moisture 0.70 0.58
a higher amount of moisture and clay and no gravel
compared to the disturbed site. At the disturbed site, the
nests had more small gravel and less moisture and clay.
Temperature. The maximum temperature was also
significantly different between the disturbed and protected
field sites (t = 7.04, df = 12, P = 0.001). Although the
disturbed site had lower nest temperatures during the
morning hours, there was a higher maximum temperature
with an average of 35 °C compared to the protected site
with an average maximum temperature of 28 °C. The
minimum average temperatures at the disturbed and
protected sites were 15 °C and 19 °C, respectively (¢
= -3.42, df = 12, P = 0.005), which did not reach the
threshold for a statistically significant difference after
Bonferroni correction. The average temperatures were
24 °C at the disturbed site and 22 °C at the protected site
(¢ = 2.70, df= 12, P =0.019).
Landscape features. Since the amounts of canopy and
vegetation nest cover were low at both the disturbed and
protected sites, there was no significant difference in
canopy cover (7 = 0.62, df = 1, P = 0.43) or vegetation
nest cover (7 = 0.31, df= 1, P=0.58). The turtles at both
sites selected for bare nesting ground with no vegetation
present (x? = 7.28, df = 3, P = 0.06). The average slopes
for the nests at the disturbed and protected sites were
13.40° and 14.17°, respectively (¢ = -0.16, df= 17, P=
0.87). Distance of vegetation from each nest site averaged
15.24 cm for the disturbed site and 22.86 cm for the
protected site (¢ = -0.74, df = 14, P = 0.47). The turtles
at both the disturbed and protected sites nested on the
floodplains or close to a water source (t = -0.11, df = 17,
P=0.91). Although the maximum distance to the nearest
water from nests was 69 m at the protected site and 24
m at the disturbed site, the average at the protected site,
including two outlier nests, was 20 m (+ 11.16) compared
to 4 m (+ 1.4) at the disturbed site.
Discussion
Wood Turtles are known to select nesting habitat that
is open, slightly sloped, and well-drained (Walde et al.
2007; Hughes et al. 2009), which the results presented
here supported. Nest site selection at the disturbed site
was nonrandom based on microhabitat characteristics.
August 2021 | Volume 15 | Number 2 | e283
Vik et al.
Both disturbed and protected nest sites consisted of open
canopy, sandy patches, and little or no vegetation.
Soil composition. The soil composition appeared to be
one of the most important factors when selecting nest
habitat at the disturbed site. The turtles preferred to
nest in soil that was primarily composed of sand, with
some small gravel and clay but limited large gravel. This
pattern is most likely related to thermoregulation and
drainage because sandy soils warm up more quickly in
the sun and do not hold water as well as soils rich in
organic substrates (Brady and Weil 2002).
At both field sites, females selected nesting areas
based on the same microhabitat characteristics. However,
the selected nest habitat differed in soil composition
between the disturbed and protected sites. Due to the
absence of random points at the protected field site, it 1s
not clear whether this difference represents differences
in nesting preferences between the two turtle populations
or differences in soil composition between the two sites.
While turtles in both sites nested in sandy habitats, the
female turtles at the protected nest site selected for higher
moisture content with no gravel.
Temperature. Although temperature was not a significant
predictor of nest site selection in the disturbed habitat,
other literature has shown its importance in nest selection
in various turtle species (Compton 1999; Hewavisenthi
and Parmenter 2002; Hughes et al. 2009). There was a
significant difference in the maximum temperature of nest
sites between the two sites. Overall, the disturbed site had
warmer nest temperatures. Compton (1999) suggested that
in the northern portion of the Wood Turtle’s range, finding
nest sites that encourage successful hatchling incubation
is critical. To increase development rate, the Wood Turtles
in the northern range select for warm and variable nest
temperatures rather than a narrow temperature range
(Compton 1999; Hughes et al. 2009), which was seen in
the disturbed nest site in this study. The disturbed site had
lower nest temperatures during the morning hours as well,
causing high temperature variation, which may promote
shorter incubation periods (Hughes 2009). Although
northern Wood Turtle populations are known to select
for warm nest temperature, a maximum temperature of
35°C at the disturbed site may potentially be harmful to
hatchlings by decreasing their survival rate. In some
cases, embryonic mortality of nests may increase with
high incubation temperatures (Matsuzawa et al. 2002:
Hawkes et al. 2007; Maulany et al. 2012). For example,
a study found that by incubating freshwater Mary River
Turtle (E/usor macrurus) eggs at 32 °C, hatchling
success was lower (Micheli-Campbell et al. 2011); and
the same was true for Chinese Three-keeled Pond Turtle
(Chinemys reevesii) eggs exposed to temperatures above
32 °C (Du et al. 2007).
Amphib. Reptile Conserv.
55
Landscape features. Wood turtles at both sites selected
for slightly sloped habitat. Many turtle species use slope
as an environmental nesting cue (Schwarzkopf and
Brooks 1987; Horrocks and Scott 1991). Slope may
reflect a change in elevation making it an important cue
(Horrocks and Scott 1991). A change to a greater slope
could indicate that the turtle has reached an elevation that
increases the probability of hatching success for her nest
(Wood and Bjorndal 2000).
At the disturbed site, 42% of the turtles selected nest
sites with no vegetation, while 58% chose nests near
small herbaceous plants. The most common plants the
turtles nested next to were Spotted Knapweed (Centaurea
stoebe) and Common Lady’s Thumbprint (Persicaria
pensylvanica). Nesting near herbaceous vegetation may
be advantageous if it provides a concealing structure for
females without shading the nest (Harding and Bloomer
1979; Hughes et al. 2009). The herbaceous root system
may also help prevent slope erosion caused by rainfall
(Buhlmann and Osborn 2011). Alternatively, vegetation
can have a negative impact on the nests due to root
invasion and reduced sunlight exposure, leading to egg
mortality (Congdon et al. 2000; Behler and Castellano
2005). Root invasion and shading were common problems
at the disturbed site, especially as the vegetation grew.
Anthropogenic nest sites. It is common for Wood Turtles
to use anthropogenic nest sites, such as agricultural fields,
yards, clear-cuts, railway embankments, and roadsides
(Congdon et al. 2000; Saumure et al. 2007). Although
human-impacted nesting sites may provide appropriate
canopy openings, this disturbed habitat can negatively
affect the turtles (Kolbe and Janzen 2002). Nesting
in an anthropogenic site increases the probabilities of
nests being walked on, predation, collecting, mortality
associated with crossing roads, shading and/or root
invasion by invasive plant species (Garber and Burger
1995). In addition, anthropogenic disturbances could
cause Wood Turtles to delay nesting and/or to nest
in unfavorable habitat since this species is extremely
sensitive to disturbance prior to egg laying (Walde et al.
2007). Turtle use of human impacted areas, however,
indicates that conservation measures can be taken to
mitigate such negative effects. Artificial nesting mounds
could be built that enhance nesting success (Beaudry
et al. 2010). If actively managed, these mounds could
potentially reduce exposure to many of the common
threats that nesting females face (Buhlmann and Osborn
2011).
Conclusions
Because Wood Turtles are long-lived organisms with
delayed sexual maturity, populations may require a
long time to recover; and so conservation biologists
seeking to manage them face a pressing challenge in
August 2021 | Volume 15 | Number 2 | e283
Nesting ecology of Glyptemys insculpta
a world that is undergoing rapid changes (Garber and
Burger 1995; Kolbe and Janzen 2002). Thus, efforts to
understand what effects human impacts have on Wood
Turtle nesting habitat and population dynamics 1s
crucial. It is also important to recognize which factors
contribute to suitable Wood Turtle nesting habitat for the
persistence and conservation of this species (Kolbe and
Janzen 2002). To help protect this Endangered turtle, our
research provides data that identifies the microhabitat
variables Wood Turtles are selecting for in a nest habitat.
Future studies should include a “false nest” subset, 1.e.,
nests constructed by the female but then abandoned.
This might provide more evidence as to what habitat
the female is actively selecting for and/or rejecting,
which could improve our ability to protect or construct
appropriate nesting habitat for this Endangered species.
Acknowledgments.—Alexander Robillard provided
knowledge, comments, and guidance during this project.
We thank Hannah Harby and Timothy Gochenour for
their field contributions and photography. Previous drafts
of this manuscript were reviewed by Donna Vogler, Sean
Robinson, Jeffrey Heilveil, and Russell Burke. Funding
for this work was supported by Hudson River Foundation
(79063, 2017), Western New York Herpetological
Society (80415, 2018), Riverbanks Society (79530,
2017), International Herpetological Symposium (79454,
2017), American Wildlife Conservation Fund (77108,
2017), and Rhode Island Zoological Society (80007,
2017). All procedures were reviewed and approved by
the SUNY Oneonta Institutional Animal Care and Use
Committee (IACUC) and DEC (DEC Scientific permit
#2136 and IACUC #2018-25).
Literature Cited
Arvisais M, Bourgeois J-C, Lévesque E, Daigle C,
Masse D, Jutras J. 2002. Home range and movements
of a Wood Turtle (Clemmys insculpta) population at
the northern limit of its range. Canadian Journal of
Zoology 80(3): 402-408.
Arvisais M, Levesque E, Bourgeois J, Daigle C, Masse
D, Jutras J. 2004. Habitat selection by the Wood Turtle
(Clemmys insculpta) at the northern limit of its range.
Canadian Journal of Zoology 82(3): 391-398.
Bates D, Maechler M, Bolker B, Walker S. 2015. Fitting
linear mixed effects models using Ime4. Journal of
Statistical Software 67(1): 1-48.
Beaudry F, Demaynadier PG, Hunter Jr ML. 2010.
Nesting movements and the use of anthropogenic
nesting sites by Spotted Turtles (Clemmys guttata)
and Blanding’s Turtles (Emydoidea blandingii).
Herpetological Conservation and Biology 5(1): 1-8.
Bol L. 2007. Massachusetts Forestry Conservation
Management Practices for Wood Turtles. Natural
Heritage and Endangered Species Program, No.
2007.1. Massachusetts Division of Fisheries and
Amphib. Reptile Conserv.
Wildlife, Westborough, Massachusetts, USA. 21 p.
Brady NC, Weil RR. 2002. The Nature and Properties of
Soils. 13” Edition. Pearson Education Canada, Upper
Saddle River, New Jersey, USA. 960 p.
Buhlmann KA, Osborn CP. 2011. Use of an artificial
nesting mound by Wood Turtles (Glyptemys
insculpta): a tool for turtle conservation. Northeastern
Naturalist 18(3): 315-334.
Burnham KP, Anderson DR. 2002. Model Selection and
Multimodel Inference. Springer-Verlag, New York,
New York, USA. 488 p.
Bury RB. 2006. Natural history, field ecology,
conservation biology, and wildlife management: time
to connect the dots. Herpetological Conservation and
Biology 1(1): 56-61.
Clutton-Brock TH. 1991. The Evolution of Parental
Care. Princeton University Press, Princeton, New
Jersey, USA. 352 p.
Compton BW. 1999. Ecology and conservation of the
Wood Turtle (Glyptemys insculpta) in Maine. MS.
Thesis, Department of Wildlife Ecology, University
of Maine, Orono, Maine, USA.
Compton BW, Rhymer JM, McCollough M. 2002. Habitat
selection by Wood Turtles (Clemmys insculpta): an
application of paired logistic regression. Ecology
83(3): 833-843.
Congdon JD, Dunham AE, Van Loben Sels RC.
1993. Delayed sexual maturity and demographics
of Blanding’s Turtles (Emydoidea _blandingii):
implications for conservation and management of
long-lived organisms. Conservation Biology 7(4).:
826-833.
Congdon JD, Nagle RD, Kinney OM, Osenioski M,
Avery HW, Van Loben Sels RC, Tinkle DW. 2000.
Nesting ecology and embryo mortality: implications
for hatchling success and demography of Blanding’s
Turtles (Emydoidea _ blandingii). | Chelonian
Conservation and Biology 3(4): 569-579.
Dragon J. 2014. Habitat selection, movement, and
survival of hatchling Wood Turtles (G/yptemys
insculpta) in an atypical habitat. M.S. Thesis,
Department of Environmental Science and Policy,
George Mason University, Fairfax, Virginia. USA.
Du WG, Hu LJ, Lu JL, Zhu LJ. 2007. Effects of incu-
bation temperature on embryonic development rate,
sex ratio, and post-hatching growth in the Chinese
Three-keeled Pond Turtle, Chinemys reevesii.
Aquaculture 272(1): 747.
Ernst CH, Lovich JE, Barbour RW. 1994. Turtles of the
United States and Canada. Smithsonian Institution
Press, Washington, DC, USA. 578 p.
Ewert MA, Nelson CE. 1991. Sex determination in
turtles: diverse patterns and some possible adaptive
values. Copeia 1991(1): 50-69.
Foscarini DA. 1994. Demography of the Wood Turtle
(Clemmys insculpta) and habitat selection in the
Maitland River valley. M.S. Thesis, Department of
August 2021 | Volume 15 | Number 2 | e283
Vik et al.
Integrative Biology, University of Guelph, Guelph,
Ontario, Canada. 123 p.
Garber SD, Burger J. 1995. A 20-year study documenting
the relationship between turtle decline and human
recreation. Ecological Applications 5(4): 1,151-
1,162.
Gibbons JW, Scott ED, Ryan TJ, Buhlmann KA,
Tuberville TD, Metts BS, Greene JL, Mills T, Leiden
Y, Poppy S, et al. 2000. The global decline of reptiles,
déja vu amphibians. BioScience 50(8): 653-666.
Gross MR. 2005. The evolution of parental care. The
Quarterly Review of Biology 80(1): 37-46.
Harding JH, Bloomer TJ. 1979. The Wood Turtle,
Clemmys insculpta: a natural history. Bulletin of the
New York Herpetological Society 15(1): 9-26.
Hawkes L, Broderick A, Godfrey M, Godley B. 2007.
Investigating the potential impacts of climate change
on a marine turtle population. Global Change Biology
13: 1-10.
Hewavisenthi S, Parmenter CJ. 2002. Incubation
environment and nest success of the Flatback Turtle
(Natator depressus) from a natural nesting beach.
Copeia 2002(2): 302-312.
Horne BD, Brauman RJ, Moore MJC, Siegel RA. 2003.
Reproductive and nesting ecology of the Yellow-
blotched Map Turtle, Graptemys flavimaculata, for
conservation and management. Copeia 2003(4): 729-—
738.
Horrocks JA, Scott NM. 1991. Nest site location and
nest success in the Hawksbill Turtle (Eretmochelys
imbricata) in Barbados, West Indies. Marine Ecology
Progress Series 69(1—2): 1-8.
Hughes GN, Greaves WF, Litzgus JD. 2009. Nest-site
selection by Wood Turtles (Glyptemys insculpta)
in a thermally limited environment. Northeastern
Naturalist 16(3): 321-338.
IUCN. 2016. Wood Turtle, G/yptemys insculpta.
The IUCN Red List of Threatened Species 2011:
e.T4965A974 16259.
Jamovi Project. 2018. Jamovi (Version 0.9.5.12).
Available: https://www.jamovi.org [Accessed: 31
January 2020].
Janzen FJ, Morjan CL. 2002. Egg size, incubation
temperature, and posthatching growth in Painted
Turtles (Chrysemys picta). Journal of Herpetology
36(2): 308-311.
Kamel SJ, Mrosovsky N. 2005. Repeatability of nesting
preferences in the Hawksbill Sea Turtle, Erotmochelys
imbricata, and their fitness consequences. Animal
Behaviour 70(4): 819-828.
Kaufmann JH. 1992. Habitat use by Wood Turtles in
central Pennsylvania. Journal of Herpetology 26(3):
315-321.
Kolbe JJ, Janzen FJ. 2002. Impact of nest-site selection
on nest success and nest temperature in natural and
disturbed habitats. Ecology 83(1): 269-281.
Lee Y. 1999. Special Animal Abstract for Glyptemys
Amphib. Reptile Conserv.
57
insculpta (Wood Turtle). Michigan Natural Features
Inventory, Lansing, Michigan, USA. 4 p.
Lovich JE, Ernst CH, McBreen JF. 1990. Growth,
maturity, and sexual dimorphism in the Wood Turtle,
Clemmys insculpta. Canadian Journal Zoology 68(4):
672-677.
Matsuzawa Y, Sato K, Sakamoto W, Byjorndal K. 2002.
Seasonal fluctuations in sand temperature: effects on
the incubation period and mortality of Loggerhead
Sea Turtle (Caretta caretta) pre-emergent hatchlings
in Minabe, Japan. Marine Biology 140(3): 639-646.
Maulany R, Booth D, Baxter G. 2012. Emergence
success and sex ratio of natural and relocated nests of
Olive Ridley Turtles from Alas Purwo National Park,
East Java, Indonesia. Copeia 2012(4): 738-747.
Mazerolle MJ. 2017. AICcmodavg: model selection and
multimodel inference based on (Q)AIC. R package
version 2.1-1. Available: https://cran.rproject.org/
package=AICcmodavg [Accessed: 31 January 2020].
McCallum ML, McCallum JL. 2006. Publication trends
of natural history and field studies in herpetology.
Herpetological Conservation and Biology 1(1): 62-
67.
Micheli-Campbell MA, Campbell H, Cramp RL, Booth
D, Franklin C. 2011. Staying cool, keeping strong:
incubation temperature affects performance in a
freshwater turtle. Journal of Zoology 285(4): 266—
DTD:
Nagle RD, Plummer MV, Congdon JD, Fischer RU. 2003.
Parental investment, embryo growth, and hatchling
lipid reserves in Softshell Turtles (Apalone mutica)
from Arkansas. Herpetologica 59(2): 145-154.
NYS DEC. 2021. Great Swamp Wildlife Management
Area - New York State Department of Environmental
Conservation. Available: https://www.dec.ny.gov/
outdoor/68929 html [Accessed: 23 August 2021].
R Core Team. 2013. R: a language and environment for
statistical computing. R Foundation for Statistical
Computing, Boston, Massachusetts, USA. Available:
http://www.R-project.org/ [Accessed: 31 January
2020].
Saumure RA. 2004. The spatial ecology and conservation
of the North American Wood Turtle (G/yptemys
insculpta) in a fragmented agri-forest landscape.
Ph.D. Dissertation, Department of Natural Sciences,
McGill University, Montreal, Quebec, Canada.
Saumure RA, Herman TB, Titman RD. 2007. Effects
of haying and agricultural practices on a declining
species: the North American Wood Turtle, Glyptemys
insculpta. Biological Conservation 135(4): 565-575.
Schwarzkopf L, Brooks RJ. 1987. Nest site selection
and offspring sex ratio in Painted Turtles (Chrysemys
picta). Copeia 1987(1): 53-61.
Turtle Conservation Coalition. 2018. Turtles in trouble:
the world’s 25+ most endangered tortoises and
freshwater turtles. Available: www.iucn-tfsg.org/
trouble/ and www.turtleconservancy.org/trouble/
August 2021 | Volume 15 | Number 2 | e283
Nesting ecology of Glyptemys insculpta
[Accessed: 31 May 2019].
U.S. Fish and Wildlife Service. 2019. Environmental
conservation online system species profile for Wood
Turtle (G/yptemys insculpta). Available: https://ecos.
fws.gov/ecp/species/6997 [Accessed: 7 June 2019].
Walde DA. 1998. Ecology of the Wood Turtle, Clemmys
insculpta. M.S. Thesis, Department of Natural
Resources and Science, McGill University, Montreal,
Quebec, Canada.
Walde AD, Bider JR, Masse D, Saumure RA, Titman
RD. 2007. Nesting ecology and hatching success of
the Wood Turtles (Glyptemys insculpta), in Quebec.
Herpetological Conservation and Biology 2(1): 49-
60.
Weisrock DW, Janzen FJ. 1999. Thermal and fitness
related consequences of nest location in Painted
Turtles (Chrysemys picta). Functional Ecology 13(1):
94-101.
Williams T. 1999. The terrible turtle trade: the pet trade is
decimating turtle populations and spreading disease.
Audubon 101: 44-51.
Wood DW, Bjorndal KA. 2000. Relation of temperature,
moisture, salinity, and slope to nest selection in
Loggerhead Sea Turtles. Copeia 2000(1): 119-128.
Alexandra VIk obtained her M.S. in Biology from State University of New York-College at
Oneonta. She has a B.S. in Biology from James Madison University (Harrisonburg, Virginia,
USA), with a concentration in Ecology and Environmental Studies. Her research interests lie in
reproductive behavior and how anthropogenic disturbances are affecting wildlife. She now teaches
molecular biology and the scientific method at Randolph-Macon College (Ashland, Virginia, USA).
Elizabeth Bastiaans is a professor at State University of New York-College at Oneonta. She
completed her B.A. at the University of Chicago (Chicago, Illinois, USA), her Ph.D. at the University
of California, Santa Cruz, and a postdoctoral fellowship at the University of Minnesota, Twin Cities
(Minneapolis-St. Paul, Minnesota, USA). Elizabeth’s previous research focused on sexual signal
evolution in Mexican montane lizards and life history evolution in tropical crickets. In this work,
she used methods such as capture-mark-recapture studies, mate choice trials, aggression trials,
maintenance of lizards in captivity, spatial analyses, DNA sequencing, and molecular phylogenetics.
As a postdoctoral fellow at the University of Minnesota, Elizabeth studied the reproductive behavior,
life history, and immune physiology of Pacific Field Crickets (7eleogryllus oceanicus).
Daniel Stich is a professor at State University of New York-College at Oneonta. He earned his B.T.
in Fisheries and Aquaculture at the State University of New York, Cobleskill College of Agriculture
and Technology, an MLS. in Fish and Wildlife Conservation at the Virginia Polytechnic Institute and
State University (Blacksburg, Virginia, USA), and a Ph.D. in Wildlife Ecology at the University of
Maine (Orono, Maine, USA). He previously worked with NOAA Fisheries as a contracted fishery
biologist studying the effects of dam passage performance standards and lake connectivity on
alosines (shad and herring) in the Northeast, and continues to collaborate with federal agencies
on related issues. Daniel uses data-driven approaches to answer questions about a wide range of
species and topics that range in breadth from physiology of individual organisms to population-
level responses to management actions. These approaches make use of modern quantitative and
computer-based modeling techniques to address complex problems faced by both local and regional
resource managers, and are extensively supplemented by field and laboratory research.
Donna Vogler was born and educated in the Midwestern United States, with a B.S. from The Ohio
State University (Columbus, Ohio, USA), and an M.S. from Iowa State University (Ames, Iowa,
USA), before working for the U.S. Fish and Wildlife Service in Washington, DC, USA. Donna
earned a Ph.D. from Pennsylvania State University (University Park, Pennsylvania, USA) in
Botany, and was a postdoctoral researcher at the University of Pittsburgh (Pittsburgh, Pennsylvania,
USA) before joining the SUNY-Oneonta faculty in 2000. Donna’s recent research topics include
demographic studies of invasive plant species (e.g., Marsh Thistle, Cirsium palustre), floral
mechanisms related to self vs. outcross pollination, and using Wood Turtle habitat communities and
vegetation management at regional airports to reduce wildlife hazards.
Amphib. Reptile Conserv.
August 2021 | Volume 15 | Number 2 | e283
Official journal website:
amphibian-reptile-conservation.org
Amphibian & Reptile Conservation
15(2) [General Section]: 59-71 (e284).
Herpetofauna of Marechal Newton Cavalcanti Instruction
Center, a hotspot Atlantic Forest fragment in Pernambuco,
north-eastern Brazil
Leonardo P.C. Oitaven, Danilo S. Barreto, Mariana M. de Assungao, José R. de O. Santos,
Alan P. Araujo, *Geraldo J.B. de Moura
Laboratorio de Estudos Herpetologicos e Paleoherpetologicos, Universidade Federal Rural de Pernambuco, Rua Dom Manoel de Medeiros, s/n,
Dois Irmdos, CEP 52171-900, Recife, Pernambuco, BRAZIL
Abstract.—Determining the richness and composition of species in an area provides indispensable information
for understanding their natural history, habitat requirements, and other ecological interactions; in addition to
improving our knowledge of their geographic distributions and a better understanding of their ecophysiological
restrictions. The development of strategies that reconcile human population growth with biodiversity
conservation is a current challenge for humanity, especially in areas with exceptionally high historical rates
of destruction, such as the Atlantic Forest. This work contributes to our understanding of the biodiversity of
the Atlantic Forest in the state of Pernambuco, Brazil, by documenting the anuran and reptile species found
in the largest Atlantic Forest remnant in the state: the Integral Conservation Protection Rainforest Unit of
the Marechal Newton Cavalcanti Instruction Centre (CMINIC). Sampling was carried out between August 2008
and December 2009, and a total of 83 species were recorded, including 30 anuran amphibians and 53 reptiles
(three testudines, 19 lizards, two amphisbaenians, 27 snakes, and two crocodilians). Most of the species that
were recorded are widely distributed in the Atlantic Forest, although at the state, national and international
levels, three of the anurans (10%) and four of the reptiles (7.5%) are in the threatened conservation status
classifications. The occurrence of species listed on national and state lists in categories representing critically
endangered, endangered, and vulnerable status in this region reinforces the need for conservation actions, and
the necessity of obtaining better knowledge about the area, which continues to be poorly studied even today.
Keywords. Lissamphibia, Sauropsida, richness, diversity, herpetology, South America
Citation: Oitaven LPC, Barreto DS, de Assungao MM, Santos JRO, Araujo AP, de Moura GJB. 2021. Herpetofauna of Marechal Newton Cavalcanti
Instruction Center, a hotspot Atlantic Forest fragment in Pernambuco, north-eastern Brazil. Amphibian & Reptile Conservation 15(2) [General Section]:
59-71 (e284).
Copyright: © 2021 Oitaven et al. This is an open access article distributed under the terms of the Creative Commons Attribution License [Attribution
4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction in any
medium, provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced, are
as follows: official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 30 October 2020; Published: 26 August 2021
Introduction
The production of updated lists which detail the richness
and composition of the species in an area are indispensable
for studying diversity, ecosystem compositions, and
Species distributions (Pedrosa et al. 2014; Freitas et
al. 2017). Moreover, such lists are indispensable for
developing conservation initiatives, because they provide
not only present-day information, but also historic
information on the species composition of an area in a past
state of preservation (Freitas et al. 2017). The accumulated
information brings together records of the occurrence (or
disappearance) of species, as well as the occurrence of
Species 1n various threat status categories, in areas that may
have undergone changes due to anthropogenic degradation,
climate shifts, or other modifications (Pedrosa et al. 2014).
Correspondence. “[email protected]
Amphib. Reptile Conserv.
Through documenting biodiversity, researchers can
contribute to the development of effective management
plans for the conservation of individual species, as well
as the ecosystems they inhabit (Dixo and Verdade 2006;
Pereira et al. 2015). This is particularly important for
the Atlantic Forest biome which has been extensively
degraded since the period of Brazilian colonization
(Dixo and Verdade 2006; Palmeira and Goncalves
2015). As a result of human population growth, the
forest fragments are highly exposed to predators and
the anthropogenic degradation of fauna and flora, as
well as soil and water pollution (Dixo and Verdade
2006). This situation makes the knowledge of the
fauna from this ecosystem a top priority for creating
conservation plans (Condez et al. 2009; Palmeira and
Goncalves 2015).
August 2021 | Volume 15 | Number 2 | e284
Herpetofauna in an Atlantic Forest hotspot in Brazil
The Atlantic Forest biome is known to harbor a high
richness of anurans (530 species, or 53.6% of the anuran
species in Brazil, Santos et al. 2016; Costa and Beérnils
2018) and reptiles (200 species, or 23.7% of reptile
species in Brazil, Palmeira and Gongalves 2015; Costa
and Bérnils 2018). This diversity has been attributed to
the great variety of habitats and microhabitats in this
domain, which also favor a number of specialist species,
as well as endemics (Condez et al. 2009; Palmeira and
Gongalves 2015). This work contributes to our knowledge
of the biodiversity in the Atlantic Forest of Pernambuco,
by providing a list of the anurans and reptiles found in the
largest Atlantic Forest remnant in the state, the Integral
Conservation Protection Rainforest Unit of the Marechal
Newton Cavalcanti Instruction Center (CMINIC).
Materials and Methods
Study area. This study was conducted at the Marechal
Newton Cavalcanti Instruction Center (CIMNC;:
7.8312°S, 35.1033°W), which is the largest Atlantic
Forest fragment of the mesoregion in the rainforest
region of the state of Pernambuco, northeastern Brazil
(Guimaraes 2008; Lucena 2009). It encompasses a
total area of 7,342 ha, including the cities of Aracgoiaba,
Paulista, Igarassu, Paudalho, and Tracunhaem (Lucena
2009), and is approximately 42 km from the state capital
of Recife (Fig. 1). Itis mostly characterized by a relatively
homogeneous conservation state, composed of secondary
forests with medium-to-advanced stages of regeneration,
with some parts of the area also showing traces of initial
regeneration and recent disturbance (Guimaraes 2008).
The relief in the region is strongly undulating, and
the elevation ranges from 60 to 254 m asl. The climate
is tropical with dry summers and an average annual
temperature of 25.2 °C. The rainy season begins in
February and ends in October, with an average annual
rainfall of 1,634 mm (Guimaraes 2008).
Field sampling. Sampling efforts were carried out
from August 2008 through December 2009, totaling
one year and five months of uninterrupted sampling.
Three different sampling strategies were employed:
a passive method through pitfall traps (Condez et al.
2009); active searches limited by time; and searches by
third parties (1.e., by locals). These three complementary
methods were used in order to maximize the diversity
of species encountered (Condez et al. 2009; Palmeira
and Gongalves 2015). The naming of species on the list
follows Amphibian Species of the World 6.0, an Online
Reference (Frost 2019) and Costa and Bérnils (2018).
Specimens were collected under a scientific permit
issued by IBAMA/RAN (088/07).
For pitfall samplings, a total of two trap lines were
installed, each composed of ten 60-L buckets, interconnected
by 110 m of a 50 cm-high fence, which remained active for
518 days (August 2008 through December 2009), for a total
sampling effort of 10.360 d/bucket. The active searches
were conducted from August 2008 through December
2009, for a total of 24 searches, each one being 9 h in
duration. These were divided into three stages of 3 h each
at nightfall (1600-1900 h), at night (2000-2300 h), and at
dawn (0430-0730 h), and were always conducted by three
collectors, totaling a sampling effort of 648 person-h.
42 40 38 6 4M 32 3
f 7
/ ‘
+4 f 4
C t
C )
} ¢
MA {
“4 \ Me ;
CE J
| ra
‘ RN
1 -
es rf JS Fe
: ect
\, a Ta F 7 oe F ]
j i a r Sel Maia do Buraquinho
—. { Leet 4 \ .
ad PI } Ss ise “
i — i = a |
ws f C A ay
“ AY ZL a a— — Mata do CAMNIG
Ean | a | f Se ee, -
? a -» PE a;
a Serra do Uruba | ae Gujai Ecological Reserve
a7 Ne t~- yf i c ak
zs = L iG a
é,
Co AL
B 4 mi ~.
} “~
c Ly
‘| 4 OS santa de June
= au)
Sra
fade Wut, eae da Made de Ogun - PE
Mate do CUMNIC, Arposike - PE
a2 0
G
UERre Geosere
Fig. 1. Atlantic Forest fragment of Marechal Newton Cavalcanti Instruction Center (CIMNIC), Pernambuco, Northeastern Brazil. A
few other Ecological Reserves located in Pernambuco State, as well as other states in Northeastern Brazil, are also shown.
Amphib. Reptile Conserv.
60
August 2021 | Volume 15 | Number 2 | e284
Oitaven et al.
gyrinaethes (Peixoto, Caramaschi, and Freire, 2003); (B) Phyllodytes edelmoi (Peixoto, Caramaschi, and Freire, 2003); (C)
Phyllodytes luteolus (Wied-Neuwied, 1824); (D) Pristimantis ramagii (Boulenger, 1888); (E) Pithecopus nordestinus (Caramaschi,
2006); (F) Dendropsophus elegans (Wied-Neuwied, 1824); (G) Scinax cretatus (Nunes and Pombal, 2011); (H) Scinax eurydice
(Bokermann, 1968); (1) Scinax x-signatus (Spix, 1824); (J) Dermatonotus muelleri (Boettger, 1885); (IX) Elachistocleis ovalis
(Schneider, 1799); (L) Stereocyclops incrassatus (Cope, 1870). Photos: M.A. Freitas.
One specimen of each species was collected and
euthanized with lidocaine application to the ventral region
(anuran) or intramuscular ketamine injections (reptiles).
The specimens were fixed in 10% formaldehyde, and
later preserved in 70% ethanol. All of the collected
specimens were deposited at the UFRPE (Universidade
Federal Rural de Pernambuco) herpetological and
paleoherpetological collection, although for some species
only visual and photographic records were obtained. The
species conservation status categories were determined
using the classification of the International Union for
Conservation Nature Red List of Threatened Species
(IUCN 2017) as well the Brazilian National (MMA
2014) and Pernambuco State lists (SEMAS 2015, 2017)
Amphib. Reptile Conserv.
61
of threatened amphibian and reptile classifications.
The information on these lists has been combined into
a comprehensive list at the laboratory’s website (LEHP
2018). When collections were only obtained from third
parties, or represent just one individual captured for a
species without accounting, the data were insufficient to
generate a reliable sampling curve.
Results
In total, 30 anuran amphibians and 53 reptile species were
recorded, which included three testudines, 27 snakes, 19
lizards, two amphisbaenians, and two crocodilians (Figs.
2-6).
August 2021 | Volume 15 | Number 2 | e284
Herpetofauna in an Atlantic Forest hotspot in Brazil
2 et
tl ;
Fig. 3. Additional anuran species found in the Marechal Newton Cavalcanti Instruction Center Atlantic Forest fragment. (A) Boana
crepitans (Wied-Neuwied, 1824); (B) Leptodactylus troglodytes (A. Lutz, 1926); (C) Leptodactylus natalensis (A. Lutz, 1930); (D)
Dendropsophus branneri (Cochran, 1948); (E) Boana faber (Wied-Neuwied, 1821); (F) Boana raniceps (Cope, 1862); (G) Boana
semilineatus (Spix, 1824); (H) Boana albomarginatus (Spix, 1824); (I) Leptodactylus latrans (Linneaus, 1758); (J) Leptodactylus
marmoratus (Steindachner, 1867); (IX) Leptodactylus mystacinus (Burmeister, 1861); (L) Leptodactylus fuscus (Schneider, 1799);
(M) Leptodactylus vastus (A. Lutz, 1930); (N) Physalaemus cuvieri (Cruz and Pimenta, 2004); (0) Dendropsophus haddadi (Bastos
and Pombal, 1996); (P) Dendropsophus minutus (Peters, 1872). Photos: M.A. Freitas.
Regarding the conservation status of the reported and 45 (85%) were LC (Table 1; MMA 2014; SEMAS
anuran species for the roughly comparable categories at 2015, 2017; IUCN 2017; LEHP 2018).
the three levels (state, national, and international), three With respect to the sampling methods, 67 species were
(10%, Phyllodytes acuminatus, Phyllodytes edelmoi, collected by active search, 33 by passive search, and 24 by
and Phyllodytes gyrinaethes) were in the threatened _ third parties (Table 1). All anuran species were collected
categories, one (3.3%) was Near Threatened (NT), three —_ by active search, with 18 collected only by active search,
(10%) were Data Deficient (DD), and 23 (76.7%) were — while the remaining 12 species were collected by both
Least Concern (LC). Among reptiles, four species were __ passive and active searches. For lizards, 11 species were
threatened (7.5%, two lizards, Strobilurus torquatus collected through active searching exclusively, while
and Cercosaura ocellata, and two snakes, Siphlophis — eight species were also captured by passive search.
compressus and Lachesis muta), four (7.5%) were DD __ Testudines were not collected by active search, with one
Amphib. Reptile Conserv. 62 August 2021 | Volume 15 | Number 2 | e284
Oitaven et al.
Table 1. Herpetofauna recorded between August 2008 and December 2009 at Marechal Newton Cavalcanti Instruction Center,
Pernambuco, Northeastern Brazil. Type of record: CP = Passive collection; CA = Active collection; CT = Collected by third parties;
Conservation status codes listed below for either the international, national or state levels: LC = limited concern; DD = insufficient
data; NA = not evaluated; NT = near threatened; CT = critically threatened; EN = endangered; VU = vulnerable.
Sampling
Conservation status method
International
Taxon Voucher (IUCN) National State CA CP CT
Amphibia: Anura
Craugastoridae
Pristimantis ramagii (Boulenger, 1888) 0591-0592 LC LC Le xX
Hylidae
Dendropsophus branneri (Cochran, 1948) 0593 Le LC LC xX
Dendropsophus elegans (Wied-Neuwied, 1824) 3466 EC LE LC xX
Dendropsophus haddadi (Bastos and Pombal, 1996) VR LG Le he x
Dendropsophus minutus (Peters, 1872) 2495 LC LC LC xX
Boana albomarginatus (Spix, 1824) 2496 LG Le LE xX
Boana crepitans (Wied-Neuwied, 1824) 3789 Le LC Ee x
Boana faber (Wied-Neuwied, 1821) VR EC Re. Le x
Boana raniceps (Cope, 1862) 3451-3452 LG Le he xX
Boana semilineatus (Spix, 1824) 3596 LC LC Le x
Phyllodytes acuminatus (Bokermann, 1966) VR LG Le EN x
Phyllodytes edelmoi (Peixoto, Caramaschi, and Freire, 2003) VR DD NT EN xX
Phyllodytes gyrinaethes (Peixoto, Caramaschi, and Freire, 2003) VR DD CR EN xX
Phyllodytes luteolus (Wied-Neuwied, 1824) VR LC |b LC x
Pithecopus nordestinus (Caramaschi, 2006) 2546-2547 DD Le Le x
Scinax cretatus (Nunes and Pombal, 2011) VR Le Le LC x
Scinax eurydice (Bokermann, 1968) 3477-3478 Le LC Ee x
Scinax x-signatus (Spix, 1824) 2552-2553 LC RE. Le xX
Leptodactylidae
Physalaemus cuvieri (Cruz and Pimenta, 2004) 3401-3402 LC LC Le x xX
Leptodactylus fuscus (Schneider, 1799) 3556-3557 LG Le Le x x
Leptodactylus marmoratus (Steindachner, 1867) 3568 Le Le Le xX x
Leptodactylus mystacinus (Burmeister, 1861) VR LC |G Le x x
Leptodactylus natalensis (A. Lutz, 1930) 2651 LC |b LC x x
Leptodactylus latrans (Linneaus, 1758) 0840 LC LC VG x x
Leptodactylus troglodytes (A. Lutz, 1926) VR Le Le Le x x
Leptodactylus vastus (A. Lutz, 1930) 1328 Le LC jh oe x x
Mycrohylidae
Dermatonotus muelleri (Boettger, 1885) 3542 LC LC LC x x
Elachistocleis ovalis (Schneider, 1799) VR LC LC LC x x
Stereocyclops incrassatus (Cope, 1870) 0588-0590 Le Le LC x xX
Ranidae
Lithobates palmipes (Spx, 1824) 0852 UC LE LC x xX
Reptilia: Testudines
Knosternidae
Kinosternon scorpioides (Linneaus, 1766) VR Le Le Le x x
Mesoclemmys tuberculata (Ltiederwalt, 1926) VR NA LC Le x
Phrynops geoffroanus (Schweigger, 1812) VR NA Le. LC x xX
Amphib. Reptile Conserv. 63 August 2021 | Volume 15 | Number 2 | e284
Herpetofauna in an Atlantic Forest hotspot in Brazil
Table 1 (continued). Herpetofauna recorded between August 2008 and December 2009 at Marechal Newton Cavalcanti Instruction
Center, Pernambuco, Northeastern Brazil. Type of record: CP = Passive collection; CA = Active collection; CT = Collected by third
parties; Conservation status codes listed below for either the international, national or state levels: LC = limited concern; DD =
insufficient data; NA = not evaluated; NT = near threatened; CT = critically threatened; EN = endangered; VU = vulnerable.
Sampling
Conservation status method
International
Taxon Voucher (IUCN) National State CA CP CT
Reptilia: Squamata (lacertids)
Leiosauridae
Enyalius catenatus (Wied-Neuwied, 1821) VR Le Le LC x
Phyllodactylidae
Gymnodactylus darwinii (Gray, 1845) 0587 Le LC 1 x x
Dactyloidae
Norops fuscoauratus (D'Orbigny, 1837) VR LC LC LC xX
Norops punctatus (Daudin, 1802) 0567 LG LC Le xX
Tropiduridae
Tropidurus hispidus (Spix, 1825) 3600 LC LC LC xX
Tropidurus semitaeniatus (Spix, 1825) VR LG LC ie xX
Strobilurus torquatus (Wiegmann, 1834) VR Le Le VU xX
Teiidae
Ameiva ameiva (Linneaus, 1758) VR LC LC LC x xX
Ameivula ocellifera (Spix, 1825) 2540 LC LC LC xX x
Kentropyx calcarata (Spix, 1825) 0694 LC LC LC x x
Salvator merianae (Dumeril and Bibron,1839) VR LC Le LC x
Gymnophythalmidae
Acratosaura mentalis (Amaral, 1933) VR LC LC LC x x
SoHo i caeoya eT Xavier Freire, Machado VR LC LC LC x x
Cercosaura ocellata (Wagler, 1830) VR LC LG. VU x x
Gekkonidae
Hemidactylus mabouia (Moreau de Jonnés, 1818) VR LC Le LC x
Iguanidae
Iguana iguana (Linneaus, 1758) 0831 LG Le LC xX
Polychrotidae
Polychrus acutirostris (Spix, 1825) VR LC Le Ee x
Polychrus marmoratus (Linneaus, 1758) VR LC Ee LC x
Coleodactylus meridionalis (Boulenger, 1888) 2865, 2869 LC LE Le x x
Reptilia: Squamata (Amphisbaenians)
Amphisbenidae
Amphisbaena alba (Liennaeus, 1758) VR LC Le Le x x
Amphisbaena vermiculares (Wagler, 1824) 4468 NA Le | xX x
Reptilia: Squamata (snakes)
Boidae
Boa constrictor (Linneaus, 1758) VR NA LC Le xX
Epicrates cenchria (Linneaus, 1758) VR NA Le LC x xX
Colubridae
Chironius flavolineatus (Jan, 1863) 0549 NA LE Le x
Dendrophidion atlantica (Freire, Caramaschi, and Gongalves, 2010) 0546 NA LC NA x x
Spilotes pullatus (Linneaus, 1758) 0554 NA Le LC x x
Tantilla melanocephala (Linneaus, 1758) 0547 NA Le LC x x
Amphib. Reptile Conserv. 64 August 2021 | Volume 15 | Number 2 | e284
Oitaven et al.
Table 1 (continued). Herpetofauna recorded between August 2008 and December 2009 at Marechal Newton Cavalcanti Instruction
Center, Pernambuco, Northeastern Brazil. Type of record: CP = Passive collection; CA = Active collection; CT = Collected by third
parties; Conservation status codes listed below for either the international, national or state levels: LC = limited concern; DD =
insufficient data; NA = not evaluated; NT = near threatened; CT = critically threatened; EN = endangered; VU = vulnerable.
Sampling
Conservation status method
International
Taxon Voucher (IUCN) National State CA CP CT
Dipsadidae
Boiruna sertaneja (Zaher, 1996) VR NA 1 Le x x x
Erythrolamprus almadensis (Wagler, 1824) VR NA LC LC x
Erythrolamprus poecilogyrus (Wied-Neuwied, 1825) 4466 NA LE LC x
Erythrolamprus viridis (Wagler, 1824) 0564, 0566 Le Le Ee x
Helicops angulatus (Linneaus, 1758) VR NA LC LC xX
Oxybelis aeneus (Wagler, 1824) 4969 NA LC LC x
Oxyrhopus petolarius (Linneaus, 1758) 4492 NA Le LC xX
Oxyrhopus trigeminus (Dumeéril, Bibron, and Dumeril, 1854) 0552 NA Le Le x x x
Philodryas olferssi (Lichtenstein, 1823) VR NA LG. Le x x
Philodryas patagoniensis (Girard, 1825) 0556 NA Le Le x
Sibon nebulatus (Linneaus, 1758) 0553 NA Le NA x
Sibynomorphus neuwiedi (Ihering, 1911) 0550 NA Le LE x x x
Siphlophis compressus (Daudin, 1803) 0565 LC Le VU xX
Thamnodynastes pallidus (Linneaus, 1758) 0548 LC Le LC xX
Xenodon merremii (Wagler, 1824) 0555 NA Le LC x
Elapidae
Micrurus ibiboboca (Merrem, 1820) 0560-0562 NA Le DD x x
Micrurus leminiscatus (Linneaus, 1758) VR NA LC DD xX xX
oe eat bre oe Jr. Feitosa, Costa-Prudente, 0563 NA LC DD x x
Typhlopidae
Amerotyphlops brongersmianus (Vanzolini, 1976) VR NA LC LC x
Viperidae
Crotalus durissus (Linneaus, 1758) 0558 LC Le i x x x
Lachesis muta (Linneaus, 1766) 0559 NA LC VU xX
Reptilia: Crocodylia
Alligatoridae
Caiman latirostres (Daudin, 1802) VR NA Le Le. x x
Paleosuchus palpebrosus (Cuvier, 1807) VR Le. Le DD x x
Total 68 33 24
species exclusively captured using a specifictrap(funnel Discussion
trap), and the other two captured by funnel traps and
third parties. For crocodilians and amphisbaenians, the
traps did not prove to be an adequate collection method,
with all four species captured by active search or third
parties. The snake species showed the greatest variation
in method suitability. Of the 27 snake species, four
were captured by all three methods, while three species
were found by passive search, five by active search, and
seven by third parties. Eight of the snake species were
collected using at least two of the collecting methods
(Fig. 7).
Amphib. Reptile Conserv.
65
To the best of our knowledge, this study represents the
first initiative to catalog the diversity of herpetofauna in
the CMNIC area. Several other studies in similar Atlantic
Forest remnants (by biome and phytophysiognomy),
which covered the same seasons and had similar sample
efforts, reported less richness (Fig. 1). These studies
were conducted in Serra do Urubt (69 species; 8.5666°S,
35.6166°W; 207 km from our study site; Roberto
et al. 2017), Mata do Junco (59 species; 10.5416°S,
37.0583°W; 649 km from our study site; Morato et al.
August 2021 | Volume 15 | Number 2 | e284
Herpetofauna in an Atlantic Forest hotspot in Brazil
act
a) ee
2011), Gurjau Ecological Reserve (62 species; 8.2291°S,
35.0597°W; 77 km from our study site; Santos et al.
2016; Silva et al. 2017), and Mata do Buraquinho (51
species; 7.145°S, 34.865°W; 110 km from our study site;
Santana et al. 2008). However, at these study sites, the
thinning curves were not stabilized, which indicates that
the diversity could have been even higher.
Based on the inventories published for the Brazil
Northeast Atlantic Forest, the richness of the anurans
and reptiles shows great diversity in various remnants
of this ecosystem (Palmeira and Gongalves 2015; Santos
et al. 2016). In conjunction with the intrinsic aspects of
the biological potential of the locality (i.e., microclimate,
succession history, etc.), the reported richness also
depends on methodological aspects, such as capture
Amphib. Reptile Conserv.
Fig. 4. Testudines, amphisbaenians, and crocodilians found in the Marechal Newton Cavalcanti Instruction Center Atlantic Forest
fragment. (A) Phrynops geoffroanus (Schweigger, 1812); (B) Kinosternon scorpioides (Linneaus, 1766); (C) Mesoclemmys
tuberculata (Luederwalt, 1926); (D) Amphisbaena vermiculares (Wagler, 1824), (E) Amphisbaena alba (Liennaeus, 1758); (F)
Caiman latirostris (Daudin, 1802); (G) Paleosuchus palpebrosus (Cuvier, 1807). Photos: M.A. Freitas.
strategies and sampling effort. The data reported here
suggests that this area 1s important for conservation, due
to the high representation of the species richness (214
sp.) in the state (38.8%) (Martins-Sobrinho et al. 2016;
SEMAS 2015). Most of the recorded species (74.6%) are
widely distributed in the Atlantic Forest (Dias et al. 2014;
Palmeira and Gongalves 2015; Roberto et al. 2017), as
well as other domains (Pedrosa et al. 2014). However,
some of the species reported locally in this study, 10% of
anurans and 7.5% of reptiles, represent some threatened
status categories, reinforcing the need for conservation
actions in this region.
Considering the sampling methods, this study revealed
that all of the methods used were complementary, being
affected by several factors such as species habits (Freitas
August 2021 | Volume 15 | Number 2 | e284
Oitaven et al.
! ne Bad
Fig. 5. Lac
ertid species found in the Marechal Newton Cavalcanti Instruction Center Atlantic Forest fragment. (A) Enyalius catenatus
(Wied-Neuwied, 1821); (B) Gymnodactylus aff. darwinii (Gray, 1845); (C) Norops fuscoauratus (D'Orbigny, 1837); (D) Tropidurus
hispidus (Spix, 1825); (E) Tropidurus semitaeniatus (Spix, 1825); (F) Ameiva ameiva (Linneaus, 1758); (G) Ameivula ocellifera
(Spix, 1825); (H) Salvator merianae (Dumeril and Bibron, 1839); (I) Kentropyx calcarata (Spix, 1825); (J) Cercosaura ocellata
(Weagler, 1830); (IK) Hemidactylus mabouia (Moreau de Jonnés, 1818); (L) Jguana iguana (Linneaus, 1758); (M) Coleodactylus
meridionalis (Boulenger, 1888); (N) Polychrus marmoratus (Linneaus, 1758); (O) Strobilurus torquatus (Wiegmann, 1834).
Photos: M.A. Freitas.
et al. 2017). Pit traps are very useful in the Atlantic Forest
due to the rarity of some of the species. In addition,
some of the places are difficult to access, especially
for terrestrial and fossorial species such as those in
the families Microhylidae (Crump and Scott 1994),
Gymnophytalmidae (Garda et al. 2014), and Elapidae
Amphib. Reptile Conserv.
(Viana and Mendes 2015). The active search represents
a good method for sampling species with arboreal habits
(Mesquita et al. 2015), large size (Pedrosa et al. 2014), or
species-specific vocalizations (Crump and Scott 1994).
Due to the aquatic habitat and difficult conditions for
visualizing the individuals through the water, the passive
August 2021 | Volume 15 | Number 2 | e284
Herpetofauna in an Atlantic Forest hotspot in Brazil
Fig. 6. Snakes species found in the Marechal Newton Cavalcanti Instruction Center Atlantic Forest fragment. (A) Boa constrictor
(Linneaus, 1758); (B) Epicrates cenchria (Linneaus, 1758); (C) Chironius flavolineatus (Jan, 1863); (D) Dendrophidion atlantica
(Freire, Caramaschi, and Gongalves, 2010); (E) Spilotes pullatus (Linneaus, 1758); (F) Tantilla melanocephala (Linneaus, 1758);
(G) Erythrolamprus almadensis (Wagler, 1824); (H) Erythrolamprus poecilogyrus (Wied-Neuwied, 1825); (1) Erythrolamprus
viridis (Wagler, 1824); (J) Helicops angulatus (Linneaus, 1758); (IK) Oxybelis aeneus (Wagler, 1824); (L) Oxyrhopus petolarius
(Linneaus, 1758); (M) Oxyrhopus trigeminus (Dumeril, Bibron, and Dumeril, 1854); (N) Philodryas olferssi (Lichtenstein, 1823);
(O) Philodryas patagoniensis (Girard, 1825); (P) Sibynomorphus neuwiedi (Ihering, 1911); (Q) Siphlophis compressus (Daundin,
1803); (R) Xenodon merremii (Wagler, 1824); (S) Thamnodynastes pallidus (Linneaus, 1758); (T) Micrurus leminiscatus (Linneaus,
1758); (U) Micrurus ibiboboca (Merrem, 1820); (V) Amerotyphlops brongersmianus (Vanzolini, 1976); (W) Crotalus durissus
(Linneaus, 1758); (X) Lachesis muta (Linneaus, 1766). Photos: M.A. Freitas.
Amphib. Reptile Conserv. 68 August 2021 | Volume 15 | Number 2 | e284
Oitaven et al.
35 im Anura
Reptiles
Number of species
N
oO
10
5
0
Active search Passive search Collected by third parties
Fig. 7. Comparative evaluation of the sampling methods for
anurans and reptiles recorded at Marechal Newton Cavalcanti
Instruction Center (CMNIC) Atlantic Forest fragment, from
August 2008 through December 2009.
search by funnel trap represents the best option for
Testudines, as well as crocodilians (Balestra et al. 2016).
The results obtained here are consistent with those from
studies which used similar methods (Morato et al. 2011;
Dias et al. 2014; Palmeira and Goncalves 2015; Santos
et al. 2016), revealing that the various kinds of methods
used are governed by the sample effort, in conjunction
with the species-specific and environmental conditions
(Pedrosa et al. 2014).
Considering that this study represents the first effort
to identify the herpetofauna diversity in this region, the
results are able to reveal gaps in the knowledge, raising
the awareness of the region’s size and unexplored areas.
In addition, this work reinforces the need for more data
on the fauna that inhabit this study site, especially the
herpetofauna given its high diversity in this biome, which
will be useful for more accurate wildlife conservation
and environmental projects, because surveys such as
this one increase the number of species registered in the
area. We strongly recommend that long-term studies be
conducted in this area, in a further attempt to describe the
entire herpetofauna, which could include the addition of
new species to the list, in addition to the possibility of
new species records for the State of Pernambuco.
Acknowledgements.—The authors would like to thank
FACEPE for financial assistance, the CMINIC project,
and IBAMA Institute for the permit issued (088/07).
Literature Cited
Balestra RAM, Valadio RM, Vogt RC, Bernhard R,
Ferrara CR, Brito ES, Drummond GM. 2016. Roteiro
para inventarios e monitoramentos de quel6dnios
continentais. Biodiversidade Brasileira |: 114—152.
Condez TH, Sawaya RJ, Dixo M. 2009. Herpetofauna
dos remanescentes de Mata Atlantica da regiao
de Tapirai e Piedade, SP, sudeste do Brasil. Biota
Neotropica 9(1): 157-185.
Costa HC, Bérnils RS. 2018. Répteis do Brasil e suas
Unidades Federativas: lista de espécies. Herpetologia
Brasileira 7(1): 11-57.
Amphib. Reptile Conserv.
Crump ML, Scott NJ. 1994. Visual encounter surveys.
Pp. 84-92 In: Measuring and Monitoring Biological
Diversity: Standard Methods for Amphibians. Editors,
Heyer R, Donnelly MA, McDiarmid RW, Hayek LC,
Foster MS. Smithsonian Institution Press, Washington,
DC, USA. 364 p.
Dias IR, Mira-Mendes CD, Solé M. 2014. Rapid
inventory of herpetofauna at the APA (environmental
protection area) of the Lagoa Encantada and Rio
Almada, Southern Bahia, Brazil. Herpetology
Notes 7: 627-637.
Dixo M, Verdade VK. 2006. Herpetofauna de
serrapilheira da Reserva Florestal de Morro Grande,
Cotia (SP). Biota Neotropica 6(2): 1-20.
Freitas MA, Vieira RS, Entiauspe-Neto OM, Sousa
SO, Farias T, Souza AG, Moura GJB. 2017.
Herpetofauna of the northwest Amazon forest in the
state of Maranhao, Brazil, with remarks on the Gurupi
Biological Reserve. ZooKeys 643: 141-155.
Frost DR. 2019. Amphibian Species of the World: an
Online Reference. Version 6.0. Available: http://
research.amnh.org/herpetology/amphibia/index. html
[Accessed: 18 July 2018].
Garda AA, de Medeiros PHS, Lion MB, de Brito
MRM, Vieira GHC, Mesquita DO. 2014.
Autoecology of Dryadosaura nordestina (Squamata:
Gymnophthalmidae) from Atlantic Forest fragments
in northeastern Brazil. Zoologia 31(5): 418-425.
Guimaraes HB. 2008. Gest&éo ambiental em areas sob
a tutela do Exército Brasileiro: O caso Campo de
Instrucao Marechal Newton Cavalcante-Pernambuco-
Brasil. Master’s Thesis, Universidade Federal de
Pernambuco (UFPE), Pernambuco, Brazil. 118 p.
LEHP (Laboratorio de Estudos Herpetologicos e
Paleoherpetologicos). 2018. Compilacaéo Continua
das Espécies de Anfibios e “Répteis” do Estado de
Pernambuco. Available: https://lehpufrpe.wixsite.
com/lehpufrpe/especies-ameacadas-pe [Accessed: 13
July 2018].
Lucena MFA. 2009. Flora da Mata do CIMNC,
Pernambuco, Brasil. Recife, Apoio a Criacgdo de
Unidades de Conservagdo na Floresta Atlantica
de Pernambuco. Unpublished Project, Centro de
Pesquisas Ambientais do Nordeste (CEPAN), Recife,
Pernambuco, Brazil.
Martins Sobrinho PM, Santos EG, Melo VL, Santos EM,
Moura GJB. 2016. First record of Macrogenioglottus
alipioi Carvalhoi, 1964 (Amphibia, Anura) for the
state of Pernambuco, Brazil. Herpetology Notes 9:
103-104.
Mesquita DO, Costa GC, Figueredo AS, Franca FG,
Garda AA, Bello Soares AH, Werneck FP. 2015.
The autecology of Anolis brasiliensis (Squamata,
Dactyloidae) in a _ neotropical savanna. The
Herpetological Journal 25(4): 233-244.
MMA (Ministério do Meio Ambiente). 2014. Espécies
ameacadas - lista 2014. Instituto Chico Mendes.
August 2021 | Volume 15 | Number 2 | e284
Herpetofauna in an Atlantic Forest hotspot in Brazil
Available: http://www.icmbio.gov.br/portal/
faunabrasileira/lista-de-especies [Accessed:
13 July 2018].
Morato SAA, de Lima AMX, Staut DCP, Faria RG,
de Souza-Alves JP, Gouveia SF, da Silva MJ. 2011.
Amphibians and reptiles of the Refigio de Vida
Silvestre Mata do Junco, municipality of Capela,
state of Sergipe, northeastern Brazil. Check List 7(6):
756-762.
Palmeira CNS, Goncalves U. 2015. Anurofauna de uma
localidade na Mata Atlantica setentrional, Alagoas,
Brasil. Boletim do Museu de Biologia Mello Leitdo
(Nova Série) 37(1): 141-163.
Pedrosa IMMC, Costa TB, Faria RG, Franca FGR,
Laranjeiras DO, Oliveira TCSPO, Garda AA. 2014.
Herpetofauna of protected areas in the Caatinga
III: The Catimbau National Park, Pernambuco,
Brazil. Biota Neotropica 14(4): 1-12.
Pereira EN, Teles MJL, Santos EM. 2015. Herpetofauna
em remanescente de Caatinga no Sertéo de
Pernambuco, Brasil. Boletim do Museu de Biologia
Mello Leitdo (Nova Série) 37: 37-51.
SEMAS (Secretario de Estado do Meio Ambiente e
Sustentabilidade). 2015. Resolug¢éo SEMAS N° 1 DE
09/01/2015. Lista Estadual Oficial de Espécies da
Fauna Ameagadas de Extin¢ao — Anfibios. Available:
https://www.legisweb.com.br/legislacao/?id=280590
[Accessed: 31 October 2020].
SEMAS (Secretario de Estado do Meio Ambiente e
Amphib. Reptile Conserv.
70
Sustentabilidade). 2017. Resolug¢éo SEMAS N° 1 DE
15/05/2017. Lista Estadual Oficial de Espécies da
Fauna Ameagadas de Extin¢gao — Répteis. Available:
https://www.legisweb.com.br/legislacao/?id=343580
[Accessed: 31 October 2020].
Roberto IJ, de Oliveira CR, de Araujo Filho JA, de
Oliveira HF, Avila RW. 2017. The herpetofauna of the
Serra do Urubu mountain range: a key biodiversity
area for conservation in the Brazilian Atlantic
forest. Papéis Avulsos de Zoologia 57(27): 347-373.
Santana GG, Vieira WLS, Pereira-Filho GA, Delfim FR,
Lima YCC, Vieira KS. 2008. Herpetofauna em um
fragmento de Floresta Atlantica no Estado da Paraiba,
Regiado Nordeste do Brasil. Biotemas 21(1): 75-84.
Santos JRO, O1taven LPC, Aratyo AP, Moura GJB.
2016. Anfibios (Anura e Gymnophiona) do refugio de
vida silvestre “Matas do sistema Gurjau,” estado de
Pernambuco, Nordeste do Brasil. Revista Nordestina
de Zoologia 10(1): 83-96.
Silva TL, Barbosa GG, Oliveira CN, Rodrigues GG.
2017. Répteis do refugio de vida silvestre “Matas
do sistema Gurjau,” Pernambuco, Brasil. Revista
Nordestina de Zoologia 11(1): 43-47.
Viana PF, Mendes DMM. 2015. Feeding behavior
and first record of Rhinatrema bivittatum (Guérin-
Méneville, 1829) as part of the diet of the Ribbon
Coral Snake, Micrurus lemniscatus (Linnaeus, 1758)
in the Central Amazon region (Serpentes: Elapidae).
Herpetology Notes 8: 445-447.
August 2021 | Volume 15 | Number 2 | e284
Amphib. Reptile Conserv.
Oitaven et al.
Leonardo Pessoa Cabus Oitaven is currently serving as a Ph.D. student, associated with the
Laboratorio de Estudos Herpetologicos e Paleoherpetologicos (LEHP), Department of Biology,
Universidade Federal Rural de Pernambuco (UFRPE), Recife, Pernambuco, Brazil. Leonardo is
obtaining his Ph.D. from the Ciéncia Animal Tropical program (PGCAT) at UFRPE and his research
interests include various aspects of the ecology of reptiles and amphibians. He has authored articles
and book chapters on the herpetofauna of Pernambuco state (Brazil), and has been working in snake
husbandry, including captive rearing of venomous snakes for research and venom extraction for
serum production.
Danilo Sé Barreto obtained his Bachelor’s degree in Biology from Universidade Federal Rural de
Pernambuco (UFRPE) in Recife, Pernambuco, Brazil. Danilo has been developing various research
interests in herpetology, with an emphasis on snakes.
Mariana Miranda d'Assunc4o obtained her Bachelor’s degree in Biology from Universidade
Federal Rural de Pernambuco (UFRPE) in Recife, Pernambuco, Brazil. Currently she is a Specialist
in Environmental Management at the Faculdade Frassinetti do Recife (FAFIRE) in Recife,
Pernambuco, Brazil. She has also been developing a variety of research interests in herpetology,
with an emphasis on snakes.
José Ricardo de Oliveira-Santos obtained his Master’s degree in Ecology from Universidade do
Estado da Bahia (UNEB), Salvador, Bahia, Brazil. Currently, he is working ona Ph.D. in the Ciéncia
Animal Tropical (PGCAT) program at Universidade Federal Rural de Pernambuco (UFRPE). José
has acted as an anti-racism activist, as well as Professor in the Departamento de Educacéo, Campus
VII of UNEB. Currently, he is developing projects on the hematologic and biochemichal patterns
of endemic anuran species from Brazil, with the aim of verifying the effects of anthropic actions
on wildlife. In addition, has developed various electronic media-based science communication
projects, using the podcast Rapadura com Ciéncia and YouTube, as well as Instagram.
Alan Pedro Aratjo is currently a Ph.D. student in the Ecology and Evolution program at
Universidade Federal de Goias (UFG) in Goidania, Goias, Brazil, and has previously obtained a
Biology and Ecology Master’s degree. He has been developing studies on anurans associated with
bromeliads, with an emphasis on acoustic community and phoretic relationships.
Geraldo Jorge Barbosa de Moura currently works as a Professor and Researcher at the Universidade
Federal Rural de Pernambuco (UFRPE), teaching and guiding undergraduate students in on-site
courses in the Biological Sciences, as well as Stricto Sensu Academic Graduate Programs at the
Master’s and Ph.D. levels in Ecology, Tropical Animal Science, and Environmental Sciences; in
addition to guiding the Graduate Programs in Environmental Planning at Universidade Catolica do
Salvador (UCSAL), Human Ecology at Universidade do Estado da Bahia (UNEB), and Geosciences
and Paleontology at Universidade Federal do Ceara (UFC). He has extensive experience in
research, mainly in the areas of Behavior, Ecology, Paleontology, Environmental Management, and
Theoretical-Clinical Psychoanalysis and Teaching. Geraldo also serves as a member of the Editorial
Boards of various national and international journals.
71 August 2021 | Volume 15 | Number 2 | e284
The herpetofauna of Veracruz, Mexico
SF,
Introductory Page. Crotalus mictlantecuhtli Carbajal-Marquez, Cedefio- Vazquez, Martinez-Arce, Neri-Castro, and Machkour-
M’Rabet, 2020. The Veracruz Neotropical Rattlesnake is a cryptic state endemic species in the Crotalus durissus species complex,
which recently was described. This rattlesnake is distributed in the southern portion of the state of Veracruz, and eventually might be
found in northeastern Oaxaca and western Tabasco. This species occurs at elevations from near sea level to 1,200 m. The describers
indicated that this rattlesnake “inhabits mostly open dry areas with rocky outcrops in tropical deciduous forest and seasonal rain
forest along the Atlantic versant” (Carbajal-Marquez et al. 2020: 465). The conservation status of this species has not been evaluated
by the IUCN or by SEMARNAT; however, we calculated its EVS value as 16, placing it in the middle portion of the high vulner-
ability category. This individual was photographed in the vicinity of La Antigua, in the municipality of the same name. Photo by
Isaac Ajactle-Tequiliquihua.
Amphib. Reptile Conserv. 72 September 2021 | Volume 15 | Number 2 | e285
Amphibian & Reptile Conservation
15(2) [General Section]: 72-155 (e285).
Official journal website:
amphibian-reptile-conservation.org
The herpetofauna of Veracruz, Mexico:
composition, distribution, and conservation status
‘Lizzeth A. Torres-Hernandez, ‘Aurelio Ramirez-Bautista, 7Raciel Cruz-Elizalde, *Uriel Hernandez-
Salinas, *Christian Berriozabal-Islas, Dominic L. DeSantis, “Jerry D. Johnson, ‘Arturo Rocha,
8Eli Garcia-Padilla, °Vicente Mata-Silva, °Lydia Allison Fucsko, and ‘Larry David Wilson
'Laboratorio de Ecologia de Poblaciones, Centro de Investigaciones Biologicas, Instituto de Ciencias Bdsicas e Ingenieria, Universidad Auténoma del
Estado de Hidalgo, Km 4.5 Carretera Pachuca-Tulancingo, 42184 Mineral de La Reforma, Hidalgo, MEXICO ?2Laboratorio de Zoologia, Facultad
de Ciencias Naturales, Universidad Autonoma de Querétaro, Avenida de las Ciencias S/N, Santa Fe Juriquilla, C. P. 76230, Querétaro, Querétaro,
MEXICO ?Instituto Politécnico Nacional, CIIDIR Unidad Durango, Sigma 119, Fraccionamiento 20 de Noviembre II, Durango 34220, MEXICO
‘Programa Educativo de Ingenieria en Biotecnologia, Universidad Politécnica de Quintana Roo, Av. Arco Bicentenario M 11, Lote 1119-33, Sm
255, 77500 Canciin, Quintana Roo, México y Universidad de Quintana Roo, Departamento de Administracion turistica, Playa del Carmen Cancun,
Quintana Roo, MEXICO *Department of Biological and Environmental Sciences, Georgia College and State University, Milledgeville, Georgia 31061,
USA °Department of Biological Sciences, The University of Texas at El Paso, El Paso, Texas 79968-0500, USA "Department of Biological Sciences, El
Paso Community College, El Paso, Texas 79927, USA *Oaxaca de Juarez, Oaxaca 68023, MEXICO °Department of Humanities and Social Sciences,
Swinburne University of Technology, Melbourne, Victoria, AUSTRALIA "Centro Zamorano de Biodiversidad, Escuela Agricola Panamericana
Zamorano, Departamento de Francisco Morazan, HONDURAS "1350 Pelican Court, Homestead, Florida 33035—1031, USA
Abstract.—The herpetofauna of the state of Veracruz, Mexico, currently consists of 359 species, including
76 anurans, 45 caudates, one caecilian, one crocodylian, 217 squamates, and 19 turtles. The distribution
of the herpetofaunal species are catalogued here among the four recognized physiographic regions in
the state. The total number of species ranges from 179 in the Sierra de Los Tuxtlas to 236 in the Sierra
Madre Oriental. The number of species shared among the four physiographic regions ranges from 100
between the Gulf Coastal Lowlands and the Transmexican Volcanic Belt, to 190 between the Sierra Madre
Oriental and the Transmexican Volcanic Belt. A similarity dendrogram based on the Unweighted Pair Group
Method with Arithmetic Averages (UPGMA) depicts two distinct clusters, one between the Sierra Madre
Oriental and the Transmexican Volcanic Belt, and the other between the Gulf Coastal Lowlands and the
Sierra de Los Tuxtlas. The former cluster reflects two adjacent regions in highland environments that
share a substantial number of herpetofaunal species, and the latter cluster shares a sizeable number
of wide-ranging, generalist, lowland species found on the Atlantic and Pacific versants of Mexico and
Central America. The level of herpetofaunal endemism is relatively high, with 182 of 359 species either
endemic to Mexico or to Veracruz. The distributional categorization of the total herpetofauna is as follows:
169 non-endemic species; 138 country endemic species; 44 state endemic species; and eight non-native
species. The 169 non-endemic species are allocated to the following distributional categories: MXCA (89),
MXSA (30), MXUS (29), USCA (11), USSA (four), and OCEA (five). The principal environmental threats to
the herpetofauna of Veracruz include deforestation, livestock, roads, water pollution, myths and other
cultural factors, diseases, invasive species, and illegal commerce. The conservation status of each native
species was evaluated using the SEMARNAT, IUCN, and EVS systems, of which the EVS system proved to
be the most useful. The Relative Herpetofaunal Priority method was employed to determine the rank order
significance of the four regions, and this identified the Sierra Madre Oriental as the region of greatest
importance. Only six protected areas exist in Veracruz, most of which are located in the Gulf Coastal
Lowlands, the region of least conservation significance. The area of greatest significance, the Sierra Madre
Oriental, does not contain any protected areas. A total of 265 species have been recorded within the six
protected areas, of which 138 are non-endemics, 89 are country endemics, 31 are state endemics, and
seven are non-natives. Finally, we provide a set of conclusions and recommendations to enhance the
prospects for the future protection of the herpetofauna of Veracruz.
Keywords: Anurans, caudates, physiographic regions, protected areas, protection recommendations, squamates, turtles
Resumen.—La herpetofauna de Veracruz, Mexico, comprende 359 especies, incluidas 76 anuros, 45
caudados, una cecilido, un cocodrilido, 217 escamosos y 19 tortugas. Catalogamos la distribucion de las
especies de herpetofauna en cuatro regiones fisiograficas reconocidas. El numero total de especies varia
de 179 en la Sierra de Los Tuxtlas a 236 en la Sierra Madre Oriental. El numero de especies compartidas
Correspondence. /[email protected] (LATH), [email protected] (ARB), [email protected] (RCE), uhernndez3@
gmail.com (UHS), [email protected] (CBI), [email protected] (DLD), [email protected] (JDJ), [email protected]
(AR), [email protected] (EGP), [email protected] (VMS), [email protected] (LAF), [email protected] (LDW)
Amphib. Reptile Conserv. 73 September 2021 | Volume 15 | Number 2 | e285
The herpetofauna of Veracruz, Mexico
entre las cuatro regiones fisiograficas varia de 100 entre las Tierras Bajas Costeras del Golfo y el Cinturon
Volcanico Transmexicano a 190 entre la Sierra Madre Oriental y el Cinturon Volcanico Transmexicano.
Un dendrograma de similitud basado en el Método de Grupos de Pares no Ponderados con Promedios
Aritméticos (UPGMA) muestra dos grupos distintos, uno entre la Sierra Madre Oriental y el Cinturon
Volcanico Transmexicano y el otro entre las Tierras Bajas Costeras del Golfo y la Sierra de Los Tuxtlas. El
primer grupo refleja las dos regiones que comparten un numero sustancial de especies de herpetofauna
de ambientes de tierras altas en areas adyacentes, y el ultimo grupo comparte un numero considerable de
especies de tierras bajas generalistas de amplio rango que se encuentran en las vertientes del Atlantico
y Pacifico de Mexico y America Central. El nivel de endemismo de la herpetofauna es relativamente alto,
de 359, 182 especies son endemicas de Mexico o Veracruz. De la herpetofauna total, la clasificacion de
distribucion es la siguiente: 169 especies no endémicas; 138 especies endemicas al pais; 44 especies
endemicas al estado; y ocho especies exoticas. Las 169 especies no endémicas se asignan a las siguientes
categorias de distribucion: MXCA (89); MXSA (30); MXUS (29); USCA (11); USSA (cuatro); y OCEA (cinco).
Las principales amenazas ambientales para la herpetofauna de Veracruz incluyen la deforestacion, la
ganaderia, las carreteras, la contaminacion del agua, los mitos y otros factores culturales, las enfermedades,
las especies invasoras y el comercio ilegal. El estado de conservacion de cada especie nativa se evaluo
utilizando los sistemas SEMARNAT, IUCN y EVS, de los cuales el sistema EVS resulto mas util. Se utilizo
el metodo de Prioridad Relativa de la Herpetofauna para determinar el orden de importancia de las cuatro
regiones, con la mayor importancia asignada a la Sierra Madre Oriental. Solo existen seis areas protegidas
en Veracruz, la mayoria de las cuales estan ubicadas en las Tierras Bajas Costeras del Golfo, la region de
menor importancia para la conservacion. La zona de mayor importancia, la Sierra Madre Oriental, no tiene
areas protegidas dentro de ella. Se registra un total de 265 especies dentro de las seis areas protegidas,
de las cuales 138 son no endémicas, 89 son endemicas del pais, 31 son endemicas del estado y siete
son no nativas. Finalmente, se brinda un conjunto de conclusiones y recomendaciones para mejorar las
perspectivas de proteccion futura de la herpetofauna de Veracruz.
Palabras Clave: Anuros, caudados, regiones fisiograficas, areas protegidas, recomendaciones de _ proteccion,
escamosos, tortugas
Citation: Torres-Hernandez, LA, Ramirez-Bautista A, Cruz-Elizalde R, Hernandez-Salinas U, Berriozabal-Islas C, DeSantis DL, Johnson JD, RochaA,
Garcia-Padilla E, Mata-Silva V, Fucsko LA, and Wilson LD. 2021. The herpetofauna of Veracruz, Mexico: composition, distribution, and conservation
status. Amphibian & Reptile Conservation 15(2) [General Section]: 72-155 (e285).
Copyright: © 2020 Torres-Hernandez et al. This is an open access article distributed under the terms of the Creative Commons Attribution License
[Attribution 4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction
in any medium, provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced,
are as follows: official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 31 March 2021; Published: 29 September 2021.
ce
ature is the metaphorical goddess of all existence to the southeast by Chiapas, and to the east by Tabasco.
that lies beyond human control. Humanity is blessed Its surface area covers 71,826 km’, which ranks 11" in
to the extent we love her, and her products, from the _ size among the 32 federal entities or states in Mexico.
sweet descent of her sunsets to the tantrums of her — The population in 2020 was 8,062,597, ranking 3" in the
thunderstorms, and from the empty vast space beyond country, with a population density of 110 people/km’,
her biosphere to the seething diversity within it, of which — which was 10" in the country (http://inegi.org.mx;
we ourselves are a recent chance addition.” Accessed: 3 April 2021).
The highest mountain in Mexico is the stratovolcano
E. O. Wilson (2020) — Pico de Orizaba (or Citlaltépetl), with an elevation of
5,747 m, which lies along the border of Veracruz and
Introduction neighboring Puebla (Woolrich-Pifia et al. 2017), traversing
the caldera at the peak (http://maps.google.com; Accessed:
Veracruz includes 212 municipalities and is a narrow, 8 June 2020). This imposing volcano lies on the eastern
elongate, crescent-shaped state in Mexico (Fig. 1) _ periphery of the Transmexican Volcanic Belt (TVB), a
that extends 650 km (from north to south) along the — roughly 1,000 km-long volcanic arc in central Mexico that
southwestern coast of the Gulf of Mexico, and varies in —_ extends from near the Gulf of Mexico to near the Pacific
width from 32 to 212 km. The state is situated entirely | Ocean at latitudes between 18°30’N and 21°30’N.
within the tropics, but at its northernmost extent lies only In addition to the TVB, Veracruz also harbors elements
160 km south of the Tropic of Cancer at latitude 23.43663° — of three other physiographic regions, including the Gulf
N. The state is bordered to the north by Tamaulipas, to | Coastal Lowlands (GCL), the Sierra Madre Oriental
the west by San Luis Potosi, Hidalgo, Puebla, and Oaxaca, (SMO), and the Sierra de Los Tuxtlas (SLT). The GCL
Amphib. Reptile Conserv. 74 September 2021 | Volume 15 | Number 2 | e285
Torres-Hernandez et al.
extends along the entire length of the state and lies between
the shore of the Gulf of Mexico and the lower limits of the
SMO and the TVB. Herein, the same cut-off point (200 m)
for the upper limit of the GCL was used as in Johnson et al.
(2010, 2015a) and Cruz-Saenz et al. (2017) for the Pacific
Coastal Plain in Chiapas and Jalisco, respectively.
The SMO is a narrow and elongate mountain range
in eastern Mexico that extends from near the Rio
Grande along the border of Texas (in the United States)
and Coahuila (in Mexico) southward along the eastern
periphery of the Central Plateau (= Mesa Central) through
Nuevo Leon, southwestern Tamaulipas, eastern San Luis
Potosi, northeastern Querétaro, eastern Hidalgo, and
northern Puebla, where it joins the eastern extension of the
TVB to the west of the GCL (Lemos-Espinal and Dixon
2013; Ramirez-Bautista et al. 2014; Nevarez-de los Reyes
et al. 2016; Woolrich-Pifia et al. 2017; Lazcano etal. 2019).
The SLT is an isolated volcanic belt and mountain range
in southeastern Veracruz that contains Volcan Santa Marta
and Volcan San Martin Tuxtla, both above 1,700 m in
elevation. This range is separated from the Transmexican
Volcanic Belt to the northwest by about 250 km and from
the Central American Volcanic Belt to the southeast by
about 330 km (http://www.wikipedia.org; Accessed: 8
June 2020).
Because of its geographic position, Veracruz
encompasses the broadest range of elevations of any state
in Mexico, from sea level along the eastern coast of the
Gulf of Mexico to the peak of Pico de Orizaba at almost 6
km above sea level along its western border.
Materials and Methods
Our Taxonomic Position
In this paper, we maintain the same taxonomic position as
explained in previous works on other parts of Mesoamerica
(e.g., Johnson et al. 2015a,b; Mata-Silva et al. 2015;
Teran-Juarez et al. 2016; Woolrich-Pifia et al. 2016, 2017;
Nevarez-de los Reyes et al. 2016; Cruz-Saenz et al. 2017;
Gonzalez-Sanchez et al. 2017; Ramirez-Bautista et al.
2020). Consult Johnson (2015b) for a statement of this
position, with special reference to the subspecies concept.
System for Determining Distributional Status
We used the same system developed by Alvarado-Diaz et
al. (2013) for the herpetofauna of Michoacan to determine
the distributional status of members of the herpetofauna of
Veracruz. Subsequently, Mata-Silva et al. (2015), Johnson
et al. (2015a), Teran-Juarez et al. (2016), Woolrich-Pifia
et al. (2016, 2017), Nevarez-de los Reyes et al. (2016),
Cruz-Saenz et al. (2017), Gonzalez-Sanchez et al. (2017),
Lazcano et al. (2019), and Ramirez-Bautista et al. (2020)
utilized this system, which consists of the following four
categories: SE = endemic to state (in this case Veracruz);
CE = endemic to Mexico; NE = not endemic to Mexico;
Amphib. Reptile Conserv.
and NN = non-native in Mexico.
Systems for Determining Conservation Status
To evaluate the conservation status of the herpetofauna
of Veracruz, we employed the same systems (.e.,
SEMARNAT, IUCN, and EVS) used by Alvarado-Diaz et
al. (2013), Mata-Silva et al. (2015), Johnson et al. (2015a),
Teran-Juarez et al. (2016), Woolrich-Pifia et al. (2016,
2017), Nevarez-de los Reyes et al. (2016), Cruz-Saenz
et al. (2017), Gonzalez-Sanchez et al. (2017), Lazcano et
al. (2019), and Ramirez-Bautista et al. (2020). Detailed
descriptions of these three systems appear in earlier papers
in this series (e.g., Alvarado-Diaz et al. 2013; Johnson
et al. 2015a; Mata-Silva et al. 2015), and thus are not
repeated here.
The Mexican Conservation Series
The Mexican Conservation Series (MCS) was initiated
in 2013, with a study on the herpetofauna of Michoacan
(Alvarado-Diaz et al. 2013), as part of a set of five papers
designated as the Special Mexico Issue published in
Amphibian & Reptile Conservation. The basic format
for entries in the MCS was established in this paper,
i.e., an examination of the composition, physiographic
distribution, and conservation status of the herpetofauna
of a given Mexican state or group of states. Two years
later, the MCS resumed with a paper on the herpetofauna
of Oaxaca (Mata-Silva et al. 2015), and that same year
with a paper on the herpetofauna of Chiapas (Johnson et
al. 2015a). Three entries in the MCS appeared tn 2016, on
Tamaulipas (Teran-Juarez et al. 2016), Nayarit (Woolrich-
Pifia et al. 2016), and Nuevo Leon (Nevarez-de los Reyes
et al. 2016). Three more entries appeared the following
year, on Jalisco (Cruz-Saenz et al. 2017), the Mexican
Yucatan Peninsula (Gonzalez-Sanchez et al. 2017), and
Puebla (Woolrich-Pifia et al. 2017), followed by another
in 2019, on Coahuila (Lazcano et al. 2019). Finally, one
entry appeared in 2020, on Hidalgo (Ramirez-Bautista et
al. 2020). Consequently, this paper on the herpetofauna of
Veracruz is the 12" entry in this series.
Physiography and Climate
Physiographic Regions (Fig. 1)
The distribution of the herpetofauna of Veracruz was
analyzed using the classification system of physiographic
regions (= physiographic provinces of INEGI 2000
and CONABIO 2008). According to these sources, the
state contains four regions (Fig. 1), as briefly described
below. Note that Veracruz falls within the biogeographic
area described by Holt et al. (2013) as the “Panamanian
Realm” (Tropical Mexico and Central America), which
supersedes previous traditional classifications by other
biogeographers.
September 2021 | Volume 15 | Number 2 | e285
The herpetofauna of Veracruz, Mexico
se°c'o"w sr-oo"w Se°oo"wW ss°0'o"wW oo'o"wW
Tamaulipas
Gulf of Mexico
19°O'0"N
18°0'0"N
Torn
Oaxaca
0 25 50 100 150 200
es Kilometers
16°0'O°N
Se°0'O"W sroo"w seo" W sSoorw aorw
Physiographic regions
BP Gult Coastal Lowlands (GCL)
Ae we Sierra de Los Tuxtlas (SLT)
eee Z Sierra Madre Oriental (SMO)
metas Transmexican Volcanic Belt (TVB)
Fig. 1. Location in Mexico and physiographic regions of Veracruz, Mexico. Abbreviations: GCL = Gulf Coastal Lowlands; SLT =
Sierra de Los Tuxtlas; SMO = Sierra Madre Oriental; and TVB = Transmexican Volcanic Belt.
Gulf Coastal Lowlands (GCL). In Mexico, this region
(Figs. 2-3) extends from the Rio San Fernando in
Tamaulipas southeastward to the Rio Candelaria, located
on the Yucatan Peninsula (Morrone 2001). This region
covers various-sized Atlantic versant portions of the states
of Tamaulipas, San Luis Potosi, Veracruz, Hidalgo, Puebla,
Oaxaca, Chiapas, Tabasco, Campeche, Yucatan, and
Quintana Roo. In Veracruz, the GCL is located between
25°52717.02”N, -94°04'11.48"°W, and 20°55°36.56’N,
-90°18°06.7"W, at elevations ranging from about sea
level to 200 m (Espinosa et al. 2008). The mean annual
precipitation in this region ranges from 1,000—2,000
mm, whereas the average annual temperature is 21.2 °C.
Numerically dominant vegetation types include tropical or
subtropical evergreen forest, scrub, sub-deciduous forest,
and dry forest (CONABIO 2008; Wilson and Johnson
2010), depending on the elevation and amount of rainfall.
Sierra de Los Tuxtlas (SLT). In Veracruz, this physiographic
region (Fig. 4) is bordered to the north and east by the Gulf
of Mexico, to the east and southeast by the Olmec region,
and to the west by the Papaloapan region (CONABIO
2008). The SLT (18°42’36” to 18°03’00”N, -95°25’48”
to -94°34’12”W) contains four municipalities: Catemaco,
Amphib. Reptile Conserv.
Hueyapan de Ocampo, San Andrés Tuxtlas, and Santiago
Tuxtla (Gonzalez-Soriano et al. 1997). This region has a
surface area of 3,484.34 km? (4.1% of state’s territory),
and due to their combined size, the municipalities of
San Andrés Tuxtlas and Hueyapan de Ocampo comprise
56.6% of its territory. The region is volcanic in origin, and
because of its proximity to the Gulf of Mexico it generates
a sizable amount of precipitation, making it one of the
rainiest regions in Mexico (Table 2). The elevations of
the steep-sided volcanic cones range from 200—1,700 m
(CONABIO 2008). The climate of the region ranges from
humid tropical to humid subtropical, depending on the
elevation. The average temperature ranges from 21.5—27.3
°C, and the annual rainfall is over 4,500 mm. Even though
rainfall is frequent throughout the year, there is arecognized
“rainy season” from May to February, and a “dry season”
from March to May (CONABIO 2008). The driest month
generally 1s May, and wettest months are either August,
September, October, or November. The region contains
such lush vegetation as tropical and subtropical evergreen
forest, but 1t has been subjected to intense agricultural
exploitation since pre-Hispanic times (Gonzalez-Soriano
et al. 1997). The most important agricultural products are
corn, beans, sugar cane, and tobacco. Fishing and raising
September 2021 | Volume 15 | Number 2 | e285
Torres-Hernandez et al.
Fig. 2. Gulf Coastal Lowlands. Vegetation in the vicinity of El
Salmoral, municipality of La Antigua. Photo by Isaac Ajactle-
Tequiliquihua.
eo;
Fig. 4. Sierra de Los Tuxtlas. Cloud forest at the top of Volcan
San Martin. Photo by Eli Garcia-Padilla.
ce Se
Fig. 6. Transmexican Volcanic Belt. Vegetation on the “roof
of Mexico,” Volcan Pico de Orizaba or “Citlatépetl.” Photo by
Jorge Gonzalez Sanchez.
livestock are common in areas that have been transformed
into grassland, in addition to industrial activities and
tourism.
Sierra Madre Oriental (SMO). The Sierra Madre Oriental
(Fig. 5) is an extensive mountain system that extends for
about 1,350 km from the Rio Grande on the northwest, to
about the Isthmus of Tehuantepec in northeastern Oaxaca
on the southeast (Campbell 1999). Collectively, this area
constitutes 2.84% of the land in Mexico (Morrone 2001;
CONABIO 2008). In Veracruz, the northern limit of the
SMO lies at 25°36’23.13”N, -100°17°38.99"W and the
Amphib. Reptile Conserv.
ss 4 L } a fe Bite ” SL
Fig. 3. G
ulf Coastal Lowlands. Mangrove forest during the
dry season in the vicinity of Tumilco, municipality of Tuxpam.
Photo by Uriel Hernandez-Salinas.
2 7 cae
Fig. 5. Sierra Madre Oriental. Montane cloud forest in the mu-
nicipality of Tatatila. Photo by Fidel Lopez Guzman.
southern limit at 17°28’45.86’N, -96°04’34.85”W. The
upper elevations of the SMO in Veracruz range from
2,500-3,700 m (CONABIO 2008). To the east, the SMO
is bordered by the GCL, and to the west by a very small
portion of the Northern Plateau Basins and Ranges (NB;
Wilson and Johnson 2010), the Mesa Central (MC; which
includes a small portion of TVB), and the Sierra Madre del
Sur (SUR) (Campbell 1999). The SMO contains portions
of 22 municipalities. This region is geologically complex
and consists mostly of sedimentary and metamorphic
rocks from the Cretaceous and Jurassic (CONABIO
2008). The mean annual precipitation varies considerably,
ranging from 400-800 mm in montane cloud forests
in the municipalities of Xalapa and Chiconquiaco
(CONABIO 2008) to 220 and 234 mm in drier areas in the
municipalities of Perote and Las Vigas, respectively. The
average annual temperature for the region 1s 17.4 °C, and in
winter and summer ranges from 4—28 °C in montane areas,
and from 10-40 °C in temperate valleys. On the wetter
slopes, the numerically dominant vegetation communities
are coniferous forest (28%), oak forest (26%), and cloud
forest (8%), while xerophilous scrub (16%) occurs in the
drier areas (CONABIO 2008).
Transmexican Volcanic Belt (TVB). The Transmexican
Volcanic Belt (Fig. 6) is a volcanic arc located in the Mesa
Central (Campbell 1999) that slightly tilts in a northwest
to southeast direction and extends from Nayarit on the
September 2021 | Volume 15 | Number 2 | e285
The herpetofauna of Veracruz, Mexico
Pacific versant (Ferrusquia-Villafranca 2007; CONABIO
AO i a
pas aS BY oOMmN O&O NAO CoCo 2008), and then parallels the northern slope of the Balsas
oF ae = NAKED OND COMO KUN ere : :
Ses Be oe ae os aa =n Basin into Veracruz, where it converges with the SMO
& oF a near Pico de Orizaba. This belt 1s formed by a set of
8 a 3 S b volcanoes of different ages (Miocene to Plio-Pleistocene),
Bs s< 2 = aRaA RAN _LA@n 4fa ane i pocsonce ue Soon ee Peet aN,
§ 3 8 : 3 aaa 2aGa cla “la -98 37 42.45 W and 21f53 40.02 N, -105°36’09.80”"W.
ESoxu| A This region occupies 8% of Mexico’s surface area, and
o 2 Sh a ranges in elevation from 1,000—5,747 m. In Veracruz,
3 q's 3 3 2 mz ae the TVB reaches elevations from 1,500—5,747 m. Within
3 g 2 < 5 co — 2 as = uae % + the TVB are Pico de Orizaba, Cofre de Perote, Sierra
Ree LL 5 = - ee de Zongolica, and Sierra de Chiconquiaco (CONABIO
SOs 2008). The mean annual precipitation ranges from 581—
Ns = is EJ m Wa ry 2,236 mm, and the mean annual temperature is 15.3 °C
9Sa0 i Bee ee eters Ei ee (Suarez-Mota et al. 2014). Numerically dominant natural
gg fe a Ee SE EOS SE RUN SUN vegetation communities are represented primarily by
a S 7 coniferous forest (31%) and oak forest (28%), with the
= =e os bs remainder composed of subalpine scrub and subtropical
Bb = = E = mMHo wmMo mto ofn dry forest; disturbed areas such as farmland and pastures
2 ie = = aan Aaa =A ald have replaced the natural vegetation.
fav <s ag & N
sk oY :
Bb 23 Climate
a Ow ~
£8<5| 6 (Soe S83 5228 225] am ni
ies 3 Ait OE Ae lees igh Col perature. The monthly minimum, mean, and
2 5S & ll bas a a a ap maximum temperatures for a single locality are indicated
SAZ ys _ _ " y in each of the four recognized physiographic regions in
O€ ER: = SE eye MoO eae Osea Veracruz in Table LL The elevations for these localities
c z g S = CERYC ECUO aces: Pen range from 40 m in the city of Veracruz to 3,000 m at
7 = 3 a Orizaba. The mean annual temperature is highest at
SSE , LOG de Se Sag EE Veracruz (40 m asl) in the GCL at 27.3 °C, followed by
28 a = BAD AGT NAS aww San Andrés oe ‘Se as : a Bae as eae ie
BSEy 4 aA ed Huayacocotla (2, m asl) in the SMO at 21. , wit
a. = = Ee the lowest mean temperature of 16.6 °C at Orizaba in the
5 ais ep |omt anit can noo TVB (3,000 m asl).
3 bc cs &] = |Aas Aaa Tan F248 In the four physiographic regions in Veracruz, the
q ae s minimum annual temperatures range from 4.3—10.7 °C
z - fs g a || Noo la Rell pastaw lower than the maximum annual temperatures (Table
ay S 'S 5 = la aa saa 228 22a 1). The mean minimum monthly temperatures peak
E ie 6 & in May (SLT and SMO), June (GCL), or September
& SBS] . siby ef im hat (TVB), and reach their lowest levels in January (GCL,
Seat ee || cee [Pecuthee e ty Cee eet, Se SLT, and SMO) or December (TVB). The mean monthly
Ea See. |inem [isa eee eo ee temperatures are highest in May (TVB), July (GCL), and
g 8 sé August (SLT and SMO), and lowest in January (GCL,
E E oe c 1 re a ” SMO, and TVB) or February (SLT).
Sa a Fee alt eune et esr ioe ae a — | |
ee Ae es ee (PG a as Precipitation. As typical in tropical climates, the
5 5 re E a precipitation regime in Veracruz is partitioned into a six-
a 5 s at month wet season that extends from May to October, and
= 0 : s tEan nA, cen Loa a dry season of similar length, from November to April
PERS) € [Fan =SN Ooa SSA (Table 2). The mean monthly precipitation is highest in
eee) "> September (GCL), October (SLT, TVB), or November
eee Ss]. (SMO), and lowest in January (GCL, SLT, TVB) or
8 Sols Rectgee o £ 5 3 February (SMO). During the rainy season (May to
688 = & 5 ge 2 as = g % S October) from 58.8 to 76.5% of the annual precipitation
= = 2 : g 2 = 2 : 3 S 5 z q occurs. The annual rainfall ranges from 267.6 mm in the
2ees| ea sR 8 2 Ss TVB to 2,218.8 mm in the SLT (Table 2).
£586) ™ e
SOR xo
Amphib. Reptile Conserv. 78 September 2021 | Volume 15 | Number 2 | e285
Torres-Hernandez et al.
No. 1. Jncilius cavifrons (Firschein, 1950). The Mountain
Toad is a state endemic species restricted in distribution to the
Sierra de los Tuxtlas physiographic region (Frost 2020). This
individual was found at Los Tuxtlas, in the municipality of
San Andrés Tuxtla. Wilson et al. (2013a) calculated its EVS
as 13, placing it at the upper limit of the medium vulnerability
category. Its conservation status has been established as
Endangered by the IUCN, and as Special Protection (Pr) by
SEMARNAT. Photo by Christian Berriozabal-Islas.
No. 2. Hyalinobatrachium viridissimum (Taylor, 1942). The
Northern Glassfrog is a non-endemic species distributed from
Guerrero and Veracruz, Mexico, through Guatemala and Belize
to northwestern Honduras, and possibly to the departments
of Santa Ana and Cabafias in El Salvador (Frost 2020). This
individual was found at Comapa, in the municipality of the same
name. We determined its EVS as 11, placing it in the middle of
the medium vulnerability category. Its conservation status has
not been assessed by either the IUCN or SEMARNAT. Photo
by Aaron Arias Hernandez.
No. 3. Craugastor alfredi (Boulenger, 1898). Alfred’s Rainfrog
is a non-endemic species distributed from central Veracruz,
Mexico, to western El Petén, Guatemala (Kohler 2011). This
individual was encountered at Los Tuxtlas, in the municipality
of San Andrés Tuxtla. Wilson et al. (2013a) calculated its EVS as
11, placing it in the middle of the medium vulnerability category.
Its conservation status has been evaluated as Vulnerable by the
IUCN, but this species has not been assessed by SEMARNAT.
Photo by Christian Berriozabal-Islas.
Amphib. Reptile Conserv.
No. 4. Craugastor rhodopis (Cope, 1867). The Polymorphic
Robber Frog is a country endemic species found in western
Veracruz and adjacent Hidalgo and Puebla, as well as in central
and southeastern Chiapas and adjacent Oaxaca (Frost 2020).
This individual was found at Huayacocotla, in the municipality
of the same name. Wilson et al. (2013a) determined its EVS as
14, placing it at the lower limit of the high vulnerability category.
Its conservation status has been assessed as Vulnerable by the
IUCN, but this species has not been evaluated by SEMARNAT.
Photo by Christian Berriozabal-Islas.
September 2021 | Volume 15 | Number 2 | e285
The herpetofauna of Veracruz, Mexico
ges Recent Literature on the Veracruz Herpetofauna
== iso) = — — —
S.ss S Ot ANN ent on
— m | 4 ee nN: Oe mn a) ' i
- 8 = EJESEG 4eG BAR CAS Our knowledge of the Mexican herpetofauna continues
— Sn oo A ee S eh oe Noe] . Ts
ee oe ea “a ae a to expand. As of this writing, several modern state-
3)
Gres Be am ‘
2 Sooo level treatments have appeared, in book form in some
oe) a N Som >
OS ‘ >| 2 SiS eA nm end ee cases and as lengthy papers in others. Although the
BaOaASs = ON. Paine oe. Seuss herpetofauna of Veracruz is one of the most diverse in
o 20 Desh aa N \O
SS Se gl EBs Unset De Bs || Tene etn try, it has not und h t
a22u| 8 LS e entire country, it has not undergone such a recen
is 2 a treatment. Toward this end, a summary of the pertinent
oO : j oy
ZOES ie literature is assembled here to document the composition
ayo < 2 —~ = —~ :
s 3 2 =) = Soe Oe ee Ra of the herpetofauna of Veracruz (Table 3). The literature
5-25 l 2 OO ae atten etek: ONE citations are organized in this table in alphabetical order
=& = e| Z for each of the physiographic regions, and then by year
=a oO : :
ost 5 of publication.
> omen ip ann aN a — of
oS So 2 Sy oe SRS SS oo OG, al
Ty eS PGi S sio "st ONS ‘ ike
TR AN | Blaam Sunn = Saye Composition of the Herpetofauna
#2o _ ieee SESE EO a Se
Cen oS
eca oh
Sesame Families
Press be
son fs > ie Ze a} oe ,
S 5 2 gees oe 2 ee a oi The herpetofaunal species in Veracruz are classified in
2S o-9 Sp Meee ee ee en oa oh MS =
voEAZsS!l Blannmn ant Han AVS 51 families, including 11 families of anurans, four of
> nm Ov cm) ae bas a ‘ 1: 13
gSEsa| a salamanders, one of caecilians, one of crocodylians, 25
Ym VY 2 3 . :
BALES of squamates, and nine of turtles (Table 4). This total
een! Ux , qe
BSE! g ya he px & figure represents 85.0% of the 60 herpetofaunal families
O: > Ios Sgr NAY So 6 ‘ é
eosn| fe SYR SSS SS a art known from Mexico (Wilson et al. 2013a,b; J. Johnson,
ee) 2 [kes Sas San oe unpub. data, 19 March 2020). Of the 16 amphibian
8 E 2 3 families, 72.1% (88) of the 122 species (Tables 5—6) are
= sx z ee ee in the families Bufonidae (nine), Hylidae (29), Ranidae
N & So lo oma) 7 ‘ i on
Se or Blast gxXAS CMzX Sor eight), and Plethodontidae (42). Among the 35 families
oO 6U) Te) |[eies donee GES: Res ee, ecm Kaas :
£5 2S i ~ = a of reptiles, 70.0% (166) of the 237 species (Table 5) are
7 oO : E Pas . allocated to the families Anguidae (10), Dactyloidae
» & = S eee ee ht 18), Phrynosomatidae (20), Colubridae (41), Dipsadidae
255 %| Bl-“58 Sun 62S sux ;
2's = & me |PAs= san Fea TS (46), Natricidae (14), and Viperidae (17).
oOo oO
= Uv pa
ones
Gen og —~ fam ie = G
EASES a rere ata en (0 Tone) enera
Sue! s |=e8 ssh FSR acy
on Oo oOo FR Ne eel eee = wat
SOEs ‘<i cm One hundred and forty-two herpetofaunal genera are
YU SF
eessa| —_ a yan ems _ represented in Veracruz, including 32 genera of anurans,
aso5k FE LTONnN ORR ante tom
2 eés Bloons raw onN ore 10 of salamanders, one of caecilians, one of crocodylians,
=O ara — nim m st 4 0 Gerke aan =n
mar 84 of squamates, and 14 of turtles (Table 4). These 142
Sess aioe
Ags enera comprise 66.0% of the 215 recorded from Mexico
esas SIlnamo oka +6Rn whoo
Sa Soa | pha [oe ee eee Neher (J. Johnson, unpub. data, 19 March 2020). Among the
<s89E S Arn Hn Aw © aan eat ;
ER ZE| = ~ ~ ~ LY amphibians (Table 5), the species are most numerous
a0} a UV YO . aie .
ei in the genera Jncilius (seven species), Craugastor
So 8 o> >
= RB
No) i) p> : :
% ER = ae a i oa 11), Eleutherodactylus (seven), Lithobates (eight),
Ss @ > >
eee] 2B ISSSs wae BSS GaS| Chi ion (10), Pseud 10), and Thori
Seat OP | alee, | sey Roa re en ee eMac iropterotriton (10), Pseudoeurycea (10), an orius
poli Rens aa = a re ine). Among the reptiles (Table 5), the most speci
BILE) & (nine). Among the reptiles (Table 5), the most speciose
2 3S 2s = genera are Norops (18 species), Sceloporus (17), Tantilla
a5 5 : az |aARQ+t Coto nen Naa (five), Coniophanes (five), Geophis (eight), Rhadinaea
é Tigeeet| fey (PSone Cee Eevee BeOS (seven), Thamnophis (11), and Crotalus (10).
geo
SoS Species
See ee || RE elie See ie sé So The herpetofauna of Veracruz consists of 359 species,
2 8 & ; s 2 Y e : 4 oe 5 5 including 76 anurans, 45 salamanders, one caecilian,
23 2 a 2 & 4 2 a 2 . BS one crocodylian, 217 squamates, and 19 turtles (Table
iS #e = = 4). The current numbers of native species in these six
on
Amphib. Reptile Conserv. 80 September 2021 | Volume 15 | Number 2 | e285
Torres-Hernandez et al.
| ¢ Ae pe 5 : ai
es - . a)
on .
tat _ . 5
. or. ¥ % Pa
‘ . ~My ed ~ : 25 “ 4
fo f 4 < Se a , © \ ail
e Sool P BY one a : ia —
No. 5. Craugastor vulcani (Shannon and Werler, 1955). The
Volcan San Martin Rainfrog is a state endemic species restricted
in distribution to the Sierra de Los Tuxtlas physiographic
region (Frost 2020). This individual was encountered at Los
Tuxtlas, in the municipality of San Andrés Tuxtla. Wilson et
al. (2013a) calculated its EVS as 17, placing it in the middle
of the high vulnerability category. Its conservation status has
been determined as Endangered by the IUCN, but this species
has not been evaluated by SEMARNAT. Photo by Christian
Berriozabal-Islas.
No. 6. Megastomatohyla mixomaculata (Taylor, 1950). The
Variegated Treefrog is a country endemic species only known
from the municipalities of Coscomatepec, Zongolica, and Los
Reyes in central Veracruz, and in the Sierra Negra region of
southeastern Puebla, Mexico, at elevations from 900 to 1,650
m (Frost 2020). This individual was photographed at Finca
Santa Martha, in the municipality of Los Reyes. Wilson et
al. (2013a) ascertained its EVS as 14, placing it in the lower
portion of the high vulnerability category. Its conservation
status has been assessed as Endangered by the IUCN, and as
Threatened (A) by SEMARNAT. Photo by Jesse Hosman.
No. 7. Rheohyla miotympanum (Cope, 1863). The Small-eared
Treefrog is a country endemic species distributed from “Nuevo
Leon and Coahuila (Sierra Madre Oriental) to Guanajuato
(Sierra Santa Rosa), Hidalgo, and Oaxaca, adjacent Veracruz,
and central Chiapas” (Frost 2020). This individual was found
at El Potrero, in the municipality of Acultzingo. Wilson et al.
(2013a) determined its EVS as 9, placing it at the upper limit
of the low vulnerability category. Its conservation status has
been judged as Near Threatened by the IUCN, but this species
has not been evaluated by SEMARNAT. Photo by Bruno
Rosas Fragoso.
Amphib. Reptile Conserv.
No. 8. Scinax staufferi (Cope, 1865). Stauffer’s Long-nosed
Treefrog is a non-endemic species occurring in savannas
and sub-humid forest in lowlands to moderate elevations
from southern Tamaulipas, Mexico, southward to Nicaragua
on the Caribbean versant, and from Guerrero, Mexico, to
northwestern Costa Rica on the Pacific; it also occurs in
disjunct areas along the Pacific lowlands of western to central
Panama (Frost 2020). This individual was found at Misantla,
in the municipality of the same name. Wilson et al. (2013a)
ascertained its EVS as 4, placing it in the low vulnerability
category. Its conservation status has been assessed as Least
Concern by the IUCN, and this species is not listed by
SEMARNAT. Photo by Bruno Rosas-Fragoso.
September 2021 | Volume 15 | Number 2 | e285
The herpetofauna of Veracruz, Mexico
Table 3. Summary of the literature documenting the composition and physiographic distribution of the herpetofauna of Veracruz,
Mexico.
Phy goesap tic Documentation
region
Aguilar-Lopez and Canseco-Marquez (2006); Aguilar-Lopez and Pineda (2015); Aguilar-Lopez et al. (2010, 2015, 2016,
2020); Altamirano-Alvarez and Soriano-Sarabia (2010); Avila-Najera et al. (2018); Badillo-Saldafia et al. (2018); Barrio-
Amoros (2019); Bury and Whelan (1984); Campbell and Lamar (1989, 2004); Carbajal-Marquez et al. (2020); Cazares-
Hernandez (2015); Chambers and Hillis (2020); Chavez-Lugo (2015); de la Torre-Loranca et al. (2006); Dixon and Lemos-
Espinal (2010); Duellman (1958, 2001); Duellman and Trueb (1986); Escobedo-Galvan and Gonzalez-Salazar (2011);
Flores-Villela (1998); Frost (2020); Garcia-Vazquez et al. (2010); Guzman-Guzman (2011); Iverson (1992); Johnson et
al. (2010); Jones and Lovich (2009); Klauber (1972); Lemos-Espinal and Dixon (2013); Marquez (1994); McCranie et al.
Gulf Coastal (2020); Méndez-de la Cruz and Casas-Andreu (1992); Mendoza-Henao et al. (2020); Meza-Lazaro and Nieto-Montes de
Lowlands Oca (2015); Morales-Mavil et al. (2017); Myers et al. (2017); Ochoa-Ochoa and Flores-Villela (2011); Oliver-Lopez et al.
(2009); Ordéfiez-Gomez and Valadez-Azua (2008); Palacios-Aguilar and Flores-Villela (2020); Pérez-Higareda and Smith
(1991); Pineda-Arredondo (2015); Ramirez-Bautista et al. (2006, 2009, 2010, 2014); Ramirez-Gonzalez and Canseco-
Marquez (2015); Reyes- Velasco et al. (2020); Rossman et al. (1996); Roze (1996); Ruane et al. (2014); Sanchez-Juarez
(2002); Scarpetta et al. (2015); SEMARNAT (2018); Smith and Taylor (1966); Solis-Zurita et al. (2019); Uribe-Pefia et
al. (1999); Valverde and Rouse-Holzwart (2017); Vazquez-Diaz and Quintero-Diaz (2005); Werler and Dixon (2000);
Wilson (1970); Wilson et al. (2010, 2013a,b); Wright and Wright (1957); Yafiez-Arenas et al. (2016).
Avila-Najera et al. (2018); Badillo-Saldafia et al. (2014, 2018); Barrio-Amorés (2019); Bury and Whelan (1984); Campbell
and Lamar (2004); Carbajal-Marquez et al. (2020); Chambers and Hillis (2020); de la Torre-Loranca et al. (2006); Dixon
and Lemos-Espinal (2010); Duellman (1958, 2001); Flores-Villela (1998); Frost (2020); Garcia-Vazquez et al. (2010);
Guzman-Guzman (2011); Iverson (1992); Johnson et al. (2010); Lemos-Espinal and Dixon (2013); McCranie et al. (2020);
Mendoza-Henao et al. (2020); Meza-Lazaro and Nieto-Montes de Oca (2015); Ochoa-Ochoa and Flores-Villela (2011);
Oliver-Lopez et al. (2009); Palacios-Aguilar and Flores-Villela (2020); Pérez-Higareda and Smith (1991); Pérez-Higareda
et al. (2007); Pineda-Arredondo (2015); Ramirez-Bautista (1977); Ramirez-Bautista and Nieto-Montes de Oca (1997);
Ramirez-Bautista et al. (2006, 2009, 2010, 2014); Ramirez-Gonzalez and Canseco-Marquez (2015); Rossman et al. (1996);
Roze (1996); SEMARNAT (2018); Sherbrooke and Lazcano- Villareal (1999); Sherbrooke (2003); Smith and Taylor
(1966); Solis-Zurita et al. (2019); Urbina-Cardona et al. (2006); Uribe-Pefia et al. (1999); Vazquez-Diaz and Quintero-
Diaz (2005); Werler and Dixon (2000); Wilson et al. (2010, 2013a,b).
Sierra de Los
Tuxtlas
Avila-Najera et al. (2018); Bury and Whelan (1984); Campbell and Lamar (1989, 2004); Canseco-Marquez and Gutiérrez-
Mayén (2010); Canseco-Marquez et al. (2016); Castillo-Juarez et al. (2020); Cazares-Hernandez et al. (2018); Ceron-de
la Luz (2010); Chacon-Juarez and Vasquez-Cruz (2018); Chambers and Hillis (2020); Contreras-Calvario et al. (2019);
Cruz-Elizalde et al. (2020); de la Torre-Loranca et al. (2006, 2019); Dixon and Lemos-Espinal (2010); Duellman (1958,
2001); Ernst and Ernst (2003); Flores-Villela (1998); Frost (2020); Garcia-Bafiuelos et al. (2020); Garcia-Castillo et al.
(2018); Garcia-Morales et al. (2017); Guzman-Guzman (2011); Iverson (1992); Johnson et al. (2010); Jones and Lovich
Sierra Madre (2009); Klauber (1972); Lara-Hernandez and Vasquez-Cruz (2020); Lemos-Espinal and Dixon (2013); Lemos-Espinal
Oriental et al. (2019); Macario-Cueyatcle et al. (2019); McCranie et al. (2020); Mendoza-Henao et al. (2020); Meza-Lazaro and
Nieto-Montes de Oca (2015); Ochoa-Ochoa and Flores-Villela (2011); Oliver-Lopez et al. (2009); Paredes-Garcia et al.
(2011); Peralta-Hernandez et al. (2019); Pérez-Higareda and Smith (1991); Pérez-Sato et al. (2018); Pineda-Arredondo
(2015); Ramirez-Bautista et al. (2006, 2009, 2010, 2014); Reyes-Velasco et al. (2020); Rossman et al. (1996); Roze (1996);
SEMARNAT (2018); Sherbrooke (2003); Sherbrooke and Lazcano- Villareal (1999); Smith and Taylor (1966); Solis-Zurita
et al. (2019); Uribe-Pefia et al. (1999); Vasquez-Cruz and Canseco-Marquez (2020); Vasquez-Cruz et al. (2018, 2019,
2020a,b); Wilson et al. (2010, 2013ab); Wright and Wright (1957).
Avila-Najera et al. (2018); Bello-Sanchez et al. (2014); Bury and Whelan (1984); Campbell and Lamar (1989, 2004):
Canseco-Marquez and Gutiérrez-Mayén (2010); Canseco-Marquez et al. (2016); Carbajal-Marquez et al. (2020); Castillo-
Juarez et al. (2020); Cazares-Hernandez et al. (2018); Cerén-de la Luz (2010); Chacon-Juarez and Vasquez-Cruz (2018);
Chambers and Hillis (2020); Conant (2003); Contreras-Calvario et al. (2019); de la Torre-Loranca et al. (2006, 2019); Dixon
and Lemos-Espinal (2010); Duellman (1958, 2001); Duellman and Trueb (1986); Ernst and Ernst (2003); Flores-Villela
(1998); Frost (2020); Garcia-Bafiuelos et al. (2020); Garcia-Castillo et al. (2018); Garcia-Morales et al. (2017); Gonzalez-
Romero and Murrieta-Galindo (2008); Gonzalez-Zamora et al. (2018); Guzman-Guzman (2011); Iverson (1992); Johnson
et al. (2010); Kelly-Hernandez et al. (2020); Klauber (1972); Lara-Hernandez and Vasquez-Cruz (2020); Lemos-Espinal
and Dixon (2013); Lemos-Espinal et al. (2019); Macario-Cueyatcle et al. (2019); McCranie et al. (2020); Mendoza-Henao
et al. (2020); Meza-Lazaro and Nieto-Montes de Oca (2015); Murrieta-Galindo et al. (2013); Ochoa-Ochoa and Flores-
Villela (2011); Oliver-Lopez et al. (2009); Orddfiez-Gomez and Valadez-Azua (2008); Palacios-A guilar and Flores-Villela
(2020); Paredes-Garcia et al. (2011); Parra-Olea et al. (2020); Peralta-Hernandez et al. (2019); Pérez-Higareda and Smith
(1991); Pérez-Sato et al. (2018); Pineda-Arredondo (2015); Ramirez-Bautista et al. (2006, 2009, 2010, 2014); Reyes-
Velasco et al. (2020); Rossman et al. (1996); Roze (1996); Sandoval-Comte et al. (2017); SEMARNAT (2018); Smith and
Taylor (1966); Solis-Zurita et al. (2019); Uribe—Pefia et al. (1999); Vasquez-Cruz and Canseco-Marquez (2020); Vasquez-
Cruz et al. (2018, 2019, 2020a,b); Wilson et al. (2010, 2013a,b); Yafiez-Arenas et al. (2016).
Transmexican
Volcanic Belt
Amphib. Reptile Conserv. 82 September 2021 | Volume 15 | Number 2 | e285
Torres-Hernandez et al.
<
No. 9. Triprion spinosus (Steindachner, 1864). The Coronated
Treefrog is a non-endemic species with a disjunct distribution
in humid forests, primarily in the premontane zone, in eastern
Mexico (Tabasco, Veracruz, Puebla, Oaxaca, and Chiapas,
800—2,068 m asl), Guatemala, northeastern Honduras (95 m
asl), the Atlantic versant of Costa Rica and western Panama,
and from southwestern Costa Rica to west-central Panama on
the Pacific slopes, at elevations from 350 to 1,330 m (Frost
2020). This individual was found at Finca Santa Martha,
in the municipality of Los Reyes. Wilson et al. (2013a)
ascertained its EVS as 14, placing it in the lower portion of
the high vulnerability category. Its conservation status has
been assessed as Least Concern by the IUCN, and this species
is not listed by SEMARNAT. Photo by Jesse Hosman.
ia ls rs et ae ae
No. 11. Lithobates vaillanti (Brochi, 1877). Vaillant’s Frog
is a non-endemic species occurring at low and moderate
elevations from north-central Veracruz and northern Oaxaca to
the central Rio Magdalena region in Colombia on the Atlantic
versant, and on the Pacific versant in southeastern Oaxaca
and northwestern Chiapas, Mexico, and from northwestern
Nicaragua to southwestern Ecuador, at elevations from 0 to
1,700 m (Frost 2020). This individual was photographed in
the vicinity of Catemaco, in the municipality of the same
name. Wilson et al. (2013a) determined its EVS as 9, placing
it in the higher portion of the low vulnerability category. Its
conservation status has been assessed as Least Concern by the
IUCN, and this species is not listed by SEMARNAT. Photo by
Christian Berriozabal-Islas.
Amphib. Reptile Conserv.
No. 10. Agalychnis taylori Funkhouser, 1957. The Northern
Red-eyed Treefrog is a non-endemic species occurring from
“west-central Honduras north through Guatemala along the
Atlantic lowlands of Oaxaca and southern Veracruz, Mexico”
(Frost 2020). This individual was encountered at Los Tuxtlas,
in the municipality of San Andrés Tuxtla. Wilson et al. (2013a)
ascertained its EVS as 11, placing it in the middle of the
medium vulnerability category. Its conservation status has
been assessed as Least Concern by the IUCN, and this species
is not listed by SEMARNAT. Photo by Eli Garcia-Padilla.
No. 12. Aquiloeurycea cafetalera Parra-Olea, Rovito,
Marquez-Valdelmar, Cruz, Murrieta-Galindo, and Wake,
2010. The Coffee Grove Salamander is a country endemic
species known to occur in the municipalities of Chocoman,
Zongolica, Los Reyes, Tequila y Union, and Progreso in
Veracruz (Frost 2020), as well as in Puebla (Woolrich et
al. 2017). This individual was encountered at Finca Santa
Martha, in the municipality of Los Reyes. Johnson et al.
(2017) calculated the EVS as 17, placing it in the middle of
the high vulnerability category. Its conservation status has not
been determined by either the IUCN or SEMARNAT. Photo
by Matthieu Berroneau.
September 2021 | Volume 15 | Number 2 | e285
The herpetofauna of Veracruz, Mexico
Table 4. Composition of the native and non-native herpetofauna of Veracruz, Mexico.
ay Sa
Gymnophiona
Subtotal
122
Crocodylia
Squamata
groups in Mexico are, respectively, 408, 154, three, three,
885, and 51 (J. Johnson, unpub. data, 6 July 2020). The
359 herpetofaunal species in Veracruz comprise 26.7%
of the 1,347 species in the entire Mexican herpetofauna
(J. Johnson, unpub. data, 6 July 2020). In all the species
listed in the text, those that are country (Mexico)
endemics are indicated by (*) and those that are state
(Veracruz) endemics are indicated by (**).
Veracruz shares a border with seven other Mexican
states, 1.e., Tamaulipas, San Luis Potosi, Hidalgo, Puebla,
Oaxaca, Chiapas, and Tabasco (Fig. 1). Studies of the
herpetofauna of five of these seven states (Tamaulipas,
Hidalgo, Puebla, Chiapas, and Oaxaca) have appeared
thus far in the MCS (Teran-Juarez et al. 2016; Ramirez-
Bautista et al. 2020; Woolrich-Pifia et al. 2017; Johnson
et al. 2015a; and Mata-Silva et al. 2015, respectively).
The herpetofaunas of each of these five states include,
respectively, 184, 203, 267, 330, and 442 species, and
the number of composite species increases from north
to south. The state area/species richness ratios for
these five states are as follows: Tamaulipas (80,249
km/?/184 = 436.1); Hidalgo (20,813/203 = 102.5); Puebla
(34,306/267 = 128.5); Chiapas (73,311/330 = 222.2); and
Oaxaca (93,757/442 = 212.1). The comparable figure for
Veracruz is 200.1 (71,826/359), which is most similar to
that for Oaxaca. This relationship ranges from highest
to lowest among the six states in the following order:
Tamaulipas, Chiapas, Oaxaca, Veracruz, Puebla, and
Hidalgo.
Patterns of Physiographic Distribution
Here, we recognize four physiographic regions in
Veracruz (Fig. 1) and document the distribution of the
herpetofauna among these four regions in Table 5, and
summarize the data in Table 6.
The total number of species in each of these four
regions ranges from a low of 179 in the Sierra de Los
Tuxtlas (SLT) to 236 in the Sierra Madre Oriental (SMO).
The intermediate figures are 222 for the Transmexican
Volcanic Belt (TVB) and 190 for the Gulf Coastal
Lowlands (GCL). The percentage of the entire state
herpetofauna comprising each of the four physiographic
regions is, in order of size (236/359) 65.7% (SMO),
Table 5. Distribution of the herpetofaunal species of Veracruz, Mexico, by physiographic region. See text for descriptions of these
regions. * = species endemic to Mexico; ** = species endemic to Veracruz; and *** = non-native species.
Physiographic regions of Veracruz Number
taxa Gulf Coastal Sierrade Los SierraMadre Transmexican ot regions
Lowlands Tuxtlas Oriental Volcanic Belt occupied
Anura (76 species)
Bufonidae (9 species)
Anaxyrus compactilis* xX xX 2
Incilius cavifrons** x x 2
Incilius cristatus* xX x xX >
Incilius macrocristatus xX |
Incilius marmoreus* x x x 3
Incilius nebulifer xX xX xX 3
Incilius occidentalis* xX xX 2
Incilius valliceps xX xX xX xX 4
Rhinella horribilis xX xX xX xX 4
Centrolenidae (1 species)
Hyalinobatrachium viridissimum xX xX xX xX 4
Craugastoridae (11 species)
Craugastor alfredi x x x xX 4
Craugastor berkenbuschii* x xX xX xX 4
Craugastor decoratus* xX xX 2
Amphib. Reptile Conserv. 84 September 2021 | Volume 15 | Number 2 | e285
Torres-Hernandez et al.
re | Pad eee eo; : ;
No. 13. Bolitoglossa platydactyla (Gray, 1831). The Broad-
footed Salamander is a country endemic species distributed
from “southern Tamaulipas and eastern San Luis Potosi south
through Hidalgo to southern Veracruz, Puebla, Oaxaca, and
extreme northeastern Chiapas” (Frost 2020). This individual
was found at Siete Palmas, in the municipality of Ixcatepec.
Wilson et al. (2013a) determined its EVS as 15, placing in
the lower portion of the high vulnerability category. Its
conservation status has been evaluated as Least Concern by
the IUCN, and as Special Protection (Pr) by SEMARNAT.
Photo by Christian Berriozabal-Islas.
No. 15. /sthmura gigantea (Taylor, 1939). The Giant False
Brook Salamander is a country endemic species known
from the La Joya-Jalapa region of Veracruz into northeastern
Hidalgo (Frost 2020). This individual was found on the
road between Zongolica and Tequila, in the municipality of
Zongolica. Wilson et al. (2013a) determined its EVS as 16,
placing it in the middle of the high vulnerability category.
Its conservation status has been calculated as Critically
Endangered by the IUCN, but this species has not been
evaluated by SEMARNAT. Photo by Matthieu Berroneau.
Amphib. Reptile Conserv.
No. 14. Bolitoglossa rufescens. The Common Dwarf
Salamander is a non-endemic species found from “extreme
eastern San Luis Potosi...south through Veracruz, and,
provisionally east of the Isthmus of Tehuantepec in Chiapas
to Belize and northwestern Honduras” (Frost 2020). This
individual was encountered at Los Tuxtlas, in the municipality
of San Andrés Tuxtla. Wilson et al. (2013a) calculated its
EVS as 9, placing it at the upper limit of the low vulnerability
category. Its conservation status was determined as Least
Concern by the IUCN, and as Special Protection (Pr) by
SEMARNAT. Photo by Christian Berriozabal-Islas.
No. 16. Pseudoeurycea werleri Darling and Smith, 1954.
Werler’s False Brook Salamander is a country endemic
species “known from the Sierra de Los Tuxtlas, southern
Veracruz...and the northern slopes of the Sierra de Juarez
[sic] about Vista Hermosa, northern Oaxaca” (Stuart et al.
2008). This individual was located on Volcan San Martin, in
the municipality of San Andrés Tuxtla. Wilson et al. (2013a)
ascertained its EVS as 17, placing it in the middle of the
high vulnerability category. Its conservation status has been
determined as Endangered by the IUCN, and as Special
Protection (Pr) by SEMARNAT. Photo by Eli Garcia-Padilla.
September 2021 | Volume 15 | Number 2 | e285
The herpetofauna of Veracruz, Mexico
Table 5 (continued). Distribution of the herpetofaunal species of Veracruz, Mexico, by physiographic region. See text for
descriptions of these regions. * = species endemic to Mexico; ** = species endemic to Veracruz; and *** = non-native species.
Physiographic regions of Veracruz Number
Le Gulf Coastal Sierrade Los SierraMadre Transmexican of Peeluus
Lowlands Tuxtlas Oriental Volcanic Belt Groupie’
Craugastor laticeps x xX 2
Craugastor loki x x xX xX 4
Craugastor megalotympanum** x 1
Craugastor mexicanus* x xX 2
Craugastor pygmaeus xX x xX xX 4
Craugastor rhodopis* x x xX xX 4
Craugastor spatulatus* xX x 2
Craugastor vulcani** x xX 2
Eleutherodactylidae (7 species)
Eleutherodactylus cystignathoides xX xX 2
Eleutherodactylus leprus xX xX 2
Eleutherodactylus longipes* xX l
Eleutherodactylus nitidus* x xX W2
Eleutherodactylus planirostris*** x xX xX 3
Eleutherodactylus verrucipes* xX xX 2
Eleutherodactylus verruculatus** xX xX 2
Hylidae (29 species)
Bromeliohyla dendroscarta* xX xX xX 3
Charadrahyla nephila* xX 1
Charadrahyla taeniopus* xX xX 2
Dendropsophus ebraccatus xX xX xX 3
Dendropsophus microcephalus xX xX xX xX 4
Dryophytes arenicolor xX l
Dryophytes euphorbiaceus* xX xX 2
Dryophytes eximius* xX x xX 3
Dryophytes plicatus* xX xX 2
Duellmanohyla chamulae* xX l
Ecnomiohyla valancifer** x 1
Exerodonta bivocata* x 1
Megastomatohyla mixomaculata* xX xX xX 3
Megastomatohyla nubicola** x xX 2
Ptychohyla zophodes* xX x 2
Quilticohyla zoque* xX 1
Rheohyla miotympanum* xX xX x x 4
Sarcohyla arborescandens* xX xX 2
Sarcohyla bistincta* x x 2
Sarcohyla pachyderma** xX 1
Sarcohyla siopela* xX xX 2
Scinax staufferi x x x x 4
Smilisca baudinii xX x x x 4
Smilisca cyanosticta x x xX xX 4
Tlalocohyla godmani* x x 2»
Tlalocohyla loquax xX xX xX xX 4
Tlalocohyla picta xX p46 xX xX 4
Trachycephalus vermiculatus xX xX xX xX 4
Triprion spinosus xX »4 xX xX 4
Leptodactylidae (3 species)
Engystomops pustulosus xX x 2
Leptodactylus fragilis xX xX x xX 4
Leptodactylus melanonotus xX xX xX xX 4
Amphib. Reptile Conserv. 86 September 2021 | Volume 15 | Number 2 | e285
Table 5 (continued). Distribution of the herpetofaunal species of Veracruz, Mexico, by physiographic region. See text for
Torres-Hernandez et al.
descriptions of these regions. * = species endemic to Mexico; ** = species endemic to Veracruz; and *** = non-native species.
Taxa
Microhylidae (3 species)
Gastrophryne elegans
Hypopachus ustus
Hypopachus variolosus
Phyllomedusidae (2 species)
Agalychnis callidryas
Agalychnis moreletii
Ranidae (8 species)
Lithobates berlandieri
Lithobates brownorum
Lithobates catesbeianus***
Lithobates johni*
Lithobates maculatus
Lithobates montezumae*
Lithobates spectabilis*
Lithobates vaillanti
Rhinophrynidae (1 species)
Rhinophrynus dorsalis
Scaphiopodidae (2 species)
Scaphiopus couchii
Spea multiplicata
Caudata (45 species)
Ambystomatidae (1 species)
Ambystoma velasci*
Plethodontidae (42 species)
Aquiloeurycea cafetalera*
Aquiloeurycea cephalica*
Aquiloeurycea praecellens**
Bolitoglossa alberchi*
Bolitoglossa mexicana
Bolitoglossa occidentalis
Bolitoglossa platydactyla*
Bolitoglossa rufescens
Bolitoglossa veracrucis*
Chiropterotriton aureus **
Chiropterotriton casasi**
Chiropterotriton ceronorum*
Chiropterotriton chiropterus*
Chiropterotriton chondrostega*
Chiropterotriton lavae**
Chiropterotriton nubilus**
Chiropterotriton perotensis**
Chiroterotriton terrestris *
Chiropterotriton totonacus**
Isthmura corrugata**
Isthmura gigantea*
Isthmura naucampatepetl**
Parvimolge townsendi**
Pseudoeurycea firscheini*
Pseudoeurycea gadovii*
Pseudoeurycea granitum**
Amphib. Reptile Conserv.
Physiographic regions of Veracruz Number
Gulf Coastal Sierra de Los Sierra Madre ‘Transmexican of regions
Lowlands Tuxtlas Oriental Volcanic Belt pemupied
Xx Xx 2
xX xX xX XxX 4
Xx Xx Xx Xx 4
xX xX Xx Xx 4
xX 4 xX xX 4
Xx xX xX xX 4
xX xX 2
xX XxX XxX xX 4
xX 1
XxX xX 2
Xx Xx p
xX b 4 2
xX Xx Xx 4 4
xX xX 2
xX Xx xX 3
xX xX 2
xX xX 2
xX xX 2
xX xX 2
Xx xX 2
XxX 1
xX Xx Xx xX 4
xX 1
Xx Xx xX xX 4
xX XxX xX xX 4
Xx 1
xX 1
xX 1
xX 1
xX 1
Xx 1
xX 1
Xx 1
xX 1
4 1
xX 1
Xx 1
xX Xx wi
xX Xx 2
xX Xx 2
xX xX 2
xX Xx 2
XxX xX 2
87 September 2021 | Volume 15 | Number 2 | e285
The herpetofauna of Veracruz, Mexico
Table 5 (continued). Distribution of the herpetofaunal species of Veracruz, Mexico, by physiographic region. See text for
descriptions of these regions. * = species endemic to Mexico; ** = species endemic to Veracruz; and *** = non-native species.
Physiographic regions of Veracruz Number
Taxa Gulf Coastal Sierra de Los
Lowlands Tuxtlas
Pseudoeurycea leprosa*
Pseudoeurycea lineola**
Pseudoeurycea lynchi*
Pseudoeurycea melanomolga*
Pseudoeurycea nigromaculata**
Pseudoeurycea orchimelas**
Pseudoeurycea werleri*
Thorius dubitus*
Thorius lunaris**
Thorius magnipes**
Thorius minydemus**
Thorius munificus**
Thorius narismagnus**
Thorius pennatulus**
Thorius spilogaster**
Thorius troglodytes**
Salamandridae (1 species)
Notophthalmus meridionalis xX
Sirenidae (1 species)
Siren intermedia xX
Gymnophiona (1 species)
Dermophiidae (1 species)
Dermophis mexicanus x
Crocodylia (1 species)
Crocodylidae (1 species)
Crocodylus moreletii xX
Squamata (217 species)
Anguidae (10 species)
Abronia chiszari**
Abronia graminea*
Abronia reidi**
Abronia taeniata* x
Barisia imbricata*
Gerrhonotus liocephalus xX
Gerrhonotus ophiurus*
Mesaspis antauges**
~<
Ophisaurus ceroni**
Ophisaurus incomptus*
Corytophanidae (4 species)
Basiliscus vittatus
Corytophanes hernandesii
Laemanctus longipes
xxx
Laemanctus serratus
Dactyloidae (18 species)
Norops alvarezdeltoroi*
Norops barkeri*
Norops beckeri
Norops biporcatus
xx mK KM
Norops compressicauda*
Norops cymbops*
Norops duellmani**
Amphib. Reptile Conserv. 88
x
x x x
x x x
of regions
Sierra Madre Transmexican :
occupied
Oriental Volcanic Belt
N
Kx x KK KM
x x KK
*<
| RO Oe ee NO OO ae LO an \O oS)
x xX xX
x xX x xm mK ~<
~< xx KK MK ~<
FeENNANWENE
x x XK
NN BD
~<
PFNFEFWNHN =
September 2021 | Volume 15 | Number 2 | e285
Torres-Hernandez et al.
Table 5 (continued). Distribution of the herpetofaunal species of Veracruz, Mexico, by physiographic region. See text for
descriptions of these regions. * = species endemic to Mexico; ** = species endemic to Veracruz; and *** = non-native species.
Taxa
Norops laeviventris
Norops lemurinus
Norops naufragus*
Norops petersii
Norops purpuronectes*
Norops rodriguezii
Norops sagrei***
Norops schiedii**
Norops sericeus
Norops tropidonotus
Norops uniformis
Dibamidae (1 species)
Anelytropsis papillosus*
Diploglossidae (4 species)
Celestus enneagrammus*
Celestus ingridae**
Celestus legnotus*
Celestus rozellae
Eublepharidae (1 species)
Coleonyx elegans
Gekkonidae (3 species)
Hemidactylus frenatus***
Hemidactylus mabouia ***
Hemidactylus turcicus***
Iguanidae (2 species)
Ctenosaura acanthura
Iguana iguana
Mabuyidae (1 species)
Marisora lineola
Phrynosomatidae (20 species)
Holbrookia propinqua
Phrynosoma braconnieri*
Phrynosoma orbiculare*
Sceloporus aeneus*
Sceloporus aureolus*
Sceloporus bicanthalis*
Sceloporus cyanogenys
Sceloporus formosus*
Sceloporus grammicus
Sceloporus internasalis
Sceloporus jalapae*
Sceloporus megalepidurus*
Sceloporus mucronatus *
Sceloporus salvini*
Sceloporus scalaris*
Sceloporus serrifer
Sceloporus spinosus*
Sceloporus teapensis
Sceloporus torquatus*
Sceloporus variabilis
Scincidae (5 species)
Amphib. Reptile Conserv.
Gulf Coastal
Lowlands
Physiographic regions of Veracruz Number
Sierra de Los Sierra Madre =‘ Transmexican oh rezions
Tuxtlas Oriental Volcanic Belt occupied
xX Xx Xx 3
Xx Xx Xx 4
xX 1
xX Xx Xx 4
1
4 2
xX 2
Xx Xx 2
xX xX b 4 4
Xx Xx xX 3
xX 2
Xx xX 2
XxX xX 2
xX 1
Xx 1
1
XxX Xx xX 4
xX 2
Xx xX 3
xX 2
Xx xX XxX 4
Xx 2
Xx xX xX 4
1
xX xX bs
xX xX 2
XxX XxX wi
xX 1
xX xX 2
Xx 1
XxX XxX 2
4 xX 3
xX Xx 2
xX xX 2
Xx xX 2
xX x 2
xX xX xX 3
xX xX 2
XxX 2
Xx xX 2
xX xX xX 4
xX xX Z
Xx Xx Xx 4
89 September 2021 | Volume 15 | Number 2 | e285
The herpetofauna of Veracruz, Mexico
Table 5 (continued). Distribution of the herpetofaunal species of Veracruz, Mexico, by physiographic region. See text for
descriptions of these regions. * = species endemic to Mexico; ** = species endemic to Veracruz; and *** = non-native species.
Taxa
Plestiodon brevirostris*
Plestiodon copei*
Plestiodon lynxe*
Plestiodon sumichrasti
Plestiodon tetragrammus
Sphaerodactylidae (2 species)
Gonatodes albogularis
Sphaerodactylus glaucus
Sphenomorphidae (3 species)
Scincella cherriei
Scincella gemmingeri*
Scincella silvicola*
Teiidae (5 species)
Aspidoscelis costata*
Aspidoscelis deppii
Aspidoscelis gularis
Aspidoscelis guttatus*
Holcosus amphigrammus*
Xantusiidae (5 species)
Lepidophyma flavimaculatum
Lepidophyma pajapanense*
Lepidophyma sylvaticum*
Lepidophyma tuxtlae*
Lepidophyma zongolica*
Xenosauridae (3 species)
Xenosaurus grandis*
Xenosaurus rectocollaris*
Xenosaurus tzacualtipantecus*
Boidae (1 species)
Boa imperator
Colubridae (41 species)
Coluber constrictor
Conopsis acuta*
Conopsis lineata*
Conopsis nasus*
Dendrophidion vinitor
Drymarchon melanurus
Drymobius chloroticus
Drymobius margaritiferus
Ficimia olivacea*
Ficimia publia
Ficimia streckeri
Ficimia variegata*
Lampropeltis polyzona
Lampropeltis triangulum
Leptophis ahaetulla
Leptophis mexicanus
Masticophis flagellum
Masticophis mentovarius
Masticophis schotti
Mastigodryas melanolomus
Amphib. Reptile Conserv.
Gulf Coastal
Lowlands
xx KX
x x MK MK
~ xX XM
Km KKM KK KK KK
Physiographic regions of Veracruz Number
Sierra de Los Sierra Madre =‘ Transmexican oh rezions
Tuxtlas Oriental Volcanic Belt occupied
Xx Xx 2
Xx Xx Xx 3
xX XxX 3
xX Xx Xx 3
Xx 1
xX Xx Xx 4
xX Xx Xx 4
xX Xx xX 4
xX Xx 2
Xx xX 2
1
xX xX 3
xX Xx xX 4
xX XxX xX 4
xX 2
xX p
xX 2
Xx 2
xX Xx 83
4 xX XxX 3
xX 1
Xx 1
xX xX xX 4
1
1
xX xX w
xX xX 2
xX 1
xX Xx xX 4
xX 2
Xx xX x 4
XxX xX xX 3
xX 2
xX 2
Xx 2
XxX xX xX 4
1
1
Xx xX XxX 4
1
Xx 2
xX 2
xX Xx 3
90 September 2021 | Volume 15 | Number 2 | e285
Torres-Hernandez et al.
Table 5 (continued). Distribution of the herpetofaunal species of Veracruz, Mexico, by physiographic region. See text for
descriptions of these regions. * = species endemic to Mexico; ** = species endemic to Veracruz; and *** = non-native species.
Physiographic regions of Veracruz Number
of regions
Taxa Gulf Coastal Sierra de Los Sierra Madre Transmexican :
occupied
Lowlands Tuxtlas Oriental Volcanic Belt
Oxybelis aeneus x xX xX
Oxybelis fulgidus x xX
Pantherophis emoryi xX
Phrynonax poecilonotus x x
Pituophis deppei* xX
x xX
Pituophis lineaticollis
Pseudelaphe flavirufa x xX
Salvadora bairdi* x
Salvadora grahamiae
Senticolis triaspis
Spilotes pullatus
Stenorrhina degenhardtii
xx KKK KK
x x x
~ rx
Stenorrhina freminvillii
Tantilla bocourti*
Tantilla rubra
Tantilla schistosa xX xX
Tantilla shawi*
Kx KKK KK KK
x x x XK
Tantilla slavensi**
Tantillita lintoni x
Trimorphodon biscutatus
x x XK
*<
WNRE EP RNNF KR KR RNWWNWNNN W
~<
~<
~ x x
Trimorphodon tau*
Dipsadidae (46 species)
Adelphicos quadrivirgatum
~<
*<
Adelphicos visoninum
~<
Amastridium sapperi
Chersodromus liebmanni*
Clelia scytalina
Coniophanes bipunctatus
Coniophanes fissidens
xx KKK
xx KKK
Coniophanes imperialis
Coniophanes quinquevittatus
Coniophanes taeniatus*
Kx mK Km MK MK KM OM
~<
Conophis lineatus
xxx mK KK KM
Conophis morai**
Diadophis punctatus xX
Geophis bicolor*
Geophis blanchardi*
xx KKM MK
x
Geophis carinosus xX xX
Geophis chalybeus** x
Geophis juliai** xX
~<
x
Geophis lorancai*
Geophis mutitorques*
Geophis semidoliatus*
Imantodes cenchoa
Imantodes gemmistratus
Leptodeira frenata
Leptodeira maculata
Leptodeira polysticta
Leptodeira septentrionalis
Ninia diademata
Ninia sebae
FFA NAPNWHWrRKNWRYKNNK NN FwWN FH HHPwWwW He W
KK MK MK KM
KKM KM MM KM
~<
<
x xX xX
x mx x
Amphib. Reptile Conserv. 91 September 2021 | Volume 15 | Number 2 | e285
The herpetofauna of Veracruz, Mexico
Table 5 (continued). Distribution of the herpetofaunal species of Veracruz, Mexico, by physiographic region. See text for
descriptions of these regions. * = species endemic to Mexico; ** = species endemic to Veracruz; and *** = non-native species.
Taxa
Oxyrhopus petolarius
Pliocercus elapoides
Rhadinaea cuneata*
Rhadinaea decorata
Rhadinaea forbesi**
Rhadinaea fulvivittis*
Rhadinaea macdougalli*
Rhadinaea marcellae*
Rhadinaea quinquelineata*
Rhadinella schistosa*
Sibon dimidiatus
Sibon linearis**
Sibon nebulatus
Tretanorhinus nigroluteus
Tropidodipsas fasciata
Tropidodipsas sartorii
Xenodon rabdocephalus
Elapidae (4 species)
Micrurus diastema*
Micrurus elegans
Micrurus limbatus**
Micrurus tener
Leptotyphlopidae (4 species)
Epictia phenops
Epictia resetari*
Rena dulcis
Rena myopica*
Natricidae (14 species)
Nerodia rhombifer
Storeria dekayi
Storeria storerioides*
Thamnophis chrysocephalus*
Thamnophis conanti*
Thamnophis cyrtopsis
Thamnophis eques
Thamnophis godmani*
Thamnophis marcianus
Thamnophis proximus
Thamnophis pulchrilatus*
Thamnophis scalaris*
Thamnophis scaliger*
Thamnophis sumichrasti*
Sibynophiidae (1 species)
Scaphiodontophis annulatus
Typhlopidae (2 species)
Amerotyphlops tenuis
Virgotyphlops braminus***
Viperidae (17 species)
Agkistrodon taylori*
Bothrops asper
Cerrophidion petlalcalensis*
Amphib. Reptile Conserv.
Gulf Coastal
Lowlands
xx KX
xx mK KK
Physiographic regions of Veracruz Number
Sierra de Los Sierra Madre =‘ Transmexican oF regions
Tuxtlas Oriental Volcanic Belt occupied
xX 2
xX Xx XxX 4
Xx XxX 3
xX Xx Xx 4
XxX 1
Xx Xx 2
xX XxX z
Xx 1
xX 1
Xx 1
Xx XxX 2
Xx 1
xX 2
xX 2
xX 2
xX Xx xX 4
XxX 2
xX XxX Xx 4
Xx Xx xX 4
xX 1
Xx 1
Xx Xx 3
xX XxX 2
xX 2
Xx 2
xX xX 3
xX xX 2
Xx xX 2
xX p.4 2
xX 1
xX 1
xX xX 2
xX xX ws
xX xX 2
XxX xX xX 4
xX 1
xX D4 2
xX 1
xX xX 2
xX xX 3
XxX xX xX 4
xX xX XxX 4
Xx 2
XxX Xx xX 4
xX xX 2
92 September 2021 | Volume 15 | Number 2 | e285
Torres-Hernandez et al.
Table 5 (continued). Distribution of the herpetofaunal species of Veracruz, Mexico, by physiographic region. See text for
descriptions of these regions. * = species endemic to Mexico; ** = species endemic to Veracruz; and *** = non-native species.
Physiographic regions of Veracruz
Taxa Gulf Coastal
Lowlands
Crotalus aquilus*
Crotalus atrox x
Crotalus intermedius* xX
Crotalus mictlantecuhtli** XxX
Crotalus molossus
Crotalus polystictus*
Crotalus ravus*
Crotalus scutulatus
Crotalus totonacus*
Crotalus triseriatus*
Metlapilcoatlus nummifer*
Metlapilcoatlus olmec xX
Ophryacus smaragdinus*
Ophryacus undulatus*
Testudines (19 species)
Cheloniidae (4 species)
Caretta caretta
Chelonia mydas
Eretmochelys imbricata
x x Kx xX
Lepidochelys kempii
Chelydridae (1 species)
Chelydra rossignonii xX
Dermatemyidae (1 species)
Dermatemys mawii x
Dermochelyidae (1 species)
Dermochelys coriacea xX
Emydidae (3 species)
Terrapene mexicana* x
Trachemys scripta*** x
Trachemys venusta x
Geoemydidae (1 species)
Rhinoclemmys areolata xX
Kinosternidae (5 species)
Kinosternon acutum x
Kinosternon flavescens x
Kinosternon herrerai* x
Kinosternon leucostomum x
Kinosternon scorpioides x
Staurotypidae (2 species)
Claudius angustatus
Staurotypus triporcatus
Testudinidae (1 species)
Gopherus berlandieri xX
(222/359) 61.8% (TVB), (190/359) 52.9% (GCL), and
(179/359) 49.9% (SLT). The average percentage of
occupancy is 57.6%, or somewhat in excess of one-half
of the number of Veracruz’s herpetofaunal species.
The numbers of amphibian species in the SMO and
TVB (Table 6) are very similar to each other (57 and
56 anurans of 76; 28 and 31 salamanders of 45; 0 and
Amphib. Reptile Conserv.
Sierra de Los
Number
of regions
Transmexican E
occupied
Volcanic Belt
x
Sierra Madre
Tuxtlas Oriental
Kx KM KKK XK
x KKK MK
NNNNNNNNKENWWEE
x xX
x
xx KK
NNN N
~<
NNN Ww
one caecilian of one; and totals of 85 and 88 of 122,
respectively). The numbers of reptile species in these
two regions (Table 6), however, are relatively dissimilar
when compared to the situation with amphibians (0 and
0 crocodylians of one; 151 and 132 squamates of 217; 0
and two turtles of 19; and totals of 151 and 134 of 237,
respectively).
93 September 2021 | Volume 15 | Number 2 | e285
The herpetofauna of Veracruz, Mexico
Table 6. Summary of distributional occurrence of the herpetofaunal families in Veracruz, Mexico, by physiographic province. GLC
= Gulf Coastal Lowlands; SLT = Sierra de los Tuxtlas; SMO = Sierra Madre Oriental; and TVB = Transmexican Volcanic Belt.
Family
Bufonidae
Centrolenidae
Craugastoridae
Eleutherodactylidae
Hylidae
Leptodactylidae
Microhylidae
Phyllomedusidae
Ranidae
Rhinophrynidae
Scaphiopodidae
Subtotal
Ambystomatidae
Plethodontidae
Salamandridae
Sirenidae
Subtotal
Dermophiidae
Subtotal
Total
Crocodylidae
Subtotal
Anguidae
Corytophanidae
Dactyloidae
Dibamidae
Diploglossidae
Eublepharidae
Gekkonidae
Iguanidae
Mabuyidae
Phrynosomatidae
Scincidae
Sphaerodactylidae
Sphenomorphidae
Tetidae
Xantusiidae
Xenosauridae
Subtotal
Boidae
Colubridae
Dipsadidae
Elapidae
Leptotyphlopidae
Natricidae
Sibynophiidae
Typhlopidae
Viperidae
Subtotal
Cheloniidae
Chelydridae
Dermatemyidae
Dermochelyidae
Emydidae
Geoemydidae
Kinosternidae
Staurotypidae
Testudinidae
Subtotal
Total
Sum Total
Amphib. Reptile Conserv.
Number of
species
9
1
NR oNwWwRr
I
N
eS
_
Nn
HAeunvwnanSenv-s- Ze oec-Re-
Q
Q
="
WEAN NHwWHEHHERBYANHNYN Be Fl Saevynraenv-- | Hevse- Vera] FoeH-unvwgerara
94
Distributional occurrence
SLT SMO TVB
4 7 v3
1 l 1
8 8 8
2 5 4
15 23 22
3 2 2
3 2 2
2 2 2
p) 5 6
] ae —
— 2, D:
44 57 56
—- 1 1
11 26 30
ee 1 un
11 28 31
l —- l
1 — 1
56 85 88
| = —_
1 =— —
3 6 f
3 2 3
12 9 7
— 1 1
l 2 1
l 1 l
3 — 1
2 l 1
l l 1
4 17 17
2 > 4
l l l
3 3
2 4 4
eS) 2, 1
| 3 1
42 58 53
1 1 1
22 26 23
32 32 25
8 3 2
Z 4 —
| 13 11
1 — 1
2 2 2
3 (2 14
67 93 79
4 =
l = —
1 — =
1 ~- 1
l —— —
3 ~- i
2 a —
13 — 2
123 151 134
179 236 222
September 2021 | Volume 15 | Number 2 | e285
Torres-Hernandez et al.
No. 17. Abronia graminea. The Sierra de Tehuacan Arboreal
Alligator Lizard is a country endemic species distributed in
central Veracruz, eastern Puebla, and Oaxaca (Uetz et al.
2020). This individual was found at Finca Santa Martha,
in the municipality of Los Reyes. Wilson et al. (2013b)
determined its EVS as 15, placing it in the lower portion of the
high vulnerability category. Its conservation status has been
assessed as Endangered by the IUCN, and as Threatened (A)
by SEMARNAT. Photo by Matthieu Berroneau.
a
No. 19. Gerrhonotus ophiurus Cope, 1867. The Snake Lizard
is acountry endemic species distributed from central San Luis
Potosi south to eastern Querétaro, Hidalgo, Tlaxcala, northern
Veracruz, and Puebla (Lemos-Espinal and Dixon 2013). This
individual was discovered at Comapa, in the municipality
of the same name. Wilson et al. (2013b) determined its EVS
as 12, placing it in the middle of the medium vulnerability
category. Its conservation status has been determined as Least
Concern by the IUCN, but this species has not been evaluated
by SEMARNAT. Photo by Aaron Arias.
Amphib. Reptile Conserv.
No. 18. Barisia imbricata. The Transvolcanic Alligator
Lizard is a country endemic species that occurs broadly in the
Sierra Madre Oriental and Transmexican Volcanic Belt from
Hidalgo south to Oaxaca, and west to Jalisco and Michoacan
(Ramirez-Bautista et al. 2014). This individual was located at
San Isidro, in the municipality of Mariano Escobedo. Wilson
et al. (2013b) assessed its EVS as 14, placing it at the lower
limit of the high vulnerability category. Its conservation status
has been determined as Least Concern by the IUCN, and
as Special Protection (Pr) by SEMARNAT. Photo by René
Avalos-Vela.
.. : Ae |
No. 20. Ophisaurus ceroni Holman, 1965. Ceron’s Glass
Lizard is a state endemic species distributed in the Gulf Coastal
Lowlands physiographic region (Uetz et al. 2020). This
individual was located at Cuitlahuac, in the municipality of
the same name. Wilson et al. (2013b) calculated its EVS as 14,
placing it at the lower limit of the high vulnerability category.
Its conservation status has been assessed as Endangered by
the IUCN, and as Threatened (A) by SEMARNAT. Photo by
Matthieu Berroneau.
September 2021 | Volume 15 | Number 2 | e285
The herpetofauna of Veracruz, Mexico
The members of the Veracruz herpetofauna occupy
from 1-4 of the four physiographic regions, as follows:
one (86; 24.0%), two (153; 42.6%), three (45; 12.5%),
and four (75; 20.9%). The mean regional occupancy 1s
2.3, meaning that each species, on average, inhabits only
slightly more than one-half of the physiographic regions
located in the state.
A large proportion of the herpetofauna is found in
one or two regions (239 species, or 66.6% of the total).
This situation is of significant conservation importance,
as discussed below in the section on conservation status.
The number of species found in a single region varies
from 16 in the SLT to 27 in the GCL. The 27 single-
region species in the GCL are:
Incilius macrocristatus
Eleutherodactylus longipes*
Duellmanohyla chamulae*
Exerodonta bivocata*
Quilticohyla zoque*
Bolitoglossa veracrucis*
Siren intermedia
Ophisaurus ceroni**
Norops alvarezdeltoroi*
Norops compressicauda*
Norops purpuronectes*
Celestus rozellae
Holbrookia propinqua
Gonatodes albogularis
Aspidoscelis deppii
Coluber constrictor
Conopsis acuta*
Lampropeltis triangulum
Leptophis ahaetulla
Masticophis flagellum
Adelphicos visoninum
Crotalus atrox
Dermatemys mawii
Terrapene mexicana*
Trachemys venusta
Kinosternon flavescens
Gopherus berlandieri
Sixteen of the 27 GCL single-region species (59.3%)
are non-endemics, 10 (37.0%) are country endemics
(indicated by asterisks) and one (3.7%) is a state endemic.
As expected, the largest number of these lowland-
inhabiting species ranges outside the limits of Mexico.
The 25 single-region species in the SMO are as follows:
Sarcohyla pachyderma**
Chiropterotriton aureus **
Chiropterotriton terrestris*
Thorius lunaris**
Thorius magnipes**
Amphib. Reptile Conserv.
Thorius minydemus**
Thorius munificus**
Norops naufragus*
Celestus legnotus*
Sceloporus aureolus*
Sceloporus cyanogenys
Plestiodon tetragrammus
Xenosaurus rectocollaris*
Xenosaurus tzacualtipantecus*
Tantilla shawi*
Geophis chalybeus**
Geophis mutitorques*
Rhadinaea forbesi**
Rhadinaea marcellae*
Rhadinaea quinquelineata*
Rhadinella schistosa*
Micrurus tener
Thamnophis conanti*
Thamnophis cyrtopsis
Thamnophis pulchrilatus*
Thirteen of the 25 SMO single-region species (52.0%)
are Mexican endemics, eight (32.0%) are state endemic
species, and four (16.0%) are non-endemic species. As
expected, the largest number of these species in this
montane region are Mexican endemics, with the next
largest number being state endemics, for a total of 21
endemic taxa (84.0%).
The 18 single-region species in the TVB are as follows:
Dryophytes arenicolor
Lithobates johni*
Chiropterotriton casasi**
Chiropterotriton ceronorum*
Chiropterotriton chiropterus*
Chiropterotriton chondrostega*
Chiropterotriton lavae**
Chiropterotriton nubilus**
Chiropterotriton perotensis**
Chiropterotriton totonacus**
Isthmura corrugata**
Thorius spilogaster**
Ophisaurus incomptus*
Stenorrhina freminvillii
Geophis bicolor*
Thamnophis scaliger*
Crotalus aquilus*
Crotalus polystictus*
Nine of the 18 single-region TVB species (50.0%) are
country endemics, seven (38.9%) are state endemics, and
two (11.1%) are non-endemics. Again, it was expected
that the largest number of these species in this montane
region would be Mexican endemics, with the next largest
number being state endemics, for a total of 16 endemic
taxa (88.9%).
September 2021 | Volume 15 | Number 2 | e285
Torres-Hernandez et al.
No. 21. Corytophanes hernandezii (Wiegmann, 1831).
Hernandez’s Helmeted Basilisk is a non-endemic species
ranging from southeastern San Luis Potosi south to
northwestern Honduras (Kohler 2008). This individual was
located at Los Tuxtlas, in the municipality of San Andrés
Tuxtla. Wilson et al. (2013b) assessed its EVS at 13, placing
it at the upper limit of the medium vulnerability category. Its
conservation status has been determined as Least Concern by
the IUCN, and as Special Protection (Pr) by SEMARNAT.
Photo by Christian Berriozabal-Islas.
=e , tg 5 an r . < > —
6
No. 23. Celestus enneagrammus (Cope, 1861). The Huaxteca
Lesser Galliwasp is a country endemic species found in
the states of Veracruz, Puebla, Oaxaca, and Chiapas (Uetz
et al. 2020). This individual was located at Tequila, in
the municipality of the same name. Wilson et al. (2013b)
ascertained its EVS as 14, placing it at the lower limit of the
high vulnerability category. Its conservation status 1s indicated
as Least Concern by the IUCN, and as Special Protection (Pr)
by SEMARNAT. Photo by René Avalos-Vela.
Amphib. Reptile Conserv.
- ‘< 3 :
No. 22. Norops barkeri Schmidt, 1939. Barker’s Anole is a
country endemic species found in the region of the Isthmus
of Tehuantepec in Veracruz, Tabasco, Oaxaca, and Chiapas
(Kohler 2008). This individual was found at Los Tuxtlas, in
the municipality of San Andrés Tuxtla. Wilson et al. (2013b)
determined its EVS as 15, placing in the lower portion of the
high vulnerability category. Its conservation status has not
been evaluated by either the IUCN or SEMARNAT. Photo by
Christian Berriozabal-Islas.
No. 24. Sceloporus salvini Gunther, 1890. Salvin’s Spiny
Lizard is a country endemic species that ranges into Veracruz
and Oaxaca (Uetz et al. 2020). This individual was discovered
at Tepexilotla, in the municipality of Chocaman. Wilson et
al. (2013b) determined its EVS as 15, placing it in the lower
portion of the high vulnerability category. Its conservation
status has been evaluated as Data Deficient by the IUCN, and
as Threatened (A) by SEMARNAT. Photo by René Avalos-
Vela.
September 2021 | Volume 15 | Number 2 | e285
The herpetofauna of Veracruz, Mexico
Fig. 7. UPGMA generated dendrogram illustrating the similar-
ity relationships of species richness among the herpetofaunal
components in the four physiographic regions of Veracruz
(based on the data in Table 7; Sokal and Michener 1958). Simi-
larity values were calculated using Duellman’s (1990) Coef-
ficient of Biogeographic Resemblance (CBR).
The 16 single-region species in the SLT are as follows:
Craugastor megalotympanum**
Charadrahyla nephila*
Ecnomiohyla valancifer**
Bolitoglossa alberchi*
Bolitoglossa occidentalis
Pseudoeurycea orchimelas**
Pseudoeurycea werleri*
Thorius narismagnus**
Abronia chiszari**
Abronia reidi**
Norops duellmani**
Celestus ingridae**
Dendrophidion vinitor
Tantilla slavensi**
Sibon linearis**
Micrurus limbatus**
Eleven of the 16 single-region SLT species (68.8%) are
state endemics, three (18.8%) are country endemics,
and two (12.5%) are non-endemics. Given the isolation
of this montane region relative to others in the vicinity,
this is also the expected pattern, with the prevalence of
state endemics versus the other distributional categories
represented. In total, this region supports 14 endemic
taxa (87.5%).
In summary, of the 86 single-region species in
Veracruz, 24 (27.9%) are non-endemics, 35 (40.7%)
are Mexican endemics, and 27 (31.4%) are state
endemics. Of the four physiographic regions, the SMO
has the greatest conservation significance given that it
encompasses the greatest overall number of species (236
of 359, or 65.7%), the greatest numbers of country and
state endemics (130 [109 and 21, respectively] of 182, or
71.4%), and the second highest number of single-region
species (25 of 86, or 29.1%).
A Coefficient of Biogeographic Resemblance (CBR)
matrix was constructed for assessing the herpetofaunal
similarity relationships (Duellman 1990) among the
four physiographic regions in Veracruz (Table 7) and
those data were used to create a UPGMA dendrogram
(Fig. 7; Sokal and Michener 1958). The SMO contains
the greatest amount of species richness (236 species)
and the SLT the least (179 species). The mean species
richness value for all four regions is 206.8. The number
of shared species between each regional pair ranges
from a high of 190 between the SMO and TVB, to a
low of 100 between the TVB and GCL. The mean value
of shared species among all four regions is 123.0. The
lowest number of shared species between the TVB and
GCL (100 species) was expected, as these two regions
are completely separated from each other by the SMO
and are environmentally different on an elevational scale.
The GCL, with an elevational range from sea level to
about 200 m, contains tropical evergreen forest, scrub,
sub-deciduous forest, and tropical dry forest (CONABIO,
2008). Conversely, with a limited geographic area within
Veracruz, the TVB contains primarily coniferous and
oak forest vegetation with the remainder comprised of
subalpine scrub, cloud forest, xerophilous scrub, and
tropical dry forest. The elevations for the TVB range
from 1,000 m in sloping river valleys to 5,700 m on the
highest volcanic peak. The TVB and SMO share the most
Table 7. Pair-wise comparison matrix of Coefficient of Biogeographic Resemblance (CBR) data of herpetofaunal relationships for
the four physiographic regions in Veracruz, Mexico. Underlined values = number of species in each region; upper triangular matrix
values = species in common between two regions; and lower triangular matrix values = CBR values. The formula for this algorithm
is CBR = 2C/N, + N, (Duellman 1990), where C is the number of species in common to both regions, N, is the number of species
in the first region, and N, is the number of species in the second region. See Fig. 7 for the UPGMA dendrogram produced from the
CBR data.
Gulf Coastal Sierra de Los Tuxtlas Sierra Madre Transmexican
Lowlands Oriental Volcanic Belt
Gulf Coastal Lowlands 190 137 105 100
Sierra de Los Tuxtlas 0.74 179 104 102
Sierra Madre Oriental 0.49 0.50 236 190
Transmexican Volcanic Belt 0.49 0.51 0.83 222
Amphib. Reptile Conserv.
98
September 2021 | Volume 15 | Number 2 | e285
Torres-Hernandez et al.
LR)
-—. ° Z wa
7 ' ’
. 2. <=.
No. 25. Scincella cherriei (Cope, 1893). The Brown Forest
Skink is a non-endemic species occurring from Veracruz
to western Panama (Uetz et al. 2020). This individual was
found at Los Tuxtlas, in the municipality of San Andrés
Tuxtla. Wilson et al. (2013b) calculated its EVS as 8, placing
it in the upper portion of the low vulnerability category. Its
conservation status has not been assessed by either the IUCN
or SEMARNAT. Photo by Christian Berriozabal-Islas.
ete. “3
No. 27. Sphaerodactylus glaucus (Cope, 1866). The Collared
Dwarf Gecko is non-endemic species occurring from Veracruz,
Tabasco, Oaxaca, and Chiapas in Mexico, through the Yucatan
Peninsula and northern Guatemala to the interior of western
Honduras, at elevations from 200 to 1,000 m (Kohler 2008).
This individual was found at Los Tuxtlas, in the municipality
of San Andrés Tuxtla. Wilson et al. (2013b) determined its
EVS as 12, placing it in the medium vulnerability category.
This species has not been assessed by either the IUCN or
SEMARNAT. Photo by Christian Berriozabal-Islas.
Amphib. Reptile Conserv.
99
No. 26. Lepidophyma tuxtlae Werler and Shannon, 1957. The
Tuxtla Tropical Night Lizard is a country endemic species
distributed from the Sierra de Los Tuxtlas to the El Ocote region
of Chiapas (K6éhler 2008). This individual was located at Los
Tuxtlas, in the municipality of San Andrés Tuxtla. Wilson et
al. (2013b) determined its EVS as 11, placing it in the middle
of the medium vulnerability category. Its conservation status 1s
designated as Data Deficient by the IUCN, and as Threatened
(A) by SEMARNAT. Photo by Christian Berriozabal-Islas.
No. 28. Boa imperator Daudin, 1803. The Central American
Boa Constrictor is a non-endemic species occurring in Central
America (including South American populations in the
Choco of Colombia and Ecuador [and probably Peru], and
North American populations along the Gulf coast of Mexico
(west of the Isthmus of Tehuantepec; Card et al. 2016). This
individual was encountered at Los Tuxtlas, in the municipality
of San Andrés Tuxtla. We calculated its EVS as 10, placing
it at the lower limit of the medium vulnerability category. Its
conservation status has not been determined by the IUCN or
SEMARNAT. Photo by Christian Berriozabal-Islas.
September 2021 | Volume 15 | Number 2 | e285
The herpetofauna of Veracruz, Mexico
species (190), which also was expected because they are
directly adjacent to each other in Veracruz and share
many of the same montane environments in their limited
geographic ranges within the state. The SLT and GCL
share the second largest number of species (137). The
SLT is an isolated mountainous region with a maximum
elevation of 1,700 m, which is nearly surrounded by
lowland habitats, some of which ascend upward to an
elevation of 200 m into lower montane areas on volcanic
slopes. Pairwise comparisons of the aligned regions in
order from highest to lowest species richness (underlined
values) and their corresponding numbers of shared
species (in parentheses) are as follows:
SMO 236: TVB (190), SLT (104), GCL (105)
TVB 222: SMO (190), SLT (102), GCL (100)
GCL 190: SLT (137), SMO (105), TVB (100)
SLT 179: GCL (137), SMO (104), TVB (102)
In general, the pattern indicates how species richness
values within each of the four biogeographic regions of
Veracruz equate to numbers of shared species among
the other three regions. There is a higher correlation of
species richness values to the numbers of shared species
between regions that are in contact with each other, but
also a correlation between regions that share ecological
parameters. Interestingly, the two regions that share the
second highest number of species (137) are a highland
region (SLT) and a lowland region (GCL), which is
probably due to the GCL containing many generalist
species that tolerate both montane and non-montane
environments at low to moderate elevations. The fact that
the GCL shares fewer species with the SMO and TVB
gives credibility to the premise that regions separated by
ecological barriers will share fewer species than they will
with regions in direct contact.
The following data show the ranges and mean numbers
of shared species (bold in parentheses) for each of the
four regions, and are arranged according to increasing
species richness (underlined values) in each region:
Sierra Madre Oriental, SMO (236): 104—190 (133)
Transmexican Volcanic Belt, TVB (222): 100-190
(130.7)
Gulf Coastal Lowlands, GCL (190): 100-137 (114)
Sierra de Los Tuxtlas, SLT (179): 102-137 (114.3)
The mean numbers of shared species compared to the
species richness in the four regions indicate that higher
Species richness in a pairwise comparison tends, with one
exception, to translate into higher reciprocal numbers when
all the regional pairs are totaled. The comparison between
the SMO and TVB are 1* and 2™ in species richness and 1°
and 2" in the average value of shared species, respectively.
The minor exception is that the GCL, a lowland region,
is 3™ in species richness but last (4) in the mean number
of shared species, whereas the SLT is lower in species
Amphib. Reptile Conserv.
richness but slightly higher in the mean numbers of shared
species. Apparently, the size of the region has an important
effect on species richness, and the ecological variability
(highlands vs. lowlands) has an important effect on the
average number of shared species in Veracruz.
Regarding area, the GCL in Veracruz is by far larger
than all three mountainous areas combined (SMO,
TVB, and SLT), but is 3“ in species richness; it has 11
more species than the SLT. The total area of the SLT is
much smaller compared to the other three regions and
it is located only within a small portion of southeastern
Veracruz, whereas the other three regions have much
larger ranges outside of the state.
Based on the data in Table 7, a UPGMA dendrogram
(Fig. 7) depicts herpetofaunal similarity resemblance
patterns in a hierarchical fashion among the four
physiographic regions of Veracruz (Fig. 1). The
dendrogram is composed of two distinct clusters: one
comprising two montane regions (SMO and TVB) at the
0.83 level, and the other containing one montane region
(SLT) and one lowland region (GCL) at the 0.74 level.
The two clusters connect with each other at the 0.50
level. Regions in both clusters have portions adjacent
to each other somewhere in their total ranges, and the
GCL surrounds the SLT to a varying degree only in
southeastern Veracruz. Many of the shared species with
the GCL contain wide-ranging generalist species that
occur all along the Gulf lowlands from Tamaulipas and
the adjacent USA into the Yucatan Peninsula of Mexico
and northern Central America, and a few enter northern
South America (Wilson and Johnson 2010). In our
opinion, those lowland generalist species are the main
reason why the SLT clusters with the GLC instead of
with the SMO, even though the GLC and SMO share
borders along the northern half of Veracruz.
Distribution Status Categorizations
This analysis of the distributional status of the members
of the Veracruz herpetofauna utilizes the same system
employed by Alvarado-Diaz et al. (2013) and all the other
entries in the MCS (see above). The four categories 1n this
system are non-endemic, country endemic, state endemic,
and non-native. The data are presented based on these
categories in Table 8, and summarized in Table 9.
In descending order of size, the numbers of species in
each of these categories are non-endemics: 169 (47.1%),
country endemics: 138 (38.4%), state endemics: 44
(12.3%), and non-natives: 8 (2.2%). The herpetofauna
of Veracruz, therefore, resembles several other state
herpetofaunas covered previously in the MCS in that
the largest number of species fall into the non-endemic
category, 1.e., Oaxaca (Mata-Silva et al. 2015); Chiapas
(Johnson et al. 2015a); Tamaulipas (Teran-Juarez et al.
2016); Nuevo Leon (Nevarez-de los Reyes et al. 2016);
the Mexican Yucatan Peninsula (Gonzalez-Sanchez et
al. 2017); and Coahuila (Lazcano et al. 2019). In other
September 2021 | Volume 15 | Number 2 | e285
Torres-Hernandez et al.
No. 29. Spilotes pullatus Linnaeus, 1758. The Tropical Tree
Snake is a non-endemic species found from Tamaulipas
southward through Central America and South America to
Argentina on the Atlantic versant, and from the Isthmus of
Tehuantepec to Ecuador on the Pacific versant (Lemos-
Espinal and Dixon 2013). This individual was found at Los
Tuxtlas, in the municipality of San Andrés Tuxtla. Wilson et
al. (2013b) determined its EVS as 6, placing it in the middle of
the low vulnerability category. Its conservation status has not
been determined by either the IUCN or SEMARNAT. Photo
by Christian Berriozabal-Islas.
No. 31. Clelia scytalina (Cope, 1867). The Mexican Snake
Eater is a non-endemic species ranging from southern Mexico
to Guatemala and Belize (Kohler 2008). This individual was
found at Los Tuxtlas, in the municipality of San Andrés Tuxtla.
Wilson et al. (2013b) determined its EVS as 13, placing it
at the upper limit of the medium vulnerability category. Its
conservation status has not been determined by either the
IUCN or SEMARNAT. Photo by Christian Berriozabal-Islas.
Amphib. Reptile Conserv.
me EE ee =e
No. 30. Adelphicos quadrivirgatum Jan, 1862. The
Mesoamerican Earth Snake is a non-endemic species
distributed from Tamaulipas to Honduras on the Atlantic
versant, and from Oaxaca to Guatemala on the Pacific versant
(Lemos-Espinal and Dixon 2013). This individual was located
at Los Tuxtlas, in the municipality of San Andrés Tuxtla.
Wilson et al. (2013b) ascertained its EVS as 10, placing it
at the lower limit of the medium vulnerability category. Its
conservation status has been calculated as Least Concern by
the IUCN, and as Special Protection (Pr) by SEMARNAT.
Photo by Christian Berriozabal-Islas.
No. 32. Jmantodes cenchoa (Linnaeus, 1758). The Blunt-
headed Treesnake is a non-endemic species occurring at
low and moderate elevations (up to 1,600 m) on the Atlantic
versant from southern Tamaulipas, southward through
Central and South America to Argentina. It also occurs along
the Pacific lowlands and premontane slopes from Chiapas
to Guatemala. In the Yucatan Peninsula, it is known from
southern Campeche and Quintana Roo, but apparently is
absent from the arid north-western region of the peninsula
(Heimes 2016). This individual was found at Los Tuxtlas, in
the municipality of San Andrés Tuxtla. Wilson et al. (2013b)
determined its EVS as 6, placing it in the low vulnerability
category. Its conservation status has not been determined by
either the IUCN or SEMARNAT. Photo by Eli Garcia-Padilla.
September 2021 | Volume 15 | Number 2 | e285
The herpetofauna of Veracruz, Mexico
Table 8. Distributional and conservation status measures for members of the herpetofauna of Veracruz, Mexico. Distributional
Status: CE = endemic to country of Mexico; SE = endemic to state of Veracruz; NE = not endemic to state or country; and NN
= non-native. The numbers suffixed to the NE category signify the distributional categories developed by Wilson et al. (2017)
and implemented in the taxonomic list at the Mesoamerican Herpetology website (http://www.mesoamericanherpetology.com),
as follows: 3 = species distributed only in Mexico and the United States; 4 = species found only in Mexico and Central America;
6 = species ranging from Mexico to South America; 7 = species ranging from the United States to Central America; 8 = species
ranging from the United States to South America; and 9 = Oceanic species. Environmental Vulnerability Scores (taken from
Wilson et al. 2013a,b): low (L) vulnerability species (EVS 3-9); medium (M) vulnerability species (EVS 10-13); and high (H)
vulnerability species (EVS 14-19). IUCN categorization: CR = Critically Endangered; EN = Endangered; VU = Vulnerable; NT =
Near Threatened; LC = Least Concern; DD = Data Deficient; and NE = Not Evaluated. SEMARNAT Status: A = Threatened; P =
Endangered; Pr = Special Protection; and NS = No Status. See Alvarado-Diaz et al. (2013), Johnson et al. (2015a), and Mata-Silva
et al. (2015) for explanations of the EVS, IUCN, and SEMARNAT rating systems.
Distributional nba ease IUCN SEMARNAT
Taxon Vulnerability ow
status Category (score) categorization status
gory
Anaxyrus compactilis* CE H (14) LE NS
Incilius cavifrons** SE M (13) EN Pr
Incilius cristatus* CE H (14) CR Pr
Incilius macrocristatus NE4 M (11) VU NS
Incilius marmoreus * CE M (11) EN NS
Incilius nebulifer NE3 L (6) CR NS
Incilius occidentalis* GE M (11) EG NS
Incilius valliceps NE4 L (6) Le NS
Rhinella horribilis NE7 L (3) NE NS
Hyalinobatrachium viridissimum NE4 M (11) NE NS
Craugastor alfredi NE4 M (11) VU NS
Craugastor berkenbuschii* CE H (14) NT Pr
Craugastor decoratus* CE H (15) VU Pr
Craugastor laticeps NE4 M (12) NT Pr
Craugastor loki NE4 M (10) Le NS
Craugastor megalotympanum** SE H (18) CR Pr
Craugastor mexicanus* CE H (16) LG NS
Craugastor pygmaeus NE4 L(9) VU NS
Craugastor rhodopis* CE H (14) VU NS
Craugastor spatulatus* CE H (16) EN Pr
Craugastor vulcani** SE H (17) EN NS
Eleutherodactylus cystignathoides NE3 M (12) LC NS
Eleutherodactylus leprus NE4 M (12) VU NS
Eleutherodactylus longipes* CE H (15) VU NS
Eleutherodactylus nitidus* CE M (12) LC NS
Eleutherodactylus planirostris*** NN — — —
Eleutherodactylus verrucipes* GE H (16) VU Pr
Eleutherodactylus verruculatus** SE H (18) DD NS
Bromeliohyla dendroscarta* CE H (17) CR Pr
Charadrahyla nephila* CE M (13) VU NS
Charadrahyla taeniopus* CE M (13) VU A
Dendropsophus ebraccatus NE6 M (12) LC NS
Dendropsophus microcephalus NE6 L (7) LG NS
Dryophytes arenicolor NE3 L (7) Le NS
Dryophytes euphorbiaceus* CE M (13) NT NS
Dryophytes eximius* CE M (10) Le NS
Dryophytes plicatus* CE M (11) LG A
Duellmanohyla chamulae* CE M (13) EN Pr
Ecnomiohyla valancifer** SE H (18) Cre PE
Exerodonta bivocata* CE H (15) DD NS
Megastomatohyla mixomaculata* CE H (14) EN A
Megastomatohyla nubicola** SE H (14) EN A
Amphib. Reptile Conserv. 102 September 2021 | Volume 15 | Number 2 | e285
Torres-Hernandez et al.
Table 8 (continued). Distributional and conservation status measures for members of the herpetofauna of Veracruz, Mexico.
Distributional Status: CE = endemic to country of Mexico; SE = endemic to state of Veracruz; NE = not endemic to state or country;
and NN = non-native. The numbers suffixed to the NE category signify the distributional categories developed by Wilson et al.
(2017) and implemented in the taxonomic list at the Mesoamerican Herpetology website (http://www.mesoamericanherpetology.
com), as follows: 3 = species distributed only in Mexico and the United States; 4 = species found only in Mexico and Central
America; 6 = species ranging from Mexico to South America; 7 = species ranging from the United States to Central America; 8 =
species ranging from the United States to South America; and 9 = Oceanic species. Environmental Vulnerability Scores (taken from
Wilson et al. 2013a,b): low (L) vulnerability species (EVS 3-9); medium (M) vulnerability species (EVS 10-13); and high (H)
vulnerability species (EVS 14-19). IUCN categorization: CR = Critically Endangered; EN = Endangered; VU = Vulnerable; NT =
Near Threatened; LC = Least Concern; DD = Data Deficient; and NE = Not Evaluated. SEMARNAT Status: A = Threatened; P =
Endangered; Pr = Special Protection; and NS = No Status. See Alvarado-Diaz et al. (2013), Johnson et al. (2015a), and Mata-Silva
et al. (2015) for explanations of the EVS, IUCN, and SEMARNAT rating systems.
Distributional onli eae IUCN SEMARNAT
Taxon Vulnerability th
status Category (score) categorization status
gory
Ptychohyla zophodes* CE M (13) DD NS
Ouilticohyla zoque* CE H (14) NE NS
Rheohyla miotympanum* CE L(9) NT NS
Sarcohyla arborescandens* CE M (11) EN Pe
Sarcohyla bistincta* CE L (9) Le Pr
Sarcohyla pachyderma** SE H (15) CR Pr
Sarcohyla siopela* CE H (15) CR NS
Scinax staufferi NE4 L (4) LC NS
Smilisca baudinii NE7 L(3) Ee NS
Smilisca cyanosticta NE4 M (12) NT NS
Tlalocohyla godmani* CE, M (13) VU A
Tlalocohyla loquax NE4 L(7) Le NS
Tlalocohyla picta NE4 L (8) LG NS
Trachycephalus vermiculatus NE6 L (4) LG NS
Triprion spinosus NE4 H (15) Le NS
Engystomops pustulosus NE6 L (7) Le NS
Leptodactylus fragilis NE8 L (5) LC NS
Leptodactylus melanonotus NE6 L (6) LC NS
Gastrophryne elegans NE4 L (8) LC Pr
Hypopachus ustus NE4 L (7) LE Pr
Hypopachus variolosus NE7 L (4) LC NS
Agalychnis taylori NE6 M (11) LG NS
Agalychnis moreletii NE4 L (7) CR NS
Lithobates berlandieri NE3 L-C) Le Pr
Lithobates brownorum NE4 L (8) NE Pr
Lithobates catesbeianus*** NN — — —
Lithobates johni* CE H (14) EN P
Lithobates maculatus NE4 LS) Le NS
Lithobates montezumae* CE M (13) LC Pr
Lithobates spectabilis* CE M (12) Le NS
Lithobates vaillanti NE6 L(Q) LG NS
Rhinophrynus dorsalis NE7 L (8) Le Pr
Scaphiopus couchii NE3 L (3) LE. NS
Spea multiplicata NE3 L (6) LG NS
Ambystoma velasci* CE M (10) LG Pr
Aquiloeurycea cafetalera* CE H (17) NE NS
Aquiloeurycea cephalica* CE H (14) L¢ A
Aquiloeurycea praecellens** SE H (18) CR A
Bolitoglossa alberchi* CE H (15) VU NS
Bolitoglossa mexicana NE4 M (11) IBS) Pr
Bolitoglossa occidentalis NE4 M (11) LG. Pr
Bolitoglossa platydactyla* CE H (15) LG PE
Amphib. Reptile Conserv. 103 September 2021 | Volume 15 | Number 2 | e285
The herpetofauna of Veracruz, Mexico
Table 8 (continued). Distributional and conservation status measures for members of the herpetofauna of Veracruz, Mexico.
Distributional Status: CE = endemic to country of Mexico; SE = endemic to state of Veracruz; NE = not endemic to state or country;
and NN = non-native. The numbers suffixed to the NE category signify the distributional categories developed by Wilson et al.
(2017) and implemented in the taxonomic list at the Mesoamerican Herpetology website (http://www.mesoamericanherpetology.
com), as follows: 3 = species distributed only in Mexico and the United States; 4 = species found only in Mexico and Central
America; 6 = species ranging from Mexico to South America; 7 = species ranging from the United States to Central America; 8 =
species ranging from the United States to South America; and 9 = Oceanic species. Environmental Vulnerability Scores (taken from
Wilson et al. 2013a,b): low (L) vulnerability species (EVS 3-9); medium (M) vulnerability species (EVS 10-13); and high (H)
vulnerability species (EVS 14-19). IUCN categorization: CR = Critically Endangered; EN = Endangered; VU = Vulnerable; NT =
Near Threatened; LC = Least Concern; DD = Data Deficient; and NE = Not Evaluated. SEMARNAT Status: A = Threatened; P =
Endangered; Pr = Special Protection; and NS = No Status. See Alvarado-Diaz et al. (2013), Johnson et al. (2015a), and Mata-Silva
et al. (2015) for explanations of the EVS, IUCN, and SEMARNAT rating systems.
: Distributional fuveninene IUCN SEMARNAT
a status oe asset eae categorization status
ategory (score)
Bolitoglossa rufescens NE4 L(9) Le Pr
Bolitoglossa veracrucis* CE H (17) EN PE
Chiropterotriton aureus** SE H (18) CR NS
Chiropterotriton casasi** SE H (18) CR (provisional) NS
Chiropterotriton ceronorum* CE H (17) CR (provisional) NS
Chiropterotriton chiropterus* CE H (16) CR Pr
Chiropterotriton chondrostega* CE H (17) EN Pi
Chiropterotriton lavae** SE H (18) CR Pr
Chiropterotriton nubilus** SE H (18) CR NS
Chiropterotriton perotensis** SE H (18) EN (provisional) NS
Chiropterotriton totonacus** SE H (18) CR (provisional) NS
Chiropterotriton terrestris* CE H (18) CR NS
Isthmura corrugata** SE H (18) CR NS
Isthmura gigantea* CE H (16) CR NS
Isthmura naucampatepetl** SE H (17) CR NS
Parvimolge townsendi** SE H (16) CR A
Pseudoeurycea firscheini* CE H (18) EN Pr
Pseudoeurycea gadovii* CE M (13) VU Pr
Pseudoeurycea granitum** SE H (16) EN NS
Pseudoeurycea leprosa* CE H (16) Le A
Pseudoeurycea lineola** SE H (14) EN Pr
Pseudoeurycea lynchi* CE H (17) EN NS
Pseudoeurycea melanomolga* CE H (16) EN Pr
Pseudoeurycea nigromaculata** SE H (17) EN Pr
Pseudoeurycea orchimelas** SE H (17) EN NS
Pseudoeurycea werleri* CE H (17) EN Pr
Thorius dubitus* CE H (16) CR Pr
Thorius lunaris** SE H (18) CR NS
Thorius magnipes** SE H (17) CR NS
Thorius minydemus** SE H (18) EN NS
Thorius munificus** SE H (18) CR NS
Thorius narismagnus** SE H (18) CR NS
Thorius pennatulus** SE H (15) EN Pr
Thorius spilogaster** SE H (17) CR NS
Thorius troglodytes ** SE H (16) EN Pr
Notophthalmus meridionalis NE3 M (12) EN FP
Siren intermedia NE3 M (12) LC A
Dermophis mexicanus NE4 M (11) LC Pr
Crocodylus moreletii NE4 M (13) LG Pr
Abronia chiszari** SE H (17) EN P.
Abronia graminea* CE H (15) EN A
Abronia reidi** SE H (18) DD P
Amphib. Reptile Conserv. 104 September 2021 | Volume 15 | Number 2 | e285
Torres-Hernandez et al.
Table 8 (continued). Distributional and conservation status measures for members of the herpetofauna of Veracruz, Mexico.
Distributional Status: CE = endemic to country of Mexico; SE = endemic to state of Veracruz; NE = not endemic to state or country;
and NN = non-native. The numbers suffixed to the NE category signify the distributional categories developed by Wilson et al.
(2017) and implemented in the taxonomic list at the Mesoamerican Herpetology website (http://www.mesoamericanherpetology.
com), as follows: 3 = species distributed only in Mexico and the United States; 4 = species found only in Mexico and Central
America; 6 = species ranging from Mexico to South America; 7 = species ranging from the United States to Central America; 8 =
species ranging from the United States to South America; and 9 = Oceanic species. Environmental Vulnerability Scores (taken from
Wilson et al. 2013a,b): low (L) vulnerability species (EVS 3-9); medium (M) vulnerability species (EVS 10-13); and high (H)
vulnerability species (EVS 14-19). IUCN categorization: CR = Critically Endangered; EN = Endangered; VU = Vulnerable; NT =
Near Threatened; LC = Least Concern; DD = Data Deficient; and NE = Not Evaluated. SEMARNAT Status: A = Threatened; P =
Endangered; Pr = Special Protection; and NS = No Status. See Alvarado-Diaz et al. (2013), Johnson et al. (2015a), and Mata-Silva
et al. (2015) for explanations of the EVS, IUCN, and SEMARNAT rating systems.
Distributional onli ease IUCN SEMARNAT
Taxon Vulnerability th
status Category (score) categorization status
gory
Abronia taeniata* CE H (15) VU Pr
Barisia imbricata* CE H (14) EC Pr
Gerrhonotus liocephalus NE3 L (6) LC Pr
Gerrhonotus ophiurus* CE M (12) LC NS
Mesaspis antauges** SE H (16) DD Pr
Ophisaurus ceroni** SE H (14) EN A
Ophisaurus incomptus* CE H (15) NE P
Basiliscus vittatus NE4 L(7) LC NS
Corytophanes hernandesii NE4 M (13) L€ Pr
Laemanctus longipes NE4 L(9) NE PE
Laemanctus serratus NE4 L (8) Le Pr
Norops alvarezdeltoroi* CE H (17) DD NS
Norops barkeri* CE H (15) VU Pr
Norops beckeri NE4 M (12) NE NS
Norops biporcatus NE6 M (10) NE Br
Norops compressicauda* CE H (15) Le, NS
Norops cymbops* CE H (17) DD A
Norops duellmani** SE H (17) DD Pr
Norops laeviventris NE4 L (9) NE NS
Norops lemurinus NE4 L (8) NE NS
Norops naufragus* CE M (13) VU Pr
Norops petersii NE4 L(9) NE NS
Norops purpuronectes* CE H (16) NE NS
Norops rodriguezii NE4 M (10) NE NS
Norops sagrei*** NN — — —
Norops schiedii** SE H (16) DD Pr
Norops sericeus NE4 L (8) NE NS
Norops tropidonotus NE4 LQ) NE NS
Norops uniformis NE4 M (13) NE NS
Anelytropsis papillosus* CE M (10) Le A
Celestus enneagrammus* CE H (14) LG Pr
Celestus ingridae** SE H (17) DD NS
Celestus legnotus* CE H (14) LE. NS
Celestus rozellae NE4 M (13) NT Pr
Coleonyx elegans NE4 Ae) LG A
Hemidactylus frenatus*** NN — — —
Hemidactylus mabouia*** NN — — —
Hemidactylus turcicus*** NN — — —
Ctenosaura acanthura NE4 M (12) NE Pr
Iguana iguana NE6 M (12) NE Pr
Marisora lineola NE4 M (10) NE NS
Holbrookia propinqua NE3 H (15) LC NS
Amphib. Reptile Conserv. 105 September 2021 | Volume 15 | Number 2 | e285
The herpetofauna of Veracruz, Mexico
Table 8 (continued). Distributional and conservation status measures for members of the herpetofauna of Veracruz, Mexico.
Distributional Status: CE = endemic to country of Mexico; SE = endemic to state of Veracruz; NE = not endemic to state or country;
and NN = non-native. The numbers suffixed to the NE category signify the distributional categories developed by Wilson et al.
(2017) and implemented in the taxonomic list at the Mesoamerican Herpetology website (http://www.mesoamericanherpetology.
com), as follows: 3 = species distributed only in Mexico and the United States; 4 = species found only in Mexico and Central
America; 6 = species ranging from Mexico to South America; 7 = species ranging from the United States to Central America; 8 =
species ranging from the United States to South America; and 9 = Oceanic species. Environmental Vulnerability Scores (taken from
Wilson et al. 2013a,b): low (L) vulnerability species (EVS 3-9); medium (M) vulnerability species (EVS 10-13); and high (H)
vulnerability species (EVS 14-19). IUCN categorization: CR = Critically Endangered; EN = Endangered; VU = Vulnerable; NT =
Near Threatened; LC = Least Concern; DD = Data Deficient; and NE = Not Evaluated. SEMARNAT Status: A = Threatened; P =
Endangered; Pr = Special Protection; and NS = No Status. See Alvarado-Diaz et al. (2013), Johnson et al. (2015a), and Mata-Silva
et al. (2015) for explanations of the EVS, IUCN, and SEMARNAT rating systems.
Distributional nba ease IUCN SEMARNAT
Taxon Vulnerability Mille
status Category (score) categorization status
gory
Phrynosoma braconnieri* CE H (15) LC Pr
Phrynosoma orbiculare* CE M (12) EC A
Sceloporus aeneus* CE M (13) Le NS
Sceloporus aureolus* CE H (15) NE NS
Sceloporus bicanthalis* CE M (13) LC NS
Sceloporus cyanogenys NE3 M (13) NE NS
Sceloporus formosus* CE H (15) BC NS
Sceloporus grammicus NE3 L(Y) Le Pr
Sceloporus internasalis NE4 M (11) Ee NS
Sceloporus jalapae* CE M (13) LG NS
Sceloporus megalepidurus* CE, H (14) VU Pr
Sceloporus mucronatus* CE M (13) Le NS
Sceloporus salvini* CE H (15) DD A
Sceloporus scalaris* CE M (12) LG. NS
Sceloporus serrifer NE4 L (6) Le NS
Sceloporus spinosus* CE M (12) L€, NS
Sceloporus teapensis NE4 M (13) LEC NS
Sceloporus torquatus* CE M (11) nS NS
Sceloporus variabilis NE4 LG) | NS
Plestiodon brevirostris* CE M (11) Le NS
Plestiodon copei* CE H (14) LC Pr
Plestiodon lynxe* CE M (10) LC Pr
Plestiodon sumichrasti NE4 M (12) NE NS
Plestiodon tetragrammus NE3 M (12) LG NS
Gonatodes albogularis NE6 M (11) NE Pr
Sphaerodactylus glaucus NE4 M (12) Le Pr
Scincella cherriei NE4 L (8) NE NS
Scincella gemmingeri* CE M (11) LG Pr
Scincella silvicola* CE M (12) LC A
Aspidoscelis costata* CE M (11) Le Pr
Aspidoscelis deppii NE4 L (8) LG NS
Aspidoscelis gularis NE3 L(9) Le NS
Aspidoscelis guttatus* CE M (12) LE. NS
Holcosus amphigrammus* CE M (11) NE NS
Lepidophyma flavimaculatum NE4 L (8) LG Pr
Lepidophyma pajapanense* CE M (13) LC Pi;
Lepidophyma sylvaticum* CE M (11) LC Pr
Lepidophyma tuxtlae* CE M (11) DD A
Lepidophyma zongolica* CE H (16) NE NS
Xenosaurus grandis* CE 169) VU Pr
Xenosaurus rectocollaris* CE H (16) LC NS
Xenosaurus tzacualtipantecus* CE H (17) NE NS
Amphib. Reptile Conserv. 106 September 2021 | Volume 15 | Number 2 | e285
Torres-Hernandez et al.
Table 8 (continued). Distributional and conservation status measures for members of the herpetofauna of Veracruz, Mexico.
Distributional Status: CE = endemic to country of Mexico; SE = endemic to state of Veracruz; NE = not endemic to state or country;
and NN = non-native. The numbers suffixed to the NE category signify the distributional categories developed by Wilson et al.
(2017) and implemented in the taxonomic list at the Mesoamerican Herpetology website (http://www.mesoamericanherpetology.
com), as follows: 3 = species distributed only in Mexico and the United States; 4 = species found only in Mexico and Central
America; 6 = species ranging from Mexico to South America; 7 = species ranging from the United States to Central America; 8 =
species ranging from the United States to South America; and 9 = Oceanic species. Environmental Vulnerability Scores (taken from
Wilson et al. 2013a,b): low (L) vulnerability species (EVS 3-9); medium (M) vulnerability species (EVS 10-13); and high (H)
vulnerability species (EVS 14-19). IUCN categorization: CR = Critically Endangered; EN = Endangered; VU = Vulnerable; NT =
Near Threatened; LC = Least Concern; DD = Data Deficient; and NE = Not Evaluated. SEMARNAT Status: A = Threatened; P =
Endangered; Pr = Special Protection; and NS = No Status. See Alvarado-Diaz et al. (2013), Johnson et al. (2015a), and Mata-Silva
et al. (2015) for explanations of the EVS, IUCN, and SEMARNAT rating systems.
Environmental
Distributional cis IUCN SEMARNAT
Taxon Vulnerability wh
status categorization status
Category (score)
Boa imperator NE6 M (10) NE NS
Coluber constrictor NE7 M (10) LG A
Conopsis acuta* CE H (14) NE NS
Conopsis lineata* CE M (13) LC NS
Conopsis nasus* CE M (11) Le NS
Dendrophidion vinitor NE4 M (13) Le NS
Drymarcon melanurus NE6 L (6) Ee NS
Drymobius chloroticus NE4 L (8) Le NS
Drymobius margaritiferus NE8 L (6) NE NS
Ficimia olivacea* CE L(Y) NE NS
Ficimia publia NE4 L(Y) NE NS
Ficimia streckeri NE3 M (12) Le NS
Ficimia variegata* GE H (14) DD NS
Lampropeltis polyzona NE6 L (8) NE NS
Lampropeltis triangulum NE3 L (9) NE A
Leptophis ahaetulla NE6 M (10) NE Pr
Leptophis mexicanus NE4 L (6) Le A
Masticophis flagellum NE3 L (8) LG A
Masticophis mentovarius NE6 L (6) Le A
Masticophis schotti NE3 M (13) Le NS
Mastigodryas melanolomus NE4 L (6) Le NS
Oxybelis aeneus NE8 L (5) NE NS
Oxybelis fulgidus NE6 L (9) NE NS
Pantherophis emoryi NE3 M (13) LC NS
Phrynonax poecilonotus NE6 M (10) LC NS
Pituophis deppei* CE H (14) Le A
Pituophis lineaticollis NE4 L (8) EC NS
Pseudelaphe flavirufa NE4 M (10) LC NS
Salvadora bairdi* CE H (15) LC Pr
Salvadora grahamiae NE3 M (10) LC NS
Senticolis triaspis NE7 L (6) Le NS
Spilotes pullatus NE6 L (6) NE NS
Stenorrhina degenhardtii NE6 L (9) NE NS
Stenorrhina freminvillii NE4 L(7) NE NS
Tantilla bocourti* CE L(Y) Le NS
Tantilla rubra NE4 E33 BC Pr
Tantilla schistosa NE4 L (8) LC NS
Tantilla shawi* CE H (15) EN Pr
Tantilla slavensi** SE H (14) DD Pr
Tantillita lintoni NE4 M (12) EC Pr
Trimorphodon biscutatus NE4 L(7) NE NS
Trimoprhodon tau* CE M (13) LG NS
Amphib. Reptile Conserv. 107 September 2021 | Volume 15 | Number 2 | e285
The herpetofauna of Veracruz, Mexico
Table 8 (continued). Distributional and conservation status measures for members of the herpetofauna of Veracruz, Mexico.
Distributional Status: CE = endemic to country of Mexico; SE = endemic to state of Veracruz; NE = not endemic to state or country;
and NN = non-native. The numbers suffixed to the NE category signify the distributional categories developed by Wilson et al.
(2017) and implemented in the taxonomic list at the Mesoamerican Herpetology website (http://www.mesoamericanherpetology.
com), as follows: 3 = species distributed only in Mexico and the United States; 4 = species found only in Mexico and Central
America; 6 = species ranging from Mexico to South America; 7 = species ranging from the United States to Central America; 8 =
species ranging from the United States to South America; and 9 = Oceanic species. Environmental Vulnerability Scores (taken from
Wilson et al. 2013a,b): low (L) vulnerability species (EVS 3-9); medium (M) vulnerability species (EVS 10-13); and high (H)
vulnerability species (EVS 14-19). IUCN categorization: CR = Critically Endangered; EN = Endangered; VU = Vulnerable; NT =
Near Threatened; LC = Least Concern; DD = Data Deficient; and NE = Not Evaluated. SEMARNAT Status: A = Threatened; P =
Endangered; Pr = Special Protection; and NS = No Status. See Alvarado-Diaz et al. (2013), Johnson et al. (2015a), and Mata-Silva
et al. (2015) for explanations of the EVS, IUCN, and SEMARNAT rating systems.
Distributional puveronmnental IUCN SEMARNAT
Taxon Vulnerability eRe
status Category (score) categorization status
gory
Adelphicos quadrivirgatum NE4 M (10) 1G Pr
Adelphicos visoninum NE4 L (8) LAS NS
Amastridium sapperi NE4 M (10) NE NS
Chersodromus liebmanni* CE M (12) LC Pr
Clelia scytalina NE4 M (13) NE NS
Coniophanes bipunctatus NE4 LQ) Le NS
Coniophanes fissidens NE6 L4) NE NS
Coniophanes imperialis NE7 L (8) Le NS
Coniophanes quinquevittatus NE4 M (13) LC NS
Coniophanes taeniatus* CE H (15) NE NS
Conophis lineatus NE4 (9) 1G NS
Conophis morai** SE H (17) DD NS
Diadophis punctatus NE3 L (4) LC NS
Geophis bicolor* CE H (15) DD Pr
Geophis blanchardi* CE H (15) DD Pr
Geophis carinosus NE4 L (8) Le NS
Geophis chalybeus** SE H (15) DD Pr
Geophis juliai** SE M (13) VU NS
Geophis lorancai* CE H (14) NE NS
Geophis mutitorques* CE M (13) 1G Pr
Geophis semidoliatus* CE M (13) Le NS
Imantodes cenchoa NE6 L (6) NE Pr
Imantodes gemmistratus NE6 L (6) NE PE
Leptodeira frenata NE4 M (12) Le NS
Leptodeira maculata NE4 L(7) LC Pr
Leptodeira polysticta NE4 L (8) NE NS
Leptodeira septentrionalis NE8 L (8) NE NS
Ninia diademata NE4 L(Y) Le NS
Ninia sebae NE4 L (4) Lie NS
Oxyrhopus petolarius NE6 H (14) NE NS
Pliocercus elapoides NE4 M (10) LC NS
Rhadinaea cuneata* CE H (15) DD Pr
Rhadinaea decorata NE6 L(Y) LE NS
Rhadinaea forbesi** SE H (15) DD Pr
Rhadinaea fulvivittis* CE M (11) VU NS
Rhadinaea macdougalli* CE M (12) DD Pr
Rhadinaea marcellae* CE M (12) EN Pr
Rhadinaea quinquelineata* CE H (15) DD Pr
Rhadinella schistosa* CE M (13) LG NS
Sibon dimidiatus NE4 M (10) Le, NS
Sibon linearis** SE H (16) DD NS
Sibon nebulatus NE6 L (5) NE NS
Amphib. Reptile Conserv. 108 September 2021 | Volume 15 | Number 2 | e285
Torres-Hernandez et al.
Table 8 (continued). Distributional and conservation status measures for members of the herpetofauna of Veracruz, Mexico.
Distributional Status: CE = endemic to country of Mexico; SE = endemic to state of Veracruz; NE = not endemic to state or country;
and NN = non-native. The numbers suffixed to the NE category signify the distributional categories developed by Wilson et al.
(2017) and implemented in the taxonomic list at the Mesoamerican Herpetology website (http://www.mesoamericanherpetology.
com), as follows: 3 = species distributed only in Mexico and the United States; 4 = species found only in Mexico and Central
America; 6 = species ranging from Mexico to South America; 7 = species ranging from the United States to Central America; 8 =
species ranging from the United States to South America; and 9 = Oceanic species. Environmental Vulnerability Scores (taken from
Wilson et al. 2013a,b): low (L) vulnerability species (EVS 3-9); medium (M) vulnerability species (EVS 10-13); and high (H)
vulnerability species (EVS 14-19). IUCN categorization: CR = Critically Endangered; EN = Endangered; VU = Vulnerable; NT =
Near Threatened; LC = Least Concern; DD = Data Deficient; and NE = Not Evaluated. SEMARNAT Status: A = Threatened; P =
Endangered; Pr = Special Protection; and NS = No Status. See Alvarado-Diaz et al. (2013), Johnson et al. (2015a), and Mata-Silva
et al. (2015) for explanations of the EVS, IUCN, and SEMARNAT rating systems.
Distributional onli eae IUCN SEMARNAT
Taxon Vulnerability th
status Category (score) categorization status
gory
Tretanorhinus nigroluteus NE4 M (10) NE NS
Tropidodipsas fasciata NE4 M (13) NE NS
Tropidodipsas sartorii NE4 L(9) LC Pr
Xenodon rabdocephalus NE6 M (13) NE NS
Micrurus diastema* CE L (8) Le Pr
Micrurus elegans NE4 M (13) LG Pr
Micrurus limbatus** SE H (17) EO PT
Micrurus tener NE3 M (11) Le NS
Epictia phenops NE4 L (6) NE NS
Epictia resetari* CE M (13) NE NS
Rena dulcis NE3 M (13) Le NS
Rena myopica* CE M (13) LC NS
Nerodia rhombifer NE3 M (10) Le NS
Storeria dekayi NE7 L (7) ke NS
Storeria storerioides* CE M (11) Le NS
Thamnophis chrysocephalus* CE H (14) LC A
Thamnophis conanti* CE H (17) NE NS
Thamnophis cyrtopsis NE7 L(7) EG A
Thamnophis eques NE3 L (8) LC A
Thamnophis godmani* CE H (14) Le A
Thamnophis marcianus NE7 M (10) NE A
Thamnophis proximus NE7 L (7) NE A
Thamnophis pulchrilatus* CE H (15) LC NS
Thamnophis scalaris* CE H (14) Le A
Thamnophis scaliger* CE H (15) VU A
Thamnophis sumichrasti* CE H (15) Le A
Scaphiodontophis annulatus NE4 M (11) NE NS
Amerotyphlops tenuis NE4 M (11) LC NS
Virgotyphlops braminus*** NN — — —=
Agkistrodon taylori* CE H (17) LC A
Bothrops asper NE6 M (12) NE NS
Cerrophidion petlalcalensis* CE H (18) DD NS
Crotalus aquilus* CE H (16) LE. PE
Crotalus atrox NE3 L (9) EG Pr
Crotalus intermedius* CE H (15) LG A
Crotalus mictlantecuhtli** SE H (16) NE NS
Crotalus molossus NE3 L (8) LC Pr
Crotalus polystictus* CE H (16) LC Pr
Crotalus ravus* CE H (14) LG A
Crotalus scutulatus NE3 M (11) Le Pr
Crotalus totonacus* CE H (17) NE NS
Crotalus triseriatus* CE H (16) LG NS
Amphib. Reptile Conserv. 109 September 2021 | Volume 15 | Number 2 | e285
The herpetofauna of Veracruz, Mexico
Table 8 (continued). Distributional and conservation status measures for members of the herpetofauna of Veracruz, Mexico.
Distributional Status: CE = endemic to country of Mexico; SE = endemic to state of Veracruz; NE = not endemic to state or country;
and NN = non-native. The numbers suffixed to the NE category signify the distributional categories developed by Wilson et al.
(2017) and implemented in the taxonomic list at the Mesoamerican Herpetology website (http://www.mesoamericanherpetology.
com), as follows: 3 = species distributed only in Mexico and the United States; 4 = species found only in Mexico and Central
America; 6 = species ranging from Mexico to South America; 7 = species ranging from the United States to Central America; 8 =
Species ranging from the United States to South America; and 9 = Oceanic species. Environmental Vulnerability Scores (taken from
Wilson et al. 2013a,b): low (L) vulnerability species (EVS 3-9); medium (M) vulnerability species (EVS 10-13); and high (H)
vulnerability species (EVS 14-19). IUCN categorization: CR = Critically Endangered; EN = Endangered; VU = Vulnerable; NT =
Near Threatened; LC = Least Concern; DD = Data Deficient; and NE = Not Evaluated. SEMARNAT Status: A = Threatened; P =
Endangered; Pr = Special Protection; and NS = No Status. See Alvarado-Diaz et al. (2013), Johnson et al. (2015a), and Mata-Silva
et al. (2015) for explanations of the EVS, IUCN, and SEMARNAT rating systems.
Environmental
Distributional aes IUCN SEMARNAT
Taxon Vulnerability ae
status Category (score) categorization status
gory
Metlapilcoatlus nummifer* CE M (13) 1G A
Metlapilcoatlus olmec NE4 H (15) LG A
Ophryacus smaragdinus* CE H (14) NE NS
Ophryacus undulatus* CE H (15) VU Pr
Caretta caretta NE9 — EN P
Chelonia mydas NE9 — EN jt
Eretmochelys imbricata NE9 — CR P.
Lepidochelys kempii NE9 — CR FP,
Chelydra rossignonii NE4 H (17) VU NS
Dermatemys mawii NE4 H (17) CR P
Dermochelys coriacea NE9 — VU 1
Terrapene mexicana* CE H (19) NE NS
Trachemys scripta*** NN — — —
Trachemys venusta NE6 H (19) VU NS
Rhinoclemmys areolata NE4 M (13) NT A
Kinosternon acutum NE4 H (14) NT Pr
Kinosternon flavescens NE3 M (12) LE NS
Kinosternon herrerai* CE H (14) NT Pr
Kinosternon leucostomum NE6 M (10) NE Pr
Kinosternon scorpioides NE6 M (10) NE Pr
Claudius angustatus NE4 H (14) NT P
Staurotypus triporcatus NE4 H (14) NT A
Gopherus berlandieri NE3 H (18) BG. A
state herpetofaunas, the largest number of species lies
in the country endemic category, including Michoacan
(Alvarado-Diaz et al. 2013), Nayarit (Woolrich-Pifia
et al. 2016), Jalisco (Cruz-Saenz et al. 2017), Puebla
(Woolrich-Pifia et al. 2017), and Hidalgo (Ramirez-
Bautista et al. 2020).
In the 11 previous MCS entries, the numbers of state
endemic species vary significantly from one in Nayarit
and Nuevo Leon (Woolrich-Pifia et al. 2016; Nevarez-
de los Reyes et al. 2016, respectively) to 93 in Oaxaca
(Mata-Silva et al. 2015). The number of state endemics
in Veracruz lies below the mid-point in this range at 44
(Table 9). Half of these 44 species (22) are plethodontid
salamanders of the genera Aquiloeurycea (one species),
Chiropterotriton (six), Isthmura (two), Parvimolge
(one), Pseudoeurycea (four), and Thorius (eight). The
remaining species are anurans (Seven species) and
squamates (15).
Amphib. Reptile Conserv.
As noted above, in some cases in the MCS the
number of non-endemic species exceeds that of the
country endemics, whereas in other cases the situation
is reversed. So, the ratio of non-endemics to country
endemics varies considerably. The ratios in which the
number of non-endemic species exceeds that of the
country endemic species range from 1.12 in the case of
Oaxaca (Mata-Silva et al. 2015) to 127.0 in the Yucatan
Peninsula (Gonzalez-Sanchez et al. 2017). The ratios in
which the number of country endemic species supersedes
that of the non-endemics vary from 0.53 in the case of
Jalisco to 0.88 in Hidalgo. As expected, the nature of
this ratio depends on the proximity of the given Mexican
state or region to either the USA or to Central America.
In the case of the three MCS states that border the USA,
the ratios are 3.22 (100/31 in Coahuila; Lazcano et al.
2019), 2.44 (95/39 in Nuevo Leon; Nevarez-de los Reyes
et al. 2016), and 2.43 (119/49 in Tamaulipas; Teran-
September 2021 | Volume 15 | Number 2 | e285
Torres-Hernandez et al.
~ ty
wy
f Ve
— +z a Ae, = ws
. f a «3 . shied ~~ Lo” 2
No. 33. Leptodeira maculata (Hallowell, 1861). The Banded
Cat-eyed Snake is a non-endemic species distributed from
southern Tamaulipas along the Atlantic versant and from
southern Sinaloa on the Pacific versant southward to Chiapas
and western Guatemala (Daza et al. 2009). This individual
was located at Jonotal, in the municipality of Las Vigas
de Ramirez. Wilson et al. (2013b) calculated its EVS as 7,
placing it in the middle of the low vulnerability category. Its
conservation status has been assessed as Least Concern by the
IUCN, and as Special Protection (Pr) by SEMARNAT. Photo
by Christian Berriozabal-Islas.
No. 35. Bothrops asper (Garman, 1883). The Terciopelo is a
non-endemic snake ranging from southwestern Tamaulipas to
coastal Venezuela on the Atlantic versant, and from Costa Rica
to southern Ecuador on the Pacific versant, with a disjunct
population occurring in southern Chiapas and adjacent
Guatemala (Lemos-Espinal and Dixon 2013). This individual
was found at Los Tuxtlas, in the municipality of San Andrés
Tuxtla. Wilson et al. (2013b) determined its EVS as 12, placing
it in the upper portion of the medium vulnerability category.
Its conservation status has not been determined by either the
IUCN or SEMARNAT. Photo by Christian Berriozabal-Islas.
Amphib. Reptile Conserv.
No. 34. Pliocercus elapoides (Cope, 1860). The Variegated
False Coralsnake is a non-endemic species occurring at
low and moderate elevations (up to about 2,000 m) on the
Atlantic slope from southern Tamaulipas, and on the Pacific
from western Oaxaca, southward to western Honduras and
El Salvador. In the Yucatan Peninsula, the species is known
only from the base, in the south, and from the north (Heimes
2016). This individual was encountered at Los Tuxtlas, in
the municipality of San Andrés Tuxtla. Wilson et al. (2013b)
determined its EVS as 10, placing it in the lower portion of
the medium vulnerability category. Its conservation status has
been assessed as Least Concern by the IUCN, and this species
is not listed by SEMARNAT. Photo by Eli Garcia-Padilla.
Torre-Loranca, 1999. The Cerro Petlalcala Montane Pitviper
is a country endemic species ranging at the type locality in the
Cerro Petlalcala, in west-central Veracruz at elevations from
2,100 to 2,300 m (Lopez-Luna et al. 1999). This species also is
known from the municipalities of Atlahuilco, Los Reyes, and
Tequila in Veracruz, and in Oaxaca from the Sierra Mazateca
(De La Torre-Loranca et al. 2019). This individual was found
at San Andrés Tenejapan, in the municipality of the same
name. Wilson et al. (2013b) calculated its EVS at 18, placing
it in the upper portion of the high vulnerability category. Its
conservation status has been assessed as Data Deficient by the
IUCN, and this species is not listed by SEMARNAT. Photo by
René Avalos-Vela.
September 2021 | Volume 15 | Number 2 | e285
The herpetofauna of Veracruz, Mexico
Table 9. Summary of the distributional status of herpetofaunal families in Veracruz, Mexico.
Distributional status
Number
Famuly ot Non-endemic Country State Non-native
Da (NE) Endemic (CE) — Endemic (SE) (NN)
Bufonidae 9 4 4 1
Centrolenidae 1 1 = —- —
Craugastoridae 1] 4 5 2 —
Eleutherodactylidae f: 2 3 1 1
Hylidae 29 10 16 3 —
Leptodactylidae 3 3 — — —
Microhylidae 3 3 a —
Phyllomedusidae 2 2 — —
Ranidae 8 4 3 — 1
Rhinophrynidae 1 1 —- —-
Scaphiopodidae 2 2 — —
Subtotal 76 36 31 7 2
Ambystomatidae l — l —-
Plethodontidae 42 3 17 22 —
Salamandridae 1 1 = ~—
Sirenidae 1 1 — — —
Subtotal 45 5 18 ppl —
Dermophiidae 1 1 — — —
Subtotal 1 1 — —
Total 122 42 49 29 2
Crocodylidae l 1 -— -—-
Subtotal 1 1 “= — —
Anguidae 10 | 5 4
Corytophanidae 4 4 — —
Dactyloidae 18 9 6 2 1
Dibamidae l — 1 - —
Diploglossidae 4 1 2 1 —
Eublepharidae 1 1 _— — —
Gekkonidae 3 — — -- 3
Iguanidae 2 2 — — —
Mabuyidae l 1 ~- — _
Phrynosomatidae 20 7 13 — —
Scincidae 5 2 3 — —
Sphaerodactylidae 2 2 —- —- _—-
Sphenomorphidae 3 1 2 — —
Tetidae 5 2 3 -— —
Xantusiidae 5 1 4 — _-
Xenosauridae 3 — 5 — —
Subtotal 87 34 42 “i 4
Boidae 1 1 — — —
Colubridae 4] 30 10 1 —
Dipsadidae 46 28 13 5 —
Elapidae 4 2 1 1 —
Leptotyphlopidae 4 2 2. — —-
Natricidae 14 6 8 _-
Sibynophiidae 1 1 — — —
Typhlopidae 2 l — — l
Viperidae 17 5 11 1 —
Subtotal 130 76 45 8 1
Cheloniidae 4 4 —— -— —
Chelydridae 1 1 — —
Dermatemyidae 1 1 ~- — —
Dermochelyidae 1 1 ~- ~- —
Emydidae 3 1 l _- l
Geoemydidae l | — — —
Kinosternidae 5 4 1 — —
Staurotypidae 2 @ — — —
Testudinidae 1 1 = — —
Subtotal 19 16 2 _- 1
Total 237 Ae. 89 15 6
Sum total 359 169 138 44 8
Amphib. Reptile Conserv. 112 September 2021 | Volume 15 | Number 2 | e285
Torres-Hernandez et al.
Table 10. Summary of the distributional categories of the herpetofaunal families which include non-endemic species in Veracruz,
Mexico. The categorizations are: MXUS = species distributed only in Mexico and the United States (except perhaps for a few also
found in Canada); MXCA = species found only in Mexico and Central America; MXSA = species ranging from Mexico to South
America; USCA = species ranging from the United States to Central America (except perhaps for a few also found in the Antilles);
and USSA = species ranging from the United States to South America.
Distributional status
Famil RU AGRO Me
y endemic species MXUS MXCA MXSA isc nan =a
species species species species species species
(3) (4) (6) (7) (8) (9)
1
Bufonidae
Centrolenidae
Craugastoridae
Eleutherodactylidae
Hylidae
Leptodactylidae
Microhylidae
Phyllomedusidae
Ranidae
Rhinophrynidae
Scaphiopodidae
Subtotal
Plethodontidae
Salamandridae
Sirenidae
Subtotal
Dermophiidae
Subtotal
Total
Crocodylidae
Subtotal
Anguidae
Corytophanidae
Dactyloidae
Diploglossidae
Eublepharidae
Iguanidae
Mabuyidae
Phrynosomatidae
Scincidae
Sphaerodactylidae
Sphenomorphidae =
Telidae 1
Xantusiidae =
Subtotal 34 6
Boidae 1 —
Colubridae 30 6
1
1
1
2
Nar
1
1
—_
So
Remo Hew RYE RN Ww
>
re
[o)
|
~
el
|
=
N
(oe)
FPNFNNANFNKFKF ORE RH
Dipsadidae 28
Elapidae 2
Leptotyphlopidae 2
Natricidae 6
Sibynophiidae 1
Typhlopidae 1
Viperidae 5
Subtotal 76 13
Cheloniidae 4
Chelydridae 1
Dermatemyidae 1
Dermochelyidae 1 —=
Emydidae 1 — 1 — — —
1
4
Z
1
|
|
|
|
Geoemydidae —
Kinosternidae 1
Staurotypidae —
Testudinidae 1
Subtotal 16 2,
Total 127 21
Sum Total 169 29
ma | ye |
Geo
|
|
5
23 oi 3 5
30 11 4 3)
oe)
\o
Amphib. Reptile Conserv. 113 September 2021 | Volume 15 | Number 2 | e285
The herpetofauna of Veracruz, Mexico
Juarez et al. 2016). In the case of the states or the region
bordering Central America, the ratios are 8.38 (268/32 in
Chiapas; Johnson et al. 2015a) and 127.00 (127/1 in the
Yucatan Peninsula; Gonzalez-Sanchez et al. 2017). The
extreme figure for the Yucatan Peninsula is due, in part,
to this region of Mexico being confluent with the portion
of the peninsula that lies in Central America, principally
northern Guatemala. This MCS area is the only one in
which the number of country endemics is overwhelmed
by the number of regional endemics, 1.e., one compared
to 11 (Gonzalez-Sanchez et al. 2017). As indicated above,
Veracruz is a state in which the number of non-endemic
species 1s greater than that of the country endemics, so
the ratio of the former to the latter 1s 169/138, or 1.22.
Eight non-native species currently reside in Veracruz:
Eleutherodactylus planirostris, Lithobates catesbeianus,
Norops sagrei, Hemidactylus frenatus, H. mabouia, H.
turcicus, Virgotyphlops braminus, and Trachemys scipta.
Two of these species (H. frenatus and I. braminus) are
the most widespread of the non-native species reported in
the previous 11 MCS entries, as they have been reported
in 11 and 12 states, respectively (Gonzalez-Sanchez et
al. 2017, which covers the three Mexican states of the
Yucatan Peninsula).
Wilson et al. (2017) designed a system for categorizing
the distribution of the herpetofauna of Mesoamerica, and
it was applied to the pertinent categories in this study,
with the data summarized in Table 10. As mentioned
above, of the 359 total species in Veracruz, 169 are non-
endemic, and these 169 taxa were placed in six of the nine
categories recognized by Wilson et al. (2017), including
MXUS, MXCA, MXSA, USCA, USSA, and OCEA.
Given the proximity of Veracruz to Guatemala, in Central
America, and the location of the state south of the Tropic
of Cancer, understandably the largest number of species
is in the MXCA category (89; 52.7%). The next largest
number is allocated to the MXSA category (30; 17.8%),
followed closely by the number in the MXUS category
(29; 17.2%). The remaining 20 species are placed in the
USCA (11; 6.5%), USSA (four; 2.4%), and OCEA (five:
3.0%) categories.
Principal Environmental Threats
In this section, we highlight the most significant problems
that we believe affect the sustainability of the herpetofaunal
populations in Veracruz. As elsewhere in the world, Mexico
is subject to many of these problems, and Veracruz is no
exception to the countrywide situation. Various negative
factors apply here, such as the increasing and unregulated
clearing of forests for farming and livestock raising (for
grazing areas), the construction of roads, the constant and
increasing pollution of bodies of water, emerging diseases,
forest fires, and strongly ingrained cultural factors (Cruz-
Elizalde et al. 2017; Ramirez-Bautista et al. 2020), and
all are caused either directly or indirectly by humans
(anthropogenic effects).
Amphib. Reptile Conserv.
Deforestation. The state of Veracruz has a surface area
of 71,826 km? (INEGI 2011), which represents 3.6% of
the area of the country. A high diversity (17 types) of
environments is found in the state, and each has a strong
degree of deterioration. Currently, exceedingly small areas
represent these environments, including evergreen tropical
forest (251,505 ha), cloud forest (135,271 ha), deciduous
tropical forest (22,843 ha), and sub-deciduous tropical
forest (1,432 ha), as each has been converted largely to
pastures for livestock grazing (3,254,999 ha; Castillo-
Campos et al. 2011). Unfortunately, environmental
degradation continues at an accelerated rate, eliminating
~1,200-5,102 ha of natural vegetation cover per year,
similar to the situation occurring in other Mexican states
(SEMARNAT 2012).
Given the high rate of expansion of grazing areas
in Veracruz, the loss of natural habitats affects both the
biological communities and human development. The
loss of vegetation cover accelerates soil erosion, increases
water runoff and the evaporation rates of the bodies
of water that serve many local communities, and also
impacts all biodiversity, including amphibians and reptiles
(Ramirez-Bautista et al. 2014; Cruz-Elizalde et al. 2017).
At the local level, increased deforestation is driven
primarily by conversion of the land to agricultural fields and
grazing areas, of which the latter are prevalent in Veracruz
(Fig. 8). Unfortunately, in the case of agriculture and
agroecosystems, deforestation triggers the major clearing
of lands (Fig. 8), which are utilized for only one or two
years and then abandoned (Ramirez-Bautista et al. 2014).
For example, in the southeastern portions of the state,
tropical evergreen and tropical deciduous forests most
often are damaged by changes in land use when larger trees
are removed, thereby eliminating the lower vegetation and
leaf litter. The removal of the upper canopy layer strongly
affects the diversity of species, including the herpetofauna,
which is dependent on specific microclimatic conditions
(Ramirez-Bautista et al. 2020). For example, salamanders
(e.g., Bolitoglossa mexicana and B. platydactyla) and
anurans (e.g., Craugastor rhodopis) inhabit leaf litter.
Hylid frogs (e.g., Dendropsophus ebraccatus and
Rheohyla miotympanum) need trees and their associated
water sources for all stages of their life cycles. Bodies
of water are necessary for kinosternid turtles and ranid
frogs to reproduce, as well as for some genera of lizards
(e.g., Abronia, Norops, Corytophanes, Laemanctus,
Lepidophyma, and Xenosaurus) and snakes (e.g., Boa,
Leptophis, Spilotes, | Thamnophis, Metlapilcoatlus,
Bothrops, and Ophryacus) (Ramirez-Bautista et al. 2014;
Cruz-Elizalde et al. 2017).
Livestock production. As mentioned above, large sections
of land in Veracruz are converted annually into livestock
grazing areas (Fig. 9). This activity involves removing the
vegetation, often for short-term exploitation (1-2 years).
In particular, this situation is evident in cattle producing
regions in the central, northern, and southern portions
September 2021 | Volume 15 | Number 2 | e285
Torres-Hernandez et al.
F
f
i)
&
é
Fig. 8. Deforestation. Recently deforested and burned area
converted to cropland in the municipality of Uxpanapa, Gulf
Coastal Lowlands, in the southeastern portion of the state, at an
elevation of ca. 75 m. Photo by Ricardo Luria Manzano.
. ; € AK. re
Bae sah
ign = A = AT
Fig. 12. Roads. Lampropeltis polyzona found dead on the road
in the vicinity of Xico, in the municipality of the same name.
Photo by José Adrian Montiel Veranza.
of the state, and causes negative effects on biodiversity,
since vast amounts of the native vegetation are destroyed.
The soils in grazing areas are prone to erosion and will
only support livestock activity for one or two years. As
is common throughout Mexico, ranchers then are forced
to look elsewhere for new sites to clear at the expense of
natural ecosystems (Ramirez-Bautista et al. 2014, 2020:
Cruz-Elizalde et al. 2017). Physiographically, the areas
most affected are inside the SMO, GCL, and SLT. In the
Amphib. Reptile Conserv.
L— : a e ay a be
Fig. 9. Deforestation. Conversion of montane perennial forest
to cattle pasture at San Andrés Tuxtla, in the municipality of
San Andrés Tuxtla, at an elevation of 80 m. Photo by Christian
Berriozabal-Islas.
Dre TCL IR ERE NSS IT
Nie
Fig. 11. Livestock. Cattle paddock in tropical dry forest in the
vicinity of Tumilco, in the municipality of Tuxpan. Photo by
Uriel Hernandez-Salinas.
a Pe
Fig. 13. Pollution of water bodies. Creek flowing through
mangrove forest in an urban area of the city of Veracruz
desecrated with non-biodegradable trash, in the municipality of
Veracruz. Photo by Christian Berriozabal-Islas.
SLT, it is especially disheartening to see how pristine
evergreen forests have been converted to pastures. Similar
deforestation occurs in arid or semiarid districts, such
as in the Perote region, where thousands of hectares of
oak, pine, and juniper forests, and cacti and agaves, have
been destroyed in areas that today are completely eroded
(Magno-Benitez et al. 2016). Obviously, this situation is
troubling, since it has dramatically damaged the amphibian
and reptile populations in these regions.
September 2021 | Volume 15 | Number 2 | e285
The herpetofauna of Veracruz, Mexico
Fig. 14. Myths and other cultural factors. legal killing of a
rattlesnake (Crotalus mictlantecuhtli) in a fallow crop field in
Salmoral, municipality of La Antigua. Photo by Isaac Ajactle-
Tequiliquihua.
‘ " \. 7 4,
Roads. The government of the state works vigorously on
road construction for trade interests without any apparent
concern for the destruction of thousands of hectares of
pristine vegetation (Cruz-Elizalde et al. 2017; Ramirez-
Bautista et al. 2020). State authorities believe that road
infrastructure improvements are necessary for economic
and social growth, even though these developments bring
adverse consequences for biodiversity (Puc-Sanchez
et al. 2013). The building of roads not only destroys a
considerable number of natural habitats, but the roads
also act as physical barriers for many amphibian and
reptile species, thereby reducing the connectivity among
populations. Another negative factor of roads is vehicle-
induced mortality, or “roadkills,” which is one of the most
visible effects they generate when individuals attempt to
cross busy highways during migration, or when they use
the pavement for basking (Fig. 12).
Pollution of water bodies. The continuous growth of
the human population in Veracruz, and the lack of urban
development plans, have exacerbated the improper
disposal of waste products (Fig. 13), which in turn
has affected water resources, such as rivers and lakes,
especially in the GCL, SLT, and SMO regions (Cruz-
Elizalde et al. 2017). During the early 20" century in
central Veracruz, within the Chiconquiaco region of the
SMO, the rivers and lakes near towns contained a high
diversity of amphibians (e.g., Lithobates) and reptiles
(e.g., Thamnophis). Today, the water levels of these rivers
and lakes have dropped dramatically and the biodiversity
has been lost; or if any water remains, the level of
detergents 1s so high that amphibians and reptiles can no
longer survive in them. Sewage that ends up in rivers has
modified the water properties significantly and caused
many frog and turtle populations to disappear from those
sites (Ramirez-Bautista et al. 2014; Magno-Benitez et al.
2016). This situation is extremely upsetting, because most
people in the villages do not have the basic education to
understand the need for maintaining and conserving the
Amphib. Reptile Conserv.
uae
Fig. 15. Diseases. Individual of Rheohylamiotympanum afflicted
with degenerative anophthalmia of the right eye, photographed
at Zoncuantla, municipality of Coatepec, Veracruz, near the Rio
Consolapa or Pixquiac. Photo by Salvador Guzman.
local biodiversity. Unfortunately, the authorities that are
supposedly assigned to protect the environments of these
regions have been ineffective.
Myths and other cultural factors. As in many countries,
people’s customs are ingrained in their culture, and it is
difficult to change their minds about the importance of
animals in their ecosystems. In this regard, the people
of Veracruz are no exception (Ramirez-Bautista et al.
2014). Two aspects of their culture markedly contribute
to the detriment of the herpetofauna of the state: (1) a
lack of awareness of the important roles that amphibians
and reptiles play in their ecosystems; and (2) the harmful
misconceptions that often lead to their persecution, which
are maintained and supported by myths (Cruz-Elizalde
et al. 2017). For example, many people from the Los
Tuxtlas region believe that some species of salamanders
(e.g., in the genera Chiropterotriton and Bolitoglossa)
impregnate women, that lizards (of the genera Abronia,
Barisia, Hemidactylus, and Ophisaurus) are considered
venomous, and that all snakes are indiscriminately
regarded as venomous, and therefore killed on sight (Fig.
14). In this region, people also believe that all snakes are
the products of the devil and must be killed. Although, the
consumption of most members of the herpetofauna is not
well documented in the state, in some rural communities,
anurans (e.g., Lithobates berlandieri and L. vaillanti)
are known to be part of the human diet. In addition,
some inhabitants use rattlesnakes for folk medicine, and
Ctenosaura acanthura and Iguana are heavily exploited
for commercial purposes (Cruz-Elizalde et al. 2017).
Diseases. Globally, many amphibian populations are
disappearing due to chytridiomycosis, caused by the
fungus Batrachochytrium dendrobatidis (Bd; Rovito et
al. 2009; Hernandez-Austria 2017). Although this disease
has not been reported in the amphibians of Veracruz, it
may exist there since it has been detected in more than
50 species of salamanders and anurans in northeastern,
September 2021 | Volume 15 | Number 2 | e285
Torres-Hernandez et al.
A Vee link GT
Fig. 16. Exotic and invasive species. Originally, this invasive
species, Eleutherodactylus planirostris, was documented in the
state of Veracruz by Garcia-Vinalay et al. (2020). This individual
was photographed in Puerto de Veracruz, in the municipality of
the same name. Photo by Madeleine Fernandez Teco.
central, and southeastern Mexico (Mendoza-Almeralla
et al. 2015), with members of the families Hylidae and
Plethodontidae being the most affected. The records
for Bd are concentrated in areas of high amphibian
diversity (e.g., the TVB and highlands of Oaxaca and
Chiapas; Rovito et al. 2009). One report indicates that
Bd is known from anurans in Hidalgo, a state that borders
Veracruz, where it was found in the following taxa:
Craugastor rhodopis, Lithobates berlandieri, L. johni,
and Rheohyla miotympanum (Hernandez-Austria 2017).
Thus, populations of these species in Veracruz might be
infected as well (Fig. 15).
Exotic and invasive species. Historically, several exotic
herpetofaunal species have been introduced as a result
of human activities in Veracruz. Many of them are not
offensive to native species, such as lizards of the genus
Hemidactylus that have seemingly exploited previously
empty ecological niches by using microhabitats such as
rock crevices, beneath tree bark, and often the walls of
buildings. Nonetheless, one introduced amphibian that
is known to cause significant harmful effects to native
species is the American Bullfrog, Lithobates catesbeianus.
This frog is considered invasive since it actively feeds on
a broad array of prey (Gonzalez-Sanchez et al. 2021). In
other places in Mexico, this species has invaded water
sources and caused the local extinctions of fish, anuran
amphibians (e.g., Dryophytes eximius, D. plicatus, and L.
berlandieri), axolotls (Ambystoma velasci), and reptiles
(turtle eggs and hatchlings).
Illegal commerce. Illegal trafficking in herpetofauna
is a widely prevalent activity worldwide. Many species
are trafficked in Mexico, primarily those thought to
have medicinal or food value, or which are simply of
interest as pets (Cruz-Elizalde et al. 2017). In particular,
these factors negatively affect the species richness and
distribution of the endemic amphibian and reptiles.
As in many other states in Mexico, a high percentage
of reptile genera are trafficked in Veracruz, including
Amphib. Reptile Conserv.
Fig. 17. //legal commerce. Due to its bright colors and natural
beauty, Abronia graminea is among one the more persecuted
species for the illegal pet trade market in the state of Veracruz.
Photo by Aaron Arias Hernandez, Torito Wildlife.
turtles (Kinosternon), lizards (Abronia, Ophisaurus,
Ctenosaura, and Xenosaurus), and snakes (Crotalus,
Boa, Lampropeltis, and Micrurus). Many of these are sold
as exotic pets (Fig. 17) in the domestic and international
markets (Lavin-Murcio and Lazcano 2010; Paredes-
Garcia et al. 2011). In southeastern Veracruz, local
authorities allow the illegal sale of live herpetofauna, and
turtle and iguana eggs, in the markets.
Consequently, governmental authorities at all levels
and conservation groups must invest more time and
effort in protecting the affected species and the habitats
in which they occur. Such efforts are particularly critical
in regions that contain species and habitats that already
are vulnerable to anthropogenic pressures. Another
critical step for authorities is the need to invest in more
resources for educating the public on the important roles
of herpetofauna in ecosystems. Without these efforts,
adequate protection for these species will remain an
elusive goal.
Conservation Status
The conservation status of the members of the
herpetofauna of Veracruz was evaluated using the same
three systems of conservation assessment employed in
the previous MCS entries: SEMARNAT (2010), the
IUCN Red List (http://tucnredlist.org), and the EVS
(Wilson et al. 2013a,b), with the EVS data updated as
necessary.
The SEMARNAT System
As noted by Ramirez-Bautista et al. (2020: 91), the
SEMARNAT system for assessing conservation status
was developed and implemented by the Secretaria del
Medio Ambiente y Recursos Naturales of the federal
government of Mexico (SEMARNAT 2010). The status
ratings for some of the resident herpetofaunal species in
Veracruz are given in Table 8, and summarized in Table
11. As also noted by Ramirez-Bautista et al. (2020: 91),
September 2021 | Volume 15 | Number 2 | e285
The herpetofauna of Veracruz, Mexico
Table 11. SEMARNAT categorizations for the herpetofaunal species found in Veracruz, Mexico, arranged by families. Non-native
Species are excluded.
SEMARNAT categorizations
Number
Family of ;
species Endangered (P) ‘Threatened (A), Rohan a ta
Bufonidae 9 — — 2 7
Centrolenidae 1 —— — 1
Craugastoridae 11 — — 5 6
Eleutherodactylidae 6 — — 1 5
Hylidae ae] — 5 6 18
Leptodactylidae 3 — — 3
Microhylidae 3 — — 2 l
Phyllomedusidae 2 — — 2
Ranidae 7 l — 3 3
Rhinophrynidae 1 — — 1 —
Scaphiopodidae 2 — — 2
Subtotal 74 1 5 20 48
Ambystomatidae l — 1 —
Plethodontidae 42 — 4 17 21
Salamandridae 1 1 — — —
Sirenidae l — 1 — ---
Subtotal 45 1 5 18 21
Dermophiidae 1 — — 1 —
Subtotal 1 — — 1 —-
Total 120 Z 10 39 69
Crocodylidae 1 — 1 —
Subtotal 1 — — 1 —
Anguidae 10 3 2 4 1
Corytophanidae 4 — — 3 1
Dactyloidae 17 — 1 5 11
Dibamidae l 1 — —
Diploglossidae 4 — —- 2 2
Eublepharidae 1 ~- 1 — —
Iguanidae 2 — — 2 —
Mabuyidae 1 —- —- — 1
Phrynosomatidae 20 — 2 3 15
Scincidae 5 _- — 2 3
Sphaerodactylidae 2 — — 2 —
Sphenomorphidae 3 aan 1 1 1
Teiidae 5 a — 1 4
Xantusiidae 5 — 1 3 1
Xenosauridae 3 — l 2
Subtotal 83 3 9 29 42
Boidae l — — — l
Colubridae 4] — 6 6 29
Dipsadidae 46 — — 15 31
Elapidae 4 - -— 3 1
Leptotyphlopidae 4 — — — 4
Natricidae 14 — 9 — 5
Sibynophiidae 1 —- — — 1
Typhlopidae 1 — — — 1
Viperidae 17 — 5 6 6
Subtotal 19 — 20 30 79
Cheloniidae 4 4 — —
Chelydridae 1 — -- _— 1
Dermatemyidae 1 1 = — —
Dermochelyidae 1 1 — —
Emydidae 2 — —- — 2
Geoemydidae 1 — 1 — —
Kinosternidae 5 — = 4 1
Staurotypidae 2 1 1 —- —
Testudinidae 1 — 1 — —
Subtotal 18 7 3 4 4
Total 231 10 32 64 125
Sum Total 351 12 42 103 194
Amphib. Reptile Conserv. 118 September 2021 | Volume 15 | Number 2 | e285
Torres-Hernandez et al.
No. 37. Metlapilcoatlus nummifer (Ruppell, 1845). The
Jumping Pitviper is a country endemic occurring from San
Luis Potosi southward through Hidalgo and west-central
Veracruz to northern and southeastern Oaxaca (Lemos-
Espinal and Dixon 2013). This individual was located at Los
Reyes, in the municipality of the same name. Wilson et al.
(2013b) determined its EVS as 13, placing it at the upper limit
of the medium vulnerability category. Its conservation status
has been evaluated as Least Concern by the IUCN, and as
Threatened (A) by SEMARNAT. Photo by René Avalos-Vela.
No. 38. Metlapilcoatlus olmec (Pérez-Higareda et al. 1985).
The Olmecan Jumping Pitviper is a non-endemic species with
a highly disjunct distribution, with populations occurring in
the Sierra de Los Tuxtlas of southern Veracruz, the Sierra
Atravesada (Cerro Baul region) of south-eastern Oaxaca, the
Mesa de Ocozocoautla of northwestern Chiapas, and some
isolated localities in central Guatemala (Purulha in Baja
Verapaz and Sierra de las Minas); its vertical distribution
extends from about 530 to at least 1,200 m asl (Heimes
2016). This individual was photographed at Los Tuxtlas, in
the municipality of San Andrés Tuxtla. Wilson et al. (2013b)
determined its EVS as 15, placing it in the lower portion of the
high vulnerability category. Its conservation status has been
evaluated as Least Concern by the IUCN, and this species is
not listed by SEMARNAT. Photo by Eli Garcia-Padilla.
No. 39. Ophryacus smaragdinus Grunwald, Jones, Franz-
Chavez, and Ahumada-Carillo, 2015. The Emerald Horned
Pitviper is a country endemic species ranging from west-
central Veracruz and east-central Hidalgo to northeastern
Puebla and north-central Oaxaca (Griinwald et al. 2015). This
individual was found at Nogales, in the municipality of the
same name. Johnson et al. (2017) calculated its EVS as 14,
placing it at the lower limit of the high vulnerability category.
Its conservation status has not been evaluated by either the
IUCN or SEMARNAT. Photo by René Avalos-Vela.
Amphib. Reptile Conserv.
No. 40. Ophryacus undulatus Jan, 1859. The Mexican Horned
Pitviper is a country endemic species occurring from west-
central Veracruz to southern Oaxaca and central Guerrero
(Uetz et al. 2020). This individual was found at Finca Santa
Martha, in the municipality of Los Reyes. Wilson et al. (2013b)
determined its EVS as 15, placing it in the lower portion of the
high vulnerability category. Its conservation status has been
assessed as Vulnerable by the IUCN, and as Special Protection
(Pr) by SEMARNAT. Photo by Matthieu Berroneau.
September 2021 | Volume 15 | Number 2 | e285
The herpetofauna of Veracruz, Mexico
Table 12. Comparison of the SEMARNAT and distributional categorizations for the herpetofauna of Veracruz, Mexico. Non-
native species are excluded.
SEMARNAT category
Distributional category Endangered (P) Threatened (A) Special No status (NS) Total
protection (Pr)
Non-endemic species (NE) 8 15 38 108 169
Country-endemic species (CE) 2 23 49 64 138
State-endemic species (SE) 2 4 16 22 44
Total 12 42 103 194 351
three categories of assessment exist in the SEMARNAT
system: Endangered (P), Threatened (A), and Under
Special Protection (Pr); while species that remain
unassessed in this system are assigned a “No Status”
(NS) category (Tables 8 and 11).
The data in Table 11 show that of the 351 native
members of the Veracruz herpetofauna, only 157 (44.7%)
have been assessed using the SEMARNAT system. Thus,
194 species (55.3%) lack an evaluation based on this
system. Of the 157 species that are evaluated, 12 (7.6%)
are allocated to the Endangered (P) category, 42 (26.8%)
to the Threatened (A) category, and 103 (65.6%) to the
Special Protection (Pr) category.
One might wonder whether the deficiencies of
applying this system of conservation assessment (..e.,
where more than one-half of the native members of the
Veracruz herpetofauna remain unassessed) result from
an emphasis being placed by SEMARNAT personnel
on the species endemic to a given state or the country at
large. If so, “then that consideration should be evident
by comparison of the SEMARNAT assignments to both
distributional categories and to SEMARNAT categories”
(Ramirez-Bautista et al. 2020: 91). In order to examine
whether such a bias might be evident, these comparisons
are allocated in Table 12. These data indicate that of the
12 species allocated to the Endangered (P) category,
eight (66.7%) are non-endemics, two (16.7%) are
country endemics, and two (16.7%) are state endemics.
Of the 42 species placed in the Threatened (A) category,
23 (54.8%) are country endemics, 15 (35.7%) are
non-endemics, and four (9.5%) are state endemics. Of
the 103 species allotted to the Special Protection (Pr)
category, 49 (47.6%) are country endemics, 38 (36.9%)
are non-endemics, and 16 (15.5%) are state endemics.
Of the 194 species that remain unevaluated, 108 (55.7%)
are non-endemics, 64 (33.0%) are country endemics,
and 22 (11.3%) are state endemics. Of the total of 182
country and state endemic species, 96 (52.7%) have been
allocated to one of the three SEMARNAT categories.
In comparison, of the 169 non-endemic species, 61
(36.1%) have been apportioned into one of the three
categories. Thus, these data do not demonstrate a clear
bias toward the assessment of endemic species, although
they indicate that the SEMARNAT system of assessment
has not been extended to a sufficient percentage of the
Veracruz herpetofauna to be of much value for their
Amphib. Reptile Conserv.
120
conservation action planning. As indicated by the data in
Table 12, only 61 of 169 non-endemic species (36.1%),
74 of 138 country endemic species (53.6%), and 22 of 44
state endemic species (50.0%) have been allocated to one
of the SEMARNAT categories.
The IUCN System
The IUCN system of conservation assessment can be
applied to all organisms at a global level, but primarily
has been used for vertebrate animals and flowering plants
(Ramirez-Bautista et al. 2020). This system consists of
six categories (Table 13), including three so-called “threat
categories,” 1.e., Critically Endangered, Endangered,
and Vulnerable; two lesser threat categories, 1.e., Near
Threatened and Least Concern; and one non-assessed
category, 1.e., Data Deficient. This last category 1s applied
to species for which too little information about their
population status is available to allow for their allocation
to one of the other categories. Since it seems that some
subset of species is not placed into one of the six above-
mentioned categories, here we placed them in a “Not
Evaluated” category.
The data for allocating members of the Veracruz
herpetofauna to the IUCN categories are shown in
Table 8, and summarized in Table 13. The data in the
latter table indicate that of the 351 native members of
the herpetofauna, 30 (8.5%) are placed in the Critically
Endangered (CR) category, 31 (8.8%) in the Endangered
(EN) category, and 25 (7.1%) in the Vulnerable
(VU) category, for a total of 86 (24.5%) in the “threat
categories.” Among the lesser threat categories, 11
(3.1%) are apportioned in the Near Threatened (NT)
category and 161 (45.9%) in the Least Concern (LC)
category, for a total of 172 (49.0%). Finally, 24 species
(6.8%) are placed in the Data Deficient (DD) category,
and 69 species (19.7%) are Not Evaluated (Table 13).
In order to ascertain the relationship between the
application of the IUCN categories and the distributional
categories, the data on the correspondence between
these two allocations are shown in Table 14. These data
demonstrate that of the 182 country and state endemic
species, 71 (39.0%) are placed in one of the three threat
categories, with most of them (53) allocated to the
CR and EN categories. The majority of the 351 native
species (161; 45.9%) are apportioned to the LC category,
September 2021 | Volume 15 | Number 2 | e285
Torres-Hernandez et al.
Table 13. IUCN Red List categorizations for the herpetofaunal families in Veracruz, Mexico. Non-native species are excluded. The three
shaded columns to the left are the “threat categories,” and the two shaded columns to the right are the categories for which too little
information on conservation status exists to allow the taxa to be placed in any other IUCN category, or they have not been evaluated.
IUCN Red List categorization
Number Te
Critically Near Least Data Not
; of Endangered ‘Vulnerable :
Family species Endangered EN) (WU) Threatened Concern Deficient Evaluated
(CR) ( (NT) (LC) (DD) (NE)
Bufonidae 9 2 2 1 — 3 == 1
Centrolenidae 1 — — — — — — 1
Craugastoridae 1] 1 2 4 2 2 — —
Eleutherodactylidae 6 — — 3 — fs i —
Hylidae 29 4 4 3 3 12 2 1
Leptodactylidae 3 — — — 3 — —
Microhylidae 3 — — —. — 3 — —
Phyllomedusidae 2 1 — — — 1 — —
Ranidae 7 — 1 — — B) — 1
Rhinophrynidae 1 — — — 1 1 — —
Scaphiopodidae 2 — — — — 2 — —
Subtotal 74 8 9 11 5 34 3 4
Ambystomatidae 1 — — — — 1 — —
Plethodontidae 42 19 14 2 — 6 — 1
Salamandridae 1 — 1 — — a -- —
Sirenidae 1 — — — — 1 — —
Subtotal 45 19 15 2 — 8 — 1
Dermophiidae 1 — — — — 1 — —
Subtotal 1 — — — a 1 — —
Total 120 27 24 13 5 43 3 5
Crocodylidae 1 — — — — 1 — —
Subtotal 1 — — — — 1 _ —
Anguidae 10 — 3 1 — 3 ps 1
Corytophanidae + — — — — 3 — 1
Dactyloidae 17 — — 2 — 1 4 10
Dibamidae 1 — — — — 1 — =
Diploglossidae 4 — — — 1 ps 1 —
Eublepharidae 1 — — — — 1 — —
Iguanidae 2 — — — — — — Zz
Mabuyidae 1 — — — — — — 1
Phrynosomatidae 20 — — 1 — 16 2
Scincidae 5 — — — — 4 — 1
Sphaerodactylidae 2 — — — — 1 — 1
Sphenomorphidae 3 — — — — w — 1
Tetidae 5 — — — — 4 — 1
Xantusiidae 5 — — — — 3 1 1
Xenosauridae 3 — — 1 — 1 — 1
Subtotal 83 — 3 5 1 42 9 23
Boidae 1 — — — — — — 1
Colubridae 4] — 1 — — 25 2 83
Dipsadidae 46 — 1 p — 20 9 14
Elapidae + — — — — 4 — ——
Leptotyphlopidae 4 — — — — 2 — 2
Natricidae 14 — — 1 — 10 — 3
Sibynophiidae 1 — — — — — — 1
Typhlopidae 1 — — — = 1 — —
Viperidae Vd — — 1 — 1] 1 4
Subtotal 129 — 2 4 -- 73 12 38
Cheloniidae + z 2 — — — — —
Chelydridae 1 — — 1 — — — —
Dermatemyidae 1 1 — — —- — -- —-
Dermochelyidae 1 — — 1 — — — —
Emydidae 2 — _ 1 — — -- 1
Geoemydidae 1 — — 1 — — —
Kinosternidae 5 — — — 2 1 — 2
Staurotypidae 2 — — — 2 — a ——
Testudinidae 1 — — — — 1 — _
Subtotal 18 3 2 3 5 p — 3
Total 231 3 7 12 6 118 21 64
Sum total 351 30 31 25 11 161 24 69
Category total 351 86 172 93
Amphib. Reptile Conserv. 121 September 2021 | Volume 15 | Number 2 | e285
The herpetofauna of Veracruz, Mexico
Table 14. Comparison of the IUCN and distributional categorizations for the herpetofauna of Veracruz, Mexico. Non-native species
are excluded.
IUCN categories
ee ae eidiapeiea’ onitdahacted, PVUINSIRDIG: esi gin Coen Mahan coum Avahiaeds “SADtat
(CR) ey wt) (NT) (LC) (DD) (NE)
Non-endemic species (NE) 5 3 7 7 96 — 51 169
Country-endemic species (CE) 8 15 17 4 64 13 17 138
State-endemic species (SE) 17 13 1 — 1 1] 1 44
Total 30 31 25 11 161 24 69 351
including 64 country endemics (64/161; 39.8%) and one
state endemic. Of the 24 DD species, 13 are country
endemics and 11 are state endemics. Of the 69 species
(69/351; 19.7%) which were Not Evaluated, the majority
are non-endemic species (51; 73.9%), while 18 (26.1%)
are country and state endemics. Thus, slightly less than
one-fifth of the native species occurring in Veracruz have
not been evaluated by the IUCN system. An additional
24 species (6.8%) presently are allocated to the DD
category. Thus, a total of 93 species (26.5%) are either
considered as Data Deficient or have not been evaluated
by using this system.
The EVS System
The EVS (Environmental Vulnerability Score) system of
conservation assessment was designed initially for use
in evaluating the conservation status of members of the
herpetofauna of Honduras (Wilson and McCranie 2014),
but subsequently has been employed in the same way
for other elements of the Mexican and Central American
herpetofaunas (e.g., Wilson et al. 2010, 2013a,b; Johnson
et al. 2015b, 2017; Mata-Silva et al. 2015, 2019; and
all entries in the MCS [see above]). In this study, the
EVS values for 346 native non-marine species residing
in Veracruz are provided in Table 8, and summarized in
Table 15.
The EVS values range from 3 to 19, or one less
than the entire theoretical range of 3 to 20. The most
frequent values (applied to 10 or more species) are: 6
(16), 7 (15), 8 (23), 9 (25), 10 (23), 11 (27), 12 (29), 13
(40), 14 (31), 15 (34), 16 (21), 17 (26), and 18 (20). We
applied these 13 values to 330 of the 346 native non-
marine species (95.4%) in Veracruz. The lowest score of
3 was determined for three species (Rhinella horribilis,
Smilisca baudinii, and Scaphiopus couchii) and the
highest score of 19 for two turtles (7errapene mexicana*
and Trachemys venusta).
As in all previous MCS studies, herein the EVS values
are assembled into three categories of low (scores 3-9),
medium (10-13), and high (14-19) vulnerability. Based
on this categorization, the species figures increase from
low vulnerability (93) through medium vulnerability
(119) to high vulnerability (134). Typically, this pattern
is characteristic of state herpetofaunas containing more
country and state endemic species (182 in the case
Amphib. Reptile Conserv.
of Veracruz) than non-endemic species (169), as we
discovered previously in Michoacan (Diaz-Alvarado
et al. 2013), Oaxaca (Mata-Silva et al. 2015), Jalisco
(Cruz-Saenz et al. 2017), and Puebla (Woolrich-Pifia et
al. 2017).
The IUCN categorizations for the Veracruz
herpetofauna were compared to those of the EVS
system (Table 16), and 61 of the 134 high vulnerability
species (45.5%) are allocated to the three IUCN “threat
categories.” At the other extreme, 60 low vulnerability
species (by EVS) account for 37.3% of the 161 LC
species (by IUCN). Thus, apparently there is poor
correspondence between the evaluations offered by the
IUCN and EVS systems, as was reported in previous
MCS entries.
As indicated in prior MCS studies, the reason for
the poor correspondence between the evaluations of
conservation status offered by the IUCN and EVS
systems is the relatively high number of species allocated
to the DD, NE, and LC categories (254 of 346 species,
or 73.4%; Table 16). Interestingly, of the 24 DD species,
which include three anurans and 21 squamates, 13 are
country endemics and 11 are state endemics (Table 17).
All but three species are in the high vulnerability EVS
category, as those three have an EVS of 11, 12, and 13.
We consider these 24 species as ill-served by remaining
in the IUCN DD category. In our opinion, the species with
EVS values of 11 (Lepidophyma tuxtlae* ), 12 (Rhadinaea
macdougalli*), and 13 (Ptychohyla zophodes*) should
be placed in the NT category. The two species with an
EVS of 14 (Ficimia variegata* and Tantilla slavensi**)
should be allocated to the VU category. The 11 species
with an EVS of 15 or 16 need to be placed in the EN
category. The eight species with an EVS of 17 or 18
should be allocated to the CR category.
Sixty-nine species remain unassessed by using the
IUCN system, so we allocated them to the NE category
(Table 18). These 69 species include four anurans, one
salamander, 61 squamates, and three turtles. Of these
species, 17 are country endemics, one is a state endemic,
and the remaining 51 are non-endemics. Their EVS
values extend from 3 to 19, the entire range applicable
to the Veracruz herpetofauna. The 38 species with
values of 3 to 10 can be allocated to the LC category.
The 15 species with an EVS of 11 (Hyalinobatrachium
viridissimum, Gonatodes albogularis, —_Holcosus
122 September 2021 | Volume 15 | Number 2 | e285
Torres-Hernandez et al.
No. 41. Rhinoclemmys areolata (Dumeéril, Bibron, and
Dumeril, 1851). The Furrowed Wood Turtle is a non-endemic
species ranging from southern Veracruz southward through
Tabasco and northern Chiapas to the Yucatan Peninsula and
eastern Guatemala and northwestern Honduras (Lee 2000;
McCranie 2018). This individual was found at Minatitlan,
in the municipality of the same name. Wilson et al. (2013b)
calculated its EVS as 13, placing it at the upper limit of the
medium vulnerability category. Its conservation status was
assessed as Near Threatened by the IUCN, and as Threatened
(A) by SEMARNAT. Photo by Christian Berriozabal-Islas.
No. 42. Kinosternon scorpioides Linneaus, 1766. The
Scorpion Mud Turtle is a non-endemic species occurring from
northern Tamaulipas to southern Brazil (Lemos-Espinal and
Dixon 2013). This individual was located at Coatzacoalcos,
in the municipality of the same name. Wilson et al. (2013b)
determined its EVS as 10, placing it in the lower portion of
the medium vulnerability category. Its conservation status
has not been determined by the IUCN, but was assessed as
Special Protection (Pr) by SEMARNAT. Photo by Christian
Berriozabal-Islas.
No. 43. Claudius angustatus Cope, 1865. The Narrow-bridged
Musk Turtle is a non-endemic species occurring from central
Veracruz across northern Guatemala to northern Belize
(Kohler 2008). This individual came from Coatzacoalcos,
in the municipality of the same name. Wilson et al. (2013b)
calculated its EVS as 14, placing it at the lower limit of the
high vulnerability category. Its conservation status has been
evaluated as Near Threatened by the IUCN, and as Endangered
(P) by SEMARNAT. Photo by Christian Berriozabal-Islas.
Amphib. Reptile Conserv.
No. 44. Staurotypus triporcatus (Wiegmann, 1828). The
Mexican Giant Musk Turtle is a non-endemic species
distributed from Veracruz through the base of the Yucatan
Peninsula to western Honduras (Kohler 2008). This individual
was found at Laguna la Escondida, Los Tuxtlas, in the
municipality of San Andrés Tuxtla. Wilson et al. (2013b)
determined its EVS as 14, placing it at the lower limit of the
high vulnerability category. Its conservation status has been
assessed as Near Threatened by the IUCN, and as Threatened
(A) by SEMARNAT. Photo by Christian Berriozabal-Islas.
September 2021 | Volume 15 | Number 2 | e285
The herpetofauna of Veracruz, Mexico
Table 15. Environmental Vulnerability Scores (EVS) for the herpetofaunal species in Veracruz, Mexico, arranged by family. The
shaded area to the left encompasses low vulnerability scores, and the one to the right high vulnerability scores. Non-native species
are excluded.
Number
Family of Environmental Vulnerability Score (EVS)
species
3 4 S 7 8 9 10 WH 12 13 14 #15 «16 £417—~« ©18—)=«19
Bufonidae 9 1 —_- — 2 —- — — — 3 — 1 2 Se =.
Centrolenidae 1 Sy ££ 2] 2 S =] > Bs 1 — — ee
Craugastoridae 1] —- -—- -—- =—- —- — 1 1 1 1 — 2 i 2 1 1 —
Eleutherodactylidae 6 —- -—- —- -—- —- —- —- ~~ — 3 —- — 1 1 —- 1 —-
Hylidae 29 1 2 —- — 3 1 2 1 2 2 6 3 4 — 1 1 —
Leptodactylidae 3 —- — 1 j 1 , , ER
Microhylidae 3 — 1 = = 1 1 Cr
Phyllomedusidae ws —- —- —- — 1 —_- —- — 1 . ogg |
Ranidae 7 —- — 1 — 1 1 1 —_-_ — 1 1 a ee ee ee
Rhinophrynidae 1 —- —- > ~~ i — =e
Scaphiopodidae 2 1 —_- — 1 rs ee
Subtotal 74 3 3 2 4 d: 4 4 2 8 q 8 8 6 3 Z 3 —
Ambystomatidae 1 —- > eee ee 1 ~~ — — ae
Plethodontidae 42 - -—- -—- -—- hl 1 — 2 — 1 2 3 8 1 140 —
Salamandridae 1 ee 1 — Pee ate ee ee Ss
Sirenidae 1 Sa Se Serif - ka--=_ 1 — ee ae
Subtotal 45 —- —- FS ee 1 1 Z 2 1 2 3 8 ite
Dermophiidae 1 —- Se ee ae ae ee 1 SS. ee
Subtotal 1 —S SS SS Se SS STS = BS 1 — Ee OE ee = ee eee
Total 120 3 3 2 4 a 4 5 3 11 9 9 10 9 HW 13 #W
Crocodylidae 1 ee 1 ee eee eee ee ee
Subtotal 1 Oe 1 cory fe ae) se es
Anguidae 10 —- —- — 1 —- —- =—- —- — 1 — 2 3 1 1 1 —
Corytophanidae + —- —- —- — 1 1 1 —- — — 1 ee ee
Dactyloidae 17 —- —- —- =—- — 2 3 2 — 1 2 — 2 ys 3 —_—_ —
Dibamidae 1 = ] +] SS ]S SS = 1 ~—~ -_ -. =
Diploglossidae + —- -—-|- | FS FO Tre ee oe 1 a —_- — 1 =< =
Eublepharidae 1 = —_ +] S|] YS = 1 — ee OES ee
Iguanidae 2 —- —- —- —- —- —- — ~~ — 2 — ee ee
Mabuyidae 1 —- =| =| —- —- — — 1 — — — eee
Phrynosomatidae 20 —_- — 1 1 —_—- — 1 — 2 3 6 1 5 —- —- — —
Scincidae 5 —- —> eee ee ee 1 1 2 — 1 = —
Sphaerodactylidae 2 —- —- SS SES Sr i 1 1 — Bae eS ee
Sphenomorphidae 3 —- —- ~—> — — 1 —_—- — 1 1 — = ee SS
Tetidae 5 —- — — ~~ — 1 1 — o) 1 — Ee wes Peg ss Ges
Xantusiidae 5 —- —- —- =—- — 1 —- — 2 — 1 —_- — 1 a
Xenosauridae 3 =S =] SS SS 1 —~ - -. 2 = l 1 ee
Subtotal 83 —- — 1 2 1 6 8 5 9 12 11 6 10 s 6 1 -—
Boidae 1 —- —- —- —- — — — 1 — — — a
Colubridae 4] —- — 2 7 2 5 6 5 1 2 me 4 2 —- —- ~— —
Dipsadidae 46 a 2 1 2 5; 5 5 5 1 4 8 2 i 1 1 —- —
Elapidae - —- —- —- — — 1 —- — 1 — I —- —- — 1 a
Leptotyphlopidae + —- —- — 1 es — Cl rl CO 3 — SS £2 Sea =
Natricidae 14 —- —- =—> — i — 1 — 3 — 1 3 f=
Sibynophiidae 1 —- —- —- —- —- — — — 1 — — 1a
Typhlopidae 1 —- —- —- — —- ~—> — — 1 — — (ae ee eee
Viperidae 17 —- —- > SS 1 1 — 1 1 1 2 3 4 2 1 —-
Subtotal 129 — pe 3 10 7 ce 13 7 7 18 els 5 5 1 _
Chelydridae 1 ee 1 ae =
Dermatemyidae 1 es = ll. 1 a)
Emydidae 2 ee ee eee ll ee)
Geoemydidae 1 ee 1 ee ee ee ee
Kinosternidae 5 —S eS ee a a ee 2 — 1 — 2 ee ee eee
Staurotypidae 2 Se ses sr re OD Ee 2 ey eS pe
Testudinidae 1 ee os — se — =
Subtotal 13 —- —- —- ~—- ~—- — — 2 = 1 1 4 4 2 1 2
Total 226 — iz 4 12 8 19 20 20 16 20 31 21 25 10 = 13 3 #3
Sum total 346 3 5 6 1ceeetoeeecoeeezon 23 27 29 40 (Ste Gee zo 2
Category total 346 93 119 134
Amphib. Reptile Conserv. 124 September 2021 | Volume 15 | Number 2 | e285
Torres-Hernandez et al.
Table 16. Comparison of the Environmental Vulnerability Scores (EVS) and IUCN categorizations for members of the herpetofauna
of Veracruz, Mexico. Non-native species are excluded. The shaded area at the top encompasses low vulnerability category scores,
and the one at the bottom high vulnerability category scores.
IUCN category
EVS Critically Endansered Vulnerable Near Least Data Not Total
Endangered 8 Threatened Concern Deficient Evaluated
3 — —- — —— wy) — 1 3
4 — — — — 5 — — 5
5 ~~ — — — 4 _- 2 6
6 1 —- ~— -— 10 —- 5 16
7 1 — -- — 10 — 4 15
8 — — — — 16 — 7 23
9 — — 2 1 13 —- 9 25
10 — — — — 14 — 10 24
11 _— 2 B: —— 17 1 4 27
12 — 2 1 2 17 1 5 28
13 —- 2 6 3 22 1 6 40
14 1 5 Z 5 2 2 5 32
15 2 3 7 10 8 3 33
16 4 4 1 — 6 3 3 21
17 6 8 1 — 2 5 4 26
18 13 3 — — 1 3 — 20
19 — — 1 — — — 1 2
Total 28 29 24 11 161 24 69 346
Table 17. Environmental Vulnerability Scores (EVS) for members of the herpetofauna of Veracruz, Mexico, allocated to the IUCN
Data Deficient category. * = country endemic; ** = state endemic.
Environmental Vulnerability Score (EVS)
aon Geographic Ecological Ra es f Total
distribution distribution Br score
persecution
Eleutherodactylus verruculatus** 6 8 4 18
Exerodonta bivocata* 6 8 1 15
Ptychohyla zophodes* ] 7 1 13
Abronia reidi** 6 8 4 18
Mesaspis antauges** 6 gy 3 16
Norops alvarezdeltoroi* 6 8 3 17
Norops cymbops* 6 8 3 17
Norops duellmani** 6 8 3 17
Norops schiedii** 5 8 3 16
Celestus ingridae** 6 8 3 17
Sceloporus salvini* 5 7 3 15
Lepidophyma tuxtlae* 5 4 2 1]
Ficimia variegata* 5 gf 2 14
Tantilla slavensi** 5 7 2 14
Conophis morai** 6 v2 4 17
Geophis bicolor* 5 8 2 15
Geophis blanchardi* *) 8 2 15
Geophis chalybeus** 6 - 2 15
Rhadinaea cuneata* 6 7 2 15
Rhadinaea forbesi** 5 8 2 15
Rhadinaea macdougalli* 5 5 2 12
Rhadinaea quinquelineata* 5 8 2 15
Sibon linearis** 6 8 2) 16
Cerrophidion petlalcalensis* 5 8 5 18
Amphib. Reptile Conserv. 125 September 2021 | Volume 15 | Number 2 | e285
The herpetofauna of Veracruz, Mexico
Table 18. Environmental Vulnerability Scores (EVS) for members of the herpetofauna of Veracruz, Mexico, that are currently Not
Evaluated (NE) by the IUCN. Non-native taxa are excluded. * = country endemic; ** = state endemic.
Environmental Vulnerability Score (EVS)
Reproductive
Taxon Geographic Ecological Total
distribution distribution meddle Deere of score
persecution
Rhinella horribilis 3
Hyalinobatrachium viridissimum 1]
QOuilticohyla zoque* 14
Lithobates brownorum 8
Aquiloeurycea cafetalera* 17
Ophisaurus incomptus* 15
Laemanctus longipes 9
Norops beckeri 12
Norops biporcatus 10
Norops laeviventris 9
Norops lemurinus 8
Norops petersi 9
Norops purpuronectes* 16
Norops rodriguezii 10
Norops sericeus 8
Norops tropidonotus 9
Norops uniformis 13
Ctenosaura acanthura 12
Iguana iguana |e:
Marisora lineola 10
Sceloporus aureolus* 15
Sceloporus cyanogenys 13
Plestiodon sumichrasti 12
Gonatodes albogularis 1]
Scincella cherriei 8
Holcosus amphigrammus* 1]
Lepidophyma zongolica* 16
Xenosaurus tzacualtipantecus* 17
Boa imperator 10
Conopsis acuta* 14
Drymobius margaritiferus
Ficimia olivacea*
Ficimia publia
Lampropeltis polyzona
Lampropeltis triangulum
Leptophis ahaetulla
Oxybelis aeneus
Oxybelis fulgidus
Spilotes pullatus
Stenorrhina degenharatii
Stenorrhina freminvillii
Trimorphodon biscutatus
Amastridium sapperi
Clelia scytalina
Coniophanes fissidens
Coniophanes taeniatus*
Geophis lorancai*
Imantodes cenchoa
Imantodes gemmistratus
LOW AWN WW eRe RaW EWM WD EWN Re RE One BBN HK WR WR WWHE BUH NAWADNWWHBMABWNPAN ANN WWWWDWRHADNHN He
BRBRODANIAHPMNNNWOADBMNABNNAN WWWYIYWNABRE NWR NH WER WN DH OOWNNANDAAIWWAANWWOBNWAANOnWO Hr
WWANnANnAAANnBBRR ERP NBN NNBPENNNWWANHAHWHHRWHRNADNNANA WN W WD WW WW WD AD W WW WW WW WWW WN Ber We
Leptodeira polysticta
Leptodeira septentrionalis
Oxyrhopus petolarius 14
Sibon nebulatus 5
Tretanorhinus nigroluteus 10
Tropidodipsas fasciata 13
Xenodon rabdocephalus 13
Epictia phenops 6
Epictia resetari* 13
Thamnophis conanti* 17
Thamnophis marcianus 10
Thamnophis proximus a
Scaphiodontophis annulatus 1]
Bothrops asper 12
Crotalus mictlantecuhtli** 16
Crotalus totonacus* 17
Ophryacus smaragdinus* 14
Terrapene mexicana* 19
Kinosternon leucostomum 10
Kinosternon scorpioides 10
Amphib. Reptile Conserv. 126 September 2021 | Volume 15 | Number 2 | e285
Torres-Hernandez et al.
Table 19. Environmental Vulnerability Scores (EVS) for members of the herpetofauna of Veracruz, Mexico, that are currently
allocated to the Least Concern (LC) category by the IUCN. Non-native taxa are excluded. * = country endemic; ** = state endemic.
Environmental Vulnerability Score (EVS)
Taxon Phe ae Ecological cL Dieses f Total
istribution distribution 3 score
persecution
Anaxyrus compactilis* 5 8 l 14
Incilius occidentalis* 5 5 1 11
Incilius valliceps 3 2 l 6
Craugastor loki 2 4 4 10
Craugastor mexicanus* 5 v 4 16
Eleutherodactylus cystignathoides 2 6 4 12
Eleutherodactylus nitidus* 5 ) 4 2
Dendropsophus ebraccatus 3 6 1 10
Dendropsophus microcephalus 3 3 1 ZF
Dryophytes arenicolor 2 4 l 7
Dryophytes eximius* 2) 4 1 10
Dryophytes plicatus* 5 5 l 11
Sarcohyla bistincta* 5 3 1 9
Scinax staufferi 2 1 1 4
Smilisca baudinii 1 1 1 3
Tlalocohyla loquax 3 3 l 7
Tlalocohyla picta 2 5 l 8
Trachycephalus vermiculatus l 2 1 4
Triprion spinosus 3 6 5) 14
Engystomops pustulosus 3 2 2 7
Leptodactylus fragilis 1 2 2 5
Leptodactylus melanonotus l 3 2 6
Gastrophryne elegans 2 5 l 8
Hypopachus ustus 2 4 l 7
Hypopachus variolosus 2 1 1 4
Agalychnis taylori 3 5 3 1]
Lithobates berlandieri 4 2 1 u)
Lithobates maculatus 3 l 1 5
Lithobates montezumae* 5 7 1 13
Lithobates spectabilis* 5 6 1 12
Lithobates vaillanti 3 S 1 9
Rhinophrynus dorsalis 2 5 1 8
Scaphiopus couchii 1 1 l 3
Spea multiplicata 1 4 l 6
Ambystoma velasci* 5 4 1 10
Aquiloeurycea cephalica* 5 5 4 14
Bolitoglossa mexicana 4 3 4 1]
Bolitoglossa occidentalis 4 3 4 1]
Bolitoglossa platydactyla* 5 6 4 15
Bolitoglossa rufescens l 4 4 9
Pseudoeurycea leprosa* 5 7 4 16
Siren intermedia 3 8 1 12
Dermophis mexicanus 4 3 4 1]
Crocodylus moreletii 2 >) 6 13
Barisia imbricata* 5 6 3 14
Gerrhonotus liocephalus 2 l 3 6
Gerrhonotus ophiurus* 5 4 3 12
Basiliscus vittatus 1 3 3 7
Corytophanes hernandesii 4 6 3 13
Laemanctus serratus 2 S 3 8
Norops compressicauda* 5 7 3 15
Amphib. Reptile Conserv. 127 September 2021 | Volume 15 | Number 2 | e285
The herpetofauna of Veracruz, Mexico
Table 19 (continued). Environmental Vulnerability Scores (EVS) for members of the herpetofauna of Veracruz, Mexico, that are currently
allocated to the Least Concern (LC) category by the IUCN. Non-native taxa are excluded. * = country endemic; ** = state endemic.
Environmental Vulnerability Score (EVS)
taxon Geographic Feologcat = RepduenG ot
distribution distribution ! score
persecution
Anelytropsis papillosus* 5 4 l 10
Celestus enneagrammus* 5 6 3 14
Celestus legnotus* a 6 3 14
Coleonyx elegans 2 3 4 i)
Holbrookia propinqua 4 8 3 15
Phrynosoma braconnieri* 5 e; 3 15
Phrynosoma orbiculare* 5 4 3 12
Sceloporus aeneus* 5 5 3 13
Sceloporus bicanthalis* 5 3) 3 13
Sceloporus formosus* 5 i 3 15
Sceloporus grammicus 2 4 3 9
Sceloporus internasalis 4 4 3 1]
Sceloporus jalapae* 5 > 3 13
Sceloporus mucronatus * 5 2) 3 13
Sceloporus scalaris* 5 4 3 12
Sceloporus serrifer 2 l 3 6
Sceloporus spinosus* 5 4 3 1Z
Sceloporus teapensis 4 6 3 13
Sceloporus torquatus* 5 3 3 1]
Sceloporus variabilis 1 1 3 5
Plestiodon brevirostris* Bs) 3 3 11
Plestiodon copei* 5 6 3 14
Plestiodon lynxe* 5 2 3 10
Plestiodon tetragrammus 4 5 3 12
Sphaerodactylus glaucus 4 > 5 12
Scincella gemmingeri* 5 3 3 1]
Scincella silvicola* 5 4 3 12
Aspidoscelis costata* s 3 3 1]
Aspidoscelis deppii 1 4 3 8
Aspidoscelis gularis a 4 3 9
Aspidoscelis guttatus* 5 4 3 12
Lepidophyma flavimaculatum l 5 2 8
Lepidophyma pajapanense * 5 6 2 13
Lepidophyma sylvaticum* 5 4 2 1]
Xenosaurus rectocollaris* 5 8 3 16
Coluber constrictor 1 6 3 10
Conopsis lineata* 5 6 wv: 13
Conopsis nasus* 5 4 By 11
Dendrophidion vinitor 3 q 3 13
Drymarcon melanurus l 1 4 6
Drymobius chloroticus l 3 4 8
Ficimia streckeri 3 7 2 12
Leptophis mexicanus l l 4 6
Masticophis flagellum 1 3 4 8
Masticophis mentovarius l l 4 6
Masticophis schotti 4 5 4 13
Mastigodryas melanolomus l 1 4 6
Pantherophis emoryi é 6 4 13
Phrynonax poecilonotus 3 4 3 10
Pituophis deppei* 5 5 4 14
Pituophis lineaticollis 2 ) 4 8
Amphib. Reptile Conserv. 128 September 2021 | Volume 15 | Number 2 | e285
Torres-Hernandez et al.
Table 19 (continued). Environmental Vulnerability Scores (EVS) for members of the herpetofauna of Veracruz, Mexico, that are currently
allocated to the Least Concern (LC) category by the IUCN. Non-native taxa are excluded. * = country endemic; ** = state endemic.
Environmental Vulnerability Score (EVS)
taxon Geographic —Feologcat —epoduetnG ot
distribution distribution ! score
persecution
Pseudelaphe flavirufa 2 4 4 10
Salvadora bairdi* 5 6 4 15
Salvadora grahamiae 4 2 4 10
Senticolis triaspis 2 l 3 6
Tantilla bocourti* 5 2 2 9
Tantilla rubra 2 1 2 5
Tantilla schistosa 3 3 2 8
Tantillita lintoni 4 6 2 12
Trimoprhodon tau* 5 4 4 13
Adelphicos quadrivirgatum 4 4 2 10
Adelphicos visoninum 4 3 l 8
Chersodromus liebmanni* 5 5 Z 12
Coniophanes bipunctatus 1 5 3 9
Coniophanes imperialis 2 3 3 8
Coniophanes quinquevittatus 4 6 3 13
Conophis lineatus 2 3 4 9
Diadophis punctatus 1 l 2 4
Geophis carinosus 2 4 2 8
Geophis mutitorques* 5 6 2 13
Geophis semidoliatus* 5 6 Z 13
Leptodeira frenata 4 4 4 12
Leptodeira maculata 2 l 4 7
Ninia diademata 4 3 2 9
Ninia sebae 1 1 2 4
Pliocercus elapoides 4 l 5 10
Rhadinaea decorata 1 6 2 9
Rhadinella schistosa* 5 6 2 13
Sibon dimidiatus 1 a) 4 10
Tropidodipsas sartorii 2 2 5 9
Micrurus diastema* 2 1 5 8
Micrurus elegans 4 4 5 13
Micrurus limbatus** 5 te 5 17
Micrurus tener 1 = 5 11
Rena dulcis 4 8 1 13
Rena myopica* 5 7 1 13
Nerodia rhombifer 1 5 4 10
Storeria dekayi 1 4 »: 7
Storeria storerioides* a 4 2 1]
Thamnophis chrysocephalus* 5 5 4 14
Thamnophis cyrtopsis 2 l 4 7
Thamnophis eques 2 2 4 8
Thamnophis godmani* 5 5 4 14
Thamnophis pulchrilatus* 5 6 4 15
Thamnophis scalaris* 5 5 4 14
Thamnophis sumichrasti* 5 6 4 13
Amerotyphlops tenuis 4 6 l 1]
Agkistrodon taylori* 5 F 5 17
Crotalus aquilus* 5 6 5 16
Crotalus atrox 1 3 5 9
Crotalus intermedius* 5 5 5 15
Crotalus molossus 2 l 5 8
Amphib. Reptile Conserv. 129 September 2021 | Volume 15 | Number 2 | e285
The herpetofauna of Veracruz, Mexico
Table 19 (continued). Environmental Vulnerability Scores (EVS) for members of the herpetofauna of Veracruz, Mexico, that are currently
allocated to the Least Concern (LC) category by the IUCN. Non-native taxa are excluded. * = country endemic; ** = state endemic.
Taxon Geographic
distribution
Crotalus polystictus* 5
Crotalus ravus* 5
Crotalus scutulatus 2
Crotalus triseriatus* 5
Metlapilcoatlus nummifer* D
Metlapilcoatlus olmec 4
Kinosternon flavescens 3
Gopherus berlandieri 4
amphigrammus*, and Scaphiodontophis annulatus),
12 (Norops beckeri, Ctenosaura acanthura, Iguana
iguana, Plestiodon sumichrasti, and Bothrops asper),
or 13 (Norops uniformis, Sceloporus cyanogenys,
Clelia scytalina, Tropidodipsas fasciata, Xenodon
rabdocephalus, and Epictia resetari*) should be placed
in the NT category. The five species with an EVS of
14 (Quilticohyla zoque*, Conopsis acuta*, Geophis
lorancai*, Oxyrhopus petolarius, and Ophryacus
smaragdinus* ) should be placed in the VU category; and
all but one of these species are country endemics. The
Six species with an EVS of 15 (Ophisaurus incomptus* ,
Sceloporus aureolus*, and Coniophanes taeniatus* ) or
16 (Norops purpuronectes*, Lepidophyma zongolica* ,
and Crotalus mictlantecuhtli**) should be allocated
to the EN category; and all these species are country
and state endemics. Finally, the five species with an
EVS of 17 (Aquiloeurycea cafetalera*, Xenosaurus
tzacualtipantecus* , Thamnophis conanti* , and Crotalus
totonacus*) or 19 (Terrapene mexicana*) should be
placed in the CR category; and all of these species are
country endemics.
The largest number of species in the herpetofauna
of Veracruz is placed in the LC category (Table 19).
Among this group of 161 species are 34 anurans,
eight salamanders, one caecilian, one crocodylian, 115
squamates, and two turtles. Of these 161 species, 96 are
non-endemics, 64 are country endemics, and one is a state
endemic. The EVS values range from 3 to 18, just one
less than the range for the entire Veracruz herpetofauna.
Environmental Vulnerability Score (EVS)
peotogical — Reprtucivg Tata
distribution persecution score
6 5 16
5 14
4 5 11
6 5 16
3 5 13
6 5 15
6 3 12
8 6 18
Seventy-four of these species have EVS values of 3 to 10,
and in our opinion can be retained in the LC category. The
56 species with an EVS of 11 to 13 should be placed in
the NT category. Twelve species have an EVS of 14, and
should be allocated to the VU category. The 16 species
with an EVS of 15 (Bolitoglossa platydactyla*, Norops
compressicauda*, Holbrookia propinqua, Phrynosoma
braconnieri*, Sceloporus formosus*, Salvadora
bairdi*, Thamnophis pulchrilatus*, T: sumichrasti*,
Crotalus intermedius*, and Metlapilcoatlus olmec) or
16 (Craugastor mexicanus*, Pseudoeurycea leprosa*,
Xenosaurus rectocollaris*, Crotalus aquilus*, C.
polystictus*, and C. triseriatus*) should be relegated to
the EN category. Finally, the three species with an EVS
of 17 (Micrurus limbatus** and Agkistrodon taylori*) or
18 (Gopherus berlandieri) should be placed in the CR
category.
Relative Herpetofaunal Priority
The concept of Relative Herpetofaunal Priority (RHP)
was initiated by Johnson et al. (2015a) and consists of
a simple means for determining the relative importance
of the herpetofauna of any geographical entity (e.g.,
a physiographic region, a municipality, or a state).
Ascertaining the RHP depends on the use of two methods:
(1) computation of the proportion of country and state
endemics relative to the entire physiographic regional
herpetofauna; and (2) calculation of the absolute number
of high EVS category species in each physiographic
Table 20. Number of herpetofaunal species in the four distributional status categories among the four physiographic regions of
Veracruz, Mexico. Rank order is based on the sum of country and state endemics.
Distributional category
Physiographic region Country
Non-endemics ;
endemics
Gulf Coastal Lowlands 142 35
Sierra de Los Tuxtlas 123 30
Sierra Madre Oriental 103 109
Transmexican Volcanic Belt 94 102
Amphib. Reptile Conserv.
Total Rank
State Non-natives order
endemics
5 8 190 4
19 yi 179 3
21 3 236 1
21 5 222 2
130 September 2021 | Volume 15 | Number 2 | e285
Torres-Hernandez et al.
Table 21. Number of herpetofaunal species in the three EVS categories among the four physiographic regions of Veracruz, Mexico.
Rank order is determined by the relative number of high EVS species. Non-native and marine species are excluded.
Physiographic province Low EVS beeen High EVS Total pats
Gulf Coastal Lowlands 74 68 35 177 4
Sierra de Los Tuxtlas 69 59 39 167 3
Sierra Madre Oriental 70 85 78 233 2
Transmexican Volcanic Belt 71 67 79 217 1
regional herpetofauna. The pertinent data for these two
approaches are shown in Tables 20 and 21.
Based on the relative number of combined country and
state endemic species in each of the four physiographic
regions and the rank each region occupies (Table 20),
the SMO region occupies rank number one, with 130
endemics of a total of 236 species (55.1%). The other
ranks are as follows: second 1s TVB (123 of 222, 55.4%):
third is SLT (49 of 179, 27.4%); and fourth is GCL (40
of 190, 21.1%).
The data on the relative number of high vulnerability
species (Table 21) indicate that rank number one 1s
occupied by the TVB region, with 79 of its total of 217
species (36.4%), followed closely by the SMO region,
occupying rank two, with 78 of its total of 233 species
(33.5%). The other two ranks are as follows: third is SLT
(39 of 167, 23.4%) and fourth is GCL (35 of 177, 19.8%).
Although the rankings of the SMO and TVB regions are
reversed when considering endemic species (SMO = 1, TVB
= 2) compared to high vulnerability species (TVB = 1, SMO
= 2), the numbers of species involved and their proportions
of their regional total numbers of species are similar to one
another, especially with regard to the accounting for the high
vulnerability species, which differ only by a single species
(TVB = 79 species, SMO = 78 species). The rankings for
the other two regions (GCL and SLT) are the same for the
two RHP measures (Tables 20-21).
Even given the reversal of rankings between the
SMO and TVB regions, evidently the SMO region is
the most important from the standpoint of conservation
(Rank one). This region houses the largest number
of country and state endemics and the second largest
number of high vulnerability species, differing by only
a single species (78 vs. 79). The 130 endemic species
include 28 anurans (25 country endemics and three state
endemics), 25 salamanders (11 country endemics and 14
state endemics), and 77 squamates (73 country endemics
and four state endemics). These 130 species are listed in
Table 5, with either a single asterisk (country endemic) or
a double asterisk (state endemic). The SMO also includes
78 high vulnerability species, consisting of 15 anurans,
23 salamanders, and 40 squamates. Of these 78 species,
56 are country endemics, 21 are state endemics, and one
is a non-endemic; and their EVS ranges from 14 to 18,
as follows:
Anaxyrus compactilis* (14)
Incilius cristatus* (14)
Amphib. Reptile Conserv. 131
Craugastor berkenbuschii* (14)
Craugastor decoratus* (15)
Craugastor mexicanus* (16)
Craugastor rhodopis* (14)
Craugastor spatulatus* (16)
Eleutherodactylus verrucipes* (16)
Eleutherodactylus verruculatus** (18)
Bromeliohyla dendroscarta* (17)
Megastomatohyla mixomaculata* (14)
Megastomatohyla nubicola** (14)
Sarcohyla pachyderma** (15)
Sarcohyla siopela* (15)
Triprion spinosus (14)
Aquiloeurycea cafetalera* (17)
Aquiloeurycea cephalica* (14)
Aquiloeurycea praecellens** (18)
Bolitoglossa platydactyla* (15)
Chiropterotriton aureus ** (18)
Chiropterotriton terrestris* (18)
Isthmura gigantea* (16)
Isthmura naucampatepetl** (17)
Parvimolge townsendi** (16)
Pseudoeurycea firscheini* (18)
Pseudoeurycea granitum** (16)
Pseudoeurycea leprosa* (16)
Pseudoeurycea lineola** (14)
Pseudoeurycea lynchi* (17)
Pseudoeurycea melanomolga* (16)
Pseudoeurycea nigromaculata** (17)
Thorius dubitus* (16)
Thorius [unaris** (18)
Thorius magnipes** (17)
Thorius minydemus** (18)
Thorius munificus** (18)
Thorius pennatulus** (15)
Thorius troglodytes** (16)
Abronia graminea* (15)
Abronia taeniata* (15)
Barisia imbricata* (14)
Mesaspis antauges** (16)
Norops cymbops* (17)
Norops schiedii** (16)
Celestus enneagrammus* (14)
Celestus legnotus* (14)
Phrynosoma braconnieri* (15)
Sceloporus aureolus* (15)
Sceloporus formosus* (15)
Sceloporus megalepidurus* (14)
September 2021 | Volume 15 | Number 2 | e285
The herpetofauna of Veracruz, Mexico
Sceloporus salvini* (15)
Plestiodon copei* (14)
Lepidophyma zongolica* (16)
Xenosaurus rectocollaris* (16)
Xenosaurus tzacualtipantecus* (17)
Pituophis deppei* (14)
Salvadora bairdi* (15)
Tantilla shawi* (15)
Geophis blanchardi* (15)
Geophis chalybeus** (15)
Geophis lorancai* (14)
Rhadinaea cuneata* (15)
Rhadinaea forbesi** (15)
Rhadinaea quinquelineata* (15)
Thamnophis chrysocephalus* (14)
Thamnophis conanti* (17)
Thamnophis godmani* (14)
Thamnophis pulchrilatus* (15)
Thamnophis scalaris* (14)
Thamnophis sumichrasti* (15)
Agkistrodon taylori* (17)
Cerrophidion petlalcalensis* (18)
Crotalus intermedius* (15)
Crotalus ravus* (14)
Crotalus totonacus* (17)
Crotalus triseriatus* (16)
Ophryacus smaragdinus* (14)
Ophryacus undulatus* (15)
The TVB region (Rank two) is of similar conservation
significance, as it contains 123 country and _ state
endemic species, and 79 high vulnerability species. The
123 endemic species comprise 27 anurans (25 country
endemics and two state endemics), 29 salamanders (15
country endemics and 14 state endemics), 66 squamates
(61 country endemics and five state endemics), and one
turtle (one country endemic). The TVB also harbors
79 high vulnerability species (Table 21), including 14
anurans, 27 salamanders, 37 squamates, and one turtle.
Of the 79 endemic high vulnerability species, 41 are
country endemics and 38 are state endemics, and their
EVS ranges from 14 to 18, as follows:
Anaxyrus compactilis* (14)
Incilius cristatus* (14)
Craugastor berkenbuschii* (14)
Craugastor decoratus* (15)
Craugastor mexicanus* (16)
Craugastor rhodopis* (14)
Craugastor spatulatus* (16)
Eleutherodactylus verruculatus** (18)
Bromeliohyla dendroscarta* (17)
Megastomatohyla mixomaculata* (14)
Megastomatohyla nubicola** (14)
Sarcohyla siopela* (15)
Triprion spinosus (14)
Lithobates johni* (14)
Amphib. Reptile Conserv.
132
Aquiloeurycea cafetalera* (17)
Aquiloeurycea cephalica* (14)
Aquiloeurycea praecellens** (18)
Bolitoglossa platydactyla* (15)
Chiropterotriton casasi** (18)
Chiropterotriton ceronorum* (17)
Chiropterotriton chiropterus* (16)
Chiropterotriton chondrostega* (17)
Chiropterotriton lavae** (18)
Chiropterotriton nubilus** (18)
Chiropterotriton perotensis** (18)
Chiropterotriton totonacus** (18)
Isthmura corrugata** (18)
Isthmura gigantea* (16)
Isthmura naucampatepetl** (17)
Parvimolge townsendi** (16)
Pseudoeurycea firscheini* (18)
Pseudoeurycea granitum** (16)
Pseudoeurycea leprosa* (16)
Pseudoeurycea lineola** (14)
Pseudoeurycea lynchi* (17)
Pseudoeurycea melanomolga* (16)
Pseudoeurycea nigromaculata** (17)
Thorius dubitus* (16)
Thorius pennatulus** (15)
Thorius spilogaster** (17)
Thorius troglodytes** (16)
Abronia graminea* (15)
Abronia taeniata* (15)
Barisia imbricata* (14)
Mesaspis antauges** (16)
Ophisaurus incomptus* (15)
Norops cymbops* (17)
Norops schiedii** (16)
Celestus enneagrammus* (14)
Phrynosoma braconnieri* (15)
Sceloporus formosus* (15)
Sceloporus megalepidurus* (14)
Sceloporus salvini* (15)
Plestiodon copei* (14)
Lepidophyma zongolica* (16)
Pituophis deppei* (14)
Salvadora bairdi* (15)
Coniophanes taeniatus* (15)
Conophis morai** (17)
Geophis bicolor* (15)
Geophis blanchardi* (15)
Geophis lorancai* (14)
Rhadinaea cuneata* (15)
Thamnophis chrysocephalus* (14)
Thamnophis godmani* (14)
Thamnophis scalaris* (14)
Thamnophis scaliger* (15)
Thamnophis sumichrasti* (15)
Cerrophidion petlalcalensis* (18)
Crotalus aquilus* (16)
Crotalus intermedius* (15)
September 2021 | Volume 15 | Number 2 | e285
Torres-Hernandez et al.
Crotalus mictlantecuhtli** (16)
Crotalus polystictus* (16)
Crotalus ravus* (14)
Crotalus totonacus* (17)
Crotalus triseriatus* (16)
Ophryacus smaragdinus* (14)
Ophryacus undulatus* (15)
Kinosternon herrerai* (14)
Rank three 1s occupied by the Sierra de Los Tuxtlas
region (Table 20), which contains 49 country and state
endemics, including 13 anurans (nine country and four
state endemics), eight salamanders (three country and
five state endemics), and 28 squamates (18 country and
10 state endemics). This region also supports 39 high
vulnerability species (Table 21), including 10 anurans,
eight salamanders, 17 squamates, and four turtles. Of
these 39 high vulnerability species, 15 are country
endemics, 17 are state endemics, and seven are non-
endemics. Their EVS ranges from 14 to 18.
Incilius cristatus* (14)
Craugastor berkenbuschii* (14)
Craugastor megalotympanum ** (18)
Craugastor rhodopis* (14)
Craugastor vulcani** (17)
Eleutherodactylus verrucipes* (16)
Bromeliohyla dendroscarta* (17)
Ecnomiohyla valancifer** (18)
Megastomatohyla mixomaculata* (14)
Triprion spinosus (14)
Bolitoglossa alberchi* (15)
Bolitoglossa platydactyla* (15)
Pseudoeurycea lineola** (14)
Pseudoeurycea nigromaculata** (17)
Pseudoeurycea orchimelas** (17)
Pseudoeurycea werleri* (17)
Thorius narismagnus** (18)
Thorius pennatulus** (15)
Abronia chiszari** (17)
Abronia reidi** (18)
Norops barkeri* (15)
Norops duellmani** (17)
Celestus ingridae** (17)
Sceloporus salvini* (15)
Plestiodon copei* (14)
Ficimia variegata* (14)
Salvadora bairdi* (15)
Tantilla slavensi** (14)
Coniophanes taeniatus* (15)
Conophis morai** (17)
Oxyrhopus petolarius (14)
Sibon linearis** (16)
Micrurus limbatus** (17)
Crotalus mictlantecuhtli** (16)
Metlapilcoatlus olmec (15)
Chelydra rossignonii (17)
Amphib. Reptile Conserv.
Kinosternon acutum (14)
Claudius angustatus (14)
Staurotypus triporcatus (14)
Rank four is occupied by the GCL region (Table 20),
which includes 40 country and state endemic species,
and 35 high vulnerability species. The 40 endemic
Species constitute 10 anurans (eight country and two state
endemics), two salamanders (two country endemics),
26 squamates (23 country and three state endemics),
and two turtles (two country endemics). The 35 high
vulnerability species in the GCL (Table 21) include nine
amphibians and 26 reptiles, collectively composed of
seven anurans, two salamanders, 17 squamates, and nine
turtles. Of the 35 species, 21 are country endemics, three
are state endemics, and 11 are non-endemics; and their
EVS ranges from 14 to 19, the entire span for the high
vulnerability species. These 35 species are as follows:
Craugastor berkenbuschii* (14)
Craugastor rhodopis* (14)
Craugastor vulcani** (17)
Eleutherodactylus longipes* (15)
Exerodonta bivocata* (15)
Quilticohyla zoque* (14)
Triprion spinosus (14)
Bolitoglossa platydactyla* (15)
Bolitoglossa veracrucis* (17)
Abronia taeniata* (15)
Ophisaurus ceroni** (14)
Norops alvarezdeltoroi* (17)
Norops barkeri* (15)
Norops compressicauda* (15)
Norops purpuronectes* (16)
Holbrookia propinqua (15)
Conopsis acuta* (14)
Ficimia variegata* (14)
Pituophis deppei* (14)
Coniophanes taeniatus* (15)
Oxyrhopus petolarius (14)
Rhadinaea cuneata* (15)
Agkistrodon taylori* (17)
Crotalus intermedius* (15)
Crotalus mictlantecuhtli** (16)
Metlapilcoatlus olmec (15)
Chelydra rossignonii (17)
Dermatemys mawii (17)
Terrapene mexicana* (19)
Trachemys venusta (19)
Kinosternon acutum (14)
Kinosternon herrerai* (14)
Claudius angustatus (14)
Staurotypus triporcatus (14)
Gopherus berlandieri (18)
Of all the species in the herpetofauna of Veracruz, 134
are high vulnerability taxa (Table 8), and the proportions
September 2021 | Volume 15 | Number 2 | e285
The herpetofauna of Veracruz, Mexico
of these species documented in the four physiographic
regions are as follows: SMO (58.2%); TVB (59.0%);
SLT (29.1%); and GCL (26.1%). These data are of
considerable importance in designing management plans
for the protected areas in the state (see discussion below).
Protected Areas in Veracruz
Protected areas are the regions legally established for
conserving the habitats and the organisms they support
for perpetuity. Such areas are intended to remain unaltered
by the destructive effects produced by humans, whose
populations generally are found along the periphery of
these areas. Protected areas, therefore, exist as islands
of natural habitat within the seas of areas occupied
by members of our own species. Ramirez-Bautista
et al. (2020) identified our species, Homo sapiens, as
“the principal invasive species,” in the sense of “any
nonnative species that significantly modifies or disrupts
the ecosystems it colonizes” (http://www.britannica.
com/science/invasive-species). So, curiously, protected
areas are set up by some members of our species to
protect a given area from the destructive effects of other
members of our species. Importantly, given that that the
populations of this principal invasive species grow at an
exponential rate of increase, then the continued existence
of protected areas always will be a matter of critical
concern that requires constant vigilance.
Therefore, the question arises as to how well the
herpetofauna is being protected by the system of protected
areas that exist in Veracruz. To initiate this examination,
a set of data on various features of protected areas in the
state was compiled and is shown in Table 22.
A total of only six protected areas exists in Veracruz,
including four national parks, one biosphere reserve,
and the sixth is an Area de Proteccién de Flora y Fauna.
These six areas were established on dates ranging from
1937 to 2009, and they range in size from 11,530.7 ha
(115.3 km?) to 155,122.5 ha (1,551.2 km/’). All of these
areas are administered at the federal level. Four of the six
areas contain a complete array of facilities; however, two
of the six have no facilities for visitors. Unfortunately,
all six areas are occupied to some degree by landowners,
which is an undesirable situation since the goals of the
landowners likely conflict with those of conservation.
Management plans, however, are available for all the
areas, except one.
Herpetofaunal surveys have been completed for
only one of the six protected areas (1.e., Reserva de
la Biosfera Los Tuxtlas). Nonetheless, the available
information on the known herpetofauna from these
Six areas was collated and is shown in Table 23, and
summarized in Table 24.
Of the 359 species recorded to date from the state
of Veracruz, 265 (73.8%) have been documented
collectively in the six protected areas (Table 24). The
numbers of species in each of the six areas range from
Amphib. Reptile Conserv.
five in the Sistema Arrecifal Lobos-Tuxpan to 179
in the Reserva de la Biosfera Los Tuxtlas. Of the 265
species recorded from the six areas, 138 (52.1%) are
non-endemics, 89 (33.6%) are country endemics, 31
(11.7%) are state endemics, and seven (2.6%) are non-
native species. Interestingly, the ratio of non-native to
country endemics in these six parks varies among them.
In Parque Nacional Cafién del Rio Blanco the ratio is
close to one (66 to 61; 1.1). In Reserva de la Biosfera Los
Tuxtlas and Sistema Arrecifal Veracruzano, the ratios are
several times in favor of the non-native species relative
to the country endemics: (123 to 30; 4.1) and (47 to 16;
2.9), respectively. In Parque Nacional Pico de Orizaba,
the relative proportions are reversed (4 to 37; 0.11).
The representation of protected areas among the
four physiographic regions of the state is biased heavily
in favor of the GCL (Table 22), which, as previously
demonstrated, is the region of least conservation
significance. In addition, the area we identified above as
the most significant from a conservation perspective, 1.e.,
the Sierra Madre Oriental, has no protected areas within
its borders. Rectifying this imbalance should be of the
highest priority for additional conservation efforts at the
federal governmental level.
In Veracruz, 93 herpetofaunal native species are not
represented in any of the six protected areas. These
species, along with their distributional status and the
physiographic regions from which they are known are
as follows:
Incilius macrocristatus (GCL)
Incilius nebulifer (GCL, SMO, TVB)
Eleutherodactylus longipes* (GCL)
Dryophytes arenicolor (TVB)
Duellmanohyla chamulae* (GCL)
Exerodonta bivocata* (GCL)
Ptychohyla zophodes* (SMO, TVB)
Quilticohyla zoque* (GCL)
Sarcohyla pachyderma** (SMO)
Tlalocohyla godmani* (SMO, TVB)
Lithobates johni* (TVB)
Lithobates montezumae* (SMO, TVB)
Lithobates spectabilis* (SMO, TVB)
Aquiloeurycea cafetalera* (SMO, TVB)
Aquiloeurycea praecellens** (SMO, TVB)
Bolitoglossa veracrucis* (GCL)
Chiropterotriton aureus ** (SMO)
Chiropterotriton casasi** (TVB)
Chiropterotriton terrestris * (SMO)
Chiropterotriton totonacus** (TVB)
Isthmura corrugata** (TVB)
Isthmura gigantea* (SMO, TVB)
Pseudoeurycea granitum** (SMO, TVB)
Pseudoeurycea lynchi* (SMO, TVB)
Thorius lunaris** (SMO)
Thorius magnipes** (SMO)
Thorius minydemus** (SMO)
September 2021 | Volume 15 | Number 2 | e285
Torres-Hernandez et al.
September 2021 | Volume 15 | Number 2 | e285
135
JUSUIUISA0L) OpeIeATV
be spur] MoT : pees. jeuo1lseN OUBZNIOBIOA,
ON SOA SOA Suv Byseoy FINO [elope A OFY [Op Bo0g “ZNIDeIOA, LV 91S $9 7661 ISNSNV PZ anbieg BINA PUIAISIS
l JI UBOIXO| ap &ISOD PR] & OUI] Tes
USUIUIDAO wal
5 es e ~ spue]Mo'T } bites 9 uedxny, A enyeruey Lae ‘stint A e10]4 Op uedxn]-sogoT
N ‘A ‘A sav yeqseog JnNH Ha te OP SISOD SE] B QJUDI ST ILS Of 600¢ Sunt ¢ UOI999}01g [eJIOOITV BUID}STS
ine op valy
USWUIDAO PEATE
. aa eS KS oq OTUBdTOA, } iene 2) “‘eusas op ejnuosTyoyeyD Jeon varte yeuo1seN apart y uot
N ‘A ‘A WV UBOTXOUISUBIT, Dae, “‘eonyoyorey |, “eplad l00sZ 61 Leo! iv onbieg RAO Pole
XS eT “ooyenyeoyed
uedeleg
JUOUIUIOAOD ‘uedeojos ‘zoreng ap
‘ d ‘ueded
sax sox sox A Ss seyXny jeropog ue eomnyeIeL uedeAroopy fe ZZ1S1 8661 BIDJSOI P] sepxny, S07
WU ‘Vv SOT Op BLIDIS WesTKepy OoRUIDIVD “VI}XN], SsIpUy JOQUISAON €Z ap BAIOSAY
ues ‘eyxXny osenues
“epeqe) “Y [osuy
A‘S spur] MoT ee 82) OorX yeuolseN pedayedureoynen
ON SOX SOX ere [elope] ‘soAoy SO] op URSeNYX] EL O€S II LE6I APN 7 ;
WU ‘Vv [eqseog JINH wesIxayy ‘oomnjenyesy ‘a101og onbieg 0 91019q dp BJOD
edwioz1y
Pepsos ‘osulz][nNoyv
‘opesjaq [orjey
by 5 ea A'S spue[MoT Peni “‘oourlg ory ‘ejinby aA Sie yeuo1oeN oouerlq
N N ‘A WV Jeyseog JINH dire i “eyelle “ezopuss| 8L 66 87 861 YIPIN CC onbieg Oly [Op uoUeD
; "7 OULIOWIB ‘SoTesON
“‘ueoeZz}V ‘ueINbozoeyx]
‘UILIO “eqezlIO
yea SIABTEAR NEI SO EE LAE TEAL moray UOTJIIpsLN sorediorun (vy) var dd1DIP JO 33B £.1039}8 sue
jeuneyoyad.z0y jUOWIOSvUR kq poidndsQ es SOIPTPLFNB aydevasoisdyd HOFPsEne’ HTeCPOTUn TAL q V PJo ed WO N
“SIOJISIA 1OJ SOTP[IOVJ = A pure
‘skemujed Jo stuajsAs = § ‘sprensd yled = Y ‘SOIAIOS DATILIISIUILUPL = VY ‘SONIIOVJ I[QLITAR IOJ SUOTILIADIQGY ‘OOIXd/| ‘ZNIOVIOA, Ul SBITY P2}99}01g [PINION XIS dy} JO soNsIIAOvIeYD ZZ IquL
Amphib. Reptile Conserv.
The herpetofauna of Veracruz, Mexico
Table 23. Distribution of herpetofaunal species in the Natural Protected Areas of Veracruz, Mexico, based on herpetofaunal surveys.
* = species endemic to Mexico; ** = species endemic to Veracruz; and *** = non-native species.
Natural Protected Area
Taxon Cafion del Cofrede Peroteo Los Picode Sistema Arrecifal ale
Rio Blanco Nauhcampatépetl Tuxtlas Orizaba Lobos-Tuxpan Se eh
Anura (62 species)
Bufonidae (7 species)
Anaxyrus compactilis* xX
Incilius cavifrons** x
Incilius cristatus* x x x
Incilius marmoreus* x
Incilius occidentalis* x
Incilius valliceps xX xX xX xX
Rhinella horribilis 4 x x x
Centrolenidae (1 species)
Hyalinobatrachium viridissimum xX xX
Craugastoridae (11 species)
Craugastor alfredi x xX xX
Craugastor berkenbuschii* x x x
Craugastor decoratus* xX x xX
Craugastor laticeps xX
Craugastor loki x xX xX
Craugastor megalotympanum** xX
Craugastor mexicanus* x
Craugastor pygmaeus x x xX xX
Craugastor rhodopis* x x xX xX xX
Craugastor spatulatus* xX
Craugastor vulcani** xX
Eleutherodactylidae (5 species)
Eleutherodactylus cystignathoides xX x
Eleutherodactylus leprus xX
Eleutherodactylus nitidus* x x
Eleutherodactylus verrucipes* xX
Eleutherodactylus verruculatus** ~
Hylidae (22 species)
Bromeliohyla dendroscarta* x 4
Charadrahyla nephila* xX
Charadrahyla taeniopus* xX
Dendropsophus ebraccatus xX
Dendropsophus microcephalus xX xX
Dryophytes euphorbiaceus* xX xX
Dryophytes eximius* x x x x
Dryophytes plicatus* xX
Ecnomiohyla valancifer** xX
Megastomatohyla mixomaculata* xX xX xX
Megastomatohyla nubicola** x
Rheohyla miotympanum* xX xX xX
Sarcohyla arborescandens* x xX x
Sarcohyla bistincta* xX xX
Sarcohyla siopela* xX
Scinax staufferi x xX xX
Smilisca baudinii x x xX xX
Smilisca cyanosticta xX
Tlalocohyla loquax xX xX xX
Tlalocohyla picta xX xX xX
Amphib. Reptile Conserv. 136 September 2021 | Volume 15 | Number 2 | e285
Torres-Hernandez et al.
Table 23 (continued). Distribution of herpetofaunal species in the Natural Protected Areas of Veracruz, Mexico, based on
herpetofaunal surveys. * = species endemic to Mexico; ** = species endemic to Veracruz; and *** = non-native species.
Taxon
Trachycephalus vermiculatus
Triprion spinosus
Leptodactylidae (3 species)
Engystomops pustulosus
Leptodactylus fragilis
Leptodactylus melanonotus
Microhylidae (3 species)
Gastrophryne elegans
Hypopachus ustus
Hypopachus variolosus
Phyllomedusidae (2 species)
Agalychnis taylori
Agalychnis moreletii
Ranidae (5 species)
Lithobates berlandieri
Lithobates brownorum
Lithobates catesbeianus***
Lithobates maculatus
Lithobates vaillanti
Rhinophrynidae (1 species)
Rhinophrynus dorsalis
Scaphiopodidae (2 species)
Scaphiopus couchii
Spea multiplicata
Caudata (28 species)
Ambystomatidae (1 species)
Ambystoma velasci*
Plethodontidae (26 species)
Aquiloeurycea cephalica*
Bolitoglossa alberchi*
Bolitoglossa mexicana
Bolitoglossa occidentalis
Bolitoglossa platydactyla*
Bolitoglossa rufescens
Chiropterotriton ceronorum*
Chiropterotriton chiropterus*
Chiropterotriton chondrostega*
Chiropterotriton lavae**
Chiropterotriton nubilus**
Chiropterotriton perotensis**
Isthmura naucampatepetl**
Parvimolge townsendi**
Pseudoeurycea firscheini*
Pseudoeurycea gadovii*
Pseudoeurycea leprosa*
Pseudoeurycea lineola**
Pseudoeurycea melanomolga*
Pseudoeurycea nigromaculata**
Pseudoeurycea orchimelas**
Pseudoeurycea werleri*
Amphib. Reptile Conserv.
Cafion del
x
x
Kx KKM MK
~<
Cofre de Perote 0
Rio Blanco Nauhcampateépetl
xx MK KM
137
Natural Protected Area
Los Pico de_ Sistema Arrecifal Sistema
Arrecifal
Tuxtlas Orizaba — Lobos-Tuxpan
Veracruzano
x x
x
x
x x
x x
x
x x
x
x
x
a
x
x
x
x
x x
x
D4
x
x
x
x
x x
x
x
x
x
x
x
x x
x
x
x
x
September 2021 | Volume 15 | Number 2 | e285
The herpetofauna of Veracruz, Mexico
Table 23 (continued). Distribution of herpetofaunal species in the Natural Protected Areas of Veracruz, Mexico, based on
herpetofaunal surveys. * = species endemic to Mexico; ** = species endemic to Veracruz; and *** = non-native species.
Taxon Cafion del Cofre de Perote o
Rio Blanco Nauhcampateépetl
Thorius dubitus* xX x
Thorius narismagnus**
Thorius pennatulus** x
Thorius troglodytes** xX x
Sirenidae (1 species)
Siren intermedia
Gymnophiona (1 species)
Dermophiidae (1 species)
Dermophis mexicanus
Crocodylia (1 species)
Crocodylidae (1 species)
Crocodylus moreletii
Squamata (159 species)
Anguidae (8 species)
Abronia chiszari**
~<
~<
Abronia graminea*
Abronia reidi**
Abronia taeniata*
Barisia imbricata*
Gerrhonotus liocephalus
x x MK MK
Mesaspis antauges**
Ophisaurus ceroni**
Corytophanidae (3 species)
Basiliscus vittatus
x x
Corytophanes hernandesii
Laemanctus serratus
Dactyloidae (13 species)
Norops barkeri*
Norops beckeri
Norops biporcatus
Norops duellmani**
Norops laeviventris
Norops lemurinus
x xX xX
Norops petersii
Norops rodriguezii
Norops sagrei***
Norops schiedii** x
Norops sericeus x
Norops tropidonotus x
Norops uniformis
Dibamidae (1 species)
Anelytropsis papillosus* xX
Diploglossidae (2 species)
Celestus enneagrammus* xX xX
Celestus ingridae**
Eublepharidae (1 species)
Coleonyx elegans
Gekkonidae (3 species)
Hemidactylus frenatus***
Hemidactylus mabouia *** x
Amphib. Reptile Conserv.
138
Natural Protected Area
Los Pico de_ Sistema Arrecifal Sistema
Arrecifal
Tuxtlas Orizaba — Lobos-Tuxpan
Veracruzano
x
x
x
x
x x
x
x
x
x
x
x x
x
x
x x
x x
x x
x
x
x
be
x
x
x
a
x
x
x x
x
x
x
x
x x
September 2021 | Volume 15 | Number 2 | e285
Torres-Hernandez et al.
Table 23 (continued). Distribution of herpetofaunal species in the Natural Protected Areas of Veracruz, Mexico, based on
herpetofaunal surveys. * = species endemic to Mexico; ** = species endemic to Veracruz; and *** = non-native species.
Natural Protected Area
Sistema
Arrecifal
Veracruzano
Taxon Cafion del Cofre de Peroteo Los Pico de Sistema Arrecifal
Rio Blanco Nauhcampatépetl Tuxtlas Orizaba Lobos-Tuxpan
Hemidactylus turcicus*** x xX
Iguanidae (2 species)
Ctenosaura acanthura x xX xX
Iguana iguana x x
Mabuyidae (1 species)
Marisora lineola xX xX
Phrynosomatidae (17 species)
Phrynosoma braconnieri* xX
Phrynosoma orbiculare* xX x
Sceloporus aeneus* xX
Sceloporus bicanthalis*
Sceloporus formosus* x x
Kx mK KM MK
Sceloporus grammicus xX xX
Sceloporus internasalis xX
Sceloporus jalapae* xX xX
Sceloporus megalepidurus* xX x
x x
x
Sceloporus mucronatus *
Sceloporus salvini* x
Sceloporus scalaris* xX xX
Sceloporus serrifer xX
Sceloporus spinosus*
Sceloporus teapensis
Sceloporus torquatus*
Sceloporus variabilis
Scincidae (4 species)
Plestiodon brevirostris* x x
Plestiodon copei* xX
~ XX
Plestiodon lynxe* x
Plestiodon sumichrasti xX xX xX
Sphaerodactylidae (1 species)
Sphaerodactylus glaucus xX
Sphenomorphidae (3 species)
Scincella cherriei xX
Scincella gemmingeri* xX xX
x x
Scincella silvicola*
Teiidae (5 species)
Aspidoscelis costata* xX
Aspidoscelis deppii xX
Aspidoscelis gularis
Aspidoscelis guttatus*
x xX xX
~
<
*
Holcosus amphigrammus*
Xantusiidae (3 species)
Lepidophyma flavimaculatum x
Lepidophyma pajapanense * xX
Lepidophyma tuxtlae* x
Xenosauridae (1 species)
Xenosaurus grandis* xX x
Boidae (1 species)
Boa imperator x xX x
Colubridae (28 species)
Amphib. Reptile Conserv. 139 September 2021 | Volume 15 | Number 2 | e285
The herpetofauna of Veracruz, Mexico
Table 23 (continued). Distribution of herpetofaunal species in the Natural Protected Areas of Veracruz, Mexico, based on
herpetofaunal surveys. * = species endemic to Mexico; ** = species endemic to Veracruz; and *** = non-native species.
Taxon
Coluber constrictor
Conopsis lineata*
Dendrophidion vinitor
Drymarchon melanurus
Drymobius chloroticus
Drymobius margaritiferus
Ficimia olivacea*
Ficimia publia
Ficimia variegata*
Lampropeltis polyzona
Leptophis mexicanus
Masticophis mentovarius
Mastigodryas melanolomus
Oxybelis aeneus
Oxybelis fulgidus
Phrynonax poecilonotus
Pituophis deppei*
Pseudelaphe flavirufa
Salvadora bairdi*
Senticolis triaspis
Spilotes pullatus
Stenorrhina degenhardtii
Tantilla rubra
Tantilla schistosa
Tantilla slavensi**
Tantillita lintoni
Trimorphodon biscutatus
Trimorphodon tau*
Dipsadidae (36 species)
Adelphicos quadrivirgatum
Amastridium sapperi
Chersodromus liebmanni*
Clelia scytalina
Coniophanes bipunctatus
Coniophanes fissidens
Coniophanes imperialis
Coniophanes quinquevittatus
Coniophanes taeniatus*
Conophis lineatus
Conophis morai**
Geophis blanchardi*
Geophis carinosus
Geophis juliai**
Geophis semidoliatus*
Imantodes cenchoa
Imantodes gemmistratus
Leptodeira frenata
Leptodeira maculata
Leptodeira polysticta
Leptodeira septentrionalis
Amphib. Reptile Conserv.
Cafion del
xX
x x KM
x x x
Cofre de Perote o
Rio Blanco Nauhcampateépetl
x
140
Natural Protected Area
Los
Tuxtlas
Kx Km MK MK KM MK
x x x x x Kx mK KM MK ~ x
Kx Km MK KK
KKM KM MK KM
Sistema
Arrecifal
Veracruzano
x
xX
Pico de Sistema Arrecifal
Orizaba —Lobos-Tuxpan
September 2021 | Volume 15 | Number 2 | e285
Torres-Hernandez et al.
Table 23 (continued). Distribution of herpetofaunal species in the Natural Protected Areas of Veracruz, Mexico, based on
herpetofaunal surveys. * = species endemic to Mexico; ** = species endemic to Veracruz; and *** = non-native species.
Natural Protected Area
Sistema
Arrecifal
Veracruzano
Taxon Cafion del Cofre de Peroteo Los Pico de Sistema Arrecifal
Rio Blanco Nauhcampatépet! Tuxtlas Orizaba Lobos-Tuxpan
Ninia diademata xX
Ninia sebae x xX
Oxyrhopus petolarius
Pliocercus elapoides xX
mK MK
Rhadinaea decorata x
Rhadinaea forbesi** x
Rhadinaea fulvivittis* xX
Rhadinaea macdougalli*
Sibon dimidiatus
Sibon linearis**
Sibon nebulatus
Tretanorhinus nigroluteus
Tropidodipsas fasciata
Tropidodipsas sartorii x
Kx KKK KK
Xenodon rabdocephalus
Elapidae (3 species)
Micrurus diastema* xX
Micrurus elegans xX
x x x
Micrurus limbatus**
Leptotyphlopidae (2 species)
Epictia phenops xX
Epictia resetari* xX
Natricidae (7 species)
Storeria dekayi
Thamnophis chrysocephalus*
Thamnophis eques
Thamnophis godmani*
Thamnophis proximus
Thamnophis scalaris*
Kx mK KK KM MK
Thamnophis sumichrasti*
Sibynophiidae (1 species)
Scaphiodontophis annulatus
Typhlopidae (2 species)
Amerotyphlops tenuis xX xX
va
*<
~<
Virgotyphlops braminus*** xX
Viperidae (11 species)
Bothrops asper
~<
~<
Crotalus intermedius*
Crotalus mictlantecuhtli** *
Crotalus molossus
Crotalus ravus*
Crotalus scutulatus
Crotalus triseriatus*
Kx MK MK
Kx MK MK
Metlapilcoatlus nummifer*
Metlapilcoatlus olmec xX
Ophryacus smaragdinus*
x
Ophryacus undulatus*
Testudines (14 species)
Cheloniidae (4 species)
Caretta caretta xX x xX
Amphib. Reptile Conserv. 141 September 2021 | Volume 15 | Number 2 | e285
The herpetofauna of Veracruz, Mexico
Table 23 (continued). Distribution of herpetofaunal species in the Natural Protected Areas of Veracruz, Mexico, based on
herpetofaunal surveys. * = species endemic to Mexico; ** = species endemic to Veracruz; and *** = non-native species.
Natural Protected Area
Taxon Cafion del Cofrede Peroteo Los Picode Sistema Arrecifal puslaar
Rio Blanco Nauhcampatépetl Tuxtlas Orizaba Lobos-Tuxpan WEmenisano
Chelonia mydas x xX xX
Eretmochelys imbricata xX xX xX
Lepidochelys kempii xX xX xX
Chelydridae (1 species)
Chelydra rossignonii xX
Dermochelyidae (1 species)
Dermochelys coriacea xX xX
Emydidae (1 species)
Trachemys scripta*** xX xX
Geoemydidae (1 species)
Rhinoclemmys areolata xX
Kinosternidae (4 species)
Kinosternon acutum x x
Kinosternon herrerai* x
Kinosternon leucostomum x x
Kinosternon scorpioides Bs x
Staurotypidae (2 species)
Claudius angustatus xX xX
Staurotypus triporcatus x x
Table 24. Summary of the distributional status of herpetofaunal species in protected areas of Veracruz, Mexico. Total = total number
of species recorded in all of the listed protected areas.
Distributional status
Ninber) ——_ et
Protected area of Non-endemic Country State Endemic Non-native
species (NE) Endemic (CE) (SE) (NN)
Cafion del Rio Blanco 135 66 61 8 —
Cofre de Perote o Nauhcampatépetl 76 21 47 7
Los Tuxtlas 179 123 30 19 3
Pico de Orizaba 44 4 37 3 —
Sistema Arrecifal Lobos-Tuxpan 5 5 Oo — —
Sistema Arrecifal Veracruzano 67 47 16 1 3
Total 265 138 89 31 ‘i
Thorius munificus** (SMO) Plestiodon tetragrammus (SMO)
Thorius spilogaster** (TVB) Gonatodes albogularis (GCL)
Notophthalmus meridionalis (GCL, SMO) Lepidophyma sylvaticum* (GCL, SMO)
Gerrhonotus ophiurus* (SMO, TVB) Lepidophyma zongolica* (SMO, TVB)
Ophisaurus incomptus* (TVB) Xenosaurus rectocollaris* (SMO)
Laemanctus longipes (GCL, TVB) Xenosaurus tzacualtipantecus* (SMO)
Norops alvarezdeltoroi* (GCL) Conopsis acuta* (GCL)
Norops compressicauda* (GCL) Conopsis nasus* (SMO, TVB)
Norops cymbops* (SMO, TVB) Ficimia streckeri (GCL, SMO)
Norops naufragus* (SMO) Lampropeltis triangulum (GCL)
Norops purpuronectes* (GCL) Leptophis ahaetulla (GCL)
Celestus legnotus* (SMO) Masticophis flagellum (GCL)
Celestus rozellae (GCL) Masticophis schotti (GCL, SMO)
Holbrookia propinqua (GCL) Pantherophis emoryi (GCL, SMO)
Sceloporus aureolus* (SMO) Pituophis lineaticollis (SMO, TVB)
Sceloporus cyanogenys (SMO) Salvadora grahamiae (SMO, TVB)
Amphib. Reptile Conserv. 142 September 2021 | Volume 15 | Number 2 | e285
Torres-Hernandez et al.
Stenorrhina freminvillii (TVB)
Tantilla bocourti* (SMO, TVB)
Tantilla shawi* (SMO)
Adelphicos visoninum (GCL)
Diadophis punctatus (SMO, TVB)
Geophis bicolor* (TVB)
Geophis chalybeus** (SMO)
Geophis lorancai* (SMO, TVB)
Geophis mutitorques* (SMO)
Rhadinaea cuneata* (GCL, SMO, TVB)
Rhadinaea marcellae* (SMO)
Rhadinaea quinquelineata* (SMO)
Rhadinella schistosa* (SMO)
Micrurus tener (SMO)
Rena dulcis (GCL, SMO)
Rena myopica* (GCL, SMO)
Nerodia rhombifer (GCL, SMO, TVB)
Storeria storerioides* (SMO, TVB)
Thamnophis conanti* (SMO)
Thamnophis cyrtopsis (SMO)
Thamnophis marcianus (SMO, TVB)
Thamnophis pulchrilatus* (SMO)
Thamnophis scaliger* (TVB)
Agkistrodon taylori* (GCL, SMO)
Cerrophidion petlalcalensis* (SMO, TVB)
Crotalus aquilus* (TVB)
Crotalus atrox (GCL)
Crotalus polystictus* (TVB)
Crotalus totonacus* (SMO, TVB)
Dermatemys mawii (GCL)
Terrapene mexicana* (GCL)
Trachemys venusta (GCL)
Kinosternon flavescens (GCL)
Gopherus berlandieri (GCL)
Forty-nine of these 93 species (52.7%) are country
endemics, 13 (14.0%) are state endemics, and 31 (33.3%)
are non-endemics. Thus, 62 species (66.7%) are endemic,
but are not represented within the protected areas of the
State.
Additional surveys are necessary to determine which
of these 93 species might be located in one or more of
the existing protected areas, and which would require
protection in newly-established areas. The numbers of
these species recorded in the four physiographic regions
of the state are as follows: GCL (35), SLT (0), SMO
(57), and TVB (38). Interestingly, the largest proportion
of these 93 species that are not represented in existing
protected areas is in the SMO (61.3%), a region that
currently does not contain any designated protected areas.
This fact provides an additional reason why protected
areas should be established in the limited portion of the
state occupied by elements of the SMO.
Conclusions and Recommendations
Conclusions
Amphib. Reptile Conserv.
A. Currently, the herpetofauna of Veracruz is comprised
of 359 species, including 76 anurans, 45 salamanders,
one caecilian, one crocodylian, 217 squamates (87 lizards
and 130 snakes), and 19 turtles.
B. The number of herpetofaunal species known from
each of the four physiographic regions in Veracruz ranges
from 179 in the SLT to 236 in the SMO.
C. The number of species shared among the physiographic
regions ranges from 100 between the GCL and the TVB
to 190 between the SMO and the TVB. The Coefficient
of Biogeographic Resemblance values range from a low
of 0.49 between the GCL and the SMO and between the
GCL and the TVB to a high of 0.83 between the SMO
and the TVB. The UPGMA dendrogram illustrates
two distinct clusters, one including the SMO and TVB
and the other including the SLT and GCL. The former
cluster results from the sharing of a large number of
herpetofaunal species from highland environments,
while the latter cluster reflects the sharing of a sizable
number of wide-ranging generalist lowland species
found on both versants of Mexico and Central America.
D. The level of herpetofaunal endemism in Veracruz is
relatively high. Of the 359 species that comprise the entire
herpetofauna, 182 species (50.7%) are either endemic to
the country of Mexico or to the state of Veracruz. Most of
the endemic species are country endemics (138; 75.8%),
whereas 44 (24.2%) are endemic to the state of Veracruz.
The 44 state endemic species include seven anurans, 22
salamanders, and 15 squamates. One-half of the state
endemics in Veracruz are salamanders of the plethodontid
genera Aquiloeurycea (one species), Chiropterotriton
(six), [sthmura (two), Parvimolge (one), Pseudoeurycea
(four), and Thorius (eight).
E. The distributional status of the 359 members of
the Veracruz herpetofauna is as follows (in order of
decreasing species numbers): non-endemics (169,
47.1%); country endemics (138, 38.4%); state endemics
(44, 12.3%); and non-natives (8, 2.2%).
F. The 169 non-endemic species fall into the following
distributional categories: MXCA (89, 52.7%); MXSA
(30, 17.8%); MXUS (29, 17.2%); USCA (11, 6.5%);
USSA (four, 2.4%); and OCEA (five, 3.0%).
G. The principal environmental threats to the herpetofauna
of Veracruz are deforestation, livestock production,
roads, pollution of water bodies, myths and other cultural
factors, diseases, exotic and invasive species, and illegal
commerce.
H. We evaluated the conservation status of the
herpetofauna of Veracruz by using the SEMARNAT,
IUCN, and EVS systems. As with previous MCS studies,
September 2021 | Volume 15 | Number 2 | e285
The herpetofauna of Veracruz, Mexico
the SEMARNAT system was found to be of minimal
value, since only 157 of 351 native herpetofaunal species
have been evaluated using that system. Of the 157
assessed species, 12 are placed in the Endangered (P)
category, 42 in the Threatened (A) category, and 103 in the
Special Protection (Pr) category. Using the SEMARNAT
system does not appear to be biased toward evaluating
endemic vs. non-endemic species, but it has not been
applied widely enough to be useful for evaluating the
conservation status of the Veracruz herpetofauna.
I. The results of applying the IUCN conservation
system by category and the proportions of 351 native
herpetofaunal species are as follows: CR (30, 8.5%):
EN (31, 8.8%); VU (25, 7.1%); NT (11, 3.1%); LC (161,
45.9%); DD (24, 6.8%); and NE (69, 19.7%).
J. A comparison of applying the IUCN categories by
distributional status of the 182 country and state endemic
species indicate that 71 (39.0%) are allocated to one of
the three threat categories, with the majority of them (53)
placed in the CR and EN categories. The largest portion
of the 351 native species (161, 45.9%) 1s assigned to the
LC category, which includes 64 country endemics and
one state endemic. Of the 24 DD species, 13 are country
endemics and 11 are state endemics. Finally, of the 69
NE species, the majority are non-endemic species (51,
73.9%), whereas 18 (26.1%) are endemic species. Thus,
a total of 93 native species (26.5%) are placed in the DD
and NE categories.
K. An application of the EVS system of conservation
assessment to the 346 native non-marine species
demonstrates that categorical values increase from
the low vulnerability species (93, 26.9%) through the
medium vulnerability species (119, 34.4%) to the high
vulnerability species (134, 38.7%).
L. A comparison of the IUCN and EVS conservation
status categorizations demonstrates that 45.5% of the 134
high vulnerability species are placed in one of the three
IUCN “threat categories” (CR, EN, or VU), and that
37.3% of the low vulnerability species are allocated to
the LC category. Thus, as in previous studies, the results
of applying these two conservation assessment systems
to the Veracruz herpetofauna do not align well.
M. An examination of 254 of the 346 native species
(73.4%) allocated to the IUCN DD, NE, and LC
categories indicates that many are assessed improperly,
when compared to their respective EVS values, so we
provided guidance on how these species might be re-
evaluated to better indicate their prospects for survival
in perpetuity.
N. The RHP measure was used to determine the
conservation significance of the four regional
Amphib. Reptile Conserv.
herpetofaunas in Veracruz. These analyses demonstrate
that the most significant regional herpetofauna is found
within the SMO, since it harbors the largest number of
endemic species (130, 71.4%) of the 182 total country
and state endemics. In addition, the number of high
vulnerability species (78) for this region is only one less
than for the TVB. The conservation significance of these
two regions is similar, because the SMO and TVB include
130 and 123 total endemic species, respectively, as well
as 78 and 79 high vulnerability species, respectively.
These two regions also share a significant number of
species (190 of the 236 in the SMO, and 222 in the TVB).
The other two regions (GCL and SLT) are distinctly
clustered from the SMO and TVB pairing, inasmuch as
they both have fewer than one-half of the number of high
vulnerability species as either the SMO or TVB, and only
about one-third of the endemic species.
O. Relatively few protected areas exist in Veracruz, and
all are administered by the federal government. The
collective size of the six protected areas 1s 331,290.6 ha
(3,312.9 km’), which is 4.6 % of the area of the state.
Four of these six areas are located in the GCL, which
is the state’s least significant physiographic region. A
single area is located in the TVB and only one in the SLT.
None of the current protected areas are located within the
SMO, the region of greatest conservation significance.
Most of the six protected areas contain the full array of
the requisite facilities, but landowners occupy all of these
areas. Management plans are available for all but one of
the protected areas, but herpetofaunal surveys have been
completed for only one of them.
P. Herpetofaunal records collated for each of the six
protected areas demonstrate that collectively, 265 of the
359 total number of species in the state are known from
these areas. Of these 265 species, 138 are non-endemics,
89 are country endemics, 31 are state endemics, and seven
are non-natives. The proportions of these species groups
are, respectively: 52.1%, 33.6%, 11.7%, and 2.6%.
Recommendations
A. Our interest in writing this 12" entry in the MCS
has been the same as for all the preceding entries,
i.e., to document the composition, physiographic
distribution, and conservation status of the native
herpetofaunal species, which number 359 in Veracruz.
By using the EVS methodology, we demonstrated
that of the 346 native non-marine species recorded
for the state, 93 are allocated to the low vulnerability
category, 119 to the medium category, and 134 to the
high category, confirming that the herpetofauna is of
major conservation significance. Our use of the RHP
measure indicated that from a conservation perspective
the most significant physiographic region is the SMO,
as it contains high numbers of both endemic species and
September 2021 | Volume 15 | Number 2 | e285
Torres-Hernandez et al.
species of high vulnerability. Other MCS studies found
a serious disconnection between the relative importance
of a given region’s herpetofauna and the representation
of protected areas. In the case of Veracruz, no protected
areas have been established within the SMO; and the
major conservation challenge, therefore, is to address
this disconnection by identifying and establishing one or
more protected areas within this region, while providing
special attention to protecting the resident country and
state endemic species.
B. The next most important conservation challenge is
to determine, through additional surveys, which of the
93 native species not yet recorded from any of the six
existing protected areas in Veracruz might be found in
any of them, and which species might require protection
by establishing new protected areas. This effort should
consider not only the herpetofaunal species already
known to occur in those areas, but also ones that might be
encountered in the future. Based on recent herpetological
work, such species likely will be salamanders.
C. Once all the species comprising the Veracruz
herpetofauna are demonstrated to occur within the
protected area system, the next most important step
will be to set up programs for monitoring the long-term
survival needs for all the species involved.
D. These steps need to be undertaken as rapidly as
possible, especially because from a_ conservation
perspective the most significant regions in the state (1.e.,
the SMO and TVB) are the two smallest of the four
physiographic regions in Veracruz, and likely the most
vulnerable. Time is of the essence, because Veracruz is
the 3" most populous state in Mexico, and the 10" most
densely populated.
“Homo sapiens, the wise human being, must now learn
from its mistakes and live up to its name. We who are
alive today have the formidable task of making sure that
our species does so. We must not give up hope. We have
all the tools we need, the thoughts and ideas of billions
of remarkable minds and the immeasurable energies of
nature to help us in our work. And we have one more
thing—an ability, perhaps unique among the living
creatures on the planet—to imagine a future and work
towards achieving it.”
David Attenborough (2020)
Acknowledgments.—We thank Carlos Balderas-
Valdivia, René Murrieta-Galindo, Adrian Nieto Montes
de Oca, Jorge Morales-Mavil, Alberto Gonzalez-Romero,
Eduardo Pineda-Arredondo, and Daniel Lara-Tufifio for
their logistic help; Rosamond Ione Coates-Lutes, Chief
of Los Tuxtlas Biological Field Station, for allowing
Amphib. Reptile Conserv.
us access to the station; Ferdinand Torres-Angeles for
his help with the physiographic map; SEMARNAT
for the scientific permits (SEMARNATO08-017-A,
HESSX1304811, SEMARNAT-SGPA/DGVS/02726/10,
and SGPA/DGVS/11746/13) for collecting specimens
used in this study, which were issued to ARB; and
Madeleine Fernandez Teco, Aaron Arias Hernandez, José
Adrian Montiel-Veranza, Isaac Ajactle-Tequiliquihua,
Jesse Hosman, Bruno’ Rosas-Fragoso, Matthieu
Berroneau, René Avalos-Vela, Jorge Gonzalez-Sanchez,
Fidel Lopez-Guzman, Salvador Guzman-Guzman, and
Ricardo Luria-Manzano for allowing us to use their
splendid photographic images in this work. We are also
indebted to David Lazcano and Louis Porras for their
perceptive reviews of this work.
Literature Cited
Aguilar-Lopez JL, Canseco-Marquez L. 2006.
Herpetofauna del municipio de Las Choapas, Veracruz,
México. Boletin de la Sociedad Herpetoldgica
Mexicana 14: 20-37.
Aguilar-Lopez JL, Ortiz-Lozada L, Pelayo-Martinez J,
Mota-Vargas C, Alarcon-Villegas LE, Demeneghi-
Calatayud AP. 2020. Diversidad y conservacion de
anfibios y reptiles en un area protegida privada de una
region altamente transformada en el sur de Veracruz,
México. Acta Zoologica Mexicana (n.s.) 36: 1-14.
Aguilar-Lopez JL, Pineda E, Garcia-Vazquez U. 2010.
Ampliacion del ambito geografico-altitudinal de
Duellmanohyla chamulae (Amphibia: Hylidae) y
primer registro para la anfibiofauna de Veracruz.
Revista Mexicana de Biodiversidad 81: 579-580.
Aguilar-Lopez JL, Pineda E, Luria-Manzano R, Canseco-
Marquez L. 2016. Species diversity, distribution,
and conservation status in a Mesoamerican region:
amphibians of the Uxpanapa Chimalapas Region,
México. Tropical Conservation Science 9: 1-16.
Aguilar-Lopez JL, Pineda E, Luria-Manzano R, Vinalay
AG. 2015. Anolis (Norops) compressicauda and
Craugastor berkenbuschii. Predator-prey interaction.
Mesoamerican Herpetology 2: 336-337.
Aguilar-Lopez JL, Pineda E. 2015. Diversidad y
conservacion de anfibios en Uxpanapa, Veracruz.
Biodiversitas 119: 12-16.
Altamirano-Alvarez TA, Soriano-Sarabia M. 2010.
Anfibios y Reptiles: Especies de Alvarado, Veracruz,
Mexico. Facultad de Estudios Superiores Iztacala,
Universidad Nacional Autonoma de México,
Coyoacan, México. 99 p.
Alvarado-Diaz J, Suazo-Ortufio I, Wilson LD, Medina-
Aguilar O. 2013. Patterns of physiographic distribution
and conservation status of the herpetofauna of
Michoacan, Mexico. Contributions to Special Mexico
Issue. Amphibian & Reptile Conservation 7. 128-170
(e71).
Attenborough D. 2020. A Life on Our Planet: My Witness
September 2021 | Volume 15 | Number 2 | e285
The herpetofauna of Veracruz, Mexico
Statement and a Vision for the Future. Grand Central
Publishing, New York, New York, USA. 341 p.
Avila-Najera DM, Mendoza GD, Villarreal O, Serna-
Lagunes R. 2018. Uso y valor cultural de la
herpetofauna en México: una revision de las ultimas
dos décadas (1997-2017). Acta Zoolégica Mexicana
(n.s.) 34: 1-38.
Badillo-Saldafia LM, Berriozabal-Islas C, Ramirez-
Bautista A. 2014. New record of the snake Drymobius
chloroticus (Cope, 1886) (Squamata: Colubridae)
from Hidalgo, Mexico. Check List 10: 199-201.
Badillo-Saldafia LM, Lara-Tufifio JD, Ramirez-Bautista
A, Campbell JA. 2018. New state record and potential
distribution of the snake Sibon nebulatus (Dipsadidae)
from Mexico. Western North American Naturalist 78:
242-246.
Barrio-Amoros CL. 2019. On the taxonomy of snakes
in the genus Leptodeira, with an emphasis on Costa
Rican species. JRCF Reptiles & Amphibians 26: 1-15.
Bello-Sanchez EA, Morales-Mavil JE, Suarez-
Dominguez EA, Corona-Lopez CR, Martinez-
Vaca Leon OI. 2014. Ampliacion de la distribucion
altitudinal y geografica de Lithobates johni y nuevo
registro para Veracruz, México. Revista Mexicana de
Biodiversidad 85: 979-981.
Bury BR, Whelan JA. 1984. Ecology and Management
of the Bullfrog. Resource Publication 155. U.S. Fish
and Wildlife Service, Washington, DC, USA. 23 p.
Campbell JA. 1999. Distributional patterns of amphibians
in Middle America. Pp. 111-210 In: Patterns of
Distributions of Amphibians: A Global Perspective.
Editor, Duellman WE. Johns Hopkins University
Press, Baltimore, Maryland, USA. 633 p.
Campbell JA, Lamar WW. 1989. The Venomous Reptiles
of Latin America. Cornell University Press, Ithaca,
New York, USA. 425 p.
Campbell JA, Lamar WW. 2004. The Venomous Reptiles
of the Western Hemisphere, Volume IT. Comstock/
Cornell University Press, Ithaca, New York, USA.
870 p.
Canseco-Marquez L, Guticérrez-Mayén MG. 2010.
Anfibios y Reptiles del Valle de Tehuacan-Cuicatlan.
Comision Nacional para el Conocimiento y Uso de
la Biodiversidad, Fundacion para la Reserva de la
Biosfera Cuicatlan A.C. y Benemérita Universidad
Autonoma de Puebla, México, DF, México. 302 p.
Canseco-Marquez L, Pavon-Vazquez CJ, Lopez-Luna
MA, Nieto-Montes de Oca A. 2016. A new species
of Earth Snake (Dipsadidae, Geophis) from Mexico.
ZooKeys 610: 131-145.
Carbajal-Marquez RA, Cedefio- Vazquez JR, Martinez-
Arce A, Neri-Castro E, Machkour-M’ Rabet SC. 2020.
Accessing cryptic diversity in Neotropical rattlesnakes
(Serpentes: Viperidae: Crotalus) with the description
of two new species. Zootaxa 4729: 451-481.
Card DC, Schield DR, Adams RH, Corbin AB, Perry
BW, Andrew AL, Pasquesi GIM, Smith EN, Jeskova
Amphib. Reptile Conserv.
T, Boback SM, et al. 2016. Phylogeographic and
population genetic analysis reveal multiple species
of Boa and independent origins of insular dwarfism.
Molecular Phylogenetics and Evolution 102: 104—116.
Castillo-Campos G, Avendafio-Reyes S, Medina-Abreo
ME. 2011. Flora y vegetacién. Pp. 163-179 In:
La Biodiversidad en Veracruz: Estudio de Estado,
Volumen I. Editors, Cruz-Angon A, Soto-Esparza
M, Rodriguez-Herrero H, Boege-Schmidt E, Sedas-
Larios EEJ, Marquez-Ramirez W, Primo-Castro
ME, Castillo-Campos G, Lara-Dominguez AL,
Olguin-Palacios EJ, et al. Comisién Nacional para el
Conocimiento y Uso de la Biodiversidad, Gobierno
del Estado de Veracruz y Universidad Veracruzana,
Instituto de Ecologia, A.C., México, DF, México. 678
p.
Castillo-Juarez JL, Contreras-Calvario AI, Taval-
Velazquez LP, Sanchez-Eugenio M. 2020. Nuevos
registros en la distribucion geografica de Ophryacus
smaragdinus (Grinwald, Jones, Franz-Chavez y
Ahumada-Carrillo, 2015) (Viperidae) en la region
de las altas montafias, Veracruz, México. Revista
Latinoamericana de Herpetologia 3: 121-123.
Cazares-Hernandez E, Molohua-Tzitzihua E, Méndez-
Quiahua EC, Quiahua-Colotl E, Temoxtle-Marquez
I, Rodriguez-Merino JC, Apale-Pacheco R. 2018.
Tlaconetes. Los Hijos de la Tierra. Instituto
Tecnologico Superior de Zongolica, Tepetitlanapa,
Zongolica, Veracruz, México.
Cazares-Hernandez E. 2015. Monitoreo de poblaciones
de tortugas dulceacuicolas como parte del proceso
de restauracidn de un humedal del Sitio Ramsar La
Mancha y El Llano, Veracruz, México. Master’s
Thesis, Universidad Veracruzana, Xalapa, Veracruz,
México. 67 p.
Ceron-de la Luz NM. 2010. Anfibios y reptiles del Valle
de Cuautlapan, municipio de Ixtaczoquitlan, Veracruz.
Bachelor’s Thesis, Universidad Veracruzana,
Cordoba, Veracruz, México.
Chacon-Juarez F, Vasquez-Cruz V. 2018. Geographic
distribution: Mexico, Veracruz: Clelia scytalina.
Herpetological Review 49: 717.
Chambers EA, Hillis DM. 2020. The multispecies
coalescent over-splits species in the case of
geographically widespread taxa. Systematic Biology
69: 184-193.
Chavez-Lugo EG. 2015. Diversidad de herpetofauna en
el Area Privada de Conservacion Talhpan, Veracruz.
Bachelor’s Thesis, Universidad Veracruzana, Tuxpan,
Veracruz, México.
Comision Nacional para el Conocimiento y Uso de la
Biodiversidad (CONABIO). 2008. Capital Natural
de México: Conocimiento Actual de la Biodiversidad.
Volumen I. Comision Nacional para el Conocimiento
y Uso de la Biodiversidad, México, DF, México. 100
p.
Conant R. 2003. Observations on garter snakes of the
September 2021 | Volume 15 | Number 2 | e285
Torres-Hernandez et al.
Thamnophis eques complex in the lakes of Mexico’s
Transvolcanic Belt, with descriptions of new taxa.
American Museum Novitates 3406: 1-64.
Contreras-Calvario AI, Castillo-Juarez JL, Avalos-
Vela R, Ceron-de la Luz NM, Mora-Reyes A. 2019.
Nuevos registros de distribucion de cuatro especies de
salamandras (Caudata: Plethodontidae) en la region
de las altas montafias, Veracruz, México. Revista
Latinoamericana de Herpetologia 2: 64—70.
Cruz-Elizalde R, Ramirez-Bautista A, Aguillon-
Gutiérrez DR, Magno-Benitez I, Hernandez-Austria
R. 2017. Principales amenazas para la biodiversidad
y perspectivas para su manejo y conservacion en el
estado de Hidalgo: el caso de los anfibios y reptiles.
Pp. 577-590 In: Biodiversidad del Estado de Hidalgo.
Editors, Ramirez-Bautista A, Sanchez-Gonzalez A,
Sanchez-Rojas G, Cuevas-Cardona C. Universidad
Autonoma del Estado de Hidalgo, Pachuca de Soto,
Hidalgo, México. 652 p.
Cruz-Elizalde R, Villamar-Duque TE, Ramirez-Bautista
A. 2020. Sexual dimorphism in size and shape in
the viviparous lizard Abronia taeniata (Squamata:
Anguidae) in central Mexico. Acta Zoologica 2020:
1-7.
Cruz-Saenz D, Mufioz-Nolasco FJ, Mata-Silva_ V,
Johnson JD, Garcia-Padilla E, Wilson LD. 2017.
The herpetofauna of Jalisco, Mexico: composition,
distribution, and conservation status. Mesoamerican
Herpetology 4: 22-118.
Daza JM, Smith EN, Paez VP, Parkinson CL. 2009.
Complex evolution in the neotropics: the origin and
diversification of the widespread genus Leptodeira
(Serpentes: Colubridae). Molecular Phylogenetics
and Evolution 53: 653-657.
de la Torre-Loranca MA, Aguirre-Leén G, Lopez-
Luna MA. 2006. Coralillos verdaderos (Serpentes:
Elapidae) y coralillos falsos (Serpentes: Colubridae)
de Veracruz, México. Acta Zoolégica Mexicana (n.s.)
22: 11-22.
de la Torre-Loranca MA, Griinwald CI, Valdenegro-
Brito AE, Cervantes-Burgos RI, Garcia- Vazquez UO.
2019. New distributional records for the rare Mexican
pitviper Cerrophidion petlalcalensis (Squamata:
Viperidae) from Veracruz and Oaxaca, Mexico, with
comments on distribution and natural history. Revista
Latinoamericana de Herpetologia 2: 71-77.
de la Torre-Loranca MA, Martinez-Fuentes RG, Canseco-
Marquez L, Garcia- Vazquez UO. 2020. New records
of amphibians and reptiles from Sierra de Zongolica,
Veracruz and Puebla, Mexico. Herpetological Review
51: 550-553.
Dixon JR, Lemos-Espinal JA. 2010. Anfibios y Reptiles
del Estado de Querétaro, México. Texas A&M
University, Universidad Nacional Autonoma de
México y Comisién Nacional para el Conocimiento y
Uso de la Biodiversidad, México, DF, México. 428 p.
Duellman WE. 1958. A monographic study of the
Amphib. Reptile Conserv.
colubrid snake genus Leptodeira. Bulletin of the
American Museum of Natural History 114: 1-152.
Duellman WE. 1990. Herpetofauna in neotropical
rainforests: comparative composition, history, and
resource use. Pp. 455-505 In: Four Neotropical
Rainforests. Editor, Gentry AH. Yale University Press,
New Haven, Connecticut, USA. 627 p.
Duellman WE. 2001. The Hylid Frogs of Middle America,
Volume 1. The Society for the Study of Amphibians
and Reptiles, Lawrence, Kansas, USA. 753 p.
Duellman WE, Trueb L. 1986. Biology of Amphibians.
McGraw-Hill, New York, New York, USA. 670 p.
Ernst CH, Ernst EM. 2003. Snakes of the United States
and Canada. Smithsonian Institution, Washington,
DC, USA. 668 p.
Escobedo-Galvan AH, Gonzalez-Salazar C. 2011.
Aplicando modelos de nicho ecolégico para predecir
areas potenciales de hibridacion entre Crocodylus
acutus y C. moreletii. Quehacer Cientifico en Chiapas
1: 27-35.
Espinosa-Organista D, Ocegueda-Cruz S, Aguilar-
Zufiga C, Flores-Villela O, Llorente-Bousquets J.
2008. El conocimiento biogeografico de las especies
y su regionalizacion natural. Pp. 33-65 In: Capital
Natural de México, Volumen I. Editors, Soberon J,
Halffter G, Llorente-Bousquets J. Comision Nacional
para el Conocimiento y Uso de la Biodiversidad,
México, DF, México.
Ferrusquia-Villafranca I. 2007. Ensayo sobre la
caracterizacion y significacion bioldgica. Pp. 7—24 In:
Biodiversidad de la Faja Volcanica Transmexicana.
Editors, Luna I, Morrone JJ, Espinosa D. Comision
Nacional para el Conocimiento y Uso de la
Biodiversidad, México, DF, México. 514 p.
Flores-Villela O. 1998. Herpetofauna del Estado de
Veracruz. Bases de datos SNIB-CONABIO, proyecto
No. A027. Universidad Nacional Autonoma de
México, Facultad de Ciencias, México, DF, México.
Frost DR. 2020. Amphibian Species of the World:
An Online Reference. Version 6.1. Available:
https://amphibiansoftheworld.amnh.org/index. php
[Accessed: 16 June 2020].
Garcia-Bafiuelos P, Aguilar-Lopez JL, Kelly-Hernandez
A, Vasquez-Cruz V, Pineda E, Rovito SM. 2020. A
new species of Pseudoeurycea (Amphibia: Caudata)
from the mountains of central Veracruz, Mexico.
Journal of Herpetology 54: 258-267.
Garcia-Castillo MG, Soto-Pozos AF, Aguilar-Lépez JL,
Pineda E, Parra-Olea G. 2018. Two new species of
Chiropterotriton (Caudata: Plethodontidae) from
central Veracruz, Mexico. Amphibian & Reptile
Conservation 12(2) [Special Section]: 37—54 (e167).
Garcia-Morales D, Cervantes-Burgos RI, Garcia-
Vazquez UO. 2017. Geographic distribution: Mexico,
Veracruz: Tantillita lintoni. Herpetological Review
48: 591.
Garcia- Vazquez UO, Canseco-Marquez L, Aguilar-
September 2021 | Volume 15 | Number 2 | e285
The herpetofauna of Veracruz, Mexico
Lopez JL. 2010. A new species of Night Lizard of the
genus Lepidophyma (Squamata: Xantusiidae) from
southern Puebla, México. Zootaxa 2657: 47-54.
Gonzalez-Romero A, Murrieta-Galindo R. 2008.
Capitulo 10: anfibios y reptiles. Pp. 135-147
In: Agroecosistemas Cafetaleros de Veracruz:
Biodiversidad, Manejo y Conservacion. Editors,
Manson RH, Hernandez-Ortiz V, Gallina S, Mehltreter
K. Instituto de Ecologia A.C., Instituto Nacional de
Ecologia y Secretaria del Medio Ambiente y Recursos
Naturales, México, DF, México. 330 p.
Gonzalez-Sanchez VH, Johnson JD, Garcia-Padilla E,
Mata-Silva V, DeSantis DL, Wilson LD. 2017. The
herpetofauna of the Mexican Yucatan Peninsula:
composition, distribution, and conservation status.
Mesoamerican Herpetology 4: 263-380.
Gonzalez-Sanchez VH, Johnson JD, Gonzalez-Solis
D, Wilson LD. 2021. A review of the introduced
herpetofauna of Mexico and Central America, with
comments on the effects of invasive species and
biosecurity methodology. ZooKeys 1022: 79-154.
Gonzalez-Soriano E, Dirzo R, Vogt R. (Editors). 1997.
Historia Natural de Los Tuxtlas. Instituto de Biologia,
UNAM, CONABIO e Instituto de Ecologia A.C.,
México. DF, México. 647 p.
Gonzalez-Zamora A, Sanchez-Lopez S, Delfin-Alfonso
CA, Bello-Sanchez EA. 2018. First record of
Oviposition event by Laemanctus longipes (Sauria:
Corytophanidae) in Mexico. Caldasia 40: 390-393.
Grunwald CI, Jones JM, Franz-Chavez H, Ahumada-
Carrillo IT. 2015. A new species of Ophryacus
(Serpentes: Viperidae: Crotalinae) from eastern
Mexico, with comments on the taxonomy of related
pitvipers. Mesoamerican Herpetology 2: 388-416.
Guzman-Guzman S. 2011. Anfibios y Reptiles de
Veracruz: Guia Ilustrada. Consejo Veracruzano de
Investigacion Cientifica y Desarrollo Tecnologico,
Xalapa, Veracruz, México. 231 p.
Heimes P. 2016. Snakes of Mexico. Herpetofauna
Mexicana, Volumen I. Edition Chimaira, Frankfort
am Main, Germany, and ECO Publishing, Rodeo,
New Mexico, USA. 572 p.
Hernandez-Austria R. 2017. Estudio sobre la infeccion
por el hongo Batrachochytrium dendrobatidis en cinco
especies de anuros del Estado de Hidalgo, México.
Master’s Thesis, Universidad Autonoma del Estado
de Hidalgo, Pachuca de Soto, Hidalgo, México.
Holt BG, Lessard J-P, Borregaard MK, Fritz SA, Araujo
MB, Dimitrov D, Fabre P-H, Graham CH, Graves
GR, Jonsson KA, et al. 2013. An update of Wallace’s
zoogeographic regions of the world. Science 339:
74-77.
Instituto Nacional de Estadistica, Geografia e Informatica
(INEGI). 2000. Provincias Fisiograficas de México.
Diccionario de Datos Fisiograficos. Vectoriales.
Escala 1:10 000. México, DF, México.
Instituto Nacional de Estadistica, Geografia e Informatica
Amphib. Reptile Conserv.
(INEGI). 2011. Perspectiva Estadistica de Hidalgo.
Instituto Nacional de Estadistica y Geografia, México,
DF, México. 111 p.
Iverson JB. 1992. A Revised Checklist with Distribution
Maps of the Turtles of the World. Privately Printed,
Richmond, Indiana, USA. 363 p.
Johnson JD, Mata-Silva V, Garcia-Padilla E, Wilson
LD. 2015a. The herpetofauna of Chiapas, Mexico:
composition, distribution, and conservation.
Mesoamerican Herpetology 2: 271-329.
Johnson JD, Mata-Silva V, Wilson LD. 2015b. A
conservation reassessment of the Central American
herpetofauna based on the EVS measure. Amphibian
& Reptile Conservation 9 [General Section]: 1-94
(e100).
Johnson JD, Wilson LD, Mata-Silva V, Garcia-Padilla
E, DeSantis DL. 2017. The endemic herpetofauna of
Mexico: organisms of global significance in severe
peril. Mesoamerican Herpetology 4: 543-620.
Johnson JD, Mata-Silva V, Ramirez-Bautista A. 2010.
Geographic distribution and conservation of the
herpetofauna of southeastern Mexico. Pp. 323-369
In: Conservation of Mesoamerican Amphibians and
Reptiles. Editors, Wilson LD, Townsend JH, Johnson
JD. Eagle Mountain Publishing, Eagle Mountain,
Utah, USA. 812 p.
Jones LLC, Lovich RE. 2009. Lizards of the American
Southwest. Rio Nuevo Publishers, Tucson, Arizona,
USA. 568 p.
Kelly-Hernandez A, Lara-Hernandez FA, Vasquez-Cruz
V. 2020. Geographic distribution: Mexico, Veracruz:
Crotalus mictlantecuhtli. Herpetological Review 51:
273.
Klauber LM. 1972. Rattlesnakes: Their Habits, Life
Histories, and Influence on Mankind. Second Edition.
University of California Press, Berkeley, California,
USA. 1,533 p.
Kohler G. 2008. Reptiles of Central America. Second
Edition. Herpeton Verlag Elke Kohler, Offenbach,
Germany. 400 p.
Kohler G. 2011. Amphibians of Central America.
Herpeton Verlag Elke Kohler, Offenbach, Germany.
379 p.
Kohler G. 2021. Taxonomy of horned lizards, genus
Phrynosoma (Squamata, Phrynosomatidae).
Taxonomy |: 83-115.
Lara-Hernandez FA, Vasquez-Cruz V. 2020. Geographic
distribution: Mexico, Veracruz: Senticolis triaspis.
Herpetological Review 51: 81.
Lavin-Murcio PA, Lazcano D. 2010. Geographic
distribution and conservation of the herpetofauna
of northern México. Pp. 274-301 In: Conservation
of the Mesoamerican Amphibians and Reptiles.
Editors, Wilson LD, Townsend JH, Johnson JD. Eagle
Mountain Publishing, Eagle Mountain, Utah, USA.
812 p.
Lazcano D, Nevarez-de los Reyes M, Garcia-Padilla
September 2021 | Volume 15 | Number 2 | e285
Torres-Hernandez et al.
E, Johnson JD, Mata-Silva V, DeSantis DL, Wilson
LD. 2019. The herpetofauna of Coahuila, Mexico:
composition, distribution, and conservation status.
Amphibian & Reptile Conservation 13(2) [General
Section]: 31—94 (e189).
Lemos-Espinal JA, Dixon JR. 2013. Amphibians
and Reptiles of San Luis Potosi. Eagle Mountain
Publishing, Eagle Mountain, Utah, USA. 300 p.
Lemos-Espinal JA, Smith GR, Valdez-Lares R. 2019.
Amphibians and Reptiles of Durango, Mexico. ECO
Herpetological Publishing and Distribution, Rodeo,
New Mexico, USA. 416 p.
Lopez-Luna MA, Vogt RC, Torre-Loranca MA. 1999.
A new species of montane pitviper from Veracruz,
Mexico. Herpetologica 55: 383-389.
Macario-Cueyatcle D, Lara-Hernandez FA, Vasquez-
Cruz V. 2019. Geographic distribution: Mexico,
Veracruz: Ptychohyla zophodes. Herpetological
Review 50: 521.
Magno-Benitez I, Ramirez-Bautista A, Cruz-Elizalde R.
2016. Diversidad de especies de anfibios y reptiles en
dos ambientes, natural y antropizado en el estado de
Hidalgo, México. Pp. 97-105 In: Fauna Nativa en
Ambientes Antropizados. Editors, Ramirez-Bautista
A, Pineda-Lopez R. Consejo Nacional de Ciencia y
Tecnologia (CONACYyT), Universidad Autonoma de
Querétaro, Querétaro, México. 237 p.
Marquez R. 1994. Sinopsis de Datos Bioldgicos sobre la
Tortuga Lora, Lepidochelys kempii (Garman, 1880).
FAO Sinopsis sobre la Pesca, No. 152. Instituto
Nacional de la Pesca, Secretaria de Pesca, México,
DF, México. 141 p.
Mata-Silva V, Johnson JD, Wilson LD, Garcia-Padilla
E. 2015. The herpetofauna of Oaxaca, Mexico:
composition, physiographic distribution, and
conservation status. Mesoamerican Herpetology 2:
5-62.
Mata-Silva V, DeSantis DL, Garcia-Padilla E, Johnson
JD, Wilson LD. 2019. The endemic herpetofauna of
Central America: a casualty of anthropocentrism.
Amphibian & Reptile Conservation 13(1) [General
Section]: 1-64 (e168).
McCranie JR, Matthews AJ, Hedges SB. 2020. A
morphological and molecular revision of lizards of
the genus Marisora Hedges and Conn (Squamata:
Mabuyidae) from Central America and Mexico, with
descriptions of four new species. Zootaxa 4763:
301-353.
Méndez-de la Cruz FR, Casas-Andreu G. 1992. Status
y distribucion de Crocodylus acutus en la costa de
Jalisco, México. Anales del Instituto de Biologia,
Universidad Nacional Autonoma de Mexico, Serie
Zoologia 63: 125-133.
Mendoza-Almeralla C, Burrowes P, Parra-Olea G. 2015.
La quitridiomicosis en los anfibios de México: una
revision. Revista Mexicana de Biodiversidad 86:
238-248.
Amphib. Reptile Conserv.
Mendoza-Henao AM, Arias E, Townsend JH, Parra-
Olea G. 2020. Phylogeny-based species delimitation
and integrative taxonomic. revision of the
Hyalinobatrachium fleischmanni species complex,
with resurrection of H. viridissimum (Taylor, 1942).
Systematics and Biodiversity 18: 464-484.
Meza-Lazaro RN, Nieto-Montes de Oca A. 2015. Long
forsaken species diversity in the Middle American
lizard Holcosus undulatus (Teiidae). Zoological
Journal of the Linnean Society 175: 189-210.
Morales-Mavil JE, Bello-Sanchez EA, Martinez-Vaca
Leon OIF, Suarez-Dominguez EA. 2017. Nuevo
registro de Siren intermedia (Caudata: Sirenidae)
para el estado de Veracruz, México. Acta Zooldgica
Mexicana (n.s.) 33: 139-142.
Morrone JJ. 2001. Biogeografia de América Latina y
el Caribe, Manuales y Tesis, Volumen 3. Sociedad
Entomologica Aragonesa, Zaragoza, Spain. 148 p.
Murrieta-Galindo R, Gonzalez-Romero A, Lopez-
Barrera F, Parra-Olea G. 2013. Coffee agrosystems: an
important refuge for amphibians in central Veracruz,
Mexico. Agroforestry Systems 87. 767-779.
Myers EA, Burgoon JL, Ray JM, Martinez-Gomez JE,
Matias-Ferrer N, Mulcahy DG, Burbrink FT. 2017.
Coalescent species tree inference of Coluber and
Masticophis. Copeia 105: 642-650.
Nevarez-de los Reyes M, Lazcano D, Garcia-Padilla E,
Mata-Silva V, Johnson JD, Wilson LD. 2016. The
herpetofauna of Nuevo Leon, Mexico: composition,
distribution, and conservation. Mesoamerican
Herpetology 3: 557-638.
Ochoa-Ochoa L, Flores-Villela O. 2011. Endemismo
de la herpetofauna: analisis y problematicas. Pp.
545-558 In: La Biodiversidad en Veracruz: Estudio
de Estado, Volumen IT. Editors, Cruz-Angon A, Lorea-
Hernandez FG, Hernandez-Ortiz V, Morales-Mavil
JE. Comision Nacional para el Conocimiento y Uso
de la Biodiversidad, Gobierno del Estado de Veracruz
y Universidad Veracruzana, Instituto de Ecologia,
A.C., México, DF, México. 678 p.
Oliver-Lopez L, Woolrich-Pifia GA, Lemos-Espinal JA.
2009. La Familia Bufonidae en México. Universidad
Nacional Autonoma de México y Comision Nacional
para el Conocimiento y Uso de la Biodiversidad,
México, DF, México.
Ordofiez-Gomez JD, Valadez-Azua R. 2008. Manejo, uso
y concepcion de Trachemys scripta desde el México
prehispanico hasta el México actual. AMMVEPE 19:
63-71.
Palacios-Aguilar R, Flores-Villela O. 2020. Taxonomic
revision and comments on two groups of the genus
Coniophanes (Squamata: Dipsadidae). Vertebrate
Zoology 70: 111-124.
Paredes-Garcia DM, Ramirez-Bautista A, Martinez-
Morales MA. 2011. Distribucién y representatividad
de las especies del género Crotalus en las areas
naturales protegidas de México. Revista Mexicana de
September 2021 | Volume 15 | Number 2 | e285
The herpetofauna of Veracruz, Mexico
Biodiversidad 82: 689-700.
Peralta-Hernandez R, Perea-Pérez A, Peralta-Hernandez
RO. 2019. Geographic distribution: Mexico, Veracruz.
Anolis schiedii. Herpetological Review 50: 746.
Parra-Olea G, Garcia-Castillo MG, Rovito SM, Maisano
JA, Hanken J, Wake DB. 2020. Descriptions of five
new species of the salamander genus Chiropterotriton
(Caudata: Plethodontidae) from eastern Mexico and
the status of three currently recognized taxa. PeerJ 8:
e8800
Pérez-Higareda G, Lopez-Luna MA, Smith HM. 2007.
Serpientes de la Region de Los Tuxtlas, Veracruz,
México. Guia de Identificacion Ilustrada. Instituto
de Biologia, Universidad Nacional Autonoma de
México, México, DF, México. 189 p.
Pérez-Higareda G, Smith HM. 1991. Ofidiofauna de
Veracruz. Andlisis Taxondémico y Zoogeogrdfico.
Publicaciones Especiales del Instituto de Biologia 7.
Universidad Nacional Autonoma de México, México,
DF, México. 122 p.
Pérez-Sato JA, Cerén-de la Luz NM, Serna-Lagunes
R, Rivera-Hernandez JE, Mora-Collado N, Salazar-
Ortiz J. 2018. Herpetofauna de tres localidades
del municipio de Amatlan de los Reyes, Veracruz,
México. Agro Productividad |1: 38-44.
Pineda-Arredondo E. 2015. Anfibios y Reptiles de las
Regiones Chimalapas (7) y Bosque de Coniferas
y BMM de Veracruz (11). Bases de datos SNIB-
CONABIO, proyecto JF212. Red de Biologia y
Conservacion de Vertebrados, Instituto de Ecologia,
México, DF, México.
Puc-Sanchez JI, Delgado-Trejo C, Mendoza-Ramirez
E, Suazo-Ortufio I. 2013. Las carreteras como una
fuente de mortalidad de fauna silvestre de México.
Biodiversitas 111: 12-16.
Ramirez-Bautista A. 1977. Algunos anfibios y reptiles de
la region de Los Tuxtlas, Veracruz. Bachelor’s Thesis,
Universidad Veracruzana, Xalapa, Veracruz, México
Ramirez-Bautista A, Canseco-Marquez L, Mendoza-
Quyano F. (Editors). 2006. Inventarios Herpeto-
faunisticos de México: Avances en el Conocimiento
de su Biodiversidad. Publicaciones Especiales de la
Sociedad Herpetologica Mexicana No. 3. Sociedad
Herpetologica Mexicana y Benemérita Universidad
Autonoma de Puebla, México, DF, México.
Ramirez-BautistaA, Hernandez-Salinas U, Cruz-Elizalde
R, Berriozabal-Islas C, Lara-Tufifio D, Goyenechea
Mayer-Goyenechea I, Castillo-Ceron JM. 2014. Los
Anfibios y Reptiles de Hidalgo, México: Diversidad,
Biogeografia y Conservacion. Sociedad Herpetologia
Mexicana, A.C., Universidad Autonoma del Estado de
Hidalgo, Pachuca, Hidalgo, México. 387 p.
Ramirez-BautistaA, Hernandez-Salinas U, Cruz-Elizalde
R, Berriozabal-Islas C, Moreno-Lara I, DeSantis DL,
Johnson JD, Garcia-Padilla E, Mata-Silva V, Wilson
LD. 2020. The herpetofauna of Hidalgo, Mexico:
composition, distribution, and conservation status.
Amphib. Reptile Conserv.
Amphibian & Reptile Conservation 14(1) [General
Section]: 63-118 (e224).
Ramirez-Bautista A, Hernandez-Salinas U, Garcia-
Vazquez UO, Leyte-ManriqueA, Canseco-Marquez L.
2009. Herpetofauna del Valle de México: Diversidad
y Conservacion. Universidad Autonoma del Estado de
Hidalgo y Comision Nacional para el Conocimiento y
Uso de la Biodiversidad, México, DF, México. 213 p.
Ramirez-Bautista A, Hernandez-Salinas U, Mendoza-
Quiano F, Cruz-Elizalde R, Stephenson BP, Vite-
Silva VD, Leyte-Manrique A. 2010. Lista Anotada de
los Anfibios y Reptiles del Estado de Hidalgo, México.
Universidad Autonoma del Estado de Hidalgo y
Comision Nacional para el Conocimiento y Uso de la
Biodiversidad, México, DF, México. 104 p.
Ramirez-Bautista A, Nieto-Montes de Oca A. 1997.
Ecogeografia de anfibios y reptiles. Pp. 522—528 In:
Historia Natural de los Tuxtlas. Editors, Gonzalez SE,
Dirzo R, Vogt R. Instituto de Biologia, Instituto de
Ecologia y Comision Nacional para el Conocimiento
y Uso de la Biodiversidad, México, DF, México. 647
p.
Ramirez-Gonzalez CG, Canseco-Marquez L. 2015.
Chelydra rossignonii, confirmacion de su presencia
en el estado de Oaxaca, México. Revista Mexicana de
Biodiversidad 86: 832-834.
Reyes-Velasco J, Adams RH, Boissinot S, Parkinson CL,
Campbell JA, Castoe TA, Smith EN. 2020. Genome-
wide SNPs clarify lineage diversity confused by
coloration in Coral Snakes of the Micrurus diastema
species complex (Serpentes: Elapidae). Molecular
Phylogenetics and Evolution 147: 106770.
Rossman DA, Ford NB, Seigel RA. 1996. The Garter
Snakes: Evolution and Ecology. University of
Oklahoma Press, Norman, Oklahoma, USA. 332 p.
Rovito SM, Parra-Olea G, Vazquez-Almazan CR,
Papenfuss TJ, Wake DB. 2009. Dramatic declines in
neotropical salamander populations are an important
part of the global amphibian crisis. Proceedings of the
National Academy of Sciences of the United States of
America 106: 3,231—3,236.
Roze JA. 1996. Coral Snakes of the Americas: Biology,
Identification, and Venoms. Krieger Publishing
Company, Malabar, Florida, USA. 328 p.
Ruane S, Bryson-Jr RW, Pyron RA, Burbrink FT.
2014. Coalescent species delimitation in Milksnakes
(genus Lampropeltis) and impacts on phylogenetic
comparative analyses. Systematic Biology 63:
231-250.
Sanchez-Juarez HD. 2002. Herpetofauna de las bahias de
Huatulco, Oaxaca, México: estudio comparativo con
cinco selvas bayas caducifolias. Specialization Thesis,
Universidad Veracruzana, Xalapa, Veracruz, México.
Sandoval-Comte A, Pineda E, Rovito SM, Luria-
Manzano R. 2017. A new species of Jsthmura
(Caudata: Plethodontidae) from the montane cloud
forest of central Veracruz, Mexico. Zootaxa 4277:
September 2021 | Volume 15 | Number 2 | e285
Torres-Hernandez et al.
573-582.
Scarpetta S, Gray L, Nieto-Montes de Oca A, Castafieda
MR, Herrel A, Losos JB, Luna-Reyes R, Jiménez-
Lang N, Poe S. 2015. Morphology and ecology of
the Mexican Cave Anole, Anolis alvarezdeltoroi.
Mesoamerican Herpetology 2: 261—270.
Secretaria de Medio Ambiente y Recursos Naturales
(SEMARNAT). 2012. Informe de la _ Situacion
del Medio Ambiente en México. Compendio de
Estadisticas Ambientales Indicadores Clave y de
Desempefio Ambiental. Secretaria de Medio Ambiente
y Recursos Naturales, México, DF, México. 362 p.
Secretaria de Medio Ambiente y Recursos Naturales
(SEMARNAT). 2018. Programa de Accién para la
Conservacion de las Especies: Serpientes de Cascabel
(Crotalus spp.). Secretaria de Medio Ambiente y
Recursos Naturales y Comision Nacional de Areas
Naturales Protegidas, Ciudad de México, México, DF,
México.
Sherbrooke WC, Lazcano-Villarreal D. 1999. Los
camaleones de México. México Desconocido 271:
50-57.
Sherbrooke WC. 2003. Introduction to Horned Lizards
of North America. University of California Press,
Berkeley, California, USA. 193 p.
Smith HM, Taylor EH. 1966. Herpetology of Mexico:
Annotated Checklists and Keys to the Amphibians and
Reptiles. Eric Lundberg, Ashton, Maryland, USA.
[610] p.
Sokal RR, Michener CD. 1958. A statistical method for
evaluating systematic relationships. University of
Kansas Science Bulletin 38: 1,409-1,438.
Solis-Zurita C, De Luna E, Gonzalez D. 2019.
Phylogenetic relationships in the Sce/oporus variabilis
(Squamata: Phrynosomatidae) complex based on
three molecular markers, continuous characters, and
geometric morphometric data. Zoologica Scripta 48:
419-439,
Stuart SN, Hoffman M, Chanson JS, Cox NA, Berridge
RJ, Ramani R, Young BE. 2008. Threatened
Amphibians of the World. Lynx Ediciones, Barcelona,
Spain. 758 p.
Suarez-Mota ME, Teéllez-Valdés O, Martinez-Meyer
E. 2014. Dominios climaticos de las areas naturales
protegidas del Eye Volcanico Transversal de México.
GeoFocus 14: 120-143.
Tepos-Ramirez M, Flores-Villela O, Velasco JA, Pedraza
Lara C, Garcia Rubio OR, Jadin RC. 2021. Molecular
phylogenetics and morphometrics reveal a new
endemic jumping pitviper (Serpentes: Viperidae:
Metlapilcoatlus) from the Sierra Madre Oriental of
Mexico. Journal of Herpetology 55: 181-191.
Teran-Juarez SA, Garcia-Padilla E, Mata-Silva_ V,
Johnson JD, Wilson LD. 2016. The herpetofauna of
Tamaulipas, Mexico: composition, distribution, and
conservation status. Mesoamerican Herpetology 3:
42-113.
Amphib. Reptile Conserv.
Uetz P, Freed P, HoSek J. (Editors). 2020. The Reptile
Database. Available: http://www.reptile-database. org
[Accessed: 16 June 2020].
Urbina-Cardona JN, Olivares-Pérez M, Reynoso VH.
2006. Herpetofauna diversity and microenvironment
correlates across a_pasture-edge-interior ecotone
in tropical rainforest fragments in the Los Tuxtlas
Biosphere Reserve of Veracruz, Mexico. Biological
Conservation 132: 61-75.
Uribe-Pefia Z, Ramirez-Bautista A, Casas-Andreu G.
1999. Anfibios y Reptiles de las Serranias del Distrito
Federal, México. Cuadernos del Instituto de Biologia,
No. 32. Universidad Nacional Autonoma de México,
México, DF, México. 119 p.
Valverde RA, Rouse-Holzwart K. 2017. Sea turtles of
the Gulf of Mexico. Pp. 1,189-1,351 In: Habitats and
Biota of the Gulf of Mexico: Before the Deepwater
Horizon Oil Spill, Volume 2. Fish Resources,
Fisheries, Sea Turtles, Avian Resources, Marine
Mammals, Diseases and Mortalities. Editor, Herb-
Ward C. Springer Open, New York, New York, USA.
869-1,757 p.
Vasquez-Cruz V, Canseco-Marquez L. 2020. Anfibios
y reptiles de la colonia agricola Rincon de las
Flores, Tezonapa, Veracruz, México. Revista
Latinoamericana de Herpetologia 3: 66-80.
Vasquez-Cruz V, Garcia-Vinalay A, Kelly-Hernandez A,
Aguilar-Lopez JL. 2020a. Geographic distribution:
Mexico, Veracruz: Eleutherodactylus planirostris.
Herpetological Review 51: 69.
Vasquez-Cruz V, Castillo-Juarez JL, Taval- Velazquez LP,
Reynosa-Martinez A. 2020b. Geographic distribution:
Mexico, Veracruz: Dryophytes euphorbiaceus.
Herpetological Review 51: 268.
Vasquez-Cruz V, Pérez-Gamez EM, Chacon-Juarez F.
2019. Geographic distribution: Mexico, Veracruz:
Coleonyx elegans. Herpetological Review 50(3): 524.
Vasquez-Cruz V, Kelly-Hernandez A, Reynoso-Martinez
A. 2018. Geographic distribution: Mexico, Veracruz:
Sphaerodactylus glaucus. Herpetological Review 49:
717.
Vazquez-Diaz J, Quintero-Diaz GE. 2005. Anfibios y
Reptiles de Aguascalientes. Comisién Nacional para
el Conocimiento y Uso de la Biodiversidad y Centro
de Investigaciones y Estudios Multidisciplinarios de
Aguascalientes, México, DF, México. 318 p.
Werler JE, Dixon JR. 2000. Texas Snakes: Identification,
Distribution, and Natural History. University of Texas
Press, Austin, Texas, USA. 437 p.
Wilson EO. 2020. Tales from the Ant World. Liveright
Publishing Corporation, Norton and Company, New
York, New York, USA. 227 p.
Wilson LD. 1970. The Coachwhip Snake, Masticophis
flagellum (Shaw): taxonomy and distribution. Tulane
Studies in Zoology and Botany 16: 31-99.
Wilson LD, Johnson JD. 2010. Distributional
patterns of the herpetofauna of Mesoamerica, a
September 2021 | Volume 15 | Number 2 | e285
The herpetofauna of Veracruz, Mexico
biodiversity hotspot. Pp. 30—235 In: Conservation
of Mesoamerican Amphibians and Reptiles. Editors,
Wilson LD, Townsend JH, Johnson JD. Eagle
Mountain Publishing, Eagle Mountain, Utah, USA.
812 p.
Wilson LD, Johnson JD, Mata-Silva V. 2013a. A
conservation reassessment of the amphibians of
Mexico based on the EVS measure. Amphibian &
Reptile Conservation 7(1): 97-127 (e69).
Wilson LD, Mata-Silva V, Johnson JD. 2013b. A
conservation reassessment of the reptiles of Mexico
based on the EVS measure. Amphibian & Reptile
Conservation 7(1): 1-47 (e61).
Wilson LD, Johnson JD, Porras LW, Mata-Silva V,
Garcia-Padilla E. 2017. A system for categorizing
the distribution of the Mesoamerican herpetofauna.
Mesoamerican Herpetology 4: 901-913.
Wilson LD, Townsend JH, Johnson JD. (Editors). 2010.
Conservation of Mesoamerican Amphibians and
Reptiles. Eagle Mountain Publishing, Eagle Mountain,
Utah, USA. 812 p.
Woolrich-Pifia GA, Garcia-Padilla E, DeSantis DL,
Johnson JD, Mata-Silva V, Wilson LD. 2017. The
herpetofauna of Puebla, Mexico: composition,
distribution, and conservation status. Mesoamerican
Herpetology 4: 790-884.
Woolrich-Pifia GA, Ramirez-Silva JP, Loc-Barragan J,
Ponce Campos P, Mata-Silva V, Johnson JD, Garcia-
Padilla E, Wilson LD. 2016. The herpetofauna of
Nayarit, Mexico: composition, distribution, and
conservation status. Mesoamerican Herpetology 3:
375-448.
Wright AH, Wright AA. 1957. Handbook of Snakes of
United States and Canada. Cornell University Press,
Ithaca, New York, USA. 1,105 p.
Yafiez-Arenas CA, Diaz-Gamboa LF, Rodriguez-Pérez
JA, Salmeron-Flores A, Patron-Rivero CM, Lopez-
Reyes KA, Rodriguez-Silva E, Buenfil-Avila A. 2016.
Tortugas con Potencial Invasor en México: Revision
Bibliografica y Analisis de Riesgo. Informe final
entregado a la CONABIO y al PNUD en el marco del
proyecto GEF 0089333 “Aumentar las Capacidades
Nacionales para el Manejo de las Especies Exoticas
Invasoras (EEI) a través de la Implementacion de la
Estrategia Nacional de EEI.” Unidad Académica de
Yucatan-UNAM, México, DF, México.
Addendum (changes which occurred past the conclusion of analyses)
We chose a cut-off date of 31 October 2020 to discontinue our revision of the sizeable number of calculations dealing
with the herpetofauna of Veracruz. After this date, we added the pertinent taxa and publications to this addendum, as
follows:
Exerodonta abdivita. De la Torre-Loranca et al. (2020) reported this hylid frog as new for the state of Veracruz, based
on a “dead-on-roadside” (DOR) specimen found at 1,900 m in Atlanca, in the municipality of Los Reyes.
Phrynosoma cornutum. Kohler (2021) indicated the distribution of this lizard in the extreme northern of Veracruz,
however, these records have not been genetically confirmed.
Metlapilcoatlus borealis. Tepos-Ramirez et al. (2021) described a new species of jumping viper (Metlapilcoatlus
borealis), which they showed to be distributed in Veracruz. These authors also indicated that M. nummifer 1s still
distributed in this state, such that now two species of jumping vipers are known from Veracruz.
Kinosternon integrum. De \a Torre-Loranca et al. (2020) reported this Mud Turtle as new for the state of Veracruz at
Ocotepec, in the municipality of Los Reyes, at an elevation of 1,622 m, and at Sierra de Agua, in the municipality of
Acultzingo, at an elevation of 1,389 m.
Lizzeth A. Torres-Hernandez is a Biology Bachelor’s intern at Universidad Autonoma del Estado
de Hidalgo in Mexico. She is interested in the topics of ecology, diversity, and conservation of
amphibians and reptiles of Mexico, as well as the study of climatic niches and the effects of climate
change on the distribution of these biological groups. She has realized minor contributions on the
diversity and conservation of amphibians and reptiles of Mexico.
Amphib. Reptile Conserv. 152 September 2021 | Volume 15 | Number 2 | e285
Amphib. Reptile Conserv.
Torres-Hernandez et al.
Aurelio Ramirez-Bautista began his herpetological career conducting research as an undergraduate
student at the Los Tuxtlas Biological Field Station, Veracruz, Mexico. He received his Bachelor’s
degree in Biology from Universidad Veracruzana in Veracruz, Mexico. He earned his Master’s
degree in Science and his Doctorate at the Universidad Nacional Autonoma de México (UNAM), and
received a postdoctoral appointment at the University of Oklahoma, Norman, Oklahoma, USA. His
main research involves studies on ecology, demography, reproduction, conservation, and life history
evolution, using the amphibians and reptiles of Mexico as models. He served as president of the
Sociedad Herpetologica Mexicana, as a section editor for the journal Mesoamerican Herpetology,
and as a professor at UNAM. Currently, he is a professor at Universidad Aut6noma del Estado de
Hidalgo (UAEH), where he teaches courses in population ecology, herpetology, and the natural
history of amphibians and reptiles. He has authored or co-authored 295 peer-reviewed papers and
books on herpetology, ecology, life history evolution, sexual size dimorphism, reproduction, global
climate change, potential distribution, demography, conservation, behavior, and thermal ecology.
As a professor, he has graduated 71 students, including 44 undergraduate students, 18 Master’s in
Science students, and seven Ph.D. students; he also has participated as an external advisor for Ph.D.
students at Brigham Young University (Provo, Utah, USA), the University of Miami (Coral Gables,
Florida, USA), and Eastern Carolina University (Greenville, North Carolina, USA). Aurelio has
received several national (Helia Bravo Hollis Award by the Technical Council of Scientific Research
of the UNAM, member of the National System of Researchers level II) and international (Donald
Tinkle Award by Southwestern Association of Naturalists) awards, and has a PRODEP (Programa
para el Desarrollo Profesional Docente) profile at UAEH.
Raciel Cruz-Elizalde is a Mexican herpetologist who received his B.Sc. in Biology, M.Sc. in
Biodiversity and Conservation, and Ph.D. in Biodiversity and Conservation from the Universidad
Autodnoma del Estado de Hidalgo (UAEH). Raciel is interested in the ecology, life history evolution,
diversity, and conservation of amphibians and reptiles of Mexico. He has authored or co-authored
several publications, including papers, notes, book chapters, and books on ecology, life history
evolution, sexual size dimorphism, reproduction, and the conservation of amphibians and reptiles. His
current research includes the life history evolution of diverse lizard species of the genus Sceloporus,
conservation issues in natural protected areas, and the analysis of ecological and morphological
traits in the composition of amphibian and reptile assemblages, mainly in cloud forests.
Uriel Hernandez-Salinas earned his Bachelor’s, Master’s, and Ph.D. degrees at the Universidad
Autoénoma del Estado de Hidalgo in Mexico. He is a herpetologist and the co-author of three books:
Herpetofauna del Valle de México: Diversidad y Conservacion, Lista Anotada de los Anfibios
y Reptiles del Estado de Hidalgo, México; and Los Anfibios y Reptiles del Estado de Hidalgo:
Diversidad, Biogeografia y Conservacion. He 1s a full-time professor at CIIDIR Durango, Mexico,
and curator-in-charge of the scientific collection of amphibians and reptiles at the same research
center. In addition to having authored or co-authored several peer-reviewed papers, he teaches
Environmental Management II and Fauna Management in the Master’s and Doctoral programs.
In 2015, he received the academic distinction of becoming a member of the National System of
Researchers, level 1. His main topics of interest are biodiversity, species richness, biogeography,
and the evolution of life histories of various species of amphibians and reptiles in Mexico.
Christian Berriozabal-Islas earned his Bachelor’s degree at the Universidad Autonoma del Estado
de Hidalgo in Mexico, and his Master’s and Ph.D. degrees in the Biodiversity and Conservation
program of this university. He is a herpetologist with an interest in species diversity, thermal
ecology, functional diversity, climatic change, and distributional patterns using amphibians and
reptiles as biological models. Currently, he is a professor at the Universidad Politécnica de Quintana
Roo in Mexico. Christian has been involved with projects on environmental education and wildlife
conservation in rural communities, and is a co-author of the book Los Anfibios y Reptiles del Estado
de Hidalgo, México: Diversidad, Biogeografia y Conservacion (2014). He also has authored or co-
authored several papers on diversity, ecology, and climate change. One of his primary interests is the
natural history of Mexican turtles.
153 September 2021 | Volume 15 | Number 2 | e285
Amphib. Reptile Conserv.
The herpetofauna of Veracruz, Mexico
Dominic L. DeSantis is an Assistant Professor of Biology at Georgia College and State University
(Milledgeville, Georgia, USA), in the Department of Biological and Environmental Sciences.
Dominic’s research interests broadly include the behavioral ecology, conservation biology, and
natural history of herpetofauna. In addition to ongoing collaborative projects associated with the
Mesoamerican Research Group, much of Dominic’s current research focuses on using novel animal-
borne sensor technologies to study the behavior of snakes in the field. While completing his Ph.D.
at the University of Texas at El Paso, Dominic accompanied Vicente Mata-Silva, Eli Garcia-Padilla,
and Larry David Wilson on survey and collecting expeditions to Oaxaca in 2015, 2016, and 2017,
and was a co-author on numerous natural history publications produced from those visits, including
an invited book chapter on the conservation outlook for herpetofauna in the Sierra Madre del Sur
of Oaxaca.
Jerry D. Johnson is Professor of Biological Sciences at The University of Texas at El Paso, and
has extensive experience studying the herpetofauna of Mesoamerica, especially that of southern
Mexico. Jerry is the Director of the 40,000-acre “Indio Mountains Research Station,” was a co-
editor of the book Conservation of Mesoamerican Amphibians and Reptiles and co-author of four
of its chapters. He is also the senior author of the recent paper “A conservation reassessment of
the Central American herpetofauna based on the EVS measure,” and is Mesoamerica/Caribbean
editor for Geographic Distribution section of Herpetological Review. Johnson has authored or co-
authored over 130 peer-reviewed papers, including two 2010 articles, “Geographic distribution
and conservation of the herpetofauna of southeastern Mexico” and “Distributional patterns of the
herpetofauna of Mesoamerica, a biodiversity hotspot.” One species, Zantilla johnsoni, has been
named in his honor. Presently, he is an Associate Editor and Co-chair of the Taxonomic Board for
the website Mesoamerican Herpetology.
Arturo Rocha is a Ph.D. student in the Ecology and Evolutionary Biology program at the
University of Texas at El] Paso. His interests include the study of the biogeography, physiology, and
ecology of amphibians and reptiles in the southwestern United States and Mexico. A graduate of
the University of Texas at El Paso, his thesis centered on the spatial ecology of the Trans-Pecos Rat
Snake (Bogertophis subocularis) in the northern Chihuahuan Desert. To date, he has authored or
co-authored over 20 peer-reviewed scientific publications.
Eli Garcia-Padilla is a herpetologist who focuses primarily on the study of the ecology and natural
history of the Mexican herpetofauna. His research efforts have centered on the Mexican states of Baja
California, Tamaulipas, Chiapas, and Oaxaca. His first experience in the field was researching the
ecology of the insular endemic populations of the rattlesnakes Crotalus catalinensis, C. muertensis
(C. pyrrhus), and C. tortugensis (C. atrox) in the Gulf of California. For his Bachelor’s degree, he
presented a thesis on the ecology of C. muertensis (C. pyrrhus) on Isla El Muerto, Baja California,
Mexico. To date, he has authored or co-authored over 100 peer-reviewed scientific publications.
Currently, he is employed as a formal Curator of Amphibians and Reptiles from Mexico in the
electronic platform Naturalista of the Comision Nacional para el Uso y Conocimiento de la
Biodiversidad (CONABIO,; http://www. naturalista.mx). One of his main passions is environmental
education, and for several years he has been working on various projects that include the use of
audiovisual media as a powerful tool to reach large audiences and to promote the importance of the
knowledge, protection, and conservation of the Mexican biodiversity. Eli’s interests include wildlife
and conservation photography, and his art has been published in several recognized scientific,
artistic, and educational books, magazines, and websites. Presently he is collaborating in a research
project evaluating the Jaguar (Panthera onca) as an umbrella species for the conservation of the
herpetofauna of Nuclear Central America.
154 September 2021 | Volume 15 | Number 2 | e285
Amphib. Reptile Conserv.
Torres-Hernandez et al.
Vicente Mata-Silva is a herpetologist originally from Rio Grande, Oaxaca, Mexico. His interests
include ecology, conservation, natural history, and biogeography of the herpetofaunas of Mexico,
Central America, and the southwestern United States. He received his B.S. degree from the
Universidad Nacional Autonoma de México (UNAM), and his M.S. and Ph.D. degrees from the
University of Texas at El Paso (UTEP). Vicente is an Assistant Professor of Biological Sciences
at UTEP in the Ecology and Evolutionary Biology Program, and Co-Director of UTEP’s Indio
Mountains Research Station, located in the Chihuahuan Desert of Trans-Pecos, Texas, USA. To
date, Vicente has authored or co-authored over 100 peer-reviewed scientific publications. He
also was the Distribution Notes Section Editor for the journal Mesoamerican Herpetology, and is
currently Acting Section Editor for the journal Herpetological Review, for Geographic Distribution.
Lydia Allison Fucsko, who resides in Melbourne, Australia, is an environmental activist and
amphibian conservationist. As a photographer with international publications, she has taken
countless amphibian photographs, including photo galleries of frogs mostly from southeastern
Australia. Dr. Fucsko has a Bachelor of Humanities from La Trobe University (Bundoora, Victoria,
Australia) and a Diploma in Education from the University of Melbourne (Parkville, Victoria,
Australia). She has postgraduate diplomas in computer education and in vocational education and
training from the University of Melbourne (Parkville). Additionally, Dr. Fucsko has a Master’s
Degree in Counseling from Monash University (Clayton, Victoria, Australia). She received her
Ph.D. on Environmental Education, which promoted habitat conservation, species perpetuation, and
global sustainable management, from Swinburne University of Technology (Hawthorn, Victoria,
Australia), while being mentored by the late Australian herpetologist and scholar Dr. Michael
James Tyler (Order of Australia recipient). Dr. Fucsko, a sought-after educational consultant, has
academic interests that include: clinical psychology, focusing on psychopathology; neuroscience
and empathy; environmental education for sustainable development; sentient ecology; academic
writing; and creative writing, which includes poetry and creative non-fiction books for children and
young adults. Dr. Fucsko is also the senior author (with Boria Sax) of a chapter in the 2019 Springer
Encyclopedia of Sustainability in Higher Education entitled “Learning Activities for Environmental
Education for Sustainable Development.” In 2020, the species Tantilla lydia, with the suggested
common name, Lydia’s Little Snake, was named in her honor.
Larry David Wilson is a herpetologist with lengthy experience in Mesoamerica. He was born in
Taylorville, Illinois, USA, and received his university education at Millikin University in Decatur,
Illinois, the University of Illinois at Champaign-Urbana (B.S. degree), and at Louisiana State
University in Baton Rouge (M.S. and Ph.D. degrees). He has authored or co-authored more than 450
peer-reviewed papers and books on herpetology. Larry is the senior editor of the book Conservation
of Mesoamerican Amphibians and Reptiles and the co-author of eight of its chapters. His other books
include: The Snakes of Honduras, Middle American Herpetology, The Amphibians of Honduras;
Amphibians & Reptiles of the Bay Islands and Cayos Cochinos, Honduras; The Amphibians and
Reptiles of the Honduran Mosquitia; and Guide to the Amphibians & Reptiles of Cusuco National
Park, Honduras. To date, he has authored or co-authored the descriptions of 75 currently recognized
herpetofaunal species, and seven species have been named in his honor, including the anuran
Craugastor lauraster, the lizard Norops wilsoni, and the snakes Oxybelis wilsoni, Myriopholis
wilsoni, and Cerrophidion wilsoni. Currently, Larry is Co-chair of the Taxonomic Board for the
website Mesoamerican Herpetology.
155 September 2021 | Volume 15 | Number 2 | e285
Official journal website:
amphibian-reptile-conservation.org
Amphibian & Reptile Conservation
15(2) [General Section]: 156-171 (e286).
Advertisement calls of six glassfrog species in the
Colombian Andes, and comments on priorities for future
research and conservation
1.2.3* Angela M. Mendoza-Henao, ‘Sebastian Duarte-Marin, and 'Marco Rada
'Departamento de Zoologia, Instituto de Biologia, Universidad Nacional Auténoma de México, Apartado Postal 70-153, 04510 Mexico City,
MEXICO ?*Posgrado en Ciencias Biolégicas, Universidad Nacional Aut6noma de México, Apartado Postal 70-153, C.P. 04510, Mexico City,
MEXICO ?Instituto de Investigacion de Recursos Bioldgicos Alexander von Humboldt, Claustro de San Agustin - Carrera 8 #15-08, Villa de
Leyva, Boyaca, COLOMBIA ‘Grupo Evolucién, Ecologia y Conservacion (EECO), Programa de Biologia, Universidad del Quindio, Armenia,
COLOMBIA *Departamento de Zoologia, Instituto de Biociéncias, Universidade de SGo Paulo, SGo Paulo, BRAZIL
Abstract.—Conservation initiatives are particularly important in light of the high proportion of species
threatened with extinction worldwide. Advertisement calls are a valuable resource for conservation given their
importance for studies on amphibian taxonomy, systematics, evolutionary biology, ecology, and monitoring
strategies. However, advertisement calls are still unknown for many species. Here, advertisement call
descriptions are provided for six glassfrog species (Centrolene huilensis, Centrolene hybrida, Nymphargus
orenonympha, Rulyrana flavopunctata, Rulyrana susatamai, and Sachatamia punctulata) from six localities in
four municipalities in the Andes of Colombia. Based on our current knowledge of the acoustics, distribution
ranges, presence in protected areas, and IUCN Red List threat status, some species of glassfrogs are identified
as priorities for future studies. The overall parameters measured for the advertisement calls of the species
described here fall within those known for other species from the same genus, but the species studied here are
differentiated from their congenerics by the pulse rate, number of notes, and/or dominant frequency. To date,
advertisement calls are known for approximately 60% of glassfrog species and we identified 23 priority species
with unknown calls which should be the focus of future research efforts.
Keywords. Anura, bioacoustics, Centrolenidae, South America, threatened species, taxonomy
Resumen.—Las iniciativas de conservacion son especialmente importantes teniendo en cuenta la elevada
proporcion de especies amenazadas de extincion en todo el mundo. Dada su importancia para los estudios
sobre taxonomia, sistematica, biologia evolutiva, ecologia y estrategias de seguimiento de los anfibios, los
cantos de anuncio son un recurso valioso para la conservacion. Sin embargo, los cantos de anuncio siguen
siendo desconocidos para muchas especies. En este trabajo se describen los cantos de anuncio de seis
especies de ranas de cristal (Centrolene huilensis, Centrolene hybrida, Nymphargus orenonympha, Rulyrana
flavopunctata, Rulyrana susatamai y Sachatamia punctulata) de seis localidades en cuatro municipios de los
Andes de Colombia. A partir de los conocimientos sobre acustica, areas de distribucion, presencia en areas
protegidas y estado de amenaza (Listas Rojas de la UICN), se identificaron algunas especies de ranas de cristal
como prioritarias para futuros estudios. Los parametros generales medidos en los cantos de anuncio de las
especies descritos estan dentro de los conocidos para otras especies del mismo género, pero las especies se
diferencian de sus congeéneres por la frecuencia de los pulsos, el numero de notas o la frecuencia dominante.
Hasta la fecha, se conocen los cantos de anuncio de aproximadamente el 60% de las especies de ranas de
cristal y hemos identificado 23 especies prioritarias con llamadas desconocidas hacia las que sugerimos
dirigir los esfuerzos de investigacion.
Palabras clave. América del Sur, Anura, bioacustica, Centrolenidae, especies amenazadas, taxonomia
Citation: Mendoza-Henao AM, Duarte-Marin S, Rada M. 2021. Advertisement calls of six glassfrog species in the Colombian Andes, and comments
on priorities for future research and conservation. Amphibian & Reptile Conservation 15(2) [General Section]: 156-171 (e286).
Copyright: © 2021 Mendoza-Henao et al. This is an open access article distributed under the terms of the Creative Commons Attribution License
[Attribution 4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction
in any medium, provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced,
are as follows: official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 2 May 2021; Published: 12 October 2021
Correspondence. *[email protected]
Amphib. Reptile Conserv. 156 October 2021 | Volume 15 | Number 2 | e286
Mendoza-Henao et al.
Introduction
Amphibians provide valuable ecosystem services in
aquatic and terrestrial environments acting in disease
control, pest control, and nutrient cycling (Valencia-
Aguilar et al. 2013), as well as providing an important
element of terrestrial and aquatic food webs (Zipkin et al.
2020). For instance, the tadpoles of some glassfrog species
are considered important for nutrient cycling in aquatic
ecosystems by stimulating the fungal activity in the leaf
litter (Connelly et al. 2011). Therefore, the absence of
these species can alter the structures and functions of the
ecosystems (Whiles et al. 2006, 2013). At the same time,
amphibians are the most threatened group of vertebrates
worldwide, being affected by habitat destruction, climate
change, and epidemic diseases (Lips et al. 2005; Loyola et
al. 2012; Pounds et al. 2006; Wake and Vredenburg 2008).
Habitat fragmentation threatens 89% of Neotropical
amphibians through population isolation, inbreeding,
and edge effects (Stuart et al. 2008), and the proportions
of declined species which exhibit recovery, stabilize at
lower abundance, or continue to decline remain unknown
(Scheele et al. 2019).
Considering that economic resources directed towards
conservation are scarce, these efforts must be channeled
towards the most vulnerable species (Barret et al. 2014).
Multiple approaches have been employed to identify
conservation priorities, including selection by species
range, phylogenetic endemism, or coverage by protected
areas (Mendoza and Arita 2014). Protected areas mitigate
threats acting upon anuran populations, mainly by
decreasing the deforestation due to land-use changes.
Additionally, protected areas also facilitate scientific
research by allowing investigators to perform long-term
studies on the biology and ecology of the key species
(Brooks et al. 2004; Guerra et al. 2018; Guayasamin et al.
2020; Lips et al. 2005; Loyola et al. 2012).
Detailed descriptions of advertisement calls are a
valuable resource among the multidisciplinary approaches
for clarifying taxonomic limits (e.g., Padial and De
La Riva 2009; Kohler et al. 2017), and for studies of
behavior, reproductive ecology, and evolution (Wells
2007). Advertisement calls are also an important resource
for the effective conservation assessment, planning,
and management of threatened species (Laiolo 2010;
Sanchez-Giraldo et al. 2020). However, despite increasing
efforts in the description of frog calls in neotropical
species-rich countries (Hutter et al. 2014; Guayasamin
et al. 2020; Viuche-Lozano et al 2018), information on
the advertisement calls is still lacking for many species
(Guerra et al. 2018; Rivera-Correa et al. 2021).
The glassfrogs (family Centrolenidae) are a significant
component of the neotropical amphibian communities
in rivers and streams. Glassfrogs comprise a highly
diverse group, currently with 12 genera and 156 species
(Guayasamin et al. 2020; Frost 2021). The northern Andes
in Colombia, Ecuador, Peru, and Venezuela have very high
Amphib. Reptile Conserv.
Species richness and endemism rates (Guayasamin et al.
2020; Ruiz-Carranza and Lynch 1991la; Twomey et al.
2014). Glassfrogs include riparian frogs found from sea
level in tropical rainforests to 3,300 m asl in the Andean
Paramos, where most species call to attract females, to
display territoriality, and as part of parental care behavior
(Cisneros-Heredia and McDiarmid 2007; Delia et al.
2014; Bravo-Valencia and Delia 2016; Delia et al. 2017).
Nevertheless, the vocalizations of most glassfrogs remain
largely unknown and are limited to approximately 92 of
the 156 species (or about 59%).
The large diversity in this region is threatened by
human activities such as mining, exploitation of natural
resources, and land transformation, all of which have
significant consequences on water quality and, therefore,
on the associated diversity. More than one-third of the
156 glassfrog species are in one of the risk categories
of the International Union for Conservation of Nature,
including eight Critically Endangered, 21 Endangered,
and 23 Vulnerable, with another 53 in the Data Deficient
category (IUCN 2010). Unfortunately, the areas with
higher diversity and endemism are not effectively
covered within established protected areas (Mendoza and
Arita 2014).
Considering the need for correctly identify glassfrog
species, especially distinguishing those that are sympatric
or morphologically similar, here the advertisement calls of
four glassfrog species in three genera from the Colombian
Andes are described for the first time, and call information
for two Rulyrana species from additional localities are
provided. Finally, considering that the description of
the advertisement calls is necessary for conducting field
research through active and passive searches, and that
research and conservation efforts must be channeled
towards the most vulnerable species, we also provide a
comprehensive evaluation of the current status of glassfrog
call descriptions regarding the species conservation status
to identify the priority species for future studies.
Materials and Methods
Collection Sites
Nocturnal fieldwork occurred in April and May 2018 in the
Andes of Colombia (1.e., Central and Eastern cordilleras;
Fig. 1). Advertisement calls of six species were recorded
from six localities in four municipalities: (1) Centrolene
hybrida: Miraflores municipality in Boyaca department,
at 1 km N of the finca el Vergel, 38 km, by road to ENE
Garagoa (5.10089, -73.22038; 1,947 m; 27-29 April
2018); (2) Centrolene huilensis: Isnos municipality in
Huila department at 5 km at NW of Istos in the road to
Popayan (1.96838, -76.25021; 1,988 m; 4-5 May 2018);
(3) Nymphargus oreonympha:. Alto Gabinete, La Ruidosa
stream, in Florencia municipality in Caqueta department,
road Florencia-Altamira (1.86936, -75.67183; 2,073
m, 6-7 May 2018); (4) Rulyrana flavopunctata: Sucre
October 2021 | Volume 15 | Number 2 | e286
Advertisement calls of six glassfrog species
-76°0’
Legend )
Ho
a 1200
| 2400
(> Falan
& Florencia
& Isnos [) 3600
Gi 4800
C) Miraflores
5°09’ —
ff
4°Q" _
3°09" _
2°0'
-77°0'
yo
Municipalities Altitude (m) Ae LL
( re i
-75°0'
5°0’
420
3°0"
2°0’
-73°0'
Fig. 1. Fieldwork localities in the Central and Eastern Cordilleras where the advertisement calls were obtained.
sidewalk, Florencia municipality in Caqueta department,
road Florencia-Altamira (1.86936, -75.67183; 1,134 m; 8
May 2018); (5) Rulyrana susatamai: Falan municipality,
Murillo stream in Piedecuesta, Tolima department
(5.1258, -74.97052; 1,133 m; 23-25 April 2018); and
(6) Sachatamia punctulata: Falan municipality, Cuamo
River at 10 km southwards from Falan head, in Tolima
department (5.1258, -74.97052; 441 m; 23—25 April 2018).
At each field site, free surveys (not time or effort
restricted) were conducted along the rivers and streams.
At least ten calls per individual were recorded in WAV
format with a digital recorder (Tascam DR-40) and a
unidirectional microphone (Sennheisser K6/ME 66) at a
sampling rate of 44.1 kHz and an amplitude resolution of
16 bits. Species identities were verified by comparison
of morphological characters with the species diagnoses
provided in Ruiz-Carranza and Lynch (1991 b,c; 1995a,b).
Microhabitat details were recorded, such as calling perch
height, perch type, and substrate. Surface temperatures of
either male frogs or the substrate from which a male frog
recently jumped were recorded using an infrared digital
thermometer (Benetech GM300, resolution 0.1 °C).
Snout-vent length (SVL) of calling males was measured
with a digital caliper. Voucher specimens were fixed with
10% formalin. Field numbers of Angela M. Mendoza-
Henao (AMMH) are reported for those specimens
Amphib. Reptile Conserv.
158
already deposited in the Instituto de Ciencias Naturales
(ICN), but not yet allocated museum numbers. Note that
due to the COVID-19 pandemic, the ICN is shut down
and numbers for AMMH specimens mentioned in the
manuscript are currently not available. After allocation
of museum numbers to these specimens, they can be
requested from the corresponding author. Recordings used
for call descriptions were deposited (in WAV format) in
the Coleccion de Sonidos Ambientales of the Instituto
Alexander von Humboldt (I[AVH-CSA-34233 to 34250).
Calls were analyzed using the software Raven Pro 1.4
(http://ravensoundsoftware.com/) with Blackman window
type, window size of 5 ms, 80% overlap, and DFT size of
1,024 samples to obtain the dominant frequency (in Hz). In
cases of multiple notes per call, the inter-note silent interval
was measured and for pulsed calls the pulse rate was
determined. Temporal parameters were measured from the
waveform (in ms). The sampling unit for the descriptive
analysis was the individual. Call figures of the spectrograms
were generated using Seewave v. 1.6 package (Sueur et al.
2008) in the R platform (version 3.4.3; R Development
Core Team 2014). The call terminology of Kohler et al.
(2017) was followed to categorize vocalization types,
temporal variables, and spectral variables. In that sense,
we followed the note-centered approach, and pulsed notes
were defined as those notes composed by multiple short
October 2021 | Volume 15 | Number 2 | e286
Mendoza-Henao et al.
(less than 50 ms) undividable sound units spaced with
silent intervals within the note.
Status of Glassfrogs Call Descriptions
To compile the information available in published
studies (peer-reviewed papers and books) for described
advertisement calls, online databases (AmphibiaWeb,
BioWeb Ecuador) were searched for call information,
and the Google Scholar search engine was queried with
the terms “advertisement call,” “glassfrog,” “glass frog,”
and “Centrolenidae.” Included here are the species calls
described in the sources identified, and those from an on-
going study (Duarte-Marin et al., submitted). For each
species, the information on level of threat was obtained
based on their IUCN (2019) conservation status. Because
many species are either classified as Data Deficient or simply
Non-Evaluated, we complemented the IUCN information
with two additional parameters in our comparisons: level of
endemism and occurrence in protected areas.
For the level of endemism, the range per species was
obtained and four categories were defined: Local, covering
less than 1,500 km/? of distribution at 1-5 locations in 1—2
countries; Sub-regional, area 1,501—35,000 km? in 1-3
countries without entirely covering a whole recognized
geographical region (e.g., Choco, Northern Andes);
Regional, area 35,001—200 000 km/, distributed in a large
part ofa country, in more than two countries, and distributed
in a large part or totality of a geographical region; Global:
covering more than 200,000 km/?, distributed in a whole
region or several geographical regions. For occurrence in
protected areas, the species ranges were compared with the
polygons of the protected areas of all categories included
in the World Database of Protected Areas, WDPA (IUCN/
UNEP 2010). Using Spatial Analysis tools in the ArcGIS
software (ESRI 2007), the proportion of each species
range contained in a protected area was determined. These
values were then grouped by the criteria of Rodrigues et
al. (2004): a species with a range smaller than 1,000 km?
should have 100% of its range within protected areas; and
a Species with a range larger than 250,000 km? should have
at least 10% of its range within protected areas. For species
with intermediate range sizes, the critical percentage was
calculated by linear interpolation from these two extremes.
The results of the three criteria (threat category,
endemism, and occurrence in protected areas) were
combined for each species and priority species were
defined as those with local ranges (i.e., less than five
known locations in less than 1,500 km/7), not covered by
protected areas, and in either the Critical, Endangered,
Data Deficient or Non-Evaluated categories of IUCN.
Results
In total, 250 advertisement calls were analyzed for 19
individuals of six glassfrog species. Detailed information
for the voucher code, temperature at the time of recording,
number of individuals recorded, mean snout-vent length
(SVL), air temperature, and measured call traits for each
individual is provided in Table 1. Values in the following
call descriptions are given as mean + standard deviation.
Spectrograms and oscillograms of the advertisement call
Table 1. Call features for the six glassfrog species described in this study. N = number of analyzed calls (recorded males). Values
are mean + SD. The call recordings from collected and non-collected specimens were deposited in the Coleccion de Sonidos
Ambientales Mauricio Alvarez-Rebolledo.
Centrolene Centrolene
huilensis hybrida
N: calls (males) 58 (5) 40 (4)
Mean Snout- Vent Length (mm) 27.0 21.5
Collector field numbers AMMH 174-178 AMMH 168-170
IAvH-CSA
34233-34237
IAvH-CSA
Call vouchers 34328-34340
Temperature (°C) 14.7 12.5
4,785.5 + 336.4 (first
note), 4,940.2 + 266.3
(second note)
Dominant frequency (Hz) 6,072.9 + 106.0
Call duration (ms) 142.8+4.41 227.8 + 61.22
Number of notes 1 or 2(1.9+40.31) 1 to 5 (1.2 + 0.68)
Note duration (ms) 28.8 + 1.06 19.9497
Internote interval (ms) 97.5+ 12.8 1,322.3 + 87.6
Call type Tonal Tonal
Pulses per note —_ —
Amphib. Reptile Conserv.
159
Nymphargus Rulyrana Rulyrana Sachatamia
oreonympha flavopunctata susatamai punctulata
60 (3) 18 (1) 34 (3) 40 (3)
24.5 19.8 22.8 27.8
AMMH 181-183 AMMH 186 AMMH 162-164 AMMH 165-167
IAVH-CSA IAvH-CSA IAvH-CSA IAvH-CSA
34241-34242 34244 34245-34247 34248-34250
12.6 17.0 19.5 23.5
4,085.04 134.55 6,361.9+ 35.6 5,967.2 + 163.6 5,611.74 213.9
14.3422 29.7+3.1 58.7 + 6.58 183.2 + 155.6
1 1 1 1 to 5 (2.35 + 1.14)
14.3422 29.7+3.1 58.7 + 6.58 17.6442
— — — 97.2+ 16.1
Tonal Pulsar Pulsar Pulsatic-harmonic
— 4.06 + 0.54 8.41+0.82 3.74 + 1.62
October 2021 | Volume 15 | Number 2 | e286
Advertisement calls of six glassfrog species
po Soe eee ee ee ee eee
a Centrolene huilensis am
a T 0
> £
ee 10
g 5 -15
LL -20
4 -25
-30
ao
a
Z
x
0.00 0.05 0.10 0.15 0.20
Time (5)
_ 38 Vy mphargus. 0FeonyMpha | Agpimuce
N
S tT et gl rh if chk ge tien msl haem wk nc nal ws mons fe en ee oe te ek ie ne dee ir 0
> £
5 6 -10
gs 45
iL -20
4 -25
-30
3
2
a
0.00 0.02 0.04 0.06 0.08 0.10
Time (s)
_ ®& -Rulyrana’susatamaio rr oe
=, 0
Fs 4
5 6 -10
aie 45
-20
4 giao Wha lnp ih sind lad sean ilada‘tlgheaistn tio iaasbbig Kasih, Merwe lin gud acco Aisne igi etoey alent lemme nlnsoad 25
-30
3
=
E
0.04
0.06 0.08
Time (5)
Frequency (kHz)
Amplitude
Frequency (KHz)
Amplitude
Frequency (KHz)
Amplitude
'Centrolene hybrida
0.10
Time (s)
-RULY- FAN A. AAVOPUNCEAEA o.oo ormnrennnnnn
0.00 0.02 0.04 0.06 0.08 0.10
Time (s)
8 -Sachatamia punctulata-""" rn
ei La te ice ae, GL Te Sa 0
0.00 0.05
0.10
0.15
Time (s)
0.20 0.25
Fig. 2. Spectrograms (top) and oscillograms (bottom) of the described glassfrogs advertisement calls. All calls are displayed at
Blackman window (length = 512) and 80% overlap, at the same frequency range, and all but S. punctulata and C. huilensis are
displayed at the same temporal scale.
of each species are provided in Fig. 2.
Centrolene huilensis. Individuals were found calling
from the upper side of leaves at 1.5 to 4 m above the
water. Calls were obtained between 2300 h and 0130 h
on clear nights with a full moon. The advertisement call
is composed of one or two single-toned notes similar to
a “Tic” to the human ear. The first note has a duration of
27.63 + 11.37 ms anda peak frequency of 4,785.5 + 336.42
Hz while the second one has a duration of 30.9 + 11.85
ms and a peak frequency of 4,940.2 + 266.34 Hz (Fig. 2).
Both notes have limited amplitude modulation with the
highest energy located near the middle of the note. The
notes are separated by a silent interval of 9.75 + 1.28 ms.
Centrolene hybrida. Individuals call from the upper
surfaces of leaves from 20 cm to 5 m above the water.
Advertisement calls were obtained between 2000 h and
2350 h on clear nights in vegetation above small and
medium-sized streams located on the sides of cattle-
Amphib. Reptile Conserv.
160
cleared areas. The call is a toned note similar to a “Tic”
to the human ear. The whole note lasted 19.9 + 9.7 ms and
had a dominant frequency of 6,072.9 + 106.0 Hz (Fig. 2).
In most cases, the call was composed by a single note, but
in a few instances, individuals produced calls with up to
five notes after a silent interval of 1,322.3 + 87.6 ms. The
highest energy is displayed at the first third of the note.
Nymphargus oreonympha. Individuals were recorded
calling at heights of up to 4 m in leaves and branches
above the water in a small stream between 2200 h and
0115 h, with some males near egg depositions. Calls were
obtained on nights following a heavy afternoon rain. The
call is a single-toned short note (14.3 + 22.1 ms) similar
to a “Tic” to the human ear. The dominant frequency was
3,995.9 + 37.8 Hz, and low in comparison with the other
calls described here. The notes have limited amplitude
modulation with the highest energy located near the
middle of the note. One individual showed a call with a
October 2021 | Volume 15 | Number 2 | e286
Mendoza-Henao et al.
A) By Conservation Status B) By Range
Number of calls
Call No call Call
IUCN
HM Least concern (LC) [Endangered (EN)
Mi) Near threatened (NT) [Critically endangered (CR)
| Vulnerable (VU) Data deficient (DD)
Range
Global
Msubregional
MM Regional Local
C) By Natural Protected Areas
protection
0
No call Call
Natural Protected Areas
BB No protected
i Protected
No call
Fig. 3. Counts of glassfrog species for those with and without the call described, and categorized by: (A) IUCN conservation status
categories; (B) Endemism or distribution range (see details in Materials and Methods); and (C) Occurrence in National Protected
Areas.
slightly higher dominant frequency (4,263.3 + 55.8 Hz)
after a confrontation with another male. After the combat,
the male emitted the call at 20 cm above the water on a
branch and the second individual left the branch.
Rulyrana_ flavopunctata. The specimen calling
was recorded at 0226 h from the upper side of a large
Araceae-like leaf at 1 m above the water. Several males
of the species were observed calling together with other
individuals in the background. The call is a single-trilled
note similar to a “Trit” to the human ear, lasting 29.7 + 3.1
ms, with 3—S pulses (mean 4.06) at a rate of 137.9 pulses/s,
and the dominant frequency was 6,361.8 + 35.6 Hz with
no amplitude modulation (Fig. 2).
Rulyrana susatamai. The specimens were calling from
2000-0340 h during nights with light rain. Individuals of
R. susatamai were calling from the tips of the upper sides
of leaves, above small streams at heights of around 2—5
m. The call is a single-trilled note similar to a “Tri” to
the human ear, lasting 58.7 + 6.58 ms with a dominant
frequency of 5,967.2 + 163.6 Hz (Fig. 2). The note
comprises 7-10 pulses at a rate of 143.3 pulses/s whose
energy increases slightly along the note.
Sachatamia punctulata. The calls were emitted from
rocks and on vegetation up to 4 m high between 0100
and 0300 h. After heavy rains, multiple amplectant
individuals were also observed. The call is a series of
pulsatic-harmonic notes (1—5 notes) of 17.6+ 4.2 ms, with
an internote interval of 97.2 + 16.1 ms and a dominant
frequency of 5,611.7 + 213.9 Hz with no amplitude
modulation detected (Fig. 2). It is similar to a “Tru” to the
human ear. Each note shows up to 3.74 + 1.62 pulses at a
rate of 220 pulses/s.
Status of Glassfrog Call Descriptions
Including the advertisement calls of the species described
here, the number of species with advertisement call
descriptions increases to 92 (59.3% of all species of
glassfrogs, see Appendix 1). Regarding the species
Amphib. Reptile Conserv.
by conservation status (Fig. 3A), 48 of the 55 of non-
threatened species (Least Concern and Not Evaluated)
have their calls described, while 30 of the 95 threatened
species (Vulnerable, Endangered, Critically Endangered)
have their calls described. Regarding the distribution
categories (Fig. 3B), the call is known for 63 of the 82
species that have Sub-regional, Regional, and Global
distributions; whereas only 37 of the 75 species with a
Local distribution have their calls described. Fifty of the
species with their calls described are effectively covered
by Natural Protected Areas while the call is unknown for
35 species restricted to outside of Natural Protected Areas
(Fig. 3C). By combining all these criteria, a total of 23
species whose call is undescribed are identified as priorities
for bioacoustics and conservation research (Appendix 2).
Discussion
The detailed descriptions of the advertisement calls for
the anurans of highly diverse regions, like the northern
Andes, are a valuable resource for studies in taxonomy,
biodiversity monitoring, and various ecological and
evolutionary aspects of anurans. Here, the descriptions of
the advertisement call of six Andean glassfrog species are
provided, and the call parameters are compared with those
from other species in the same genus. The species which
either do or do not have their calls described are assessed
regarding their conservation status and the implications and
challenges of the current species coverage are discussed in
terms of ecology and conservation.
Call Comparisons among Species
The overall structures of the advertisement calls of the
species included in this study coincide with those known
for other glassfrogs in terms of having short notes (less than
200 ms) of relatively high frequencies (over 3,000 Hz), but
the specific calls can be differentiated among congeneric
species. For instance, the advertisement call of S.
October 2021 | Volume 15 | Number 2 | e286
Advertisement calls of six glassfrog species
punctulata differs from the calls described for Sachatamia
ilex and Sachatamia albomaculata by having a set of
multiple notes (1—5), while those of the latter species are
composed only by a single note (Guayasamin et al. 2020;
Kubicki 2007). The call of N. oreonympha has a frequency
of 4,085.0 + 134.55 Hz, similar to most calls described
for Nymphargus species (only N. siren has a frequency
over 5,000 Hz, Guayasamin et al. 2020), however the N.
oreonympha advertisement call can be differentiated from
the others described to date (a) by having the shortest
note (14.3 + 2.2 ms vs. 202.3 + 9.3 ms in N. bejaranoi,
115.0 + 18.0 ms in N. grandisonae, 122.0 + 9.0 ms in N.
griffithsi, 26.0 + 6.0 ms in N. lasgralarias, 16.5 + 2.1 ms
in N. mariae, 100.0+7.0 ms in N. manduriacu, 181 + 2.81
ms in N. pluvialis, 24.0 + 7.0 ms in N. siren, and 170.1 +
4.41 ms in WN. truebae); and (b) because the N. oreonympha
advertisement call is comprised by a single tonal note
while most others are pulsar (N. bejaranoi, N. gradisonae,
N. manduriacu, N. pluvialis, and N. truebae,; Catenazzi
et al. 2009; Guayasamin et al. 2019, 2020; Hutter and
Guayasamin 2012; Marquez et al. 1996).
Centrolene, with 24 species described, is one of the
high diversity clades within Centrolenidae; it is also one
of the genera with more advertisement calls recorded. The
advertisement calls of Centrolene species usually consist of
pulsed notes (e.g., C. altitudinale, C. buckleyi, C. condor,
C. geckoidea, C. sabini, C. hesperia, C. notosticta, C.
peristicta, C. sanchezi, and C. venezuelense), a combination
of pulsed and tonal notes (C. /ynchi), or tonal and pulsed
notes as in “C.” quindianum (Cadle and McDiarmid
1990; Marquez et al. 1996; Grant et al. 1998; Sefiaris and
Ayarzagtiena 2005; Guayasamin et al. 2006; Dautel et al.
2011; Catenazii et al. 2009; Almendariz-C and Batalla
2012; Salgado and Guayasamin 2018; Viuche-Lozano et
al. 2018; Rios-Soto et al. 2017). This call structure differs
of that observed here in C. huilensis and C. hybrida, and
those described for C. daidalea and C. savagei, whose
calls consist of tonal note(s) (Cardozo-Urdaneta and
Sefiaris 2012; Vargas-Salinas et al. 2017). Likewise, we
can note that among Centrolene species, the advertisement
calls of C. huilensis, C. altitudinale, C. hybrida, and C.
sanchezi are quite similar in several spectral parameters
(see Sefiaris and Ayarzagtiena 2005; Guayasamin et al.
2020). However, there are remarkable differences in some
temporal parameters of the calls, i.e., the internote interval
of C. huilensis is shorter (97.5 + 12.8 ms) than that reported
in C. altitudinale (331 + 6.5 ms) and the notes of C.
hybrida are longer (227.8 + 6122 ms) than those described
for C. sanchezi (11 +2.8 ms). In addition, in most cases the
advertisement calls of C. hybrida exhibited a single note
(mean 1.2 notes per call), while in C. sanchezi the mean
was 5.9 notes. Although most glassfrog calls comprise
high-pitched short notes of high energy without variation
between the dominant frequencies of each note, the call
of C. huilensis had variation in the dominant frequencies
between the two notes. To date, this pattern is known for
only a few glassfrog species, such as C. Iynchi (Dautel et
Amphib. Reptile Conserv.
al. 2011), C. hesperium (Cadle and McDiarmid 1990), and
C. sabini (Catenazzi et al. 2009).
The delimitation of some species within Rulyrana is
still a matter of debate. For example, Twomey et al. (2014)
found a very low genetic distance between samples of the
sister species R. adiazeta and R. susatamai, raising some
questions regarding their taxonomic status. The species
are highly similar morphologically, so a multidisciplinary
approach is necessary to resolve the species limits, and
an integrative approach is necessary to determine the
phylogenetic relationships between R. susatamai and R.
adiazeta (Twomey et al. 2014). In this sense, information
for the species in their respective type localities can be
used to solve such riddles. Here, the parameters of the
advertisement call of R. susatamai obtained from the type
locality (Falan municipality, Tolima department) are quite
similar to those described by Galindo et al. (2020) from
males of the species recorded in two localities also in Tolima
department (Anzoategui and Libano municipalities).
They will be useful for direct comparisons in order to
resolve this taxonomic problem when the advertisement
call of R. adiazeta becomes available. Concerning R.
flavopunctata, although the male recorded here (eastern
slope of eastern Cordillera in Colombia, AMMH-186, Fig.
2) is morphologically similar to males from Ecuador, the
advertisement calls described by Guayasamin et al. (2020)
have a longer mean note duration (40 ms Ecuador vs. 19.9
ms Colombia), greater mean number of pulses per note (7
Ecuador vs. 4 Colombia), and greater mean pulse rate (262
pulses/s Ecuador vs. 137.9 pulses/s Colombia). In this
study, an unexpected variation in parameters is illustrated
between two geographically distant advertisement calls.
Temporal acoustic parameters, such as call duration and
number of pulses, are highly influenced by climatic and
social factors (Morais et al. 2012; Kohler et al. 2017).
Unfortunately, the number of individuals recorded in both
localities was too low to provide an explanation for these
large differences, which could potentially be interpreted
as individual or intraspecific variation or as evidence of
undescribed morphologically similar diversity. However,
the variation detected is a good example highlighting the
need to include calls from different individuals at a variety
of localities in taxonomical and ecological studies.
Usefulness and Gaps in Conservation Strategies
The advertisement calls described in this study represent
a reliable resource for further studies on glassfrog
species. Two species, S. punctulata and R. susatamai,
are considered Vulnerable and Near Threatened by the
IUCN, respectively. They were previously identified as
priority species for conservation considering their high
phylogenetic endemism (Twomey et al. 2014; Mendoza
and Arita 2014). We also described for the first time the
call of the Endangered species C. huilensis, which was
recently registered for Colombia after 30 years without
records. Populations of C. huilensis, especially those from
162 October 2021 | Volume 15 | Number 2 | e286
Mendoza-Henao et al.
Ecuador, require further evaluation regarding taxonomy
and ecological monitoring (Mendoza-Henao et al. 2019).
The call description provided here will facilitate species
identification and detection in acoustic surveys, as a valid
source of data on the species distribution which 1s needed
for conservation (Carvajal-Endara et al. 2019).
Although the number of studies of bioacoustics in
glassfrogs has increased in recent years, there are still many
species in this family for which the advertisement call is
still undescribed. Six of the eight Critical Endangered
species that do not have their advertisement call described
are not recorded in any protected areas (Fig. 3). In
addition, 23 species are under some degree of threat and
thus considered priorities for conservation (1.e., assessed
in an IUCN threat category, having a local distribution,
and not being covered by a protected area, Appendix 1).
The current gaps in glassfrog call descriptions can be
explained by several factors. Many locations where the
Species are reported are difficult to access. Considering
that some glassfrogs are highly susceptible to changes
in habitat conditions, they mostly occur in inaccessible
(and unaltered) areas of the rainforest and cloud forest
(e.g., Nymphargus garciae, Ruiz-Carranza and Lynch
1995; Nymphargus humboldti, Guayasamin et al. 2020;
Teratohyla adenocheira, Harvey and Noonan 2005). In
addition, the ecology of some glassfrog species makes it
difficult to record their calls because they are explosive
breeders. This means that they are available only for a
limited time and under specific environmental conditions,
and the males perch and call near waterfalls where they
usually go unnoticed due to the high level of background
noise (e.g., “Centrolene” medemi, C. gekoidea, and R.
adiazeta, Ruiz-Carranza and Lynch 1991; Lynch et al.
1983). Finally, low population densities or population
decreases could reduce the detectability of these species
in the field (e.g., “Centrolene” acantidiocephalum, Ruiz-
Carranza and Lynch 1989; “Centrolene” azulae, Flores
and McDiarmid 1989), making recordings of their calls
rare or non-existent.
The new call descriptions for four glassfrog species
presented here, plus the call descriptions of two species
in strategic localities, contribute to the knowledge of
endemic amphibian species that occur in the northern
Andes. In addition, our results highlight the glassfrog
species that do not have their call described thus far, and
which should be prioritized in bioacoustic studies due to
their threat status, endemism, and lack of occurrence in
protected areas. This information can be used to establish
future programs that use acoustic recordings to monitor
populations with automated records, and to explore the
taxonomic, ecological, and behavioral aspects of other
understudied species.
Acknowledgments —AMMH_ was __ supported by
scholarship 416922 from Consejo Nacional de Ciencia
y Tecnologia (CONACYyT, Mexico), through Posgrado
de Ciencias Biologicas of the Universidad Nacional
Amphib. Reptile Conserv.
Autonoma de México (UNAM). This project was
supported by PAPITT-DGAPA (UNAM) project 203617
and the Rufford Foundation (Rufford Small Grant
reference 18423-1). Funding for MR was provided by
Coordenacaéo de Aperfeigoamento de Pessoal de Nivel
Superior CAPES code 001 (PEC-PG) and PNPD programs
(Proc. 2016.1.263.41.6). We sincerely thank all the people
who supported us during field trips: Alejandro Rodriguez,
Jose Criollo, Arnol C. Sanchez, Valentina Nieto, José
Vieira, Michael Pasaje, Maria Camila Basto-Riascos, and
Davixon Jiménez Ferreira. Finally, we thank Johana Goyes
and Taggert Butterfield, and two anonymous reviewers,
for their invaluable comments on the manuscript.
Literature Cited
Almendariz A, Batallas D. 2012. Nuevos datos sobre la
distribucion, historia natural y el canto de Centrolene
condor Cisneros-Heredia y Morales-Mite, 2008
(Amphibia: Anura: Centrolenidae). Revista Politécnica
30(3): 42-53.
Barrett K, Nibbelink NP, Maerz JC. 2014. Identifying
priority species and conservation opportunities under
future climate scenarios: amphibians in a biodiversity
hotspot. Journal of Fish and Wildlife Management 5:
282-297.
Bravo-Valencia L, Delia JRJ. 2016. Maternal care in a
glassfrog: care function and commitment to offspring in
Ikakogi tayrona. Behavioral Ecology and Sociobiology
70: 41-48.
Brooks TM, Bakarr MI, Boucher T, Da Fonseca GA,
Hilton-Taylor C, Hoekstra JM, Moritz T, Olivieri S,
Parrish J, Pressey RL, et al. 2004. Coverage provided
by the global protected-area system: is it enough?
BioScience 54: 1,081—1,091.
Cadle JE, McDiarmid RW. 1990. Two new species
of Centrolenella (Anura: Centrolenidae) from
northwestern Peru. Proceedings of the Biological
Society of Washington 103: 746-768.
Caminer MA, Mila B, Jansen M, Fouquet A, Venegas PJ,
Chavez G, Lougheed SC, Ron SR. 2017. Systematics
of the Dendropsophus leucophyllatus species complex
(Anura: Hylidae): cryptic diversity and the description
of two new species. PLoS One 12: e0171785.
Cardozo-Urdaneta A, Sefiaris JC. 2012. Vocalizacion
y biologia reproductiva de las ranas de cristal
Hyalinobatrachium pallidum y Centrolene daidaleum
(Anura, Centrolenidae) en la sierra de Perija, Venezuela.
Memoria de la Fundacion La Salle de Ciencias
Naturales 70(173—174): 87-105.
Carvajal-Endara S, Coloma LA, Morales-Mite MA,
Guayasamin JM, Szekely P, Duellman WE. 2019.
Phylogenetic systematics, ecology, and conservation
of marsupial frogs (Anura: Hemiphractidae) from the
Andes of southern Ecuador, with descriptions of four
new biphasic species. Zootaxa 4562: 1-102.
Catenazzi A, Rodriguez LO, Donnelly MA. 2009. The
October 2021 | Volume 15 | Number 2 | e286
Advertisement calls of six glassfrog species
advertisement calls of four species of glassfrogs
(Centrolenidae) from southeastern Peru. Studies on
Neotropical Fauna and Environment 44. 83-91.
Chavez G, Pradel R, Catenazzi A. 2019. Integrative
taxonomy reveals first country record’ of
Hyalinobatrachium mondolfi Sefiaris and Ayarzaguena,
2001, and distribution range extensions for Cochranella
nola Harvey, 1996, and Rulyrana spiculata Duellman,
1976 (Anura: Centrolenidae) in Peru. Zootaxa 4691:
541-560.
Connelly S, Pringle CM, Whiles MR, Lips KR, Kilham S,
Brenes R. 2011. Do tadpoles affect leaf decomposition
in neotropical streams? Freshwater Biology 56: 1,863—
1875.
Dautel N, Maldonado ALS, Abuza R, Imba H, Griffin
K, Guayasamin JM. 2011. Advertisement and combat
calls of the glassfrog Centrolene lynchi (Anura:
Centrolenidae), with notes on combat and reproductive
behaviors. Phyllomedusa: Journal of Herpetology 10:
31-43.
Delia J, Ramirez-Bautista A, Summers K. 2014.
Glassfrog embryos hatch early after parental desertion.
Proceedings of the Royal Society B: Biological Sciences
281(1785): 1-7.
Delia J, Bravo- Valencia L, Warkentin KM. 2017. Patterns
of parental care in neotropical glassfrogs: fieldwork
alters hypotheses of sex-role evolution. Journal of
Evolutionary Biology 30(5): 898-914.
Flores G, McDiarmid RW. 1989. Two new species of
South American Centrolenella (Anura: Centrolenidae)
related to C. mariae. Herpetologica 45: 401-411.
Frost DR. 2021. Amphibian Species of the World: an
Online Reference. Version 6.1. American Museum of
Natural History, New York, New York, USA. Available:
https://amphibiansoftheworld.amnh.org/index. php
[Accessed: 15 September 2020].
Galindo CA, Vichue-Lozano A, Bernal MH. 2020. The
advertisement call of the Colombian endemic glassfrog
Rulyrana susatamai (Anura: Centrolenidae). Zootaxa
4852: 586-589.
Grant T, Bolivar GW, Castro F. 1998. The advertisement
call of Centrolene geckoideum. Journal of Herpetology
32: 452-455.
Guayasamin JM, Castroviejo-Fisher S, Trueb_ L,
Ayarzagtiena J, Rada M, Vila C. 2009. Phylogenetic
systematics of glassfrogs (Amphibia: Centrolenidae)
and their sister taxon Allophryne ruthveni. Zootaxa
2100: 1-97.
Guayasamin JM, Cisneros-Heredia DF, Vieira J, Kohn
S, Gavilanes G, Lynch RL, Hamilton PS, Maynard
RJ. 2019. A new glassfrog (Centrolenidae) from the
Choco-Andean Rio Manduriacu Reserve, Ecuador,
endangered by mining. PeerJ 7: e6400.
Guayasamin JM, Cisneros-Heredia DF, McDiarmid RW,
Pefia P, Hutter CR. 2020. Glassfrogs of Ecuador:
diversity, evolution, and conservation. Diversity 12:
Spee
Amphib. Reptile Conserv.
164
Guerra V, Llusia D, Gambale PG, Morais ARD, Marquez
R, Bastos RP. 2018. The advertisement calls of Brazilian
anurans: historical review, current knowledge, and
future directions. PLoS One 13: e0191691.
Harvey MB, Noonan BP. 2005. Bolivian glassfrogs
(Anura: Centrolenidae) with a description of a new
species from Amazonia. Proceedings of the Biological
Society of Washington 118: 428-441.
Hutter CR, Guayasamin JM. 2012. A new cryptic species
of glassfrog (Centrolenidae: Nymphargus) from
Reserva Las Gralarias, Ecuador. Zootaxa 3257: 1-21.
Hutter CR, Guayasamin JM, Wiens JJ. 2013. Explaining
Andean megadiversity: the evolutionary and ecological
causes of glassfrog elevational richness patterns.
Ecology Letters 16: 1,135—1,144.
IUCN. 2019. The IUCN Red List of Threatened Species.
Version 2019-1. Available: https://www.1ucnredlist.org
[Accessed: 15 September 2020].
Kohler J, Jansen M, Rodriguez A, Kok PJ, Toledo LF,
Emmrich M, Glaw F, Haddad CFB, Rodel MO, Vences
M. 2017. The use of bioacoustics in anuran taxonomy:
theory, terminology, methods, and recommendations
for best practice. Zootaxa 4251: 1-124.
Kubicki B. 2007. Ranas de Vidrio de Costa Rica/Glass
Frogs of Costa Rica. Editorial INBio, Santo Domingo
de Heredia, Costa Rica. 304 p.
Laiolo P. 2010. The emerging significance of bioacoustics
in animal species conservation. Biological Conservation
143: 1,635-1,645.
Lips KR, Burrowes PA, Mendelson HI JR, Parra-Olea
G. 2005. Amphibian declines in Latin America:
widespread population declines, extinctions, and
impacts. Biotropica 37: 163-165.
Loyola RD, Nabout JC, Trindade Filho J, Lemes P,
Cardona JNU, Dobrovolski R, Sagnori MD, Diniz
Filho JAF. 2012. Climate change might drive species
into reserves: a case study of the American Bullfrog
in the Atlantic Forest Biodiversity Hotspot. Alytes 29:
61-74.
Lynch JD, Ruiz-Carranza PM, Rueda-Almonacid JV. 1983.
Notes on the distribution and reproductive biology
of Centrolene geckoideum Jimenez de la Espada in
Colombia and Ecuador (Amphibia: Centrolenidae).
Studies on Neotropical Fauna and Environment 18:
239-243.
Marquez R, De la Riva I, Bosch J. 1996. Advertisement
calls of three glassfrogs from the Andean forests
(Amphibia: Anura: Centrolenidae). Herpetological
Journal 6: 97-99.
Mendoza AM, Arita HT. 2014. Priority setting by sites
and by species using rarity, richness, and phylogenetic
diversity: the case of neotropical glassfrogs (Anura:
Centrolenidae). Biodiversity and Conservation 23:
909-926.
Mendoza-Henao AM, Basto-Riascos MC, Rada M. 2019.
Centrolene huilensis (Ruiz-Carraza and Lynch, 1995).
Catalogo de Anfibios y Reptiles de Colombia 5: 18—23.
October 2021 | Volume 15 | Number 2 | e286
Mendoza-Henao et al.
Padial JM, De la Riva I. 2009. Integrative taxonomy
reveals cryptic Amazonian species of Pristimantis
(Anura: Strabomantidae). Zoological Journal of the
Linnean Society 155: 97-122.
Peterson CR, Dorcas ME. 1994. Automated data
acquisition. Pp. 47-57 In: Measuring and Monitoring
Biological Diversity. Editors, Heyer RW, Donnelly
MA, McDiarmid RW, Hayek LAC, and Foster SM.
Smithsonian Tropical Institute, Washington, DC, USA.
364 p.
Pounds JA, Bustamante MR, Coloma LA, Consuegra
JA, Fogden MP, Foster PN, La Marca E, Masters KL,
Merino-Viter1 A, Puschendorf R. 2006. Widespread
amphibian extinctions from epidemic disease driven by
global warming. Nature 439: 161-167.
Rios-Soto J, Ospina-L AM, Vargas-Salinas F. 2017.
The advertisement call and notes of the reproductive
ecology of the glassfrog ‘“Centrolene” quindianum
(Anura: Centrolenidae). South American Journal of
Herpetology 12(2): 117-127.
Rivera-Correa M, Ospina-L AM, Rojas-Montoya M,
Venegas-Valencia K, Rueda-Solano LA, Gutiérrez-
Cardenas PDA, Vargas-Salinas F. 2021 Cantos en
ranas y sapos de Colombia: estado del conocimiento
y perspectivas de investigaci6n en ecoacustica.
Neotropical Biodiversity 7. 350-363.
Rodrigues AS, Akcakaya HR, Andelman SJ, Bakarr MI,
Boitani L, Brooks TM, Chanson JS, Fishpool LDC,
Da Fonseca GAB, Gaston KJ, et al. 2004. Global gap
analysis: priority regions for expanding the global
protected-area network. BioScience 54: 1,092—1,100.
Rodriguez A, Dugo-Cota A, Montero-Mendieta S,
Gonzalez-Voyer A, Alonso R, Vences M, Vila C.
2017. Cryptic within cryptic: genetics, morphometrics,
and bioacoustics delimitate a new species of
Eleutherodactylus (Anura: Eleutherodactylidae) from
Eastern Cuba. Zootaxa 4221: 501-522.
Ruiz-Carranza PM, Lynch JD. 1989. Una nueva especie
de Centrolenella Noble, 1920 (Amphibia: Anura:
Centrolenidae) de la Cordillera Oriental de Colombia.
Trianea 3: 67-75.
Ruiz-Carranza PM, Lynch JD. 1991a. Ranas Centrolenidae
de Colombia I. Propuesta de una nueva clasificacion
generica. Lozania 57. 1-30.
Ruiz-Carranza PM, Lynch JD. 1991b. Ranas Centrolenidae
de Colombia II. Nuevas especies de Centrolene de la
Cordillera Oriental y Sierra Nevada de Santa Marta.
Lozania 58: 1—26.
Ruiz-Carranza PM, Lynch JD. 1991c. Ranas Centrolenidae
de Colombia IV. Nuevas especies de Cochranella del
grupo ocellata de la Cordillera Oriental. Lozania 60:
1-13.
Ruiz-Carranza PM, Lynch JD. 1995. Ranas Centrolenidae
de Colombia. V. Cuatro nuevas especies de Cochranella
de la Cordillera Central. Lozania 62: 1—23.
Ruiz-Carranza PM, Lynch JD. 1995b. Ranas Centrolenidae
de Colombia VIII. Cuatro nuevas especies de
Amphib. Reptile Conserv.
Centrolene de la Cordillera Central. Lozania 65: 1-16.
Salgado AL, Guayasamin JM. 2018. Parental care and
reproductive behavior of the Minute Dappled Glassfrog
(Centrolenidae: Centrolene peristictum). South
American Journal of Herpetology 13(3): 211-219.
Sanchez-Giraldo C, Bedoya CL, Moran-Vasquez RA,
Isaza CV, Daza JM. 2020. Ecoacoustics in the rain:
understanding acoustic indices under the most common
geophonic source in tropical rainforests. Remote
Sensing in Ecology and Conservation 6: 248-261.
Scheele BC, Pasmans F, Skerratt LF, Berger L, Martel A,
Beukema W, Acevedo AA, Burrowes PA, Carvalho T,
Catenazzi A, et al. 2019. Amphibian fungal panzootic
causes catastrophic and ongoing loss of biodiversity.
Science 363: 1,459-1,463.
Sefiaris JC, Ayarzagtiena J. 2005. Revision taxondmica
de la familia Centrolenidae (Amphibia; Anura) de
Venezuela. Publicaciones del Comité Espatiol del
Programa Hombre y Biosfera - Red lberoMaB de la
UNESCO 7. 1-337.
Stuart SN, Hoffmann M, Chanson J, Cox N, Berridge R,
Ramani P, Young B. 2008. Threatened Amphibians of
the World. Lynx Editions, Barcelona Spain; IUCN,
Gland, Switzerland; and Conservation International,
Arlington, Virginia, USA. 758 p.
Twomey E, Delia J, Castroviejo-Fisher S. 2014. A review
of northern Peruvian glassfrogs (Centrolenidae),
with the description of four new remarkable species.
Zootaxa 3851: 1-87.
Valencia-Aguilar A, Cortés-Gomez AM, Ruiz-Agudelo
CA. 2013. Ecosystem services provided by amphibians
and reptiles in Neotropical ecosystems. /nternational
Journal of Biodiversity Science, Ecosystem Services,
and Management 93: 257-272.
Vargas-Salinas F, Ospina-L AM, Rios-Soto JA, Rivera-
Correa M. 2017. Centrolene savagei. Catalogue of
American Amphibians and Reptiles 912: 1-12.
Viuche-Lozano A, Enciso-Calle MP, Bernal MH. 2018.
The advertisement call of Centrolene notostictum
(Anura, Centrolenidae) with a new record of geographic
distribution in Tolima, Colombia. Zootaxa 4377: 575—
576.
Wake DB, Vredenburg VT. 2008. Are we in the midst
of the sixth mass extinction? A view from the
world of amphibians. Proceedings of the National
Academy of Sciences of the United States of America
105(Supplement 1): 11,466—-11,473.
Whiles MR, Hall RO Jr, Dodds WK, Verburg P, Huryn
AD, Pringle CM, Lips KR, Kilham SS, Colon-Gaud
C, Rugenski AT, et al. 2013. Disease-driven amphibian
declines alter ecosystem processes in a tropical stream.
Ecosystems 16: 146-157.
Whiles MR, Lips KR, Pringle CM, Kilham SS, Bixby
RJ, Brenes R, Conelly S, Colon-Gaud JC, Hunte-
Brown M, Huryn AD. 2006. The effects of amphibian
population decline on the structure and function of
Neotropical stream ecosystems. Frontiers in Ecology
October 2021 | Volume 15 | Number 2 | e286
Advertisement calls of six glassfrog species
and the Environment 4: 27-34. KR. 2020. Tropical snake diversity collapses after
Zipkin EF, DiRenzo GV, Ray JM, Rossman S, Lips widespread amphibian loss. Science 367: 814-816.
Angela M. Mendoza-Henao is a biologist from Universidad del Valle (Cali, Colombia) with an M.Sc.
and Ph.D. in Biological Sciences from the Universidad Nacional Autonoma de México (UNAM).
Angela’s work has focused mainly in the application of molecular tools and bioacoustics for answering
questions in ecology and conservation, with an emphasis on terrestrial vertebrates, mainly neotropical
amphibians.
Sebastian Duarte-Marin is a biologist from Universidad del Quindio (Armenia, Colombia) and co-
founder of the biodiversity illustration company Entropia. Sebastian’s work has focused mainly on the
study of ecology, taxonomy, and bioacoustics of neotropical amphibians, particularly on frogs with
direct development and glassfrogs.
Marco Rada is a biologist from Pontificia Universidad Javeriana, Bogota (PUJ-Colombia) with a
Ph.D. from the Pontificia Universidade Catolica do Rio Grande do Sul, Porto Alegre (PUCRS-Brazil).
Marcos’s work has focused mainly in the use of interdisciplinary tools for answering questions in
taxonomy and phylogenetic relationships, with an emphasis on neotropical amphibians, including
glassfrogs.
Appendix 1. Status of glassfrog species with respect to whether or not their advertisement call has been described,
conservation status, distributional range, and occurrence in Natural Protected Areas.
; Call Protected
Sefiaris and
Celsiella revocata Vulnerable (VU) Subregional se | Ayarzagtiena 2005
Celsiella vozmedianoi Data Deficient (DD) +} -.--
Centrolene altitudinalis Yes Data Deficient (DD) Local Yes sara and
yarzagtiena 2005
| “Centrolene” azulae azulae Data Deficient | Data Deficient(DD) | Local |
Centrolene ballux Endangered (EN) aL et =— 1996
Centrolene buckleyi ests [| ta Vulnerable (VU) Guayasamin et al. 2006
Centrolene | Centrolene charapita = Critically | Critically Endangered (CR) (CR) Local Pies ef
Almenzariz-C and
Centrolene daidalea Vulnerable a Subregional Cardozo-Urdaneta and
Sefiaris 2012
Centrolene | Centrolene geckoidea Critically | Critically Endangered (CR) (CR) Subregional | Grant et al. 1998
Centrolene heloderma Vulnerable (VU) Subregional Guayasamin et al. 2020
Amphib. Reptile Conserv. 166 October 2021 | Volume 15 | Number 2 | e286
Mendoza-Henao et al.
Appendix 1| (continued). Status of glassfrog species with respect to whether or not their advertisement call has been
described, conservation status, distributional range, and occurrence in Natural Protected Areas.
d Call Protected
ee ace ae
| Centrolene huilensis huilensis | Endangered (EN) (EN) | Local =| No | Thisstudy = This study
[ceseeitritn | ves | tesa coneicy | Siepomat | ver [iany
[cence | ra | rastomnio0) | tae [ve |
[conte onen | vex | ingest en) | Sabo | No [Baer 300,
a
| Centrolene muelleri muelleri Data Deficient | ‘Data Deficient(DD) eee Ness
| Centrolene paezorum paezorum Data Deficient | Data Deficient(DD) | Local
— and
“Centrolene’ | “Centrolene” petrophilum | | Endangered (EN) (EN) | Local
“Centrolene ” | “Centrolene” quindiamm =| Vulnerable | Vulnerable (VU) | Subregional | No Rios-Soto et | Rios-Soto et al. 2017 | 2017
“Centrolene” robledoi Ea Least Concern (LC) ete pep -Marin et al., in
| Centrolene sanchezi sanchezi Data Deficient | Data Deficient(DD) | Local | | yes | Guayasamin et al. 2020 | et al. 2020
in prep.
Sefiaris and
a oe ia aan —— Ayarzagtiena 2005
| Chimerellacorleone corleone Data Deficient | Data Deficient(DD) | Local Twomey et al. 2014
ena | Ne | ei 06) [tn
[comantacrmina | ve [| tem Comem i | Reon
Fetes | we | Goer tt [ow
Yes
Savage and Starrett
Cochranella euknemos yes Least Concern (LC) 1967: Kubicki 2007
“Cochranella” geijskesi | No | Least Concem (LC) Least Concern (LC) Local | Local =| Yes
Cochranella granulosa Yes Least Concern (LC) | Regional | No Seo Poco URUB ICs
Cochranella guayasamini | Yes | Least Concern (LC) Subregional | No | Twomey et al. 2014
Cochranella litoralis | Cochranellalivoralis =| No. Vinerable (VU) Vulnerable (VU) Subregional | Subregional | Yes _|
Cochranella mache yes Endangered (EN) | toca | ves See et al.
“Cochranella” megistra | “Cochranella” megistra | +No. | __Endangered(EN) Endangered (EN) Subregional | Subregional] No | |
Cochranella nola =n Near Threatened (NT) Subregional aed Ba and sonlet
Cochranella resplendens Least Concern (LC) Global "|
Amphib. Reptile Conserv. 167 October 2021 | Volume 15 | Number 2 | e286
Advertisement calls of six glassfrog species
Appendix 1 (continued). Status of glassfrog species with respect to whether or not their advertisement call has been
described, conservation status, distributional range, and occurrence in Natural Protected Areas.
foe awn [oe [Ps [me
“Cochranella” xanthocheridia Vulnerable (VU) Subregional EE
Y
Y
)
te)
Espadarana andina Least Concern (LC) Subregional
Espadarana audax Least Concern (LC)
es
Espadarana callistomma Least Concern (LC)
Espadarana durrellorum Least Concern (LC)
Espadarana prosoblepon Least Concern (LC) Global
Hyalinobatrachium adespinosai Data Deficient (DD)
Hyalinobatrachium anachoretus Endangered (EN)
Hyalinobatrachium aureoguttatum Near Threatened (NT) Subregional
Fyalinobatrachium bergeri Least Concern (LC)
Co
Hyalinobatrachium chirripoi Least Concern (LC) Subregional
Fyalinobatrachium colymbiphyllum Least Concern (LC)
Hyalinobatrachium dianae Data Deficient (DD)
Fyalinobatrachium duranti Data Deficient (DD) Subregional
Hyalinobatrachium esmeralda Endangered (EN)
Hyalinobatrachium fleischmanni Least Concern (LC) Global
Yes
Yes
Yes
Yes
Yes
Sefiaris and
Ayarzagiiena 2005;
Cabanzo-Olarte and
Ortega-Chinchilla 2017
Duarte-Marin et al., in
prep.; Guayasamin et
al. 2020
Guayasamin et al. 2020
Jacobson 1985; Kubicki
2007
Guayasamin et al. 2019
Twomey et al. 2014
Castroviejo-Fisher et
al. 2009
Myers and Donelly
1997, 2001; Sefiaris and
Ayarzagtienza 2005;
Castroviejo-Fisher et
al. 2011; Oliveira et al.
2015
Marquez et al. 1996;
Castroviejo-Fisher et
al. 2009
Kubicki 2007; Kubicki
et al. 2015
Kubicki 2007; Kubicki
et al. 2015
Kubicki et al. 2015
Sefiaris and
Ayarzagtiena 2005
Acosta-Galvis 2017
Jacobson 1985; Kubicki
2007; Castroviejo-
Fisher et al. 2011; Greer
and Wells 1980
Wen et al. 2012
Sefiaris and
Ayarzagtiena 2005
Hyalinobatrachium fragile Yes Vulnerable (VU) Subregional
Hyalinobatrachium guairarepanense Endangered (EN) Local
Hyalinobatrachium iaspidiense po Data Deficient (DD) Subregional
Hyalinobatrachium ibama Vulnerable (VU) Subregional No Oy
Hyalinobatrachium kawense yes Least Concern (LC) Sa isher et
Sefiaris and
; Ayarzagtiena 2001;
Hyalinobatrachium mondolfii Least Concern (LC) Regional Castroviejo-Fisher et
al. 2011
Amphib. Reptile Conserv. 168 October 2021 | Volume 15 | Number 2 | e286
Sefiaris and
Ayarzagtiena 2005;
Castroviejo-Fisher et
Ye
N
N
Yi
Ye
N
Yi
N
Ye
Ye
Ye
Yi
Ye
Yi
Yi
Ye
Yi
al. 2011
Ye
es
(0)
(0)
es
es
0)
es
fe)
No
No
es
es
No
es
No
es
es
No
es
es
es
es
No
es
No
Mendoza-Henao et al.
Appendix 1 (continued). Status of glassfrog species with respect to whether or not their advertisement call has been
described, conservation status, distributional range, and occurrence in Natural Protected Areas.
: Call : Protected
Hyalinobatrachium munozorum Least Concern (LC) Global
Hyalinobatrachium orientale po Vulnerable (VU) Subregional
yes Castroviejo-Fisher et
i
:
3
=<
:
.
Hyalinobatrachium muiraquitan
Guayasamin et al. 2020
Castroviejo-Fisher et
al. 2008; Cardozo-
Urdaneta and Sefiaris
2012
Hyalinobatrachium orocostale
FAyalinobatrachium pallidum
Hyalinobatrachium pellucidum | yes | Near Threatened (NT) Wen et al. 2012
: Kubicki 2007; Kubicki
Yes Least Concern (LC) Subregional et al 2015
FAyalinobatrachium tatayoi Least Concern (LC)
FHyalinobatrachium taylori Least Concern (LC) Global
; Castroviejo-Fisher et
Hyalinobatrachium tricolor Yes Least Concern (LC) Regional al 2011
Hyalinobatrachium valerioi Least Concern (LC) | Regional | No Deer eae Riutoicls
Hyalinobatrachium vireovittatum Data Deficient (DD) ore Pade Babies
Hyalinobatrachium yaku Data Deficient (DD) Guayasamin et al. 2017
Vulnerable (VU) Subregional sae ee et al.
N
Ye
Ye
Ye
Ye
Ye
N
Ye
Hyalinobatrachium talamancae
Castroviejo-Fisher et
al. 2007
Sefiaris and
Ayarzagtiena 2005
Ss
Ss
Ss
Ss
Ss
Ss
Ss
ty)
es
ty)
es
es
es
es
es
es
es
No
Tkakogi tayrona
Nymphargus anomalus
Critically Endangered (CR)
Critically Endangered (CR)
Nymphargus armatus
Vulnerable (VU) Subregional
Yes
N
N
Nymphargus balionotus N
Yes
N
Nymphargus bejaranoi Marquez et al. 1996
Least Concern (LC)
Nymphargus buenaventura
Data Deficient (DD)
F
Nymphargus caritiocommatus
Duarte-Marin et al., in
prep.
Duarte-Marin et al., in
prep.
Nymphargus caucanus
Endangered (EN)
Nymphargus chami
4
Data Deficient (DD) Subregional
Data Deficient (DD)
Fe
Nymphargus chancas
F
Nymphargus cochranae
Oo
0
Oo
0
Oo
Oo
Oo
Oo
oO
Oo
Nymphargus colomai
Vulnerable (VU)
0 Data Deficient (DD)
0 Vulnerable (VU) Subregional
Nymphargus grandisonae Yes Least Concern (LC) Subregional
Nymphargus griffithsi Yes Least Concern (LC)
No Data Deficient (DD) Subregional
No Least Concern (LC) Subregional SNe ial aa Sealase
Amphib. Reptile Conserv. 169 October 2021 | Volume 15 | Number 2 | e286
Nymphargus cristinae
Gonzalez-Acosta et al.,
Nymphargus garciae in prep.
Hutter et al. 2013
Hutter and Guayasamin
2012: Arcila-Perez et
al. 2017
Vulnerable (VU) Subregional | ves |
Nymphargus humboldti
es
es
Jo
No
No
lo
es
es
No
es
es
No
No
es
(0)
No
es
No
Nymphargus ignotus
Advertisement calls of six glassfrog species
Appendix 1 (continued). Status of glassfrog species with respect to whether or not their advertisement call has been
described, conservation status, distributional range, and occurrence in Natural Protected Areas.
areas
Hutter and Guayasamin
N
Call
Species described
IUCN category
S
Nymphargus lasgralarias Endangered (EN)
Nymphargus laurae Critically Endangered (CR)
Nymphargus lindae Endangered (EN) Local
Nymphargus luminosus Endangered (EN) Local
io) io) ° °
Nymphargus luteopunctatus Endangered (EN) Local
Nymphargus manduriacu Critically Endangered (CR) Local
Guayasamin et al. 2019
Guayasamin et al. 2020
Nymphargus mariae Least Concern (LC) Regional
Nymphargus megacheirus Endangered (EN) Local
Nymphargus mixomaculatus Critically Endangered (CR) Local
Nymphargus nephelophila Data Deficient (DD) Local
Nymphargus ocellatus Data Deficient (DD)
g
Nymphargus oreonympha Data Deficient (DD)
Nymphargus phenax Endangered (EN) Local
Catenazzi et al. 2009
Duarte-Marin et al., in
prep.
Guayasamin et al. 2020
No Near Threatened (NT)
prep.
[impirgene | vo | _caiyeromgeico) | tor [ve |
imple eneraaa [vo [Dundee o>) | toes [ve |
smphre wir [v0 [| baneteito0) | too [ve [|
[rtranaatces | v0 | wrwanecvuy | Sivegoon | vo [|
[mtronamcaarmar | x0 | duartcon 00) | Some | no [|
Kubicki 2007;
Guayasamin et al. 2020
Sachatamia orejuela Least Concern (LC) Subregional ee isin Si arcs
Sachatamia punctulata Vulnerable (VU) Subregional This study
Teratohyla adenocheira Data Deficient (DD) Yes rs
Teratohyla amelie Data Deficient (DD) No Guayasamin et al. 2020
Amphib. Reptile Conserv. 170 October 2021 | Volume 15 | Number 2 | e286
Nymphargus pluvialis Data Deficient (DD) Local
Nymphargus posadae Least Concern (LC) Regional
Nymphargus prasinus Vulnerable (VU
Subregional
Nymphargus rosada Vulnerable (VU
Subregional
Nymphargus ruizi Vulnerable (VU
Subregional
a
Zl 2 peas | Se ZAliZzlazail2aiK
ololololsgtio ololtlo|fljo]g
Yi
N
N
N
Yi
es
2
a
N
N
N
N
N
Ye
Nymphargus siren Vulnerable (VU Subregional Y
Nymphargus spilotus Local Yi
Local | No | This study
es
fe)
Jo
Te)
Jo
es
No
es
es
fe)
Local No
Te)
Jo
Jo
Jo
No
JO
es
es
es
No
Mendoza-Henao et al.
Appendix | (continued). Status of glassfrog species with respect to whether or not their advertisement call has been
described, conservation status, distributional range, and occurrence in Natural Protected Areas.
: Call : Protected
. Aratyjo et al. 2018;
Teratohyla midas Least Concern (LC) Global Guayasamin et al, 2020
Ibafiez et al 1999;
Teratohyla pulverata Least Concern (LC) Savage 2002
Ibafiez et al 1999;
Teratohyla spinosa Least Concern (LC) Regional No Savage 2002; Kubicki
2007
Sefiaris and
Vitreorana castroviejoi Data Deficient (DD) Local Yes pyateaeuena: 2000,
Castroviejo-Fisher et
al. 2009
Heyer et al. 1990;
Vitreorana eurygnatha eee le | ee Least Concern (LC) Global ee) Se Santana et al. 2015
Vitreorana | Vitreorana franciscana Not | Notevaluated = | Local | yes —_| Santana et | Santana et al. 2015 | 2015
Sefiaris and
Ayarzagtiena 2005;
Vitreorana gorzulae Data Deficient (DD) Lo Castroviejo-Fisher et
al. 2009
Sefiaris and
Vitreorana helenae Data Deficient (DD) Local Yes Ayarzagtiena 2005;
Castroviejo-Fisher et
al. 2009
Sefiaris and
Vitreorana ritae Data Deficient (DD) Subregional Yes Ayarzagtiena 2005;
Cisneros-Heredia 2013
Appendix 2. List of highly threatened (IUCN classifications Endangered (EN) or Critically Endangered (CR)) and
understudied (IUCN categories Data Deficient (DD) or Not evaluated) glassfrog species with undescribed calls and a
range that either includes less than five known locations in less than 1,500 km? or does not overlap with any protected
areas. Asterisks indicate species for which the calls are currently being described.
Highly threatened species (EN or CR) Understudied species (DD or Not evaluated)
Centrolene charapita “Centrolene ” acanthidiocephalum*
“Centrolene” petrophilum “Centrolene” azulae
Centrolene paezorum
“Cochranella” ramirezi
Hyalinobatrachium muiraquitan
Amphib. Reptile Conserv. 171 October 2021 | Volume 15 | Number 2 | e286
Official journal website:
amphibian-reptile-conservation.org
Amphibian & Reptile Conservation
15(2) [Taxonomy Section]: 172-197 (e287).
Sy
aces -er
ptile-cons*
urn:lsid:zoobank.org:pub:1183F 148-3632-42D5-BA91-0CC88A7DAA58
A new species of Liolaemus (Squamata: Liolaemidae)
from the Reserva Paisajistica Subcuenca del Cotahuasi,
southwestern Peru
‘Misshell D. Ubalde-Mamani, ?*Roberto C. Gutiérrez, ***Juan C. Chaparro,
&7Alvaro J. Aguilar-Kirigin, 2José Cerdefa, Wilson Huanca-Mamani,
8Stefanny Cardenas-Ninasivincha, ‘Ana Lazo-Rivera, and °Cristian S. Abdala
‘Universidad Nacional de San Agustin de Arequipa, Escuela Profesional de Biologia, Avenida Alcides Carrion s/n, Arequipa, PERU *Museo de
Historia Natural de la Universidad Nacional de San Agustin de Arequipa, Av. Alcides Carrion s/n, Arequipa, PERU 3Servicio Nacional de Areas
Naturales Protegidas por el Estado-SERNANP, Calle Diecisiete 355, San Isidro, Lima, PERU *Museo de Biodiversidad del Peru, Urbanizacion
Mariscal Gamarra A-61, Zona 2, Cusco, PERU *Museo de Historia Natural de la Universidad Nacional de San Antonio Abad del Cusco, Paraninfo
Universitario (Plaza de Armas s/n), Cusco, PERU °Red de Investigadores en Herpetologia, La Paz, Estado Plurinacional de BOLIVIA ‘Area de
Herpetologia, Coleccion Boliviana de Fauna, Campus Universitario de Cota Cota, Facultad de Ciencias Puras y Naturales, Universidad Mayor de
San Andrés, La Paz, Estado Plurinacional de BOLIVIA *Departamento de Produccion Agricola, Facultad de Ciencias Agronomicas, Universidad
de Tarapaca, Arica, CHILE °Consejo Nacional de Investigaciones Cientificas y Técnicas (CONICET), Unidad Ejecutora Lillo (UEL), Facultad de
Cs. Naturales e IML. Universidad Nacional de Tucumadn, ARGENTINA
Abstract.—The diversity of reptiles in the Andes of southwestern Peru is poorly documented. Despite the fact
that studies on saurians have intensified in recent years, mainly in the genus Liolaemus, information gaps
on the biodiversity of this area remain. Such is the case of the Reserva Paisajistica Subcuenca del Cotahuasi
(RPSCC), Department of Arequipa, where populations of an undescribed species of the genus Liolaemus have
been discovered recently. These individuals have morphological and molecular characteristics that are not
assignable to any of the known species. Here, we describe this new species of Liolaemus, which inhabits
the dry Puna of the RPSCC above 4,500 m asl. The combination of morphological and molecular characters
differentiates this new species from its closest congeners. Phylogenetic analyses indicate that the new species
is part of the L. montanus group and is grouped in a clade alongside L. qalaywa, recently described from a site
133 km northwest of the type locality of this new species.
Keywords. Andes, Arequipa, dry Puna, protected area, Reptilia, systematics, taxonomy
Resumen.—La diversidad de reptiles en los Andes del suroeste de Peru esta poco documentada, a pesar que
en los ultimos anos se han intensificado los estudios en saurios, principalmente con el género Liolaemus,
aun existen vacios de informacion sobre la biodiversidad en esta area. Es el caso de la Reserva Paisajistica
Sub Cuenca del Cotahuasi (RPSCC), en el departamento de Arequipa, donde poblaciones de una especie
no descrita del género Liolaemus, con caracteristicas morfologicas y moleculares que no son asignables
a ninguna de las especies conocidas. A continuacion, describimos esta nueva especie de Liolaemus, que
habita la Puna seca del RPSCC, por encima de los 4.500 m snm. La combinacion de caracteres morfologicos
y moleculares lo diferencia de sus congéneres mas cercanos. Ademas, los analisis filogenéticos indican que
la nueva especie es parte del grupo L. montanus y esta agrupada en un clado junto a L. galaywa, una especie
recientemente descrita, ubicada a 133 km al noroeste de la localidad tipo de la nueva especie.
Palabras clave. Andes, Arequipa, Area protegida, Puna seca, reptiles, sistematica, taxonomia
Citation: Ubalde-Mamani MD, Gutiérrez RC, Chaparro JC, Aguilar-Kirigin AJ, Cerdefa C, Huanca-Mamani W, Cardenas-Ninasivincha C, Lazo-
Rivera A, and Abdala CS. 2021. A new species of Liolaemus (Squamata: Liolaemidae) from the Reserva Paisajistica Subcuenca del Cotahuasi,
southwestern Peru. Amphibian & Reptile Conservation 15(2) [Taxonomy Section]: 172-197 (e287).
Copyright: © 2021 Ubalde-Mamani et al. This is an open access article distributed under the terms of the Creative Commons Attribution License
[Attribution 4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction
in any medium, provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced,
are as follows: official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 8 August 2021; Published: 23 September 2021
Correspondence. *[email protected], [email protected]
Amphib. Reptile Conserv. 172 September 2021 | Volume 15 | Number 2 | e287
Ubalde-Mamani et al.
Introduction
The genus Liolaemus Wiegmann, 1834, includes 283
valid species (Abdala et al. 2021) and represents about
85% of the diversity of the Liolaemidae family, which also
harbors two other genera: Ctenoblepharys, with a single
species (C. adspersa), and Phymaturus represented by 47
species (Abdala and Quinteros 2014; Lobo and Nenda
2015; Gonzalez-Marin et al. 2016; Scolaro et al. 2016;
Hibbard et al. 2019). The genus Liolaemus is distributed
in South America, from central Peru to Patagonia in
Argentina and Chile, inhabits various regions of Bolivia,
Brazil, Uruguay, and Paraguay (Abdala and Quinteros
2014), and spans an altitudinal range from sea level to
the peaks of the Andes (Aparicio and Ocampo 2010;
Cerdefia et al. 2021). It has a very effective adaptive
radiation and occupies a great variety of ecosystems,
including environments with hostile climates, such as
the High Andes (Chaparro et al. 2020) and hyper-arid
deserts (Huamani-Valderrama et al. 2020). Liolaemus
species have a physiological condition that makes them
dependent on the environment to obtain heat, being
heliothermic (direct radiation) or thigmothermic (by
contact with the substrate) (Martori et al. 2002; Astudillo
et al. 2019). They also present different types of diets,
ranging from strict herbivores (Valdecantos et al. 2012)
to facultative omnivores (Pincheira-Donoso et al. 2008:
Semhan etal. 2013; Olivera and Aguilar 2020), in addition
to different reproductive types, including triploidy in
females of L. parthenos (Abdala et al. 2016). In Peru,
the genus Liolaemus is represented by 28 described
species (Chaparro et al. 2020; Huamani-Valderrama et
al. 2020; Arapa-Aquino et al. 2021; Quiroz et al. 2021).
In the last three years, the interest in this taxonomic
group has resulted in the descriptions of nine new
species in different regions (Gutiérrez et al. 2018;
Aguilar-Puntriano et al. 2019; Villegas-Paredes et
al. 2020; Chaparro et al. 2020; Huamani- Valderrama
et al. 2020; Arapa-Aquino et al. 2021; Quiroz et al.
2021), however, there are still several undescribed
populations that would form independent lineages
(Aguilar-Puntriano et al. 2018; Abdala et al. 2020;
Quiroz et al. 2021).
Specifically in the Deparment of Arequipa, nine species
of Liolaemus are registered (L. annectens, L. anqapuka
L. balagueri, L. etheridgei, L. insolitus, L. nazca, L.
signifer, L. tacnae, and L. yarabamba) (Zeballos et al.
2002; Gutiérrez et al. 2010; Aguilar et al. 2013; Villegas-
Paredes et al. 2020; Huamani-Valderrama et al. 2020;
Ormefio et al. 2021; Quiroz et al. 2021), but there are still
several additional species yet to be described (Abdala et
al. 2020; Huamani- Valderrama et al. 2020). An important
protected area in the northeastern part of the Department,
the Reserva Paisajistica Sub Cuenca del Cotahuasi
(RPSCC), is the largest in the western Peruvian Andes
(SERNANP 2019a). The RPSCC presents a remarkable
altitudinal gradient from 950 m asl in the Chaucalla
Amphib. Reptile Conserv.
sector up to 6,000 m asl on the summit of the mountain
Solimana, and twelve different ecosystems present in this
reserve have unique combinations of physical, climatic,
and biological characteristics that generate a unique
and globally important biological diversity (SERNANP
2019b). However, the diversity of Liolaemus reported
in the RPSCC is very low, as among the nine species
registered in Arequipa, L. annectens is the only species
reported in this area (AEDES 2008).
During recent reptile surveys conducted in the Andean
ecosystems of RPSCC, specimens of Liolaemus with
distinctive morphological characteristics were collected,
and considered a population of unknown taxonomic
status. The morphological and molecular analyses carried
out in this work allowed us to determine the independence
of this population within the genus Liolaemus. This
assessment used the general or unified concept of species
proposed by De Queiroz (1998, 2007), which defines
species as entities that represent independent historical
lineages or divergent lineages of metapopulations. The
independence of these lineages was assessed based on
a morphological and molecular phylogeny, multivariate
statistical analyses, and the description of unique
morphological characters, providing decisive evidence
to describe this population as a new species of the L.
montanus group.
Materials and Methods
Fieldwork procedures. Field surveys were conducted
in the RPSCC, at five localities in the Province of
La Union, Department of Arequipa, Peru, between
4,500—4,529 m asl. All specimens were collected by
hand and euthanized with a lethal dose of 1% Halatal.
Tissue samples were extracted from thighs and stored
in microtubes containing 96% ethanol. Specimens
were fixed in 10% formalin, stored in 70% ethanol,
and deposited in the Museo de Historia Natural de la
Universidad Nacional de San Agustin, Arequipa, Peru
(MUSA), and the Museo de Biodiversidad del Peru,
Cusco, Peru (MUBI). This study was carried out under
permission issued by Resoluci6on Jefatural N°012-2019-
SERNANP-RPSCC-J of Servicio Nacional de Areas
Naturales Protegidas por el Estado (SERNANP), of the
Ministerio de Agricultura, Peru.
Material examined. Specimens of the ZL. montanus
group were examined from four collections: Museo de
Historia Natural, Universidad Nacional de San Agustin
de Arequipa, Pert (MUSA); Museo de Biodiversidad
del Peru, Cusco, Pert (MUBI); Museo de Historia
Natural, Universidad Nacional Mayor de San Marcos
de Lima, Peru (MUSM); and Fundacion Miguel Lillo
(FML), Tucuman, Argentina. The specimens analyzed
for the first time, as well as those previously examined
by Abdala and Quinteros (2008), Abdala et al. (2008,
2009, 2013, 2020), Quinteros et al. (2008), Quinteros
September 2021 | Volume 15 | Number 2 | e287
New Liolaemus species from Peru
and Abdala (2011), Gutiérrez et al. (2018), Abdala et al.
(2020), Chaparro et al. (2020), and Huamani- Valderrama
et al (2020), are detailed in Appendix I.
Morphology. Morphological characters related to
lepidosis, morphometry, and color pattern, follow Laurent
(1985), Etheridge (1995, 2000), Abdala (2007), Abdala
et al. (2020), Abdala and Juarez-Heredia (2013), and
Gutiérrez et al. (2018). The description of the coloration
in life is based on our field notes and photographs of
the live specimens. Observations of lepidosis and body
measurements were taken using a binocular stereoscope
(10—-40x) and a precision caliper to 0.01 mm. All bilateral
characters were measured on the right side (Losos 1990;
Abdala et al. 2019). The measured morphometric traits
were: snout-vent length (SVL); length of the interparietal
(LEI); head width (AC); head height (HC); auditory
meatus height (hTy); auditory meatus width (aTy);
length of the head (LC); neck width (ACC); length of
the hand (LH); arm width (AHU); length of the radius
(LAR); length of the arm (LB); length of the thigh (M);
length of the tibia (T); length of the fourth toe of the
hind limb (4P); length of the foot without claw (L4P);
length of the trunk (TL); body width (AL); and width
of the base of the tail (WTB). The meristic characters
counted were: number of scales around the interparietal
scale (All); number of supralabials on the right side
(A12); number of infralabials on the right side (A13);
number of infralabials on the left side (A19); number of
lorilabials (A20); number of scales around the mental
scale (A14); Hellmich index (A18); subdigital lamellae
of the fourth finger of the forelimb (A20—-4); subdigital
lamellae of the fourth toe of the hind limb (A21-4);
number of dorsal scales between the occiput and the level
of the anterior edge of the thigh (A22); number of ventral
scales in contact with the second infralabial scales (A24);
number of scales in contact with the mental scale (A25),;
number of scales around the nasal scale (M3); number
of supraocular enlarged scales on the right side (M5);
number of scales that form the frontal (M6); number of
scales between the rostral and frontal (M11); number of
organs in the postrostral scales considering that the scale
organs are present on head scales of Liolaemus species,
and appear to be randomly distributed to each individual
examined (M16); number of gular scales (M23); number
of scales around midbody (M26); number of ventral
scales (M32); number of auricular scales, projecting
scales on anterior edge of auditory meatus (M34);
number of superciliaries (M37); number of temporals
(M38); and number of pygals (M40). Morphometric and
meristic characters are detailed in Appendix II.
Statistical analysis. The homoscedasticity was
evaluated with Levene’s test, and Normal distributions
of the morphometric data were examined using the
Kolmogorov-Smirnov test (P < 0.05). To reduce the
effect of non-normal distributions of the morphological
Amphib. Reptile Conserv.
data, all continuous variables were log,, transformed
and meristic variables were square-root transformed
(Urschick and Losos 1996; Sokal and Rohlf 1998;
Peres-Neto and Jackson 2001; Abdala et al. 2019).
All operational taxonomic units were analyzed by two
distinct treatments. Five populations of Liolaemus
(L. “Cotahuasi,” LZ. “Inmaculada,” L. melanogaster,
L. qalaywa, and L. williamsi) and the new species
(Liolaemus sp. nov.), were used as comparative groups
for building the PCA and DFA because they are both
phylogenetically and geographically close to Liolaemus
sp. nov. A principal component analysis (PCA) was
employed to analyze the morphological variation,
and discriminant function analysis (DFA) was used to
verify morphological variation between and within each
Liolaemus species employing a jackknife classification
matrix (Manly 2000; McCune and Grace 2002; Quinn
and Keough 2002; Zar 2010).
The PCA analysis was performed to assess the
distribution of the individual characters corresponding
to the six species (L. “Cotahuasi,” L. “Inmaculada,” L.
melanogaster, L. galaywa, L. williamsi, and Liolaemus
sp. nov.) in the multivariate space. The PCA was
based on the correlation matrices of the morphological
variables to reduce the dimensionality of the data (Lovett
et al. 2000; Quinn and Keough 2002). The PCA and DFA
were analyzed separately for continuous and meristic
characters, according to Abdalaetal. (2019), in order to not
joint both matrices in the multivariate analyses, although
there 1s no mathematical consensus on this approach
(McGarigal et al. 2000). The relationships of the new
Species and its congeners were examined by DFA means
analysis of the morphological characters. Liolaemus
groups were previously defined in the PCA analysis. This
mathematical model allows an assessment of whether the
groups discriminated by the DFA correspond to those
established by the PCA. The DFA produces a linear
combination of variables that maximizes the probability
of correctly assigning observations to predetermined
groups; and, simultaneously, new observations can be
classified into one of the groups, providing likelihood
values of such a classification (McGarigal et al. 2000;
van den Brink et al. 2003). All statistical analyses were
performed using the Statistica software, version 7.0
(http://www.statsoft.com).
DNA extraction, amplification, and sequencing. Total
genomic DNA was extracted from samples of muscle
using the GenElute mammalian genomic DNA miniprep
kit (Sigma-Aldrich) according to the manufacturer’s
instructions. Fragments of the approximately 1,174
and 850 base pairs of the mitochondrial cytochrome b
(cyt-b) and 12S rRNA genes were amplified through
Polymerase Chain Reaction (PCR) using primers
IguaCytob_F2 (5'-CCACCGTTGTTATTCAACTAC-3’)
and IguaCytob R2 (5'-GGTTTACAAGACCA-
ATGCTTT-3') (Corl et al. 2010); and tPhe
September 2021 | Volume 15 | Number 2 | e287
Ubalde-Mamani et al.
(5'-AAAGCACRGCACTGAAGATGC-3') and 12e
(5'-GTRCGCTTACCWTGTTACGACT-3') (Wiens et al.
1999), respectively. Each reaction contained 1x PCR
buffer (KCI), 2.5 mM MgCl, 0.25 mM each dNTP, 0.1
uM each primer, 1 unit of Taq DNA polymerase, and 1
uL DNA extract. PCR cycling consisted of 5 min initial
denaturation at 94 °C then 35 cycles of: 30 sec at 94
°C; 30 sec at 55 °C; and 60 sec at 72 °C; followed by a
final elongation step of 2 min at 72 °C. The PCR product
was visualized on 1.5% agarose gels stained with Gel-
Red (Biotium Inc.) and subsequently sent to Macrogen
(South Korea) for purification and direct sequencing.
The nucleotide sequence was visualized and edited using
the 4 Peaks software (http://nucleobytes.com/4peaks/). It
was checked manually, and nucleotides with ambiguous
positions were clarified. The sequences newly obtained
in this study are publicly available in GenBank (see
Appendix ITI).
Phylogenetic analysis. Two matrices were
constructed to include: (1) morphological data; (2)
molecular characters (cyt-b and 12S); morphological
phylogenetic analysis were performed using the
matrix of Abdala et al. (2020). The morphological
matrix includes 306 characters and 105 terminals
(with Ctenoblepharys adspersa as an “outgroup”
and 103 terminals of the ZL. montanus group).
Parsimony was used as the optimality criterion, only
selecting the shortest trees or those with the fewest
homoplasies. TNT version 1.5 (Tree Analysis Using
New Technology; Goloboff et al. 2003) was employed
to generate the phylogenetic hypotheses. Continuous
characters were analyzed following Goloboff et al.
(2006) and standardized using the function mkstandb.
run. For this analysis, the value of two was considered
as the highest transformation cost. Heuristic searching
was used to find the shortest trees or those with the
smallest number of steps. The matrix was analyzed
using the “implied weights” method (Goloboff 1993).
The values of the constants K were between three and
20, and the values K = 14 (morphological analysis)
were used as in the analysis of Abdala et al. (2020).
One thousand replications were performed for each
search. Symmetric resampling was used to obtain
support values for the results obtained, with 500
replications with a deletion probability of 0.33. For
the construction of the molecular phylogenetic tree,
the cyt-b and 12S sequences were concatenated and
compared with Liolaemus montanus group sequences
obtained from GenBank (Appendix IT). A maximum
likelihood phylogenetic analysis was carried out with
MEGA X (Kumar et al. 2018). Heuristic tree searches
were performed with the HK Y + G substitution model
(determined with the Akaike information criterion),
and 1,000 bootstrap replications.
Amphib. Reptile Conserv.
Results and Discussion
Studies were performed on a new lineage of lizards of the
genus Liolaemus, which was validated using integrative
taxonomy (with morphological and molecular evidence).
The results of the phylogenetic and statistical analyses
performed suggested that the new population can
be considered as distinctive from all other described
species of the Liolaemus genus. In accordance with best
practices in zoological nomenclature, the results of the
morphological revision and phylogenetic analyses are
provided following the formal presentation of the new
proposed species.
Taxonomy
Liolaemus warjantay sp. nov. (Fig. 1)
2008 Liolaemus signifer annectens, AEDES Guia de
Anfibios y Reptiles. Reserva Paisajistica Subcuenca del
Cotahuasi
2020 Liolaemus aff. galaywa, Huamani-Valderrama et al.
Amphibian & Reptile Conservation
2021 Liolaemus aff. galaywa, Quiroz et al. Zoological
Studies
urn: Isid:zoobank.org:act:33CAECD9-B6E0-49B7-8F39-18A EEEB547AB
Holotype. MUSA 5700, an adult male (Figs. 1,
2C-E, and 4A, D, G, J, M, P), from 6.4 km NE of
Pampamarca, District of Pampamarca, Province of La
Union, Department of Arequipa, Peru (15°5’41.24’S
72°57°'7.06’W) at 4,529 m asl, collected on 20 December
2019, by M. Ubalde and L. Arapa.
Paratypes. Thirteen specimens. All specimens belong
to District of Pampamarca, Province of La Union,
Department of Arequipa, Peru. Six adult males:
MUSA 5691-92 from 4.1 km NE of Pampamarca,
(15°9°37.79”S, 72°55’30.10’W) at 4,500 m asl, collected
on 6 August 2019, by M. Ubalde, J. Bedregal, J. Zegarra,
L. Caceres, and E. Guillén. MUSA 5695 from 0.06 km S
of holotype (15°5’54.30”S, 72°57’°5.49”"W) at 4,510 m
asl, collected on 19 December 2019, by M. Ubalde and
L. Arapa. MUSA 5701-02 and MUBI 17684, same data
as holotype. Five adult females: MUSA 5693-94 from
0.2 km S of holotype (15°5’47.80”S, 72°57’5.19”°W) at
4.510 masl, collected on 6 August 2019, by M. Ubalde, J.
Bedregal, J. Zegarra, L. Caceres, and E. Guillén. MUBI
17683, an adult female, from 6.3 km NE of Pampamarca,
(15°5’°44.14’S, 72°57°6.93”W) at 4,503 m asl, collected
on 6 August 2019, by M. Ubalde, J. Bedregal, J.
Zegarra, L. Caceres, and E. Guillén. MUSA 5696 and
5699 from 6.2 km NE of Pampamarca (15°5’42.68”S,
72°57 8.28’ W) at 4,504 m asl, collected on 19 December
2019, by M. Ubalde and L. Arapa. One subadult female:
September 2021 | Volume 15 | Number 2 | e287
New Liolaemus species from Peru
Fig. 1. Holotype of Liolaemus warjantay sp. nov. MUSA 5700
(SVL = 89.56 mm, Tail = 122.3 mm): (A) dorsal and (B) ventral
views of body; (C) dorsal, (D) ventral, and (E) lateral views of
head; (F) ventral view of precloacal pores; (G) ventral body
scales; (H) keeled dorsal body scales. Scale = 5 mm.
MUSA 5698 from 0.4 km S of holotype (15°5’55.81”S,
72°57'6.35°W) at 4,501 m asl, collected on 19 December
2019, by M. Ubalde and L. Arapa.
Diagnosis. We assign Liolaemus warjantay sp. nov. to the
L. montanus group because it presents a blade-like process
on the tibia, associated with the hypertrophy of the tibial
muscle tibialis anterior (Etheridge 1995; Abdala et al.
2020) and based on molecular (Fig. 6) and morphological
evidence (Fig. 5). The species of the L. montanus group
differ from those of the L. boulengeri group by the
complete absence of patches of enlarged scales in the
posterior part of the thigh (Abdala 2007). Compared
to the species of the L. montanus group, Liolaemus
warjantay sp. nov. is a robust lizard differing by its larger
size (max SVL = 89.56 mm) from Liolaemus andinus, L.
anqapuka, L. audituvelatus, L. balagueri, L. cazianiae,
L. chiribaya, L. duellmani, L. eleodori, L. erroneus,
L. etheridgei, L. evaristoi, L. fabiani, L. famatinae, L.
fittkaui, L. foxi, L. gracielae, L. griseus, L. hajeki, L.
Amphib. Reptile Conserv.
176
halonastes, L. huacahuasicus, L. insolitus, L. montanus,
L. multicolor, L. nazca, L. omorfi, L. orko, L. ortizi, L.
pantherinus, L. poconchilensis, L. poecilochromus,
L. porosus, L. pulcherrimus, L. reichei, L. robertoi,
L. rosenmanni, L. ruibali, L. schmidti, L. stolzmanni,
L. tajzara, L. thomasi, L. torresi, L. vallecurensis, L.
williamsi, and L. yarabamba (all with SVL between
50-80 mm). The presence of imbricate dorsal scales with
keels differentiates L. warjantay sp. nov. from species
with smooth juxtaposed or sub-imbricate scales, such
as Liolaemus andinus, L. audituvelatus, L. balagueri, L.
cazianiae, L. chiribaya, L. eleodori, L. fabiani, L. foxi,
L. gracielae, L. halonastes, L. insolitus, L. jamesi, L.
nigriceps, L. omorfi, L. patriciaiturrae, L. pleopholis, L.
poconchilensis, L. poecilochromus, L. porosus, L. reichei,
L. robertoi, L. robustus, L. rosenmanni, L. ruibali, L.
schmidti, L. scrocchii, L. torresi, L. vallecurensis, L.
victormoralesii, and L. vulcanus.
The new species differs from Liolaemus chiribaya,
L. evaristoi, L. etheridgei, L. insolitus, L. multicolor, L.
omorfi, L. poconchilensis, L. pulcherrimus, L. robertoi,
L. ruibali, and L. schmidti, by the absence of sky blue or
light blue scales on the sides and dorsum of the body and
tail. The number of scales around midbody in L. warjantay
sp. nov. varies between 55-64 (mean = 60.3), which
differentiates it from several species of the group with
more than 65 scales, such as L. andinus, L. audituvelatus,
L. cazianiae, L. duellmani, L. eleodori, L. erroneus, L.
forsteri, L. foxi, L. gracielae, L. halonastes, L. inti, L.
multicolor, L. nigriceps, L. patriciaiturrae, L. pleopholis, L.
poecilochromus, L. porosus, L. pulcherrimus, L. robertoi,
L. rosenmanni, L. ruibali, L. schmidti, L. multiformis, and
L. vallecurensis. The number of ventral scales between the
mental scale and the border of the vent in L. warjantay sp.
nov. varies between 72—85 (mean = 78.2), and is lower
than the number in the following species (with more than
90 ventral scales): L. andinus, L. cazianiae, L. erroneus, L.
foxi, L. gracielae, L. halonastes, L. inti, L. multicolor, L.
nigriceps, L. pachecoi, L. patriciaiturrae, L. pleopholis, L.
poecilochromus, L. porosus, L. robertoi, L. rosenmanni, L.
torresi, and L. vallecurensis; and higher than the number in
the following species (with less than 70 ventral scales): L.
dorbignyi, L. fittkaui, L. melanogaster, L. polystictus, and
L. thomasi. The number of dorsal scales of L. warjantay
sp. nov. varies between 45-63 (mean = 52.8), while
the species with more than 70 scales are L. andinus, L.
audituvelatus, L. cazianiae, L. duellmani, L. eleodori, L.
erroneous, L. fabiani, L. famatinae, L. forsteri, L. foxi, L.
gracielae, L. halonastes, L. multicolor, L. nigriceps, L.
orko, L. patriciaiturrae, L. pleophlolis, L. poecilochromus,
L. porosus, L. pulcherrimus, L. robertoi, L. rosenmanni, L.
ruibali, L. schmidti, L. torresi, and L. vallecurensis; and
the species with less than 45 dorsal scales are L. jamesi
and L. pachecoi.
Only one female was found with two vestigial
precloacal pores, that differentiates Liolaemus warjantay
sp. nov. from species that do have pores in all females
September 2021 | Volume 15 | Number 2 | e287
Ubalde-Mamani et al.
and in greater quantity as in L. aymararum, L. cazianiae,
L. chiribaya, L. chlorostictus, L. dorbignyi, L. eleodori,
L. erroneus, L. etheridgei, L. fabiani, L. famatinae, L.
griseus, L. hajeki, L. huayra, L. huacahuasicus, L. inti,
L. jamesi, L. montanus, L. nazca, L. nigriceps, L. orko, L.
pachecoi, L. pantherinus, L. patriciaiturrae, L. porosus,
L. pulcherrimus, L. galaywa, L. scrocchii, L. multiformis,
and L. vulcanus.
The color pattern clearly differentiates the new species
from Liolaemus yauri, mainly the dorsal color of the head
in both sexes of L. warjantay sp. nov. is dark grey and
always darker than body, while in Z. yauri the coloration
is lighter and not in contrast with the body color; the
color of the palpebral scales in females of L. warjantay
sp. nov. is pale yellow, and in ZL. yauri is chestnut or grey;
the shapes of the paravertebral spots in both sexes of L.
warjantay sp. nov. are in the form of thin transversal
lines and curved posteriorly (ocelli-shaped), while in L.
yauri they are circular rhomboid or sub-quadrangular.
Liolaemus warjantay sp. nov. can be distinguished
from L. annectens and L. gqalaywa (two geographically
close species) by a combination of the following
characters: trifid scales from the plantar surface, absence
of pores in the base of the tail, presence of gular fold,
and the presence of ocelli in males (Table 2, Fig. 4). The
analysis of DNA sequences of L. warjantay sp. nov.
reveals differences of 2.4-5.1% with L. galaywa, and
9.2-9 5% with L. annectens.
Description of the holotype (Fig. 1). Adult male
(MUSA 5700), SVL 89.56 mm. Head greater in length
(22.45 mm) than width (17.02 mm). Head _ height
12.51 mm. Neck width 21.43 mm. Eye diameter 3.83
mm. Interorbital distance 13.33 mm. Auditory meatus
elliptical 5.97 mm high, 1.98 mm wide. Internasal width
3.52 mm. Subocular scale length 6.18 mm. Trunk length
34.53 mm, width 28.64 mm. Tail length 122.3 mm. Tail
width 15.08 mm (cloaca level). Femur length 20.53 mm,
tibia 18.61 mm, and foot 26.01 mm. Humerus length
12.03 mm, width 8.43 mm. Forearm length 8.43 mm,
width 17.54 mm. Hand length 15.84 mm. Fourth finger
length of the foot 15.52 mm. Pygal region length 8.89
mm, and cloacal region width 12.31 mm. Nasal separated
from rostral by one scale. Two internasals slightly longer
than wide. Nasal surrounded by seven scales, separated
from canthal by one scale. Six scales between frontal and
rostral. Frontals divided into four scales. Interparietal
surrounded by eight scales. Preocular separated from
lorilabials by one scale. Five superciliaries and 15 upper
ciliary scales, lower ciliaries are neither projected nor
open between them. Three differential scales at anterior
margin of auditory meatus and a large diagonal auricular
scale. Nine temporary granular scales. Five lorilabial
scales, in contact with subocular. Eight supralabials, which
are not in contact with subocular. Five supraocular. Ten
lorilabials, five scales are in contact with the subocular
scale and separated by a scale from the preocular. Six
Amphib. Reptile Conserv.
infralabials. Four scales around the mental scale. Four
scales in contact with the second infralabial scale, and six
scales separate the fourth shields. Dorsal head with 15
scales, 42 scales up to the neck, 24 up to the antehumeral
fold (following the longitudinal fold), 59 scales around
the body, 51 dorsal from the occiput to the hind limbs.
The dorsal scales are triangular, with a pronounced keel,
mucron, and imbricate. With 79 ventral scales, eight
pygals, and seven precloacal pores.
Four chin shields, 4" pair separated by six scales.
Seventy scales around half a body. Fifty-nine triangular
dorsal body scales, imbricated, and with a keel and
mucron; laminar anterior on members, imbricate and
slightly keeled; laminar on hind limbs, imbricate and
slightly keeled; tail with dorsal scales juxtaposed.
Seventy-nine ventral scales, from the mental to the
cloacal region, following the ventral midline of the body,
laminar, imbricated. Thirty-seven imbricate gulars,
smooth. Neck with longitudinal fold with 42 granular,
not-keeled scales, ear fold and antehumeral fold present.
Forelimbs ventrally laminar, subimbricate to imbricate,
with keeled scales; hind legs laminar, imbricate, with
keeled scales. Twenty subdigital lamellae on the 4"
finger of the hand. Twenty-two subdigital lamellae of the
4" toe, with three keels, plantar trifid scales with keels
and mucrons. Lamellar ventral scales on tail, imbricate,
not keeled. Seven precloacal pores. Supernumerary
pores absent.
Color of holotype in life (Figs. 2D—F). Head completely
melanic. Temporal region with clear edges, supralabial,
infralabial, and lorilabial scales are gray with black
spots. Palpebral scales pale yellow. Neck dorsally black
and yellow on the sides with some black or dark hues.
Body uniform brownish-yellow color, vertebral field not
defined, vertebral line and dorsolateral bands absent.
Paravertebral spots diffuse, imperceptible, black in
color, and in the form of thin transversal lines, curved
posteriorly. These spots project to the sides of the body,
which are lighter yellow in color with no obvious spots.
Front and rear legs brown with yellow hues and dark
scales. Fingers light gray. Tail of the same color as the
body, a little lighter on the sides and at its distal end.
Venter light gray or whitish throughout the body, with
some dark shades in the center of the abdomen and
yellow on the sides of the abdomen.
Morphological variation (Table 1). Thirteen specimens
including MUSA 5691-96, MUSA 5698-5702, and
MUBI 17683-84 (seven males and six females).
Considering both sexes, individuals of L. warjantay
sp. nov. reach a maximum snout-vent length of 95.12
mm, with males tending to be larger than females (SVL
male mean: 85.98 mm; SVL female mean: 78.39 mm)
(Table 1). Other characters: A line of lorilabial scales.
Dorsal scales juxtaposed, triangulars the mayority
and with keeled scales between occiput and hindlimb
September 2021 | Volume 15 | Number 2 | e287
New Liolaemus species from Peru
Table 1. Morphological variation among specimens of Liolaemus warjantay sp. nov.
Morphological character
Dorsal surface of head rough
Nasal surrounded
Supralabials
Lorilabials
Supraoculars
Parietals (slightly smaller than interparietals)
Infralabials
Gulars
Temporals granular
Auditory meatus height
Auditory meatus width
Head length
Head width
Head height
Underarm to groin length
SVL males
SVL females
Femur length
Humerus length
Forearm length
Hand length
Scales around midbody
Scales dorsals
Infradigital lamellae of the 4" finger of the hand
Infradigital lamellae of the 4" finger of the toe
Ventral scales
Tail length (n = 8)
Males with precloacal pores
Females with precloacal pores
Body measurements in males
Body measurements in females
Tail length in males
Tail length in females
insertion. Parietals slightly smaller than interparietals.
Occiput scales granular or conical in males and granular
in females. Nasal and canthal separated by two scales.
Upper ear border with enlarged anterior diagonal scale.
Temporary scales granular and without keel. Subocular
in contact with three to five lorilabials. Second right
infralabial scale in contact with four or five scales.
Dorsal body scales, subimbricated to imbricate, males
with dark, light and triangular scales, females with dark
scales and rounded or triangular posterior border. Ventral
scales, imbricated in the gular, pectoral, abdominal, and
pygal region. Precloacal pores evident in males, only one
female with two small pores. Dorsal scales at the base
of the tail are imbricated. Dorsal scales on forelimbs
Amphib. Reptile Conserv.
Variation Mean STD
(14-18) 15.69 1.49
(5-7) 5.85 0.8
(6-8) 7.08 0.49
(7-9) 8.38 1.04
(4-5) 4.62 0.51
(5-9) 6.85 as |
(6-7) 6.08 0.28
(32-37) 34.58 1.83
(8-10) 9 0.71
(3.01-5.97) 3.96 0.73
(0.7—1.98) 1.36 0.38
(16.03—22.74) 20.11 2.19
(12.12—22.85) 16.98 3.36
(8.31-12.9) 10.73 1.42
(24.84—71.93) 37.84 11.58
(74.87-95.12) 85.98 6.06
(61.1-92.31) 78.39 12.18
(12.9-20.53) 16.71 2.09
(10.18—13.35) 11.59 0.99
(9.10—12.32) 11.19 0.99
(10.64—16.19) 13.3 1.63
(55-64) 60.31 2.78
(45-63) Spas 4.97
(16-20) 17.62 1.45
(17-25) 22:23 1:92
(72-85) 78.15 3.91
(99.61—-123.56) 112.52 9.06
(5-9) 7.14 1.46
(0-2) 0.33 0.82
85.95
78.39
115.74
108.36
imbricate without keel or slight keel. Dorsal scales on
hind limbs imbricate and with a slight to strong keel,
only one female with subimbricate. Heteronotes in the
region where the femoral patch would be present. Palmar
scales, imbricated and with a triangular posterior border.
Plantar scales, with slight or strong keel and triangular
rear edge, one male rounded and without keel and one
female without keel. Subdigital lamellae of the fourth toe
with three keels.
Color variation in life (Figs. 2-3). Liolaemus warjantay
sp. nov. shows evident sexual dichromatism. In males,
head and temporal region are gray or dark brown, always
darker than body. Lorilabial, supralabial, and infralabial
September 2021 | Volume 15 | Number 2 | e287
Ubalde-Mamani et al.
Fig. 2. Adult males of Liolaemus warjantay sp. nov. in dorsal, lateral, and ventral views: (A-C) MUSA 5695 (SVL = 88.18 mm);
(D-F) MUSA 5700 (SVL = 89.56 mm, Tail = 123.3 mm); (G—I) MUSA 5702 (SVL = 86.21 mm, Tail = 123.56 mm); (J—L) MUBI
17684 (SVL = 86.21 mm, Tail = 123.56 mm); (M—O) MUSA 5702 (SVL = 84.89 mm, Tail = 117.47 mm).
scales are always lighter in color than the rest of the head.
Color of body is highly variable, varying from brown
to dark gray. Paravertebral spots are dark and can vary
in shape and intensity. Most of the specimens have the
shape of light ocelli with two edges, one light internal
and the other dark external, which can vary in intensity
and thickness. These edges can project to the sides of the
body. Paravertebral spots are more evident in juvenile
specimens, and in larger males they can be very diffuse
or imperceptible. No vertebral line, dorsolateral bands,
antehumeral arch, or scapular spots. The sides of the
body are lighter than the back, and can vary from yellow
to orange. No lateral spots, with small circular spots,
with yellow orange scales. No blue scales anywhere on
the body. The forelimbs and hindquarters are generally
lighter in color than the body and with yellow or black
dots or scales. Tail with spots and lines of the body
Amphib. Reptile Conserv.
change merging or fading until they are completely
lost by approximately the first fifth of the tail, then they
become lighter or darker in color than the rest of the body
(Fig. 2). Ventrally, the color is variable, some males are
completely yellow, orange, or white; some with dark
spots or scales on different parts of the body. Females
have a similar design as males, but with less dramatic
colors (Fig. 3). Head color also varies from chestnut to
dark gray. Supralabial, infralabial, and lorilabial scales
are lighter in color than the back of the head, with gray
being the most common color. Dorsal body is light to
dark brown. Paravertebral spots are also ocelli-shaped,
but they are black or dark brown with a white border.
These ocelli are more evident in smaller females and may
be absent in larger ones. Some females with edges of the
paravertebral spots projecting to the sides of the body in
a “zigzag” line shape, with no obvious vertebral line or
September 2021 | Volume 15 | Number 2 | e287
New Liolaemus species from Peru
a
ue
Fig. 3. Adult females of Liolaemus warjantay sp. nov. in dorsal, lateral, and ventral views: (A-C) MUSA 5699 (SVL = 70.63 mm,
Tail = 99.61 mm); (D—-F) MUSA 5696 (SVL = 88.14 mm); (G—I) MUSA 5694 (SVL = 85.84 mm, Tail = 118.33 mm); (J-L) MUBI
17683 (SVL = 92.31 mm, Tail = 107.14 mm).
dorsolateral bands. Lateral body is generally the same
color as dorsum. No lateral spots. Tail and hind limbs
have the same design and color as the body, however,
they are lighter in color after the first third. Immaculate
white underneath. Some have dark spots or scales on
different parts of the body.
Distribution and natural history (Figs. 7-8). Liolaemus
warjantay sp. nov. is restricted to the type locality,
Pampamarca (Fig. 8), in the RPSCC, Department of
Arequipa, Peru, at elevations between 4,500-4,529 m asl
(Fig. 7). This species inhabits high Andean dry puna (Fig.
8), where the climate has hostile conditions due to the high
elevations, with a wide range of temperatures (-8.9-14.6
Amphib. Reptile Conserv.
°C), and an annual average of 4 °C (WorldClim database,
based on collected information on _ environmental
variables for 30 years) (Fick and Hijmans 2017).
Individuals were registered and collected during the
dry and wet seasons (July—December), in natural rocky
areas with rocks which varied in size ranging between
30-200 cm, small bushes (Parasthrephia sp.), grassland
(Stipa sp. and Festuca sp.), and to a lesser extent an
area of yareta (Azorella sp.). The peak of lizard activity
was during 1100-1300 h. In the month of July, 100%
of the adult females observed were pregnant; while in
December, no pregnant females were observed, but there
were juvenile individuals. In most cases, the juveniles
were associated with shelters that were channels under
September 2021 | Volume 15 | Number 2 | e287
Ubalde-Mamani et al.
Table 2. Morphological differences between Liolaemus warjantay sp. nov. and related species.
Males
(n =7)
Females
(n = 6)
7-10
7-9
x=8 x=8
barely
Females
(n = 10)
Male
ar)
Males
(n =9)
Females
(n = 8)
keeled | barely keeled
present absent absent
Granular scales in
i neralncla-Oe- dorsum absent absent absent absent present present
pone ay Sealcson smooth smooth barely keeled | barely keeled smooth smooth
side of body
Antehumeral scales
absent absent present present present present
enlarged
Shape of palmar scales
Mucron in scales of
Pores on base of tail absent
Dorsal coloration pattern in the
form of ocelli in males
Enlarged scales on
sides of gular fold
Color pattern
the rocks (approximately 40 cm long by 20 cm high) and
were observed together with adult females in some cases,
and the number of juveniles observed in each refuge
was between 3-6 individuals. The potential predators
of L. warjantay sp. nov. are: American Kestrel (Falco
sparverius), Andean Fox (Lycalopex culpaeus), and
snakes (Jachymenys peruviana), which were observed
during field work in the type locality of L warjantay sp.
nov., and these species are known to include a percentage
of lizards in their diets (Jaksi¢ et al. 1981, 1982; Guzman-
Sandoval et al. 2007; Walker et al. 2007; Santillan et al.
2009; Miranda et al. 2015; Pozo-Zamora et al. 2017).
Yellow coloration pattern
around the eyes observed only
in females
Etymology. The specific name in the Quechua language
(“warjantay”’) refers to the local name in RPSCC and its
surroundings assigned to the high Andean lizards of the
genus Liolaemus.
Amphib. Reptile Conserv.
181
absent absent
conical conical
Seamless pattern of yellowing
around the eyes
The design of the dorsal body
color pattern is diffuse and
variable.
The coloration of males and
females is yellow and orange
around the eye.
Phylogeny. The morphology-based phylogeny
presented here (Fig. 5), performed with all the values
of the concavity constant (K), indicates that Liolaemus
warjantay sp. nov. belongs to the L. montanus group, and
within this to the L. ortizi clade (Abdala et al. 2020), and it
is recovered as sister taxon of L. galaywa. The molecular
analysis (Fig. 6) shows that the terminals of L. warjantay
sp. nov. (MUBI 17683, MUSA 5692, MUSA 5685,
VOI 009, and VOI 006) form a monophyletic subclade.
This was also recovered as a sister of L. galaywa in a
clade with a terminal identified as L. signifer sensu lato
(MUSM 29110), from Desaguadero, in the Department
of Puno, near the Bolivian border, which was mentioned
by Chaparro et al. (2020) and might represent a potential
new species of the L. montanus group from the Titicaca
Andean plateau in southern Peru. The topology of the
molecular tree is consistent with previous results using
September 2021 | Volume 15 | Number 2 | e287
New Liolaemus species from Peru
OA ASAE
Sas
Fig. 4. Comparisons of distinctive characters between the new species described herein and the phylogenetically and morphologically
closest species. Adult males of, Liolaemus warjantay sp. nov. (MUSA 5700, holotype): (A) Infralabials with absent keel, (D)
Presence of enlarged scales on sides of gular fold, (G) Palmar scales trifid, (J) Plantar scales trifid, (M) Absence of pores at the
base of the tail, (P) Dorsolateral fold present; L. galaywa (MUBI 13286, holotype): (B) Infralabials barely keeled, (E) Absence of
enlarged scales on sides of gular fold, (H) Palmar scales triangular, (IX) Plantar scales rounded, (N) Presence of pores at the base of
the tail, (Q) Dorsolateral fold absent; L. annectens (LECG 102): (C) Infralabials with absent keel, (F) Absence of enlarged scales on
sides of gular fold, (I) Palmar scales trifid, (L) Plantar scales conical, (O) Absence of pores at the base of the tail, (R) Dorsolateral
fold present.
Amphib. Reptile Conserv. 182 September 2021 | Volume 15 | Number 2 | e287
Ubalde-Mamani et al.
Liolaemus chlorostictus clade
Liolaemus Liolaemus andinus clade
montanus
group Liolaemus foxi clade
Liolaemus reichei clade
— Liolaemus poecilochromus clade
Liolaemus multicolor clade
Liolaemus huacahuasicus clade
Liolaemus ortizi clade
L.victormoralesii
L.aff.annectens
L.annectensCylm
L.annectensSby
L.aff.annectensLe.
| L.aff.ortizid
| L.warjantay sp.nov.
L.galaywa
L.aff.ortizi3
L.ortizt
| L.aff.ortizil
L.aff.polystictus
L.aff.ortiziA
L.aff.ortizi2
L.thomasi
Liolaemus robustus clade
Liolaemus forsteri clade
Liolaemus jamesi clade
Liolaemus dorbignyi clade
Fig. 5. Phylogenetic tree showing the relationships between Liolaemus warjantay sp. nov. and species within the L. montanus group
by morphological phylogenetic analysis.
either the same molecular markers (Chaparro et al. 2020)
or only cyt-b (Huamani- Valderrama et al. 2020: Quiroz
et al. 2021).
Statistical analysis. The summary statistics for all the
non-transformed continuous and meristic characters
taken from the six species of Liolaemus are shown in
Appendix I. Levene’s test did not find homogeneity of
variance for either the continuous or meristic characters in
some groups. Therefore, Principal Component Analysis
Amphib. Reptile Conserv.
is recommended to extract the linear combinations that
best explain the variation in the data set. The results
of the PCAs for continuous and meristic characters are
presented separately in Table 3 (Fig. 9) and Table 4
(Fig. 10). The first two components of the continuous
characters explained 72.15% of the variation. A screen
plot test of the PCs indicated that only the two first
components contained nontrivial information. The first
axis represents body size, loading for most variables
positively and accounting for 63.60% of the variation,
September 2021 | Volume 15 | Number 2 | e287
New Liolaemus species from Peru
Table 3. Principal Component (PC) axis loadings of continuous
characters for L. “Cotahuasi” (n = 14), L. “Inmaculada” (n =
15), L. melanogaster (n = 2), L. galaywa (n = 8), L. williamsi
(n = 5), and L. warjantay sp. nov. (n = 11). Eigenvectors,
eigenvalues, and percentages of variance explained for the first
two Principal Components from transformed data in the six
putative species of Liolaemus.
Loadings PCI PE2
Percentage variation
accounted for oe ee
Eigenvalue 12.08 1.62
Snout-vent length 0.95 0.08
Length of the interparietal 0.89 —0.08
Head width 0.8 0.39
Head height 0.67 0.01
Auditory meatus height 0.78 —0.21
Auditory meatus width —0.06 —0.73
Length of the head 0.95 —0.01
Neck width 0.92 0.23
Length of the hand 0.8 0.07
Arm width 0.88 —0.08
Length of the radius 0.62 —0.54
Length of the arm 0.62 —0.36
Length of the thigh 0.87 —0.30
Length of the tibia 0.93 —0.08
eros ae
ee of the foot without 0.89 0.06
Length of the trunk 0.62 0.32
Body width 0.78 0.39
ee of the base of the 0.9 0.16
with strong loadings for: snout-vent length, length of the
head, length of the tibia, neck width, width of the base
of the tail, length of the interparietal, length of the foot
without claw, arm width, length of the thigh, head width,
length of the hand, auditory meatus height, body width,
and length of the fourth toe of the hind limb. The second
axis represents morphological variation and accounts for
most of the remaining variation, with strong loading for
auditory meatus width. The first three components of
meristic characters explained 43.00% of the variation,
and a screen plot test of the PCs indicated that only those
components contain relevant information. The three axes
represent morphological variation, loading strongly for
number of temporals, number of supralabials on the
right side, and number of ventral scales in contact with
the second infralabial scales. The three axes account for
the remaining variation, albeit with values below 0.70.
The positions of the species based on their scores for
the two morphological principal components axes are
illustrated in Figs. 9-10. The spatial distribution of the
Amphib. Reptile Conserv.
Table 4. Principal Component (PC) axis loadings of meristic
characters for L. “Cotahuasi” (n = 14), LZ. “Inmaculada” (n =
15), L. melanogaster (n = 2), L. galaywa (n = 8), L. williamsi
(n = 5), and L. warjantay sp. nov. (n = 11). Eigenvectors,
eigenvalues, and percentages of variance explained for the first
three Principal Components from transformed data in the six
putative species of Liolaemus.
Loadings PO? PC2 PC3
Percentage variation accounted 1932 1362 10.07
for
Eigenvalue 4.64 Ree! 2.42
Number of scales around the
interparietal scale oe ms aes
Number of supralabials on the 075 003 01
right side
Number of infralabials on the 057 017. 047
right side
Number of infralabials on the
left side
Number of lorilabials
0.41 0.4 0.15
—0.66 0.35 0.03
Number of scales around the
mental scale aca
—0.03
Hellmich index —0.60 0.27 0.18
Subdigital lamellae of the fourth
finger of the forelimb i Sie
Subdigital lamellae of the fourth
iosofthehind limb ee P28 a eOet8
Number of dorsal scales
between the occiput and the
level of the anterior edge of the St as ama
thigh
Number of ventral scales
in contact with the second —0.11 0.45 —0.74
infralabial scales
Number of scales in contact 6 16> 19:46 0.46
with the mental scale
Number of scales around the
0.2 —0.18 0.49
nasal scale
Number of supraocular enlarged
scales in the right side a ic ia aa
Number of scales that form the 0.2 045 054
frontal
Number of scales between the 033. 016 029
rostral and frontal
Number of organs in the 004 036 0.1
postrostral scales
Number of gular scales 0.65 -0.54 0.06
Number of scales around 065 042 0.28
midbody
Number of ventral scales —0.14 0.28 —0.60
Number of auricular scales 0.36 039 -0.33
Number of superciliaries —0.04 -0.63 -0.25
Number of temporals —0.86 -0.16 0)
Number of pygals —0.15 -0.33 -0.04
September 2021 | Volume 15 | Number 2 | e287
Ubalde-Mamani et al.
Liolaemus victormoralesii BYU50428
Liolaemus victormoralesii MUSM31464
Liolaemus victormoralesii MUSM31373
Liolaemus victormoralesii BYU50430
Liolaemus victormoralesii MUSM31461
Liolaemus victormoralesii MUSM31465
98 4¢| Liolaemus victormoralesii MUSM31462
9{Liolaemus victormoralesii BYU50431
5'Liolaemus victormoralesii MUSM31468
Liolaemus victormoralesii MUSM31371
Liolaemus victormoralesii MUSM31374
Liolaemus melanogaster BYU50151
Liolaemus melanogaster MUSM31472
Liolaemus melanogaster MUSM31475
Liolaemus melanogaster BYU50154
Liolaemus williamsi MUSM31486
Liolaemus williamsi BYU50463
98
99
95
Liolaemus williamsi BYU50465
Liolaemus robustus MUSM31504
Liolaemus robustus MUSM31508
Liolaemus robustus BYU50438
100 ‘Liolaemus robustus MUSM31439
Liolaemus polystictus “Castrovirreyna” BYU 50630
94100; Liolaemus polystictus MUSM31451
Liolaemus polystictus MUSM31446
74||Liolaemus polystictus “AbraApacheta” MUSM31481
90 |i |; Liolaemus polystictus “AbraApacheta” BYU50145
78 Liolaemus polystictus “AbraApacheta” BYU50148
Liolaemus warjantay sp. nov. MUSA 5692
39/Liolaemus warjantay sp. nov. MUBI 17683
gg | Liolaemus warjantay sp. nov. MUSA 5685
Liolaemus warjantay sp. nov. VOI 006
Liolaemus warjantay sp. nov. VOI 009
Liolaemus gqalaywa MUBI 12081
Liolaemus signifer MUSM29110
68;Liolaemus etheridgei BYU50494
97 | Liolaemus etheridgei BYU50493
Liolaemus etheridgei MUSM31494
Liolaemus etheridgei BYU50499
Liolaemus etheridgei BYU50495
Liolaemus annectens BYU50491
Liolaemus annectens “Lampa” MUSM 31433
Liolaemus signifer MUSM31437
140 ;Liolaemus signifer MUSM31443
99 | ‘Liolaemus signifer BYU50444
Liolaemus signifer MUSM31434
Liolaemus signifer BYU50355
gi {Liolaemus signifer MUSM31447
Liolaemus signifer BYU50357
46 78’ Liolaemus signifer BYU50350
99 jLiolaemus ortizi MUSM31513
Liolaemus ortizi MUSM31514
g6 | [Liolaemus thomasi BYU50469
gg |Liolaemus thomasi MUSM31516
75)Liolaemus thomasi BYU50466
72'Liolaemus thomasi BYU50467
57)/Liolaemus nazca BYU50507
27'Liolaemus nazca BYU50508
60 100 || jolaemus nazca MUSM31523
|Liolaemus nazca BYU50472
43° Liolaemus nazca MUSM31524
43 100 Liolaemus insolitus MUSM31490
Liolaemus insolitus BYU50462
50
98
39
35
63
47
32 Liolaemus poconchilensis MUSM31544
48 Liolaemus poconchilensis MUSM31545
66 Liolaemus angapuka LDHV 120
100 “Liolaemus anqapuka RGP 6000
Liolaemus dorbignyi LIAMMCNP 5002
Liolaemus eleodori LJIAMMCNP 2709
Liolaemus vallecurensis LJAMMCNP 650
Ctenoblepharys adspersa BYU 50502
——
0.10
Fig. 6. Phylogenetic tree showing the relationships between Liolaemus warjantay sp. nov. and species within the L. montanus group
by molecular phylogenetic analysis.
Amphib. Reptile Conserv. 185 September 2021 | Volume 15 | Number 2 | e287
New Liolaemus species from Peru
75°0'O"W 72°0'0"W 69°0'0"W
12°0'0"S
12°0'0"S
it)
= ie)
= ° Legend
a = A L. annectens 1 L. signifer
A L. angapuka aP 1. thomasi
A L. balagueri aP L. victormoralesii
A L. chiribaya #P 1. williamsi
Ay L. etheridgei @P L. yarabamba
@ L. evaristoi ap L. yauri
@ |. insolitus eS L. warjantay sp. nov.
@ L. melanogaster [10 - 1,000
@ L. nazca (1,001 - 2,000
@ Pale pace MH 2,001 - 3,000
° 2 _ _ (3,001 - 4,000
= | en Opa EDS 2 0 5.000
BB L. polystictus MM 5,001 - 6,891
BL. qalaywa
B® L. robustus
75°0'0"W
Fig. 7. Geographic distribution showing the type localities of species included in the Liolaemus montanus group in Peru.
72°0'0"W 69°0'0"W
Amphib. Reptile Conserv. 186 September 2021 | Volume 15 | Number 2 | e287
Ubalde-Mamani et al.
Principal Component 2
Principal Component 1
Fig. 9. Plot of Principal Component (PC) scores of continuous
characters for ZL. “Cotahuasi” (green circles, n = 14), L.
“Inmaculada” (white squares, n = 15), L. melanogaster (yellow
triangles, n = 2), L. galaywa (red triangles, n = 8), L. williamsi
(olive squares, n = 5), and L. warjantay sp. nov. (black stars, n
= 11). Eigenvectors, eigenvalues, and percentages explained for
the first two Principal Components are summarized in Table 3.
continuous characters indicates that body size (PC1)
and morphological variation (PC2) are sufficient to
separate the six Liolaemus species. These species can
also be distinguished by their position analyzing meristic
characters only. In both analyses, L. warjantay sp. nov.
can be differentiated from other phylogenetically related
species by its body size and morphological variation. To
further clarify the position of the Liolaemus species in the
morphospace of both continuous and meristic characters,
a DFA was carried out where the group membership was
determined a priori. The result obtained through the DFA
for the six species of Liolaemus was not significant for
continuous morphological characters (Wilk’s Lambda =
0.93, F= 0.43, P= 0.82), and the jackknife classification
was 100% satisfactory. The DFA of operational taxonomic
units for meristic characters was not significant (Wilk’s
Lamba = 0.75, F= 1.69, P=0.17), however, the jackknife
satisfactory classification was developed at a 100% rate.
These results show that our L. warjantay sp. nov. can
be reliably distinguished from the other species by the
combination of morphological characters.
On the reptile diversity in the Department of
Arequipa. Scientific research on the reptiles in the
Department of Arequipa indicates that 25 species of
reptiles have been registered from 1978 to 2021 (Péfaur
et al. 1978; Cei and Péfaur 1982; Zeballos et al. 2002;
Gutiérrez et al. 2010; Huamani-Valderrama et al. 2020:
Villegas-Paredes et al. 2020; Ormefio et al. 2021;
Quiroz et al. 2021), of which ten belong to the genus
Liolaemus. L. annectens, L. anqapuka L. balagueri, L.
etheridgei, L. insolitus, L. nazca, L. signifer, L. tacnae,
L. warjantay sp. nov., and L. yarabamba. Even so,
there is a noticeable paucity of inventory, diversity, and
distribution studies on the taxa present in this region, as
Amphib. Reptile Conserv.
a oe e
~ i
— oge ®
v | @ e
5 o
fy Oo
E ) 7 Se
v a¥
zB o Vv
= v
S i * oo _
: a ee
Principal Component I
Fig. 10. Plot of Principal Component (PC) scores of meristic
characters for ZL. “Cotahuasi” (green circles, n = 14), L.
“Inmaculada” (white squares, n = 15), L. melanogaster (yellow
triangles, n = 2), L. galaywa (red triangles, n = 8), L. williamsi
(olive squares, n = 5), and L. warjantay sp. nov. (black stars, n
= 11). Eigenvectors, eigenvalues, and percentages explained for
the first three Principal Components are summarized in Table 4.
is the case in many parts of the country. This shortage
of information includes the RPSCC where L. warjantay
sp. nov. was found, which protects an area of 490,450
ha, distributed across a space that rises from 950 m asl
through the Cotahuasi canyon to snow peaks above
6,100 m asl. Additionally, three distinct populations of
Liolaemus lizards were recorded during the field surveys
in the RPSCC, which can be considered as “candidate
species” with unique morphological characteristics,
although more analyses (molecular and morphological)
are required to investigate their taxonomic identities.
Two of the populations belong to LZ. montanus group,
one recorded near to the type locality of L. warjantay
sp. nov. and other distributed further to the southeast and
separated by the geographical barrier of the Cotahuasi
canyon. The third population belongs to the L. alticolor-
bribonii group. There is no evidence that L. annectens
occurs in the RPSCC, although this species was reported
by AEDES (2008) as “Liolaemus signifer annectens” (=
Liolaemus annectens), based on specimens observed in
Huaynacotas, Pampamarca, and Puyca localities, and
the description text and photographs of this species
provided by AEDES (2008) fit very well with the
populations of Liolaemus warjantay sp. nov. described
here. These recent discoveries are important for filling
the information gaps regarding the reptile diversity of the
Department of Arequipa, and also from Peru as a whole,
because it helps to develop our understanding of the real
potential diversity of lizards in the genus Liolaemus,
which for years has been underrated.
Acknowledgments.—We are grateful to several
institutions for allowing the review of specimens from
their museum collections: Evaristo Lopez Tejeda
(MUSA), Sonia Kretzschmar and Esteban Lavilla
September 2021 | Volume 15 | Number 2 | e287
New Liolaemus species from Peru
(FML), and the staff of Museo de Biodiversidad del
Peri (MUBI). We appreciate the comments of German
Chavez, which improved our manuscript. Thanks to the
staff of the Reserva Paisajistica Sub Cuenca del Cotahuasi
del Servicio Nacional de Areas Naturales Protegidas
por el Estado (SERNANP) for giving us access to their
facilities. M.D. Ubalde-Mamani is grateful to Cristian
Abdala, for being the advisor for his thesis in obtaining
the title of Biologist, to Romina Sehman, AnaLu
Bulacios, and Marco Paz for their advice and comments
during the Liolaemus research, and to the Abdala family
who very kindly received her at their home during her
stay in Mendoza. Thanks to José Cerdefia, Luis Arapa,
Jefferson Bedregal, Jeitson Zegarra, Erick Guillen,
Lorena Caceres, Victor Alcahuaman, Jorge Fernandez,
and Fabrizzio Peralta for their assistance in the fieldwork.
The work of M.D. Ubalde-Mamani was financially
supported by Universidad Nacional de San Agustin
de Arequipa (UNSA) under the contract N° 02-2019-
UNSA, and W. Huanca was supported by "Convenio de
Desempefio Regional UTA1795" and "UTA1799." CS.
Abdala thanks Agencia Nacional de Promoci6n Cientifica
y Tecnologica (ANPCyT), Proyectos de Investigacion
Cientifica y Tecnologica (FONCyT-PICT) 2015-1398.
We are grateful to the staff of the Ministerio de Medio
Ambiente y Agua, Viceministerio de Medio Ambiente,
Biodiversidad y Cambio Climatico in Bolivia for issuing
the permits to work with lizards of the Liolaemus
montanus group. Collection permits for specimens were
issued by Resolucion Jefatural N° 012-2019-SERNANP-
RPSCC-J y Carta N° 009-2020-SERNANP-RPSCC-J.
Literature Cited
Abdala CS. 2007. Phylogeny of the L. boulengeri
group (Iguania: Liolaemidae, Liolaemus) based on
morphological and molecular characters. Zootaxa
1538: 1-84.
Abdala CS, Quinteros S. 2008. Una nueva especie de
Liolaemus (Iguanidae: Liolemini) endémica de la
sierra de Fiambala, Catamarca, Argentina. Cuadernos
de Herpetologia 22: 35-47.
Abdala CS, Quinteros AS, Espinoza RE. 2008. Two new
species of Liolaemus (Iguania: Liolaemidae) from the
Puna of northwestern Argentina. Herpetologica 64:
458-471.
Abdala CS, Acosta JC, Cabrera MR, Villavicencio HJ,
Marinero J. 2009. A new Andean Liolaemus of the L.
montanus series (Squamata: Iguania: Liolaemidae)
from Western Argentina. South American Journal of
Herpetology 4: 91-102.
Abdala CS, Juarez-Heredia V. 2013. Taxonomia y
filogenia de un grupo de lagartos amenazados: el
grupo de Liolaemus anomalus (Iguania: Liolaemidae).
Cuadernos de Herpetologia 27. 109-153.
Abdala CS, Paz MM, Semhan RV. 2013. Nuevo
Liolaemus (Iguania: Liolaemidae) con novedoso
Amphib. Reptile Conserv.
caracter morfoldgico, de la frontera entre Argentina
y Chile. Revista de Biologia Tropical 61(4): 1,563—
1,584.
Abdala CS, Quinteros AS. 2014. Los ultimos 30 afios
de estudios de la familia de lagartijas mas diversa de
Argentina. Actualizacion taxonomica y sistematica de
Liolaemidae. Cuadernos de Herpetologia 28: 55-82.
Abdala CS, Baldo D, Juarez RA, Espinoza RE. 2016.
The first parthenogenetic pleurodont iguanian: a new
all-female Liolaemus (Squamata: Liolaemidae) from
Western Argentina. Copeia 104(2): 487-497.
Abdala CS, Aguilar-Kirigin AJ, Semhan RV, Bulacios
AL, Valdes J, Paz MM, Gutiérrez-Poblete R,
Valladares-Faundez P, Langstroth R, Aparicio J.
2019. Description and phylogeny of a new species
of Liolaemus (Iguania: Liolaemidae) endemic to the
south of the Plurinational State of Bolivia. PLoS ONE
14: e0225815.
Abdala CS, Quinteros AS, Semhan RV, Bulacios Arroyo
A, Schulte J, Paz MM, Ruiz-Monachesi MR, Laspiur
A, Aguilar-Kirigin AJ, Gutiérrez-Poblete R, et al.
2020. Unravelling interspecific relationships among
highland lizards: first phylogenetic hypothesis using
total evidence of the Liolaemus montanus group
(Iguania: Liolaemidae). Zoological Journal of the
Linnean Society 114: 1-29.
Abdala CS, Laspiur A, Langstroth RP. 2021. Las especies
del género Liolaemus (Liolaemidae). Lista de taxones
y comentarios sobre los cambios taxondmicos mas
recientes. Cuadernos de Herpetologia 35(Suplemento
1): 193-223.
AEDES (Asociacion Especializada para el Desarrollo).
2008. Guia de Anfibios y Reptiles. Reserva Paisajistica
Subcuenca del Cotahuasi, Arequipa, Peru.
Aguilar C, Wood PL Jr, Cusi JC, Guzman A, Huari F,
Lundberg M, Mortensen E, Ramirez C, Robles D,
Suarez J, et al. 2013. Integrative taxonomy and
preliminary assessment of species limits in the
Liolaemus walkeri complex (Squamata, Liolaemidae),
with descriptions of three new species from Peru.
ZooKeys 364: 47-91.
Aguilar C, Wood PL Jr, Belk M, Duff MH, Sites JW
Jr. 2016. Different roads lead to Rome: integrative
taxonomic approaches lead to the discovery of two
new lizard lineages in the Liolaemus montanus group
(Squamata: Liolaemidae). Biological Journal of the
Linnean Society 120: 448-467.
Aguilar-Puntriano C, Avila LJ, De la Riva I, Johnson L,
Morando M, Troncoso-Palacios J, Wood PL Jr, Sites
JW Jr. 2018. The shadow of the past: convergence
of young and old South American desert lizards as
measured by head shape traits. Ecology and Evolution
8: 11,399-11,409.
Aguilar-Puntriano C, Ramirez C, Castillo E, Mendoza
A, Vargas VJ, Sites JW Jr. 2019. Three new lizard
species of the Liolaemus montanus group from Peru.
Diversity 11(161): 1-19.
September 2021 | Volume 15 | Number 2 | e287
Ubalde-Mamani et al.
Aparicio J, Ocampo M. 2010. Liolaemus grupo montanus
Etheridge, 1995 (I[guania: Liolaemidae). Cuadernos
de Herpetologia 4: 133-135.
Arapa-Aquino LP, Abdala CS, Huamani-Valderrama
L, Gutiérrez RC, Cerdefia J, Quiroz AJ, Chaparro
JC. 2021. Una nueva especie de lagartija del género
Liolaemus (Iguania: Liolaemidae) endémica de la
Puna del sur de Pert. Cuadernos de Herpetologia
35(Suplemento 1): 35-48.
Astudillo G, Cordoba M, Gomez-Alés R, Acosta
JC, Villavicencio HJ. 2019. Termorregulacion
de la lagartija Liolaemus chacoensis (Squamata:
Liolaemidae) durante su ciclo reproductivo, en el
Chaco occidental, Argentina. Revista de Biologia
Tropical 67(6): 1,505—1,519.
Cei JM, Péfaur JE. 1982. Una especie nueva de Liolaemus
(Iguanidae: Squamata): su sistematica, ecologia y
distribucion. Pp. 573-586 In: Actas 8vo Congreso
Latinoamericano de Zoologia, Mérida, Venezuela,
Octubre 1980. Producciones Alfa, Merida, Venezuela.
784 p.
Cerdefia J, Farfan J, Quiroz AJ. 2021. A high mountain
lizard from Peru: the world’s highest-altitude reptile.
Herpetozoa 34: 61-65.
Chaparro JC, Quiroz AJ, Mamani L, Gutiérrez RC,
Condori P, De la Riva I, Herrera-Juarez G, Cerdefia J,
Arapa LP, Abdala CS. 2020. An endemic new species
of Andean lizard of the genus Lio/aemus from southern
Peru (Iguania: Liolaemidae) and its phylogenetic
position. Amphibian & Reptile Conservation 14(2)
[General Section]: 47-63 (e238).
Corl A, Davis A, Kuchta S, Comendant T, Sinervo B.
2010. Alternative mating strategies and the evolution
of sexual size dimorphism in the Side-blotched Lizard,
Uta stansburiana: a population-level comparative
analysis. Evolution 64: 79-96.
De Queiroz K. 1998. The general lineage concept of
species, species criteria, and the process of speciation.
Pp. 57—75 In: Endless Forms: Species and Speciation.
Editors, Howard DJ, Berlocher SH. Oxford University
Press, New York, New York, USA. 552 p.
De Queiroz K. 2007. Species concepts and species
delimitation. Systematic Biology 56: 879-886.
Etheridge R. 1995. Redescription of Ctenoblepharis
adspersa Tschudi, 1845, and the taxonomy of
Liolaeminae (Reptilia: Squamata: Tropiduridae).
American Museum Novitates 3142: 1—34.
Etheridge RE. 2000. A review of the Liolaemus
wiegmannii group (Squamata, Iguania, Tropiduridae),
and a history of morphological change in the sand
dwelling species. Herpetological Monographs 4:
293-352.
Fick SE, Hiymans RJ. 2017. WorldClim 2: new 1 km
spatial resolution climate surfaces for global land
areas. International Journal of Climatology 37(12):
4,302-4,315.
Goloboff P. 1993. Estimating character weights during
Amphib. Reptile Conserv.
tree search. Cladistics 9: 83-91.
Goloboff P, Farris J, Nixon K. 2003. TNT: Tree Analysis
Using New Technology, v. 1.0. Available: http://www.
zmuc.dk/public/phylogeny/TNT/ [Accessed: 8 April
2021].
Goloboff PA, Mattoni CI, Quinteros AS. 2006.
Continuous characters analyzed as such. Cladistics
22: 589-601.
Gonzalez-Marin AG, Pérez CHF, Minoli I, Morando M,
Avila LJ. 2016. A new lizard species of the Phymaturus
patagonicus group (Squamata: Liolaemini) from
northern Patagonia, Neuquén, Argentina. Zootaxa
4121: 412-430.
Gutiérrez R, Villegas L, Lopez E, Quiroz A. 2010.
Anfibios y reptiles de la Reserva Nacional de Salinas
y Aguada Blanca, Peru. Pp. 219-226 In: Diversidad
Bioldgica de la Reserva Nacional de Salinas y
Aguada Blanca. Editors, Zeballos H, Ochoa J, Lopez
E. DESCO, INRENA, PROFONANPE, Lima, Peru.
313 p.
Gutiérrez RC, Chaparro JC, Vasquez MY, Quiroz AJ,
Aguilar-Kirigin A, Abdala CS. 2018. Descripcion
y relaciones filogenéticas de una nueva especie de
Liolaemus (Iguania: Liolaemidae) y notas sobre
el grupo de L. montanus de Pert. Cuadernos de
Herpetologia 32(2): 81-99.
Guzman-Sandoval J, Sielfeld W, Ferru M. 2007. Dieta
de Lycalopex culpaeus (Mammalia: Canidae) en el
extremo norte de Chile (Region de Tarapaca). Gayana
71(1): 1-7.
Hibbard TN, Nenda SJ, Lobo F. 2019. A new species of
Phymaturus (Squamata: Liolaemidae) from the Auca
Mahuida Natural Protected Area, Neuquén, Argentina,
based on morphological and DNA evidence. South
American Journal of Herpetology 14: 123-135.
Huamani-Valderrama L, Quiroz AJ, Gutiérrez RC,
Aguilar-Kirigin A, Huanca-Mamani W, Valladares-
Faundez P, Cerdefia J, Chaparro JC, Santa Cruz R,
Abdala CS. 2020. Some color in the desert: description
of a new species of Liolaemus (Iguania: Liolaemidae)
from southern Peru, and its conservation status.
Amphibian & Reptile Conservation 14(3) [Taxonomy
Section]: 1-30 (e250).
Irschick DJ, Losos JB. 1996. Morphology, ecology, and
behavior of the Twig Anole, Anolis angusticeps. Pp.
291-301 In: Contributions to West Indian Herpetology:
a Tribute to Albert Schwartz. Contributions to
Herpetology. Editors, Powel R, Henderson W. Society
for the Study of Amphibians and Reptiles, Ithaca,
New York, USA. 457 p.
Jaksi¢ FM, Greene HW, Yajfiez JL. 1981. The guild
structure of a community of predatory vertebrates in
central Chile. Oecologia 49: 21-28.
Jaksi¢ FM, Greene HW, Schwenk K, Seib RL. 1982.
Predation upon reptiles in Mediterranean habitats of
Chile, Spain, and California: a comparative analysis.
Oecologia 53: 152-159.
September 2021 | Volume 15 | Number 2 | e287
New Liolaemus species from Peru
Kumar S, Stecher G, Li M, Knyaz C, Tamura K. 2018.
MEGA X: Molecular Evolutionary Genetics Analysis
across computing platforms. Molecular Biology and
Evolution 35(6): 1,547-1,549.
Laurent RF. 1985. Segunda contribucion al conocimiento
de la estructura taxonomica del género Liolaemus
Wiegmann (Iguanidae). Cuadernos de Herpetologia
1: 1-37.
Lobo F, Nenda SJ. 2015. Discovery of two new
species of Phymaturus (Iguania: Liolaemidae) from
Patagonia, Argentina, and occurrence of melanism in
the patagonicus group. Cuadernos de Herpetologia
29: 5-25.
Losos JB. 1990. Ecomorphology, performance capa-
bility, and scaling of West Indian Anolis lizards: an
evolutionary analysis. Ecological Monographs 60:
369-388.
Lovett GM, Weathers KC, Sobczak WV. 2000. Nitrogen
saturation and retention in forested watersheds
of the Catskill Mountains, New York. Ecological
Applications 10: 73-84.
Manly BFL. 2000. Multivariate Statistical Methods.
Chapman and Hall/CRC, Boca Raton, Florida, USA.
215-p.
Martori R, Aun L, Orlandini S. 2002. Relaciones
térmicas temporales en una poblacién de Liolaemus
koslowskyi. Cuadernos de Herpetologia 16(1): 33-45.
McCune B, Grace JB. 2002. Analysis of ecological
communities. MjM Software Design, Gleneden
Beach, Oregon, USA.
McGarigal K, Cushman S, Stafford S. 2000. Multivariate
Statistics for Wildlife and Ecology Research. 1\*
Edition. Springer, New York, New York, USA. 283 p.
Miranda B, Lottersberger S, Aparicio J, Aguilar-Kirigin
AT. Ocampo M, Pacheco LF. 2015. Natural history
notes: Zachymenis peruviana. Diet. Herpetological
Review 46(4): 651.
Olivera DA, Aguilar CA. 2020. Dieta de la lagartija
neotropical Liolaemus polystictus (Squamata:
Liolaemidae) de los andes centrales, Huancavelica,
Peru. Revista Peruana de Biologia 27(3): 339-348.
Ormefio, JR, Sumiano-Mejia R, Orellana-Garcia A,
Garcia Darwin A, Tenorio MI, Whaley O, Venegas
PJ, Abdala CS. 2021. Ampliacion de la distribucién
geografica de Liolaemus nazca Aguilar, Ramirez,
Castillo, Mendoza, Vargas, and Sites Jr, 2019
(Iguania: Liolaemidae) para el extremo sur de Ica y
norte de Arequipa, Pert. Cuadernos de Herpetologia
35(Suplemento 1): 237-244.
Péfaur JE, DavilaJ, Lopez E, NufiezA. 1978. Distribucion
y clasificacion de los reptiles del Departamento de
Arequipa. Bulletin de l'Institut Francais d'Etudes
Andines 7(1—2): 129-139.
Peres-Neto PR, Jackson DA. 2001. The importance of
scaling of multivariate analysis in ecological studies.
EcoScience 8: 522-526.
Pincheira-Donoso D, Scolorano JA, Sura P. 2008.
Amphib. Reptile Conserv.
A monographic catalogue on the systematics and
phylogeny of the South American iguanian lizard
family Liolaemidae (Squamata, Iguania). Zootaxa
1800: 3-85.
Pozo-Zamora GM, Aguirre J, Brito J. 2017. Dieta del
Cernicalo Americano (Falco sparverius Linnaeus,
1758) en dos localidades del valle interandino del
norte de Ecuador. Revista Peruana de Biologia 24(2):
145-150.
Quinn GP, Keough MJ. 2002. Experimental Design and
Data Analysis for Biologists. 1* Edition. Cambridge
University Press, New York, New York, USA. 537 p.
Quinteros AS, Abdala CS, Lobo FJ. 2008. Redescription
of Liolaemus dorbignyi Koslowsky, 1898 and
description of a new species of Liolaemus (Iguania:
Liolaemidae). Zootaxa 1717: 51-67.
Quinteros AS, Abdala CS. 2011. A new species of
Liolaemus of the Liolaemus montanus section
({guania: Liolaemidae) from northwestern Argentina.
Zootaxa 2789: 35-48.
Quiroz AJ, Huamani-Valderrama L, Gutiérrez RC,
Aguilar-Kirigin A, Lopez-Tejeda E, Lazo-Rivera A,
Huanca-Mamani W, Valladares-Faundez P, Morrone
JJ, Cerdefia J, et al. 2021. An endemic and endangered
new species of the lizard Liolaemus montanus group
from southwestern Peru (Iguania: Liolaemidae), with
a key for the species of the L. reichei clade. Zoological
Studies 60(23): 1-24.
Santillan MA, Travaini A, Zapata SC, Rodriguez A,
Donazar JA, Procopio DE, Zanon JI. 2009. Diet of the
American Kestrel in Argentine Patagonia. Journal of
Raptor Research 43(4): 377-381.
Scolaro JA, Corbalan V, Tappari OF, Streitenberger LO.
2016. Lizards at the end of the world: a new melanic
species of Phymaturus of the patagonicus clade from
rocky outcrops in the northwestern steppe of Chubut
province, Patagonia, Argentina (Reptilia: Iguania:
Liolaemidae). Boletin del Museo Nacional de Historia
Natural, Chile 65: 137-152.
Semhan RV, Halloy M, Abdala CS. 2013. Diet and
reproductive states in a high-altitude Neotropical liz-
ard, Liolaemus crepuscularis ([guania: Liolaemidae).
South American Journal of Herpetology 8: 102-108.
SERNANP. 201 9a. Plan Maestro dela Reserva Paisajistica
Subcuenca del Cotahuasi, 2019-2023. Available:
http://old.sernanp.gob.pe/sernanp/archivos/baselegal/
Resoluciones_Presidenciales/2019/-RP%20
079-2019-SERNANP. pdf [Accessed: 23 June 2020].
SERNANP. 2019b. Reserva Paisajistica Sub Cuenca
del Cotahuasi. Available: https://patrimoniomundial.
cultura.pe/sites/default/files/li/pdf/19.%20
Landscape%20Cotahuasi-%20Esp.pdf. [Accessed: 23
June 2020].
Sokal RR, Rohlf FJ. 1998. Biometry. The Principle
and Practice of Statistics in Biological Research. 3"
Edition. Freeman, New York, New York, USA. 887 p.
Valdecantos MS, Arias F, Espinoza RE. 2012. Herbivory
September 2021 | Volume 15 | Number 2 | e287
Ubalde-Mamani et al.
in Liolaemus poecilochromus, a small, cold-climate
lizard from the Andes of Argentina. Copeia 2012(2):
203-210.
van den Brink PJ, van den Brink NW, Ter Braak CJK.
2003. Multivariate analysis of ecotoxicological data
using ordination: demonstration of utility on the
basis of various examples. Australasian Journal of
Ecotoxicology 9: 141-156.
Villegas-Paredes L, Huamani-Valderrama L, Luque-
Fernandez C, Gutiérrez RC, Quiroz AJ, Abdala CS.
2020. Una nueva especie de Liolaemus (Iguania:
Liolaemidae) perteneciente al grupo L. montanus en
las lomas costeras del sur de Peru. Revista de Biologia
Tropical 68(1): 69-86.
reptiles of Peru.
Walker RS, Novaro AJ, Perovic P, Palacios R, Donadio
E, Lucherini M, Lopez MS. 2007. Diets of three
species of Andean carnivores in high-altitude deserts
of Argentina. Journal of Mammalogy 88(2): 519-525.
Wiens JJ, Reeder TW, De Oca ANM. 1999. Molecular
phylogenetics and evolution of sexual dichromatism
among populations of the Yarrow’s Spiny Lizard
(Sceloporus jarrovii). Evolution 53: 1,884—1,897.
Zar JH. 2010. Biostatistical Analysis. 5“ Edition. Prentice
Hall, Upper Saddle River, New Jersey, USA. 960 p.
Zeballos P, Lopez HE, Villegas L, Jiménez P, Gutiérrez
R. 2002. Distribucion de los reptiles de Arequipa, sur
del Peru. Dilloniana 4: 27-34.
Misshell D. Ubalde-Mamani is a Peruvian Biologist who graduated from the Universidad Nacional
de San Agustin, Arequipa, Peru. She is interested in the high Andean herpetofauna, particularly in
the taxonomy of the Liolaemus group, and in the ecology and conservation of amphibians and
Roberto C. Gutiérrez is a Biologist who graduated from the Universidad Nacional de San Agustin
de Arequipa, Peru. Roberto is currently the Curator and Principal Researcher of the Herpetological
Collection at the Museum of Natural History of the Universidad Nacional de San Agustin de
Arequipa, Peru, and Vice President and Founding Member of the Herpetological Association
of Peru (AHP). He is interested in the herpetofauna of the tropical Andes and the coastal desert,
with a special focus on lizards of genus Liolaemus, and is developing studies in the systematics
of amphibians and reptiles, ecology, and conservation. Roberto has conducted several biodiversity
inventories, biological assessments, and biodiversity monitoring programs, and is currently working
at the Servicio Nacional de Areas Naturales Protegidas of the Peruvian Ministry of Environment.
Juan C. Chaparro is a Peruvian Biologist with extensive experience in studying the fauna of
all the traditional geographic regions of Peru. Juan graduated in Biological Sciences from
Universidad Nacional Pedro Ruiz Gallo, Lambayeque, Peru, and received a Master’s degree in
Biodiversity in Tropical Areas and Conservation in 2013 from an institutional consortium of the
International University of Menendez Pelayo (UIMP-Spain), Universidad Tecnologica Indoamérica
(UTI-Ecuador), and Consejo Superior de Investigaciones Cientificas (CSIC-Spain). He is
currently the president of the Herpetological Association of Peru (AHP), director and curator of
the Herpetological Collection of the Museo de Biodiversidad del Pert (MUBI), and works as a
consultant in environmental studies. Juan has authored or co-authored 56 peer reviewed scientific
papers, notes, book chapters, and books on fauna, especially in herpetology and arachnology, on
topics such as taxonomy, biodiversity, systematics, phylogeny, conservation, and biogeography in
South America. He is interested in those topics, as well as life history, distributional patterns, and
evolution using amphibian and reptiles as biological models.
Amphib. Reptile Conserv.
September 2021 | Volume 15 | Number 2 | e287
Amphib. Reptile Conserv.
New Liolaemus species from Peru
Alvaro J. Aguilar-Kirigin is a Bolivian Biologist, a graduate of the Universidad Mayor de San
Andrés, La Paz, a researcher at the Coleccioén Boliviana de Fauna specializing in herpetology
since 2002, and a member of the Bolivian Network of Researchers in Herpetology. He carried out
two research internships in Argentina and Uruguay, focusing on the systematics and phylogeny of
Liolaemus and the latitudinal patterns in phenotypic plasticity regarding seasonal flexibility in the
fat body size in 59 species of lizards. He has authored over 37 publications, 18 of which are peer-
reviewed, 10 are book chapters, and seven are technical cards as part of book chapters, including
the descriptions of three species of Liolaemus. He 1s interested in integrative taxonomy as a line
of research, especially in the genus Liolaemus because of its phenotypic plasticity in the Andean
region, making incursions with linear models in the studies of comparative classical morphometry.
He is also linked to the conservation of the wildlife fauna that inhabit the Amazonian Forest in the
Department of Beni, Bolivia.
José Cerdejia is a Biologist who graduated from the Universidad Nacional de San Agustin de
Arequipa (Peru), and a researcher at Museo de Historia Natural de la Universidad Nacional de
San Agustin de Arequipa (MUSA) in Peru. José’s research includes systematics, taxonomy, and
biogeography of Lepidoptera, but with a recent interest in the taxonomy and ecology of the genus
Liolaemus in southern Peru.
Wilson Huanca-Mamani is a Biologist from the Universidad de Concepcion (Concepcion, Chile),
with a Doctorate in Plant Biotechnology from Centro de Investigacion y de Estudios Avanzados del
IPN (CINVESTAV), Unidad Irapuato (Mexico). Wilson is currently a researcher at the Universidad
de Tarapaca (Arica, Chile). One of his research interests focuses on the population genetics of desert
plants.
Stefanny Cardenas-Ninasivincha is an Agronomist from the Universidad de Tarapaca, Arica,
Chile. She is currently a Laboratory Manager at the Laboratorio de Biologia Molecular de Plantas
at the Universidad de Tarapaca, and her work focuses on the population genetics of desert plants.
Ana Lazo-Rivera is a Biologist and principal professor of the Zoology Section, Professional School
of Biology, Faculty of Biological Sciences of the Universidad Nacional de San Agustin de Arequipa,
Peru.
Cristian S. Abdala is an Argentinian Biologist, a researcher at CONICET, and a professor at
the National University of Tucuman in Argentina. Cristian received his Ph.D. degree from the
Universidad Nacional de Tucuman (UNT), and is a herpetologist with extensive experience in the
taxonomy, phylogeny, and conservation of Liolaemus lizards. He has authored or co-authored over
70 peer-reviewed papers and books on herpetology, including the descriptions of 56 recognized
lizard species, mainly in the genus Liolaemus. One species, Liolemus abdalai, has been named in
his honor. He has conducted several expeditions throughout Patagonia, the high Andes, Puna, and
salt flats of Argentina, Chile, Bolivia, and Peru. Since 2016, Christian has been the president of the
Argentine Herpetological Association.
192 September 2021 | Volume 15 | Number 2 | e287
Ubalde-Mamani et al.
Appendix I. Specimens examined.
Liolaemus annectens (n = 11): PERU. Arequipa: Caylloma, Callalli: LDVH 073, LECG 001, LECG 006, LECG 036, LECG 042,
LECG 054, LECG 058, LECG 102, LECG 109, LECG 133-34.
Liolaemus angapuka (n = 22): PERU. Arequipa: Arequipa, Uchumayo: MUBI 13521—22, MUSA 4131, 4133-34; Arequipa,
Uchumayo, Quebrada Tinajones, MUSA 1766-67, MUSA 4546, 5207-12, 5214, MUBI 14417, MUBI 14680, LSF 001, LSF 002;
Arequipa, Uchumayo, between Quebrada Tinajones and Quebrada San Jose, MUSA 5573-75.
Liolaemus balagueri (n = 18): PERU. Arequipa: Camana, Quilca, Lomas de Quilca, MUSA 1772-74, MUSA 5575-78, MUBI
13206-09, MUBI 16483-84, MUSM 39193-95: Camana, Camana, Lomas de La Chira, MUSM 39192, MUSA 5579.
Liolaemus chiribaya (n = 11): PERU. Moquegua: Mariscal Nieto, Torata, Jaguay Chico, MUSM 31548-50, MUSM 31553;
Mariscal Nieto, Torata, Cerro los Calatos, MUSM 31547, MUSM 31386, MUSM 31388—91; Mariscal Nieto, between Moquegua
and Torata, MUSM 31387.
Liolaemus etheridgei (n = 17): PERU. Arequipa: Cabrerias, Cayma, MUSA 501; Cerro Uyupampa, Sabandia, MUSA 549-54;
Monte Riberefio de la Quebrada de Tilumpaya Chiguata. Pocsi, MUSA 1113-14, 1116, 1264-68, 1353; Anexo de Yura Viejo, Yura,
MUSA 1229.
Liolaemus evaristoi (n = 16): PERU. Huancavelica: Los Libertadores, Pilpichaca, Huaytara, MUSA 2841 (holotype), 2781-85,
2840, 2842-45, MUBI 10474—78 (paratypes).
Liolaemus insolitus (n = 10): PERU. Arequipa: Lomas de Mejia, Dean Valdivia, MUSA 346, MUSA 1741, MUSA 2187-90; Alto
Inclan, Mollendo MUSA 4787-88, MUSA 4812, MUSA 4815.
Liolaemus nazca (n = 7): PERU. Ica: Nazca, MUSM 31520-21, MUSM 31523, MUSM 31525—26, MUSM 31541, MUSM 16100.
Liolaemus poconchilensis (n = 2): PERU. Tacna: Morro Sama, Las Yaras, MUSA 1638-39.
Liolaemus polystictus (n = 13): PERU. Huancavelica: Mountain near Rumichaca, Pilpichaca, MUSA 1337-1338; Santa Inés,
Castrovirreyna, MUSA 2448-2457; Santa Inés, FML 1683 (paratype).
Liolaemus qalaywa (n = 28): PERU. Apurimac: Choaquere, MUBI 13286 (holotype), MUBI 12100, MUBI 12096-99, MUBI
12101-04; Nahuinlla MUBI 13260, MUBI 1326465; Progreso, MUBI 12981—83; Punchayoc Ccasa, MUBI 17621; Ccosana,
MUBI 17622—23; Pumamarca, MUSA 5600, MUBI 13287; Chila, MUSA 5601, MUBI 12081, MUBI 12084; Ccomerococha,
MUBI 15900, MUBI 15903, MUBI 15901-02 (all paratypes).
Liolaemus robustus (n = 11): PERU. Lima: Surroundings of Huancaya, Reserva Paisajistica Nor Yauyos Cochas, MUSA 1693-—
1702; Junin: Junin, FML 1682 (paratype).
Liolaemus signifer (n = 12): PERU. Puno: Titicaca Lake, 3,840 m, FML 1434; Titicaca Lake, road to Puno, FML 1557; near
Tirapata, MUSA 1415; Huancané, Comunidad Taurahuta, MUSA 1441-43; Huerta Huayara community, 3 km before Puno, MUSA
1483-87.
Liolaemus yarabamba (n = 5): PERU. Arequipa: Yarabamba, MUSA 5570 (holotype), MUSA 501, MUSA 178-79, MUBI 17663.
Liolaemus yauri (n = 10): PERU. Cusco: Vizcachane, 3,878 m, MUSA 5672 (holotype), MUSA 5670-71, MUSA 5673-74; Huano
Huano MUSA 5675-78, MUBI 2500, 15899.
Amphib. Reptile Conserv. 193 September 2021 | Volume 15 | Number 2 | e287
New Liolaemus species from Peru
Appendix II. Morphological characteristics of six species of Liolaemus studied in this work. Range in the first line; mean +
standard deviation (mm) for quantitative characters in the second line. m = males, f = females; see Materials and Methods for
descriptions of morphological characters.
L."Cotahuasi” | ZL. "Inmaculada” | L. melanogaster L. qalaywa L. williamsi fe WAT AY Ss
nov.
n=14 n=15 n=2 n=8 n=5 n=13
wane mar =9
SVL females
Tesaresas | szess | — | marssa1_| oatesa7 | 150129
Se
SVL males
SE a CE
Piss [os Tor fs To
a
Amphib. Reptile Conserv. 194 September 2021 | Volume 15 | Number 2 | e287
Ubalde-Mamani et al.
Appendix II (continued). Morphological characteristics of six species of Liolaemus studied in this work. Range in the first line;
mean + standard deviation (mm) for quantitative characters in the second line. m = males, f = females; see Materials and Methods
for descriptions of morphological characters.
[= [| mo [| « | = | = | =
A
a = ae ee ee [a= ee (c= Cae (=
ao Ge ia
Tis [sm |e | os
SS LT =
a
Lo. S-= == == ===
A20-4
oe ee
A214
a A =
Coss [| a | 7 | #@ | = |
3
M3
Lae | as | 2 Wee (Paes ees
ee i Mee ee
= SS
=
f 2 os ee Ie eee |e
ee ee ee
A SL
Amphib. Reptile Conserv. 195 September 2021 | Volume 15 | Number 2 | e287
New Liolaemus species from Peru
Appendix III. GenBank codes and voucher information of Liolaemus used in this study.
Species name Voucher code cyt-b 12S Source
Ctenoblepharys adspersa (outgroup) BYU 50502 MH981364 MH888040 Aguilar-Puntriano et al. 2018
L. annectens BYU 50491 KX826617 KX826718 Aguilar et al. 2016
L. annectens "Lampa" MUSM 31433 KX826618 KX826719 Aguilar et al. 2016
L. angapuka MUSA 1766 MT773407 MZ098637 Ta eae a
L. anqapuka MUBI 13522 MT773408 MZ098638 Whsdaselacats ota
L. dorbignyi LJAMMCNP 5002 KF968848 KF969032 Olave et al. 2014
L. etheridgei BYU 50493 KX826619 KX826720 Aguilar et al. 2016
L. etheridgei BYU 50494 KX826620 KX826721 Aguilar et al. 2016
L. etheridgei BYU 50495 KX826621 KX826722 Aguilar et al. 2016
L. etheridgei BYU 50499 KX826623 KX826723 Aguilar et al. 2016
L. etheridgei MUSM 31494 KX826625 KX826724 Aguilar et al. 2016
L. eleodori LJAMMCNP 2709 KF968850 KF969034 Olave et al. 2014
L. insolitus MUSM 31490 KX826627 KX826727 Aguilar et al. 2016
L. insolitus BYU 50462 KX826626 KX826726 Aguilar et al. 2016
L. melanogaster BYU 50151 KX826628 KX826728 Aguilar et al. 2016
L. melanogaster MUSM 31472 KX826630 KX826730 Aguilar et al. 2016
L. melanogaster MUSM 31475 KX826631 KX826731 Aguilar et al. 2016
L. melanogaster BYU 50154 KX826629 KX826729 Aguilar et al. 2016
L. nazca BYU 50472 KX826673 KX826768 Aguilar et al. 2016
L. nazca BYU 50507 KX826674 KX826769 Aguilar et al. 2016
L. nazca BYU 50508 KX826675 KX826770 Aguilar et al. 2016
L. nazca MUSM 31523 KX826676 KX826771 Aguilar et al. 2016
L. nazca MUSM 31524 KX826677 KX826772 Aguilar et al. 2016
L. ortizi MUSM 31513 KX826633 KX826733 Aguilar et al. 2016
L. ortizi MUSM 31514 KX826634 KX826734 Aguilar et al. 2016
L. poconchilensis MUSM 31544 KX826636 KX826735 Aguilar et al. 2016
L. poconchilensis MUSM 31545 KX826637 KX826736 Aguilar et al. 2016
L. polystictus MUSM 31451 KX826642 KX826740 Aguilar et al. 2016
L. polystictus MUSM 31446 KX826641 KX826739 Aguilar et al. 2016
L. polystictus “AbraApacheta” MUSM 31481 KX826660 KX826756 Aguilar et al. 2016
L. polystictus “AbraApacheta” BYU 50145 KX826658 KX826754 Aguilar et al. 2016
L. polystictus “AbraApacheta” BYU 50148 KX826659 KX826755 Aguilar et al. 2016
L. polystictus "Castrovirreyna" BYU 50630 KX826638 KX826737 Aguilar et al. 2016
L. qalaywa MUBI 12081 MT366061 MT371370 Chaparro et al. 2020
L. robustus MUSM 31504 KX826646 KX826743 Aguilar et al. 2016
L. robustus MUSM 31508 KX826648 KX826744 Aguilar et al. 2016
L. robustus MUSM 31439 KX826645 KX826742 Aguilar et al. 2016
L. robustus BYU 50438 KX826644 KX826741 Aguilar et al. 2016
L. signifer MUSM 31443 KX826656 KX826752 Aguilar et al. 2016
L. signifer MUSM 31434 KX826654 KX826750 Aguilar et al. 2016
L. signifer BYU 50444 KX826652 KX826748 Aguilar et al. 2016
L. signifer BYU 50357 KX826651 KX826747 Aguilar et al. 2016
L. signifer BYU 50350 KX826649 KX826745 Aguilar et al. 2016
L. signifer MUSM 31437 KX826655 KX826751 Aguilar et al. 2016
Amphib. Reptile Conserv.
196
September 2021 | Volume 15 | Number 2 | e287
Ubalde-Mamani et al.
Appendix III (continued). GenBank codes and voucher information of Liolaemus used in this study.
Species name Voucher code cyt-b 12S Source
L. signifer BYU 50355 KX826650 KX826746 Aguilar et al. 2016
L. signifer MUSM 31447 KX826657 KX826753 Aguilar et al. 2016
L. signifer MUSM 29110 KX826653 KX826749 Aguilar et al. 2016
L. thomasi BYU 50469 KX826680 KX826775 Aguilar et al. 2016
L. thomasi BYU 50466 KX826678 KX826773 Aguilar et al. 2016
L. thomasi MUSM 31516 KX826681 KX826776 Aguilar et al. 2016
L. thomasi BYU 50467 KX826679 KX826774 Aguilar et al. 2016
L. vallecurensis LJIAMMCNP 650 KF968960 KF969166 Olave et al. 2014
L. victormoralesii MUSM 31371 KX826665 KX826757 Aguilar et al. 2016
L. victormoralesii MUSM 31374 KX826667 KX826762 Aguilar et al. 2016
L. victormoralesii MUSM 31373 KX826666 KX826758 Aguilar et al. 2016
L. victormoralesii MUSM 31461 KX826668 KX826763 Aguilar et al. 2016
L. victormoralesii BYU 50430 KX826663 KX826760 Aguilar et al. 2016
L. victormoralesii MUSM 31462 KX826669 KX826764 Aguilar et al. 2016
L. victormoralesii BYU 50431 KX826664 KX826761 Aguilar et al. 2016
L. victormoralesii BYU 50428 KX826662 KX826759 Aguilar et al. 2016
L. victormoralesii MUSM 31464 KX826670 KX826765 Aguilar et al. 2016
L. victormoralesii MUSM 31465 KX826671 KX826766 Aguilar et al. 2016
L. victormoralesii MUSM 31468 KX826672 KX826767 Aguilar et al. 2016
L. warjantay sp. nov. MUBI 17683 MT773399 MZ098641 Fe ae ae tae cal
L. warjantay sp. nov. MUSA 5692 MT773400 MZ098643 eased tneaiie aie
L. warjantay sp. nov. MUSA 5685 MT773401 MZ098642 oo Necnute ion
L. warjantay sp. nov VOI 009 MT773402 MZ098639 Gn ose dean, “ee
L. warjantay sp. nov VOI 006 MT773403 MZ098640 ae chececite etal
L. williamsi BYU 50463 KX826684 KX826778 Aguilar et al. 2016
L. williamsi BYU 50464 KX826685 KX826779 Aguilar et al. 2016
L. williamsi BYU 50144 KX826683 KX826777 Aguilar et al. 2016
L. williamsi MUSM 31486 KX826688 KX826781 Aguilar et al. 2016
L. williamsi BYU 50465 KX826686 KX826780 Aguilar et al. 2016
Amphib. Reptile Conserv. 197 September 2021 | Volume 15 | Number 2 | e287
Official journal website:
amphibian-reptile-conservation.org
Amphibian & Reptile Conservation
15(2) [Taxonomy Section]: 198-209 (e288).
urn:lsid:zoobank.org:pub:879FOECD-DB15-4DC3-9C35-1DA9275EF588
A new striped species of [chthyophis Fitzinger, 1826
(Amphibia: Gymnophiona: Ichthyophiidae) from Mizoram,
northeast India
‘*Hmar Tlawmte Lalremsanga, 7Jayaditya Purkayastha, ‘Lal Biakzuala, ‘Mathipi Vabeiryureilai,
‘Lal Muansanga, and ‘Gospel Zothanmawia Hmar
'Developmental Biology and Herpetology Laboratory, Department of Zoology, Mizoram University, Aizawl 796004, Mizoram, INDIA *Help Earth,
Guwahati 781007, Assam, INDIA
Abstract.—A new species of striped [chthyophis is described from Mizoram State of northeast India. For its
distinguishing features, [chthyophis benjii sp. nov. has narrow (W/S >5) irregular faint lateral yellow stripes
extending immediately from corner of the mouth to the level of the posterior vent, not contacting the disc,
barely or not visible on the collars ventrally, patchy in the trunk region; known to attain lengths greater than
400 mm, 26 < L/W < 30; head V-shaped, short (L/H > 24); TAs (tentacular apertures) more than twice as far from
nares as from eyes (TN/TE > 2); C2 (second collar) noticeably longer than C1 (first collar). It differs from all other
striped congeners, except for /. tricolor and |. multicolor, in having an indistinct pale yellowish lateral stripe
that is bordered by a darker ventrolateral longitudinal stripe immediately above the pale venter on each side.
It differs from /. tricolor and I. multicolor in having more AGs (annular grooves) 388-422 counted dorsally; and
in having 118-124 vertebrae vs. < 120 (/. tricolor) or > 125 (/. multicolor). An analysis of mitochondrial 16s rRNA
shows Ichthyophis benjii sp. nov. to be a sister taxon to /. multicofor with an uncorrected p-distance of 0.055.
At present, due to the lack of data on the population status and range of distribution, we propose the species
be considered as Data Deficient (DD) under the IUCN Red List criteria.
Keywords. 16s rRNA, caecilian, conservation, Data Deficient, [chthyophis benjii sp. nov., Indo-Burma
Citation: Lalremsanga HT, Purkayastha J, Biakzuala L, Vabeiryureilai M, Murasanga L, Hmar GZ. 2021. A new striped species of /chthyophis
Fitzinger, 1826 (Amphibia: Gymnophiona: Ichthyophiidae) from Mizoram, northeast India. Amphibian & Reptile Conservation 15(2) [Taxonomy
Section]: 198-209 (e288).
Copyright: © 2021 Lalremsanga et al. This is an open access article distributed under the terms of the Creative Commons Attribution License
[Attribution 4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction
in any medium, provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced,
are as follows: official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 14 July 2021; Published: 16 October 2021
Introduction
The caecilian genus Ichthyophis Fitzinger, 1826 is
represented globally by 49 currently recognized species,
of which India is home to 15 species (Dinesh 2020;
Lalremsanga et al. 2021) and the eight states of northeast
India are home to nine species. These nine species of
Ichthyophis can be divided into eight striped forms (/
alfredi Mathew and Sen, 2009; 1. daribokensis Mathew
and Sen, 2009; 7. garoensis Pillai and Ravichandran, 1999;
I. khumhzi Kamei, Wilkinson, Gower, and Biyu, 2009; /
moustakius Kamei, Wilkinson, Gower, and Biju, 2009; 7.
nokrekensis Mathew and Sen, 2009; /. sendenyu Kamei,
Wilkinson, Gower, and Byu, 2009; and / multicolor
Wilkinson, Presswell, Sherratt, Papadopoulou, and Gower,
2014) and a single unstriped form (/. sikkimensis Taylor,
1960). Of these nine, six were described in a single year
in 2009 (Mathew and Sen 2009; Kamei et al. 2009). Pillai
and Ravichandran (1999) described /. husaini, an unstriped
form, based on a single specimen from Thebronggiri Coffee
Garden, Rongram, Garo Hills, Meghalaya, which was later
synonymized with the striped form, /. garoensis (Kamei and
Biju, 2016).
Taylor (1962, 1968) divided the genus Ichthyophis
into two groups based on the presence or absence
of a dorsolateral stripe. While subsequent molecular
genetic studies have shown that these groups are non-
monophyletic (Gower et al. 2002), the presence or absence
of a stripe remains an important taxonomic character in
the identification of /chthyophis species. The taxonomy
of Ichthyophis is challenging, as there are many species
but few characters that serve to distinguish them. The
Correspondence. “[email protected] (HTL), [email protected] (LB)
Amphib. Reptile Conserv.
October 2021 | Volume 15 | Number 2 | e288
Lalremsanga et al.
discovery of additional new IJchthyophis species from
South and Southeast Asia is likely because one-fourth
of the currently recognized species of the group have
been described in the last 15 years (Wilkinson et al.
2014). To date, except for J. moustakius and I. multicolor
(Lalremsanga et al. 2021), no published information is
available on the molecular genetic data of northeast Indian
Ichthyophis. Based on morphology and genetic data, here
we describe a new species of striped /chthyophis from
Mizoram, India.
Materials and Methods
Morphology. Measurements were taken with a Mitutoyo
dial vernier caliper (505-671) to the nearest 0.1 mm,
except for total length and circumference, which were
measured to the nearest 1 mm using thread and a ruler.
Annular grooves were counted using ImageJ2 software
(Rueden et al. 2017), then cross-checked manually, and
vertebrae were counted using digital radiography at 56
kVp and 24 mAs (Allengers MARS 30 X-Ray Machine).
Sex was determined by examination of the gonads.
The abbreviations used here follow Kamei et al. (2009,
2013) for several features of the external morphological
characters and ratios of measurements: AGs, number of
annular grooves, counted both dorsally and ventrally;
TGs, transverse grooves on collars; L, total length; W,
maximum width at midbody; S, maximum width of
stripe; T, tail length (distance behind posterior of vent to
tail tip); C1, first collar; C2, second collar; CM, corner
of the mouth; E, eye; N, naris; TA, tentacular aperture;
L/H, total length divided by head length (the latter, ST—
NGI measured directly behind CM); PM, premaxillary-
maxillary teeth; VP, vomero-palatine teeth; OM, outer
mandibular teeth; IM, inner mandibular teeth; L/T, total
length divided by tail length (the latter, distance behind
vent); TP, tentacular papillus; ST, snout tip; NG, nuchal
groove; L/W, total length divided by midbody width;
and W/S, width at midbody divided by maximum width
of stripe at midbody. The comparison was conducted
based on literature (Taylor 1960, 1968; Kamei et al.
2009; Mathew and Sen 2009; Wilkinson et al. 2014:
Kamei and Biju 2016) and museum specimens of
regional congeners deposited in the Departmental
Museum of Zoology Mizoram University (MZMU),
India, and the National Centre for Biological Sciences
(NCBS), India (Appendix 1).
Molecular genetic analysis. Tissue samples were
preserved in absolute alcohol. DNA isolation was carried
out using the Qiagen QIAamp DNA Mini Kit, Fifth
Edition, 2006. Isolated DNA was subjected to 0.8%
agarose gel electrophoresis to check the yield and presence
of isolated DNA. Polymerase Chain Reaction (PCR)
amplification of a fragment of the mitochondrial gene
16s rRNA was carried out using the following primers:
16SF-L02510 = (5’-CGCCTGTTTATCAAAAACAT-3’)
Amphib. Reptile Conserv.
(Palumbi 1996) and 16SR -H03063 (5’-CTCCGGT-
TTGAACTCAGATC-3’) (Rassmann et al. 1997). For
amplification, a total of 0.2 uM of the primer sets, 0.2
mM dNTP mix, and 1—2 ug of template DNA were used
in a 30 ul PCR reaction mixture. The amplification was
carried out using DyNAzyme II DNA polymerase. PCR
was performed in a PCR System-Proflex 3X32 well triple
block (ThermoFisher) as follows: one cycle of 95 °C for
3 min; 35 cycles of 95 °C for 30 sec, 50.5 °C for 30 sec,
72 °C for 2 min; and a final extension of 72 °C for 5 min
and 4 °C for 10 min. The newly generated sequence was
submitted to the NCBI GenBank database (Accession
No. MZ153116), and was included in a dataset with 20
additional ichthyophiid sequences obtained from the NCBI
database. These sequences (maximum of 2,655 base pairs)
were aligned with MEGA 7 using the MUSCLE algorithm
(Edgar 2004) with default parameter settings (Kumar et al.
2016). The GenBank sequence of Uraeotyphlus cf. oxyurus
was used as the out-group. Phylogenetic relationships
were estimated with Maximum Likelihood (ML) in
RaxmlGUIv1.3 (Silvestro and Michalak 2012) using
the selected model (GITR+gamma) based on the lowest
Bayesian Information Criterion score (Nei and Kumar
2000) with 1,000 rapid bootstraps. Uncorrected pairwise
sequence divergence was calculated in MEGA7. Bayesian
inference phylogenetic analysis was also performed with
MrBayes 3.2.5 (Ronquist and Huelsenbeck 2003) using
the model (GTR+I+gamma) selected based on the Akaike
Information Criterion in MrModeltest 2.4 (Nylander
2004). The MCMC (one cold and three hot chains) was
run for 20,000,000 generations by sampling one tree every
1,000 generations. The average standard deviations of split
frequencies became less than 0.01 when the analysis was
terminated. The first 25% of trees were discarded as burn-
in, and the remaining trees were used to assess Bayesian
Posterior Probabilities (BPP) for nodal support.
Systematics
Ichthyophis benjii sp. nov.
Figs. 1-5; Tables 1-3.
urn:lsid:zoobank.org:act:41A96569-4F97-40CD-A47C-54F9A9E70DIC
Holotype: MZMU 1479, an adult male, collected by
Lal Biakzuala on 12 August 2019, from a soil pit of ca.
1.5 m depth for a pillar at a construction site at Durtlang
(23°47°6.58"N, 92°43°31.74”"E; 1,233 m asl), Aizawl
District, Mizoram, India (Fig. 1).
Paratypes (n = 4): MZMU 1462, adult male, collected by
Gospel Zothanmawiia Hmar on 15 July 2019 from a water
drain at Chhinga veng (23°44’4.99"N, 92°43’14.04”E;
991 m asl), Aizawl, Mizoram, India; MZMU 1481, adult
male, collected by Lal Biakzuala on 28 August 2019 from
the roadside at Tanhril (23°44’4.07”N, 92°40734.90”E;
October 2021 | Volume 15 | Number 2 | e288
New species of /chthyophis from India
« ai) S
% Pe eG wh :
Pf <=
7S Pet et" Seek :
Fig. 1. Holotype (MZMU 1479) of Ichthy
821 m asl), Aizawl, Mizoram, India; MZMU 1513, a
road-killed adult female, collected by Lal Biakzuala on
4 September 2019 from Lianchhiari road inside Mizoram
University Campus (23°44712.01”°N, 92°40°3.45”E;
857 m asl), Aizawl, Mizoram, India, MZMU 2025, an
adult female, collected from a soil pit of ca. 2 m depth
by Lalengzuala Tochhawng on 26 October 2020 from
Durtlang Gosen veng (23°47°4.55”N, 92°43’44.08”E;
1,230 m asl), Aizawl, Mizoram, India.
oph
Diagnosis. [chthyophis with narrow (W/S > 5) irregular
faint lateral yellow stripes extending from immediately
behind CMs to the level of the posterior of vent, not
contacting the disc, barely or not visible on the collars
ventrally, patchy in the trunk region; known to attain
lengths greater than 400 mm, 26 < L/W < 30; head more
V-shaped than U-shaped in dorsal view, short (L/H >
24); TAs more than twice as far from nares as from eyes
(TN/TE > 2); without distinctive moustache-like stripes
between snout tip and TAs; and C2 noticeably longer
than C1. Ichthyophis benjii sp. nov. differs from all other
striped congeners in having a markedly less prominent pale
yellowish lateral stripe, bordered by a darker ventrolateral
longitudinal stripe immediately above the pale venter on
each side. It can be differentiated from /. tricolor and I.
multicolor in having much higher AGs of 385-422 and
383-423 counted dorsally and ventrally, respectively.
Description of the holotype. Morphometric and meristic
data are given in Table 1. Mostly good condition;
longitudinal incisions mid-ventrally 50 mm anterior to the
third annulus from the disc and ca. 30 mm approximately
one-fourth along anterior body; small depressed scar (5.5
mm long x 2 mm wide) on the mid-dorsal surface of the
head slightly posterior to eyes; small subvertical split
Amphib. Reptile Conserv.
Te ae oe
ri
is benjii sp. nov. in life from Durtlang. Photo by H.T: Lalremsanga.
ie ae, mg
Need
rs
approximately halfway along left lower lip; patches of
stratum corneum scattered throughout. Total length 414
mm, girth maximal throughout midbody, increasing very
gradually over first 70 mm, decreasing less gradually over
last ca. 40 mm; L/W 29.2, width at mid-body slightly
more than 3% of total length (W/L 0.03). Maximum
width of stripe at midbody is less than 1% of total
length (S/L 0.0068) and 20.9% of the width at midbody
(S/W 0.20). Head and nuchal region dorsoventrally
compressed; ventral surface slightly flattened in the
trunk region. Head somewhat more V- than U-shaped in
dorsal view. In lateral view, distance of CM from top of
head is more than twice the distance from bottom of head
(top of head to CM 5 mm, bottom of head to CM 2.3
mm). Eye slightly closer to the lip than to the top of the
head in lateral view (top of head to eye 1.7 mm; eye to
lip 1.3 mm) surrounded by a narrow whitish ring. Eye
slightly elevated above adjacent skin, larger than naris
(E 0.4 mm; N 0.3 mm) but smaller than TP (0.65 mm).
TAs more than twice as far from nares as from eyes (TA-
E/TA-N 0.47). Naris above the level of AM; equidistant
from top and bottom of head in lateral view. Tongue
V-shaped, strongly plicate posteriorly, margin overlying
only posterior-most IMs. Teeth slender, inwardly curved
with sharp and pointed tips (PMs 37; VPs 37; OMs 35:
IMs 31 including empty sockets). Choanae elongated
along the axis of the head, distance between them four
times each of their greatest widths. Collar region broader
than adjacent head. Laterally, C2 slightly longer than
C1. NGI complete dorsally. Four anteromedially flexed,
evenly spaced TGs on C2 dorsally. Dorsally, AGs are
mostly complete, 401 in number, and those on first one-
third of the body curve anteromedially. The first three
AGs widely incomplete on ventral surface. A total of 397
AGs present ventrally; AGs on first four-fifths of the body
October 2021 | Volume 15 | Number 2 | e288
Lalremsanga et al
Kas
O9PININZN | SOOLNWZW | ZI6NWZN | O16NWZN | Le8INWZN | ssLINWZNW | crINWZW | EIST NWZW | IsPlAWZW | 6Zr1 «AIWzZW | sz0z AWZN [equines
‘popsooal jou eyep “— ‘Ajewour [Iv] ‘y. SUdyoig Mel Jomo’T “# ‘adAJOJOY *,, ‘O19Y Ppouyop JOU suoryeIAdIqqe
WPIOZIP WO SNIyDJsnou ‘J pue izywnyy ‘7 d14yeduAs 10J pue “aou “ds z2/uag s1ydodyjyI] JO SatIas 9dAq UY} JOJ VIEP OISLIOW pue (WIL UT) INOWIOYdIOp *][ Quy
4
JO} 1X9} 99g “BIPUT
October 2021 | Volume 15 | Number 2 | e288
Amphib. Reptile Conserv.
New species of /chthyophis from India
Fig. 2. Preserved holotype (MZMU 1479) of Ichthyophis benjii sp. nov. (A) Dorsal view of full body. (B) Ventral view of full body.
(C) Dorsal view of head. (D) Ventral view of head. (E) Left lateral view of head. (F) Ventral side of tail. Each scale bar indicates
10 mm. Photos by Ro Malsawma.
curved posteromedially, decreasing posteriorly, more or
less orthoplicate by 34 AG anterior to vent; five AGs
interrupted by the disc on both left and right; six more
midventrally complete AGs on tail. Tail short (4.7 mm),
shorter than ST-TA (5.7 mm), tapered and downturned
towards tip. The last few annuli shorter. The terminus
ends in a short (1.3 mm) cap, approximately the length
of the three preceding tail annuli or two body annuli.
Margins of longitudinally slit vent slightly elevated,
formed by ten main denticulations, five on each side,
with some irregular subdivisions. No associated papillae.
Vertebrae 124 in number.
In preservation, dorsum brownish grey, more
chocolate brownish where stratum corneum absent.
Venter much paler brownish grey. A distinct pale spot,
longer than wide (5 x 4 mm), forms a disc around the
vent. Narrow (W/S 5.1), irregular, faint yellowish lateral
stripe on each side; unbroken from slightly above and
in front of CMs to the second-to-last annulus, fading
gradually on first annulus behind the vent; wider and
more prominent behind CMs and C1, but almost broken
on C2, not visible ventrally on collars, not connecting
with or curving towards disc. Immediately below each
lateral stripe, running from C2 to the level anterior to
Amphib. Reptile Conserv.
the vent, a mostly slightly indistinguishable narrower
brown line, a little paler than the dorsal color, with a
gradual but rapid transition to a much paler tan color
that predominates on the venter, but becomes gradually
darker in the posterior region. Narrow, pale lines along
upper lower jaw and lower upper jaw. Tentacular papillus
and ST pale. Eye covered by translucent skin, surrounded
by a narrow whitish ring. In life, dorsum dark brownish
grey, venter reddish grey, narrow irregular faint lateral
stripes dull-yellow. A pale yellowish, thin midventral line
extends from level with the anterior of the CMs across
Cl to NG2. AGs appear mostly paler than adjacent skin
except in the region where crossing faint lateral yellowish
stripes, especially on venter. Tail tip pale.
Variation. Morphometric and meristic data for the type
series are given in Table 1. The specimens generally
resemble the holotype except for features highlighted
here. Specimens MZMU 1462 and MZMU 1513 much
larger, with total lengths of 473 mm and 459 mm,
respectively. MZMU 1462, MZMU 1481, MZMU 1513,
and MZMU 2025 less elongate, with lower values for
L/W (26.1—26.3). MZMU 1481 has the highest dorsal
AG count (422) and also is the only specimen to have
October 2021 | Volume 15 | Number 2 | e288
Lalremsanga et al.
87°30’E 90°0’E
cE x 5
BHUTAN
2 SI F a —
Type locality
Ichthyophis benjii sp. nov.
Ichthyophis moustakius
Ichthyophis sendenyu
Ichthyophis garoensis
Ichthyophis alfredi
Ichthyophis nokrekensis
Ichthyophis khumhzi
Ichthyophis daribokensis
Ichthyophis sikkimensis
2s. _ a esse cam se Mae i<
Fig. 3. Distribution of
more ventral AGs (423) than dorsal AGs. MZMU 1481
and MZMU 1513 lack transverse grooves on C2. MZMU
1513 has many fewer OMs (29), possibly due to damage
on the lower jaw. W/S 5.1—5.4 in specimens less than 450
mm in length; W/S 5.5—5.6 in larger specimens, indicating
that the width of the stripe does not grow as fast as the
width of the body. Similar allometries are apparent in the
relative lengths of the head (L/H) and of the tail (L/T), and
the tail appears to lengthen more slowly than the head.
AGs on the tail curve anteromedially in MZMU 1462 but
are orthoplicate in other specimens. Radiographs show
118 to 124 vertebrae with no correlation with total length.
Distribution and natural history. All the specimens
were collected from a secondary forested area of Aizawl
Municipal Council area, Aizawl District in Mizoram at ca.
821—1,233 m asl during the mid- to late monsoon season
from the months of July to October. All of the specimens
were found on the surface. Three of the paratypes were
encountered and collected at night from the roadside, while
the holotype and one paratype (MZMU 2025) were likely
trapped during nighttime in the pit fora pillar basement in the
heart of the residential area at the Durtlang locality. During
Amphib. Reptile Conserv.
P aj “ — Saas ac Pik
type localities of the Indo-Burman Jchthyophis species, including /. benjii sp. nov.
92°30’E
Meghalaya
Elevation
(metre)
| 0-449
450-899
900-1349 |
1350-1799
1800-2249
2250-2699 |
2700-3149.
3150-3599
3600-4049
} 4 \) a AS py,
ae rh \ + Bi scsi) ‘
ae hy fi 4050-4499
+S ¥ ee | | >4500
N,0€0€2
this period, surface activity appears to be nocturnal. This
Species is more rarely encountered than other sympatric
Ichthyophis species; a thorough day-and-night survey
of the herpetofauna in this area conducted from 2015 to
date has yielded only the five individuals described here.
A small freshwater shrimp was recovered from inside the
mouth of MZMU 1462, indicating that prey 1tems include
freshwater macroarthropods. Other amphibians found
in the same macrohabitat during the collection period
include the caecilians [chthyophis khumhzi, I. moustakius,
and the recently confirmed / multicolor (Lalremsanga
et al. 2021), and frogs Duttaphrynus melanostictus,
Fejervarya multistriata, Minnervarya asmati, Megophrys
serchhipii, Polypedates teraiensis, Zhangixalus suffry, and
Zhangixalus smaragdinus.
Etymology. The species epithet “benjii” is dedicated
in memory of Benjamin Lalremsanga (1988-2020,
nephew of Hmar Tlawmte Lalremsanga) who used
to actively assist the author(s) in their herpetofaunal
surveys.
Suggested English common name: Benji’s Caecilian
October 2021 | Volume 15 | Number 2 | e288
New species of /chthyophis from India
Comparison. The comparison is based onthe examination
of specimens, papers with original descriptions, and
review articles (Taylor 1960, 1965, 1968, 1973; Pillai
1986; Pillai and Ravichandran 1999; Wilkinson et al.
2007; Kamei et al. 2009; Mathew and Sen 2009; Bhatta
et al. 2011; Nishikawa et al. 2013; Wilkinson et al. 2014;
Kamei and Biju 2016). /chthyophis benji sp. nov. differs
from all the other known congeners by the following
criteria. Ichthyophis benji sp. nov. has a_ distinct
dorsolateral stripe which is absent in /. acuminatus,
I. billitonensis, I. cardamomensis, I. catlocensis, I.
chaloensis, I. dulitensis, I. glandulosus, I. javanicus,
I. lakimi, I. laosensis, I. larutensis, I. monochrous,
I. orthoplicatus, I. sikkimenis, I. singaporensis, I.
sumatranus, I. weberi, and I. youngorum, and by having
a higher number of annular groves (385-422) vs. less
than 380 annular groves in I. asplenius (247-270), I.
atricollaris (275-310), I. beddomei (240), . biangularis
(330-333), [. davidi (321-336), I. elongates (274-290),
I. hypocyaneus (314-316), I. kodaguensis (276-305),
I. longicephalus (348), I. mindanaoensis (287-326),
I. nguyenorum (212-218), I. paucisulcus (259), I.
paulil (335), I. pseudangularis (269-271), I. supachaii
(322), and I. tricolor (245-284). Ichthyophis benji sp.
nov. has a higher number of vertebrae (118-121) than
I. humphreyi (112) and I. mindanaoensis (110-116).
Ichthyophis benji sp. nov. has L/W 26-30 vs. L/W 19-
21 in LZ. glutinosus. In life, 1. benji sp. nov. has a dark
brownish grey dorsum and a pale reddish venter vs.
both dorsum and venter black in color in L. nigroflavus.
Splenial teeth are present in /. benji sp. nov. vs. being
absent in . paucidentulus. In addition to these, no single
character serves to distinguish / benjii sp. nov. from
all other Jchthyophis, but combinations of diagnostic
characters serve to distinguish it from any other species.
In particular, with the exception of 1. khumhzi and I.
longicephalus, all other south Asian striped Ichthyophis
(I. beddomei, I. garoensis, I. glutinosus, I. kodaguensis,
I. pseudangularis, and I. tricolor) differ from 1. benjii
sp. nov. in having TAs less than twice as far from nares
as from eyes (TN/TE < 2). All southeast Asian striped
Ichthyophis (I. attricolaris, I. biangularis, I. bannanicus,
I. bernisi, I. elongatus, I. humphreyi, I. hypocyaneus, I.
kohtaoensis, I. paucisulcus, and I. supachaii) differ from
I. benjii sp. nov. in having markedly fewer IMs than
dentary teeth. Ichthyophis longicephalus differs from J.
benjii sp. nov. in head shape and size (L/H < 18 vs. > 25,
respectively), and in having subequal collars and a stripe
that extends onto the tail.
Ichthyophis benjii sp. nov. differs from all the
species of northeast India and adjacent Myanmar by the
combination of the following characteristics. Ichthyophis
benjii sp. nov. has a much higher dorsal AG count (388-
422) than other species in the Indo-Burma region: L. alfredi
(269-299), I. bannanicus (328-381), I. daribokensis
(264-310), Z garoensis (264-309), I. khumhzi (341-
362), [. kohtaoensis (362-366), I. moustakius (238-268),
\O
\O
al
N
\O
loa)
sy
afl less =
~ ie
cof 1] | ae
O};l+]o
ale] a N
+|o
Nl a | +
No) Solo
lg [as
Ne) olan
cn 6 | oo
ron ala
co lolol oc
ole] sls
sia [a
ololata
an | + | Oo | oo
AlLatl ala
+t
a 2
=| s/s] s
els | ise| =
SS] os] xX] s
A = Sy) Dd
=/S/s|s
= Ss| 2
g) 8/8] 2
~S aa NS
Number of
specimens
I. bannanicus
I. daribokensis
I. garoensis
I. khumhzi
I. kohtaoensis
Table 2. Comparative data for the type series of striped Ichthyophis species of the Indo-Burma region.
Amphib. Reptile Conserv. 204 October 2021 | Volume 15 | Number 2 | e288
Lalremsanga et al.
Fig. 4. Paratypes of [chthyophis benjii sp. nov. in life: (A) MZMU 1462 from Chhinga Veng, (B) MZMU 1481 from Tanhril, (C)
MZMU 2025 from Gosen, and (D) /. multicolor MZMU 1740 from Tuirini Bridge, Aizawl District. Photos by H.T: Lalremsanga.
I. multicolor (346-386), I. nokrekensis (269-300), I.
sendenyu (283-308), and I. sikkimenis (276-292). For the
W/S ratio, Ichthyophis benjii sp. nov. (5.1—5.6) differs
from 1. daribokensis (2.8-4.2), I. moustakius (2.68-4.0)
and I. sendenyu (3.26-4.0). Ichthyophis benjii sp. nov.
differs from /. alfredi in a smaller L/H ratio (28.62-45.05
vs. 25.1—28.9 in Ichthyophis benjii sp. nov.) and from I.
sikkimensis by the presence of lateral stripes (vs. unstriped
in J. sikkimensis). Furthermore, [. benjii sp. nov. differs
from I. khumhzi (50-56), I. kohtaoensis (22-23), and I.
garoensis (40-52) in having fewer PMs (38-39); from
I. garoensis (39-48), I. khumhzi (47-58), I. kohtaoensis
(22-23), I. moustakius (40-43), and I. sikkimenis (41-
44) in number of VP (31-37); from 1. khumhzi (42-49)
and I. kohtaoensis (20-21) in number of OMs (29-37),
from /. alfredi (40), I. daribokensis (36), I. garoensis
(38-51), [. khumhzi (40-46), I. kohtaoensis (17-18),
and J. sikkimenis (43-45) in number of IMs (29-35).
Ichthyophis benjii sp. nov. differs from /. multicolor in
having < 125 vertebrae (118-124) vs. > 125 (126-132);
< 120 in I. tricolor. Among many other differences,
Ichthyophis benjii sp. nov. can be easily distinguished
from its sympatric species 1. garoensis, I. moustakius
and I. sendenyu by the absence of distinctive moustache-
like stripes extending forward from the TAs, and from /.
multicolor in having a markedly less prominent, thin, and
irregular pale yellowish lateral stripe (see Fig. 4).
Amphib. Reptile Conserv.
Molecular systematics. Both the 16s ML and
BI phylogenies are congruent in the position of
Ichthyophis benjii sp. nov., which is recovered as a
moderately supported (65% bootstrap; BPP=0.79)
sister taxon to a strongly-supported lineage (100%
bootstrap; BPP=1.0) of J multicolor (Fig. 5).
Genetically, Jchthyophis benjii sp. nov. is distinct from
I. multicolor with an uncorrected p-distance of 0.055.
Uncorrected p-distances to other sampled /chthyophis
are 0.059-0.085 (Table 3).
Discussion
The 13 nominal species of caecilians (excluding the
species newly described here) of northeast India, most
of which were described this century (Mathew and Sen
2009; Kamei et al. 2009; Kamei et al. 2013), are currently
represented by two families (Chikilidae: 4 species and
Ichthyophiidae: 9 species) (Kamei et al. 2016). None of
these species is sufficiently known regarding conservation
status, with six being Data Deficient (DD) and the rest
yet to be evaluated on the IUCN Red List. Similar to
the majority of caecilian species globally (Gower and
Wilkinson 2005), we suggest that Ichthyophis benjii
sp. nov. should currently be considered DD, given
that we know very little about its extent of distribution
and population status or its ecological preferences and
October 2021 | Volume 15 | Number 2 | e288
New species of /chthyophis from India
99
68
83]
94
75
59
76
36
65
AB686161 Ichthyophis cf. asplenia
AB686123 /chthyophis cf. nigroflava
AB686120 Ichthyophis cf. mindanaoensis
100 AB686145 Ichthyophis biangularis
AB686153 Ichthyophis sp. Sarawak
AB686159 Ichthyophis sp. Sabah
AY458594 Ichthyophis bannanicus
AB686107 /Ichthyophis cf. kohtaoensis Thailand
“ AB686168 Ichthyophis cf. supachaii
AB686166 /chthyophis cf. hypocyaneus
AB686146 Ichthyophis cf. kohtaoensis Malaysia
16 ichthyophis benjii sp. nov. (™
FR716010 /chthyophis multicolor
FR716011 /chthyophis multicolor
100
FR716013 Ichthyophis multicolor
FR716012 Ichthyophis multicolor
AY101230 Ichthyophis cf. beddomei
68
AY101228 Ichthyophis cf. tricolor
100
AY101233 Ichthyophis orthoplicatus
AY456251 Ichthyophis glutinosus
AY456254 Uraeotyphlus cf. oxyurus
0.04
Fig. 5. Maximum Likelihood phylogram of 16s rRNA. Numbers at internal branches are bootstrap support. Epicrionops marmoratus
and Rhinatrema bivittatum were used as the out-group. The taxon name in bold denotes the sample newly sequenced in this study.
Numbers preceding taxon names are GenBank accession numbers.
tolerances. Due to the prolonged monsoon season (March
to October) with heavy rainfall, especially in the State
of Mizoram, many Ichthyophis are killed in paddy
fields, agricultural areas, and near human settlements
by farmers and local people, who think they are snakes.
However, all the specimens of the new species described
here were found in areas of anthropogenic disturbance
within ca. 60 km? of the Aizawl city municipal area.
Therefore, we are hopeful that 7. benjii will not qualify
as Endangered if additional populations can be found in
a wider area.
The northeast Indian caecilian fauna is poorly known
(Kamei 2017). Working with the group here can be
difficult, given their fossorial lifestyle, the often harsh
terrains, and the challenging infrastructure. The present
report of a new Ichthyophis caecilian from northeast
India is perhaps unsurprising because this region’s
biodiversity 1s poorly explored and documented despite
its highly distinct and biogeographical importance
(Kamei et al. 2012, 2017; Mani 1995; Bossuyt et al.
2004). Dedicated fieldwork, together with more stable
systematics, will help to advance our knowledge and
Amphib. Reptile Conserv.
206
allow us to formulate more precise conservation
assessments.
Acknowledgements.—We thank the Chief Wildlife
Warden of the Environment, Forest, and Climate Change
Department, Government of Mizoram, India, for issuing
collection permit No. A. 33011/2/99-CWLW/225. We
also express our sincere thanks to the NER-BPMC (North
Eastern Region-Biotechnology Programme Management
Cell), Department of Biotechnology (DBT), Government
of India, New Delhi (DBT-NER/AAB/64/2017),;
Defence Research and Development Organization
(DRDO), New Delhi (DGTM/DFTM/GIA/19-20/0422),
and the National Mission for Himalayan Studies
(NMHS), Uttarakhand (GBPNI/NMHS-2017/MG-22)
for providing financial assistance. We are very grateful
to the reviewers, especially David Gower, for providing
useful constructive suggestions and comments for the
manuscript. We appreciate the fieldwork assistance
provided by Lalrinsanga, Lalengzuala Tochhawng,
Michael Vanlalchhuana, Dadina Zote, H. Laltlanchhuaha
and Zothangliana.
October 2021 | Volume 15 | Number 2 | e288
Lalremsanga et al.
1810 S910 810 e810 C610 (om) Sol 0 8ST 0 P81 0 810 981°0 6L10 OL 0 vsl0 9810 S810 SOLO SOLO S910 S910 I9T 0 snanaxo “¥9 snjydtjoapsy) pSTISPAV (6
5600 6L0°0 7600 7800 1800 8800 660.0 160°0 880°0 160°0 680°0 COLO 840.0 1600 8800 7800 780°0 780°0 7800 $800 yeqes ‘ds siydodysyoy 65 1989AV I@
9L0°0 €60°0 +80°0 800 vs00 LLO0.0 +800 6L0°0 780°0 6L0°0 180°0 €L0'0 7800 bL00 8400 8400 8L0°0 8200 0800 Aojordy ‘Jo stydodysyr] 8TTIOLAV 07
coro = «1800 —s« 1800 = 8400-98010 «66010 «96010 -—«O9H'0—— «6010s POLO OKO'0—s«*9HD'—«sT9.0—s 7800s T8N'0—«s 7800 = TBO ~—« 0800 papyossin ‘$9 siydodysyrq €71989AV 61
solo = SOlI'0.——«d60'0—— «$60.00 L010 «ITO 8010—s—sdTT0— 66D'0-——« EOD = OTD: 98010-9800 «9800S -«980'0—S 0800 snaupdsoddy "49 siydodyiy2] 991989AV 8
000'0 800 €Ol0 9010 IOl0 IOL0 660°0 VITO 82400 0) 0) 060°0 9L0°0 9L0°0 9L0°0 9L0'0 9L0 0 yemeleg ds siydodysyoy €51989dV LI
7300 = 010 901'0——s«*OOT'0-—s*dOT-0—sB6O'|D CEN. 8400S ZOI'0-Ss 06N10—s—«#9LN.0—s«#9LD.-—s«9LO'D——s« LOD“ 9LO'N siupjnsunig siydodyiy2] Sp1939aV OT
$400 8800 1400 7300 1200 £200 £900 9800 +200 0800 0800 0800 0800 9200 lawuoppag ‘$9 siydodysyoy O€TIOLAV ST
0600 = £8000 «9800 LLOO-— LENO ~— 0800S «18009800 «06010 s—«O610—«O6'0——s«60'0——s PLO snqpoidoysio siydoaysyo] €€T1O1AV PT
: ;' BISALTRIAL
SL0 0 0c0.0 800 9010 860.0 ce00 00 0) 8800 8800 8800 8800 1L00 sisuaon]yoy °49 s1ydodysyoq or L989 €1
cLO'0 £800 6010 560 0 cL0.0 0010 790°0 790°0 790°0 790'0 1L00 snoiupuung siydodysyz] p6S8Sp AV cl
680'0 SOl0 £60°0 ve00 0010 080°0 080°0 080°0 080'0 £900 mmoyondns "Jo siydodysy2q 891 9898V I
SOTO 8800 7800 COTO ¢LO'0 ¢L0'0 SL0'0 SL00 £900 sisuajniny siydodysyr] 9S 1989AV or
€Ol'0 LOT 0 601°0 6L0°0 6400 6400 6L0'0 $900 snsounns siydoaysyr] |STISPAV 6
€60°0 090°0 £90°0 £900 £900 L90°0 €90°0 sisuaopuppullu ‘49 siydodysyo] OT1989EV 8
pueyrey
SOTO 880°0 880°0 880°0 8800 €90°0 sisuaow1yoy ‘49 siydodysy2t LOL989aV L
6900 6900 6900 6900 6sS00 piuajdsp ‘39 siydodyiy27] 191989aV 9
000°0 000°0 000°0 $s00 sojooyjnul siydodyjyo] € {O91 LUA S
0000 00010 +~=—-sso’0 4ojooujnut siydodysysy TOOT LUA p
0000 ~—- $00 sojooujnu siydodysyzy TOOT LAA €
ss0'0 4ojoonjnu siydodysyoy QLO9TLYA 4
‘aou “ds sifuag srydodysyoq 9TTESTZIN I
IZ 07 6l 8 LI 91 ST rl €I zI I or 6 8 L 9 S p € Z I sateds pu Jaquinu UolssazIN yuRguay
‘sisAyeue otOUasO]AUd oY} UT popnyoul soyduies siydodyjyoy SUOWL WNYI SO [CLIPUOYSO}WI JOJ SddULISIP-d po}DoLIONUYL) *¢ JIQUL
October 2021 | Volume 15 | Number 2 | e288
207
Amphib. Reptile Conserv.
New species of /chthyophis from India
Literature Cited
Bossuyt F, Gower DJ, Pethiyagoda R, Roelants K,
Mannaert A, Wilkinson M, Bahir MM, Manamendra-
Arachchi K, Ng PKL, et al. 2004. Local endemism
within the Western Ghats-Sri Lanka biodiversity
hotspot. Science 306: 479-481.
Dinesh KP, Radhakrishnan C, Channakeshavamurthy
BH, Deepak P, Kulkarni NU. 2020. A checklist of
amphibians of India with IUCN conservation status.
Version 3.0, updated through April 2020. Available:
http://zsi.gov.in./WriteReadData/userfiles/file/
Checklist/Amphibians_ 2020.pdf [Accessed: 11 July
2021].
Edgar RC. 2004. MUSCLE: multiple sequence alignment
with high accuracy and high throughput. Nucleic
Acids Research 32: 1,792-1,797.
Frost DR. 2021. Amphibian Species of the World:
an Online Reference. Version 6.1. Available:
https://amphibiansoftheworld.amnh.org/index. php
[Accessed: 9 July 2021].
Gower DJ, Wilkinson M. 2005. Conservation biology
of caecilian amphibians. Conservation Biology 19:
45-55.
Kamei RG. 2017. An overview of caecilians (Amphibia:
Gymnophiona) of North East India. Pp. 49-72 In:
Diversity and Ecology of Amphibians of India. ENVIS
Bulletin: Wildlife and Protected Areas, Volume 19.
Wildlife Institute of India, Dehradun, India. 319 p.
Kamei RG, Biyu SD. 2016. On the taxonomic status of
Ichthyophis husaini Pillai and Ravichandran, 1999
(Amphibia: Gymnophiona: Ichthyophiidae). Zootaxa
4079(1): 140-150.
Kamei RG, Gower DJ, Wilkinson M, Biyu SD. 2013.
Systematics of the caecilian family Chikilidae
(Amphibia: Gymnophiona), with description of three
new species of Chikila from northeast India. Zootaxa
3666(4): 401-435.
Kamei RG, Mauro DS, Gower DJ, Van Bocxlaer I,
Sherratt E, Thomas A, Babu S, Bossuyt F, Wilkinson
M, Byu SD. 2012. Discovery of a new family of
amphibians from northeast India with ancient links to
Africa. Proceedings of the Royal Society B: Biological
Sciences 279: 2,396—2,401.
Kamei RG, Wilkinson M, Gower DJ, Biju SD. 2009.
Three new species of striped /chthyophis (Amphibia:
Gymnophiona: Ichthyophiidae) from the northeast
Indian states of Manipur and Nagaland. Zootaxa
2267: 26-42.
Kumar S, Stecher G, Tamura K. 2016. MEGA7:
Molecular Evolutionary Genetics Analysis Version 7.0
for bigger datasets. Molecular Biology and Evolution
33: 1,870—1,874.
Lalremsanga HT, Purkayastha J, Vabeiryureilai M,
Muansanga L, Decemson H, Biakzuala L. 2021.
Range extension of [chthyophis multicolor Wilkinson
et al., 2014 to India and first molecular identification
Amphib. Reptile Conserv.
of Ichthyophis moustakius Kamei et al., 2009. Check
List 17: 1,021-—1,029.
Mani MS. 1995. Biogeography in India.
Publications, Uttaranchal, India. 130 p.
Mathew R, Sen N. 2009. Studies on caecilians
(Amphibia: Gymnophiona: Ichthyophiidae) of North
East India with description of three new species
of Ichthyophis from Garo Hills, Meghalaya and
additional information on /chthyophis garoensis Pillai
and Ravichandran, 1999. Records of the Zoological
Survey of India, Occasional Papers 309: 1-56.
Nei M, Kumar S. 2000. Molecular Evolution and
Phylogenetics. Oxford University Press, New York,
New York, USA. 333 p.
Palumbi SR. 1996. Nucleic acids II: the polymerase chain
reaction. Pp. 205-247 In: Molecular Systematics.
Editors, Hillis DM, Moritz C, Mable BK. Sinauer
Associates, Sunderland, Massachusetts, USA. 636 p.
Nylander J. 2004. Mr.Modeltest v2, program distributed
by the author. Evolutionary Biology Centre, Uppsala
University, Uppsala, Sweden. Available: https://
github.com/nylander/MrModeltest2 [Accessed: 11
July 2021].
Pillat RS. 1986. Amphibian fauna of Silent Valley,
Kerala, S. India. Records of the Zoological Survey of
India 84: 220-242.
Pillai RS, Ravichandran MS. 1999. Gymnophiona
(Amphibia) of India. A taxonomic study. Records of
the Zoological Survey of India. Occasional Papers
172: i-vi+ 1-117.
Rassmann K, Tautz D, Trillmich F, Gliddon C. 1997,
The microevolution of the Galapagos Marine Iguana,
Amblyrhynchus cristatus, assessed by nuclear and
mitochondrial genetic analyses. Molecular Ecology 6:
437-452.
Ronquist F, Huelsenbeck JP. 2003. MrBayes 3: Bayesian
phylogenetic inference under mixed models.
Bioinformatics 19: 1,572—1,574.
Rueden CT, Schindelin J, Hiner MC, DeZonia BE,
Walter AE, Arena ET, Eliceiri KW. 2017. ImageJ2:
ImageJ for the next generation of scientific image
data. BMC Bioinformatics 18: 529.
Silvestro D, Michalak I. 2012. RaxmlGUI: a graphical
front-end for RAxML. Organisms, Diversity, and
Evolution 12: 335-337.
Taylor EH. 1960. On the caecilian species chthyophis
monochrous and Ichthyophis glutinosus and related
species. University of Kansas Science Bulletin 40:
37-120.
Taylor EH. 1965. New Asiatic and African caecilians
with redescriptions of certain other species. University
of Kansas Science Bulletin 46: 253-302.
Taylor EH. 1968. Caecilians of the World: A Taxonomic
Review. University of Kansas Press, Lawrence,
Kansas, USA. xiv + 848 p.
Taylor EH. 1973. A caecilian miscellany. University of
Kansas Science Bulletin 50: 187-231.
Surya
October 2021 | Volume 15 | Number 2 | e288
Lalremsanga et al.
Wilkinson M, Gower DJ, Govindappa V, Venkatachalaiah Wilkinson M, Presswell B, Sherratt E, Papadopoulou
G. 2007. A new species of Ichthyophis (Amphibia: A, Gower DJ. 2014. A new species of striped
Gymnophiona: Ichthyophiidae) from Karnataka, Ichthyophis Fitzinger, 1826 (Amphibia: Gymnophiona:
India. Herpetologica 63: 511-518. Ichthyophiidae) from Myanmar. Zootaxa 3785: 4558.
Hmar Tlawmte Lalremsanga is a Professor and Head of the Department of Zoology, Mizoram University
(Aizawl, Mizoram, India). He is a pioneer in the field of herpetology in Mizoram. Currently, he is teaching
post-graduate students, guiding research scholars, and overseeing major projects funded by the Department
of Science and Technology - Science and Engineering Research Board (DST-SERB) and Department of
Biotechnology (DBT) under the Ministry of Science and Technology, the Defence Research and Development
Organisation (DRDO) under the Ministry of Defence, and the National Mission for Himalayan Studies
(NMHS), Government of India.
Jayaditya Purkayastha is a northeastern Indian taxonomist and conservation biologist, who completed his
Ph.D. on the “Systematic study of the snake of genus Xenochrophis (Serpentes: Colubridae) of North East
India” in 2018 at Guwahati University (Guwahati, Assam, India). He has described several new species,
including a snake, frogs and a gecko, and has authored six field guide books to the amphibians, reptiles, and
birds of Assam. At present, he is General Secretary of Help Earth, a society for the promotion of the science
and conservation of biodiversity in Guwahati.
Lal Biakzuala completed his M.Phil. degree in the Department of Zoology, Mizoram University, with a
thesis on the systematics and natural history of kraits in Mizoram, northeast India. He is continuing as a Ph.D.
student in the Department of Zoology, Mizoram University, under the supervision of H.T. Lalremsanga, and is
working as a Junior Research Fellow (JRF) on a research project funded by the Department of Biotechnology
(DBT), New Delhi.
Mathipi Vabeiryureilai is a Post-doctoral degree holder in the Department of Zoology, Mizoram University
(MZU), Mizoram, India. He is presently engaged as a Research Associate (RA) in a project entitled: Mizoram
biodiversity documentation and establishment of Natural History Museum of Mizoram (amphibian section),
funded by Department of Biotechnology (DBT), New Delhi.
Lal Muansanga recently completed his M.Sc. degree in the Department of Zoology, Mizoram University,
and joined as a Junior Research Fellow (JRF), DRDO, and Ph.D. student under the supervision of H.T.
Lalremsanga at Mizoram University. He is a herpetologist who has contributed an immense amount of work
in the field of herpetology in Mizoram. At present, he is engaged in an anuran morphology and inventory
survey in different parts of Mizoram.
Gospel Zothanmawia Hmar is a Research Fellow under the supervision of H.T. Lalremsanga in Mizoram
University, who is currently working as a Junior Research Fellow on a research project in the Department
of Environmental Science, Pachhunga University College, Mizoram under DST-EMEQ-SERB, Government
of India, New Delhi. His present research involves in-situ and ex-situ conservation, inventorying, molecular
characterization, distribution, and ecological niche modelling of chelonians in Mizoram.
Appendix 1. List of comparative materials examined.
Ichthyophis khumhzi. (NDIA: MZMU 910 Mizoram University campus, Mizoram; MZMU 912 College Veng, Mizoram; MZMU 1005 Maubawk,
Mizoram; MZMU 1460 Aibawk, Mizoram; MZMU 1564 Tutvamit, Mizoram; MZMU 1739 Melthum, Mizoram; MZMU 1740 Mission Vengthlang,
Mizoram; MZMU 1796 Tanhril, Mizoram; MZMU A104, Republic veng, Mizoram; NCBS 5385 Siaha, Mizoram.
Ichthyophis cf. sendenyu. INDIA: MZMU 899 Tanhril, Mizoram; MZMU 918 Chawlhhmun, Mizoram; MZMU 921 Ramrikawn, Mizoram;
MZMU 925, Tuivamit, Mizoram.
Ichthyophis moustakius. (NDIA: MZMU 909 Kulikawn, Mizoram; MZMU 919 Chhangurkawn, Mizoram; MZMU 1758 Dampa Tiger Reserve,
Mizoram; MZMU 1761 Mizoram University (MZU) campus, Mizoram; MZMU 1847 Thakthing, Mizoram; MZMU 1863 Sihphir, Mizoram; NCBS
5389 Chhingchhip, Mizoram; NCBS 5401 Sawleng, Mizoram.
Ichthyophis cf. garoensis. (NDIA: MZMU 1506 Mizoram.
Ichthyophis multicolor: (NDIA: MZMU 911 Kolasib, Mizoram; MZMU 913 Mualpui, Mizoram; MZMU 1480 College Veng, Mizoram; MZMU
1504 Tamdil National Wetland, Mizoram; MZMU 1541 Tlangnuam, Mizoram; MZMU 1956 Tuirini, Mizoram; MZMU 1965 Zemabawk, Mizoram;
MZMU 2003 Mission Veng, Mizoram; MZMU 2005 Mizoram University campus, Mizoram; MZMU 2007 Tlangnuam, Mizoram; MZMU 2112
Mizoram University campus, Mizoram.
Amphib. Reptile Conserv. 209 October 2021 | Volume 15 | Number 2 | e288
Official journal website:
amphibian-reptile-conservation.org
Amphibian & Reptile Conservation
15(2) [General Section]: 210-227 (e289).
Human perceptions toward herpetofauna in northwestern
Bangladesh
"Md. Fazle Rabbe, 'M. Firoj Jaman, ‘Md. Mahabub Alam, ‘Md. Mokhlesur Rahman, ‘M.A. Razzaque
Sarker, and 7Ahsan Rahman Jamee
'Department of Zoology, University of Dhaka, Dhaka 1000, Dhaka, BANGLADESH ?Department of Statistics, University of Dhaka, Dhaka 1000,
Dhaka, BANGLADESH
Abstract.—People from different socioeconomic status show different attitudes toward herpetofauna. A
study was conducted to investigate local people’s perceptions and attitudes toward herpetofauna in four
northwestern districts of Bangladesh. Data were collected through a structured questionnaire survey among
236 randomly selected people. Animals were divided into four groups (frogs and toads, snakes, lizards, monitor
lizards) and perceptions about these animals were classified into six categories. “Killing herpetofauna as a
credit” was considered as a dependent variable for performing the regression models. Among the four groups,
people possessed maximum misconceptions about snakes in all six categories. Among the interviewees, 45%
respondents were positive in killing snakes, which was the highest among the four groups. Bivariate analysis
showed socioeconomic status (occupation) and other perceptions as poisonous, habitat sharing, and believing
preconceptions were significantly related with the dependent variable. From logistic regression models we
found that frog killing was influenced by landholding status of people and believing preconceptions about
frogs. Killing of reptiles is associated with educational status and perceptions, such as thinking they are all
poisonous, habitat sharing, and believing preconceptions. Socioeconomic status and superstitions had greater
negative impact on reptiles than amphibians hence, more misbelieved by people. Coexistence of humans and
wild animals through expanding and disseminating the correct knowledge about them, more sustainable use
of habitats, and greater effort in scientific communities to remedy these deficiencies are needed to conserve
these important groups of wild animals.
Keywords. Frog, killing herpetofauna, lizard, local community, monitor lizard, preconceptions, regression model,
snake, toad
Citation: Rabbe MF, Jaman MF, Alam MM, Rahman MM, Sarker MAR, Jamee AR. 2021. Human perceptions toward herpetofauna in northwestern
Bangladesh. Amphibian & Reptile Conservation 15(2) [General Section]: 210-227 (e289).
Copyright: © 2021 Rabbe et al. This is an open access article distributed under the terms of the Creative Commons Attribution License [Attribution
4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction in any
medium, provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced, are
as follows: official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 15 September 2020; Published: 15 November 2021
Introduction of past and present interactions with humans and
herpetofauna as ethnoherpetology, a subdivision of
The interactions of humans and herpetofauna have a
long history (Alves et al. 2013). People from various
socioeconomic conditions and cultures possess different
outlooks (Manstead 2018), which causes disparity in the
human perceptions toward animals. With the growth of
the human population over time, human activities such
as agricultural expansion, industrialization, urbanization,
infrastructural development, animal husbandry, hunting,
logging, forest cleaning, and other activities have been
expanding and impacting wildlife (TUCN Bangladesh
2015; Khatun et al. 2012; Lee et al. 1998). As a result,
interactions between humans and herpetofauna have
increased. Alves and Souto (2011) termed this variety
ethnozoology. Ethnozoological research is not commonly
conducted worldwide, one exception is Brazil, otherwise
ethnoherpetological studies are typically rare (Alves and
Souto 2011).
Humans often possess more positive perceptions
toward fish, birds, and mammals than they do toward
reptiles, amphibians, and invertebrates (Czech and
Krausman 2001). Reptiles and amphibians are often
feared and killed due to their unaesthetic appearance
(Bkerke et al. 2001), social and ethnic reasons (Bkerke
et al. 2001; Kellert 1996), and sensitive reactions like
animal phobias (Knight 2008). Although they tend to
be harmless and are not responsible for major economic
Correspondence. “‘fazlerabbedu(@gmail. com (MER), [email protected] (MFJ), [email protected] (MMA), [email protected].
bd (MMR), [email protected] (MARS), [email protected] (ARJ)
Amphib. Reptile Conserv.
November 2021 | Volume 15 | Number 2 | e289
Rabbe et al.
losses (Ferrand et al. 2001; Pough et al. 1998), tales,
folklore, misperceptions, and negative attitudes can
motivate society to kill reptiles and amphibians, and thus
conservation efforts can be disrupted (Ceriaco 2012).
The misconceptions or preconceptions toward animals
persist among local groups, which are often related to
their social status and culture.
Being situated at the confluence of the Indo-China and
Indian sub-regions, Bangladesh has a rich biological and
cultural heritage (Khan 2008; Stanford 1991). Studies
on human-wildlife conflicts and attitudes in Bangladesh
usually consider larger and striking animals, such as
monkeys (Ahsan and Uddin 2014), langurs (Green 1981;
Khatun et al. 2012; Khatun et al. 2013), tigers (Azad et al.
2005; Inskip et al. 2013; Reza et al. 2002), and elephants
(Palash et al. 2018; Sarker and Roskaft 2010; Wahed et al.
2016) with higher regard, than either amphibians and/or
reptiles. These more “charismatic” species tend to receive
more attention toward their conservation and achieved
people’s positive attitude. On the other hand, amphibians
and reptiles provide all four types of ecosystem services
(1.e., provisioning, regulating, cultural, and supporting).
Provisioning services are direct advantages to people,
such as herpetofauna as a source of food and medicine.
The benefits derived from the regulation of ecological
processes, such as the control of agricultural pests and
disease by herpetofauna, are referred to as regulating
services. Herpetofauna also provide cultural services
through spiritual enrichment, traditional rites, and
aesthetic experiences, as well as supporting services
as nutrient cycling in the food chain and food web. The
majority of these direct and indirect services have gone
unnoticed (Valencia-Aguilar et al. 2013). Moreover, this
group continues to face additional threats as pollution,
habitat loss, commercial use, invasive species, climate
change, and infectious diseases (Collins and Crump 2009).
In Bangladesh, research has been conducted especially
on diversity, status, distribution, and behavioral studies of
THAKURGAON
26°0'0"N
Pirgon| @ — Singra
if e
Mollikpur oy Birgonj
ph} e
Tee ;
DINAJPUR
@ Study sites
| District
Fig. 1. Map of the study area.
Amphib. Reptile Conserv.
NILPHAMARI
“— Mollapara
“( Saidpur)
Seer
birds and mammals. Meanwhile, studies on herpetofaunal
diversity have been randomly conducted at different field
sites throughout the country (Chowdhury et al. 2016;
Hasan et al. 2014; Hasan and Feeroz 2014; Hasan et al.
2017; Mahony and Reza 2008; Reza and Mukul 2009;
Reza and Perry 2015; Rabbe et al. 2017a,b; Rahman
et al. 2018a,b). However, to the best of our knowledge
ethnoherpetological research has not been carried out yet
in Bangladesh. Therefore, the specific objectives of our
research were to: 1) document the misconceptions about
herpetofauna among local people, and 2) assess people’s
overall perceptions and beliefs in this regard.
Methods
Study Area
The study was conducted in four districts (Rangpur,
Dinajpur, Thakurgaon, and Nilphamari) of Rangpur
division, Bangladesh. The sites were selected as
representative of protected and non-protected areas, and
cultural variation was considered. Data was collected in
four suburban (Saidpur, Pirgonj, Birgonj, and Posurum)
and seven village (Mollikpur, Kornai, Burirhat, Harat,
Singra, Mollapara, Dhelapir) areas representing the
four districts (Fig. 1). All habitat types of the study
area included potential habitats for herpetofauna. Non-
protected areas included croplands, bushes, thickets,
wetlands, fallow land, and others, whereas Sal Tree
(Shorea robusta) cover is the main vegetation of the
protected area of Singra National Park.
Questionnaire Design and Data Collection
Before starting the main survey, a pilot survey was
conducted through a questionnaire among 15 local
people in the study area described. The final design of the
questionnaire was developed after reviewing the pilot
89°0'0"E
Study Area Map
0 5 10 20
Kilometers
26°0'0"N
as,
\ Dhelapir By Burirhat Sy
a
te Harati \_ =
Posurum
RANGPUR
's, and the GIS user community, Sources:
armin, © OpenStreetMap contributor:
Esri, USGS, NOAA, Sources: Esri, Garmin, USGS, NPS
89°0'0"E
November 2021 | Volume 15 | Number 2 | e289
Human perceptions toward herpetofauna in northwestern Bangladesh
sample survey. During final design, herpetofauna were
divided into four groups: frogs and toads, snakes, lizards,
and monitor lizards. Specific remarks about other groups
of animals were collected as additional information. The
survey was conducted from April 2017 to March 2018.
A total sample of 236 people was interviewed in the four
districts, and only one ethnic group (Santal) was surveyed
among the eight ethnic communities. Random sampling
was conducted in each district, and almost equal amounts
of data were collected from the questionnaire sampling in
each district. The questionnaire used in this survey was
entirely closed-ended where answers were selected from
a limited number of options, usually single-word answers
such as “yes” or “no.”
Socio-economic status of the people who completed
the survey were categorized in different groups to
characterize the social conditions of the respondents.
Respondents were categorized in three age classes:
Aged = > 40 years old, Medium age = 20 to 40 years,
and Adolescent = < 20 years. Occupation of respondents
was Classified as farmer, student, and non-farmer, 1.e.,
any other profession. Educational level was divided into
three groups: illiterate, low educated = 5th to 12th grade,
and highly educated = above 12th grade. Landholding
status was grouped into: Low land holders = < 0.5 acres,
Medium land holders = 0.5 to 1 acre, and High land
holders = > 1 acre.
Among the four herpetofaunal groups, frogs and toads
represented the only amphibian group as no caecilians
have been reported from the study site in the past, and
the other three groups (snakes, lizards, and monitor
lizards) are reptiles. Respondents considered monitor
lizards as snakes (locally called “Guishap”), hence it was
separated from “lizards” as a unique group. Turtles and
tortoises were excluded from this survey as respondents
at the study sites claimed they had not seen them in their
locality.
Interviewees were fully informed about the aims and
objectives of the questionnaire survey and gave consent
prior to participating in the research. The survey was
conducted from 1000 h to 1600 h, required 20-25 min
to collect data from each person, and the hardcopy of
the questionnaire was written in the Bengali language.
Photographs of amphibians and reptiles from the book
Amphibians and Reptiles of Bangladesh: A_ Field
Guide (Hasan et al. 2014) were shown to illiterate
participants during the interview to help them identify
animals. Misconceptions of the participants were
addressed after the interviews and their erroneous ideas
about herpetofauna were clarified to increase their
understanding and awareness.
Data Analysis
To identify the relationships between people’s perceptions
and various independent variables logistic regression
was carried out. Pearson Chi-square tests were employed
Amphib. Reptile Conserv.
to assess the relationships among variables. Statistical
tools (R and SPSS) were used to find the adjusted
influence of demographic and behavioral factors of the
response to the statement that “killing herpetofauna as a
credit.” A logistic regression model was applied since the
dependent variable is binary, 1.e., “killing herpetofauna
as a credit” has two categories [1=Yes, 0=No] (Hosmer
et al. 2013). Maximum likelihood estimation technique
was used to estimate the intercept and slope parameters.
For the purpose of interpreting regression coefficients,
the odds ratio (OR) was used [OR = exp (B.)].
Results
Socio-economic Status of the Respondents
Among the 236 respondents, 123 (52.11%) were males
and 113 (47.88%) were females (Table 1). The age of
the respondents varied from 15 to 78 years; with 39
respondents (21.19%) above 40 years, 147 (62.29%)
were middle aged, and 50 (16.53%) were below 20
years old (Table 1). The respondents included 153
(64.83%) Muslims, 53 (22.46%) Hindus, and 30
(12.71%) Christians. As for their employment status,
39 (16.33%) were farmers, 107 (45.34%) were non-
farmers, and 90 (38.14%) respondents were students
(Table 1). The interviewees included 77 (32.63%)
illiterate, 94 (39.83%) low educated, and 65 (27.54%)
highly educated individuals; with 167 (70.76%) from
rural areas and 69 (29.24%) from urban areas (Table
1). Moreover, 92 (38.98%), 125 (52.97%), and 19
(8.05%) had low, medium, and high landholding status,
respectively. About one-third, 84 (35.59%) had access
to social media, whereas 157 (64.41%) had no access to
the social media (Table 1).
Human Perceptions toward Herpetofauna
Frogs and toads. Among the 236 respondents, 27 (11%)
feared frogs and toads and showed negative attitudes in
having them share their human habitations with them;
while 36 (15%) respondents believed frogs and toads
were poisonous animals and possessed misconceptions
about this group (Fig. 2). A significant relationship was
found between believing misconceptions and killing
frogs and toads (p = 0.015) (Table 2). Among the eight
socio-economic variables, only landholding status was
significantly related in killing frogs and toads (Table 2).
Bivariate analysis showed that different perceptions of
the respondents were significantly related with either sex,
religion, occupation, place of residence, land holding
status, or media connection (see Supplementary Table
S1).
The regression analysis showed that preconceptions had
a significant impact on killing frogs (p = 0.026). The
odds of responding positively to “killing frog as credit”
November 2021 | Volume 15 | Number 2 | e289
Rabbe et al.
is (5.432-1) = 4.432 times higher for people possessing
a = ~ a x = S a preconceptions than people who did not possess
a 5 preconceptions, keeping all other predictors at a fixed
- S| x S S S a S level (Table 3). However, poor people are (1-0.221) =
ft 0.779 times less interested in killing frogs and toads.
O & Ulcer Le Snakes. Most of the respondents, 208 (88%) were
= 3(Z|3 = < x + afraid of snakes, while 229 (97%) considered snakes as
3 3 poisonous (venomous) animals (Fig. 2). The statement
Zi : nlo aA w a © “Killing snake Is a credit” was believed by 106 (45%)
oe Lio eae ROS San respondents (Fig. 2). Out of the 236 respondents, 180
c is (76%) stated that they saw snake biting incidents in their
= E Bl ow Fie ig, He Rees life at least once and 192 (81%) respondents were not
I R/TI/S om + willing to share their habitation with snakes (Fig. 2).
ve = aa Significant relationship existed between views of “killing
Ea = st] a a ne snakes as credit” with either “poisonous,” “sharing
a 3 2 —" ee human habitat is harmful,” “belief in preconceptions,”
yy I tl Js m ona and “seen attacking people” (Table 2). Occupation
oO fs Dilkeee ea te Deen had a significant role in considering snake killing as a
S = credit (p = 0.013). Non-farmers (55.1%) were more
Ny mjc fo Se positive toward killing snakes than farmers and students
am 5 aati ian (Table 2). Other perceptions of snakes were found to
5 E 31). .(e a 7 x be significantly related with sex, religion, occupation,
Bz = Br eko ing <o media connection, and place of residence in the bivariate
ce ep I = is n © analysis (see Supplementary Table S2).
i “ leeds a ape Highly educated respondents were more likely to
< Ee. ae consider killing snakes as a credit, and the odds were
aT gS BN 8 ratical ME AE lion ponte
S — g Be |mes skeen 20 ata have significant correlations with killing snakes (p =
S 3 5 ars es 0.004, 0.0005, respectively). Killing snake as credit is
I 5 CO] Ina go an considered favorable by respondents who believed that
= So sS aus s sharing human habitation causes damage and the odds
i} 2 a Ry were (3.863-1) = 2.863 times as high as those who did
x iz Vlg SRSA not. People possessing preconceptions are (2.984-1) =
< |! < 1.984 times more likely to believe that killing snake is a
ae a Win ohh ri : ‘ ;
3 S 2 Palka ene, ae ise those with no preconceptions toward snakes
=
e = | De ee eo 2 Lizards. Among the respondents, one-fifth (20%)
= > a am feared lizards, and 84 (36%) answered “Yes” to “lizards
oe Jee 2. ee are poisonous animals” (Fig. 2). Killing lizards was
a i 7 jen 6 a QS associated significantly with thinking of lizards as
ane} & poisonous animals (p = 0.000) (Table 2). Although only
5 ts s S 9 2 S ci 16% respondents agreed that sharing human habitation
eg with lizards is not harmful to people (Fig. 2), the killing
a II 12 Gd o A” of lizards was significantly related with the response to
2 a SA ge eS sharing respondent’s habitats (Table 2). Among all the
z 3 2 s|2 2 2 a2 respondents, 44 (19%) believed the superstitions (¢.g.,
2% deta fob cse RAS au SUEsLiariotantiod (los) eebontets
SL Wot ~ A iS
iS ie [it a ao = thought killing lizards was not a bad deed (Fig. 2). These
E eS a superstitions about lizards influenced the responder’s
S & oe ee ee belief in killing lizards as a creditable act, which had a
2 E significant relationship (Table 2). Among all the socio-
By Soe 2 E economic variables, only occupation was significantly
& a ‘= E ey = ee 5 associated with killing lizards (Table 2). Age, sex,
22 a7(|s 63 Ys occupation, education, and media connection were
iS S Bice RE wee ee significantly related with the perceptions shown in
Amphib. Reptile Conserv. 213 November 2021 | Volume 15 | Number 2 | e289
Human perceptions toward herpetofauna in northwestern Bangladesh
Fearful
B Sharing human habitat is harmful
B Seen attacking people
iS 3 No
om
s ‘3 4 Yes
= «3 N
a ho
—- 5 Yes
e a No
ewe
c2|C Wes
4 4 No
bb &
oe Yes
B Poisonous
B Believe preconception
BERillme isa credit
Human perceptions (in percentage)
Fig. 2. Perceptions toward herpetofauna (in percentage, with the "Yes" and "No" responses for each combination of Herpetofauna
group and perception color summing to 100%).
Supplementary Table S3.
The relationship between education and considering
lizard killing as a credit is significant (Table 5). The odds
of killing lizards as a credit is (25.872-1) = 24.872 times
higher for people with higher education and (8.013-
1) = 7.013 times higher for people with primary and
secondary education than illiterate people, keeping all
other predictors at a fixed level. Respondents considering
lizards as poisonous was highly significantly correlated
with sharing their habitat is harmful to them (p= 0.001)
and the relationship with killing lizards (p= 0.001). Killing
lizards is (10.178-1) = 9.178 times higher in respondents
considering lizards as poisonous, and (7.174-1) = 6.174
times higher in respondents thinking that sharing their
habitat with lizards is harmful to them (Table 5).
Monitor lizards. Monitor lizards were considered to
be snakes by most of the respondents, with 170 (72%)
indicating they were fearful of them, and 173 (73%)
believed them to be poisonous animals (Fig. 2). Among
the respondents, 161 (68%) disagreed with sharing their
household with monitor lizards and 99 (42%) respondents
had misconceptions (e.g., spraying poisonous saliva,
considering these animal as snakes) about these animals.
Killing monitor lizard was significantly related with
thinking of monitor lizards as poisonous, considering
habitat sharing as harmful, and possessing erroneous
perceptions about them (Table 2) . Of the total respondents,
79 (33%) thought that killing monitor lizards is a heroic
deed, and about two-fifths (39%) asserted that they
had seen monitor lizards attacking humans, especially
children (Fig. 2). Similar to snakes and lizards above,
the killing of monitor lizards was significantly associated
with occupation (Table 2). Other than killing, the other
perceptions toward monitor lizards were significantly
related with age, religion, occupation, and media
connection (see Supplementary Table S4).
Monitor lizards are killed as they are considered
to be harmful, and preconceptions are believed by the
Amphib. Reptile Conserv.
respondents, with highly significant correlations (p =
0.008 and 0.0009, respectively). The odds of considering
killing monitor lizards as a credit is (2.854-1) = 1.854
times higher in people who think sharing human habitation
could cause harm to themselves. People believing
preconceptions are (3.149-1) = 2.149 times greater among
those who think of killing monitor lizards as a credit than
those who are aware of the superstitions (Table 6).
Discussion
Impact of socio-demographic status and human
perceptions toward herpetofauna. Any belief or feeling
perceived by humans about biodiversity is reflected in
their attitudes toward it (Pooley 2000). For instance, the
Common Langur (Semnopithecus entellus) is venerated
as a God in the Hindu religion (Khatun et al. 2012). To
determine the attitudes of people in Bangladesh toward
herpetofauna, respondents were asked some closed-
ended questions regarding different herpetofaunal groups.
The results showed significantly varying attitudes and
perceptions for different groups of herpetofauna.
People with low land holding status are more inclined
to kill amphibians (Table 2). These individuals have
the attitude that they have little space in which to live,
so why should they share it with others? Respondents
believe many misconceptions, like “killing frogs and
toads bring nightmares” that they are compelled to
consider those animals as harmful. This thinking clearly
indicates that social status of the respondents affects
their psychological attitudes and behavior toward these
animals. Furthermore, frogs and toads are considered as
among the dirtiest of animals since they leave their feces
in and around the home and yard, which respondents
thought to be a sign of impurity.
Religious views often promote beliefs in superstitions.
For example, Muslims considered killing snakes and
lizards as a deed of ‘Sunnah’ (Islamic belief) whereas
November 2021 | Volume 15 | Number 2 | e289
Rabbe et al.
Table 2. Human perception toward herpetofauna considering “Killing is a credit” as a dependent variable in relation to different socioeconomic
status and other perceptions of the respondents.
Variables
Age
Sex
Religion
Occupation
Education
Place of
Residence
Landholding
Status
Media
Connection
Fearful
Poisonous
Sharing human
habitat is
harmful
Believe
preconception
Seen attacking
people
Amphib. Reptile Conserv.
Category
<20
20-40
40+
Female
Male
Islam
Sonaton
Christian
Farmer
Non-farmer
Students
No
Education
Primary &
Secondary
Higher
Rural
Urban
Low
Medium
High
Frog and Toads
Yes (%) y2 (p-value)
8.0 1.80 (0.407)
3.4 —
| —
oe | 1.96 (0.161)
6.5 —
339 0.58 (0.749)
5.7 —
6.7 —
2.6 1.60 (0.450)
6.5 —
3.3 —
6.5 2.10 (0.350)
33 —
| bs) —
42 0.28 (0.595)
5.8 —
8.7 6.02 (0.049)
1.6 —
eo —
5:3 0.35 (0.555)
3.6 —
48 0.06 (0.802)
3.7 —
4.5 0.08 (0.782)
3.8 3.11 (0.078)
11.5 —
3 8.14 (0.015)
[3.9 -
=m 1.19 (0.276)
0.0 —
Yes (%)
54.0
43.5
38.5
40.7
48.8
48.4
34.0
46.7
41.0
55.1
34.4
48.1
40.4
47.7
45.5
43.5
46.7
42.4
52.6
48.0
39.3
46.4
44.7
14.3
227
50.0
52.9
60.4
33:9:
48.3
Killing is a credit
Snakes Lizards
x2 (p-value) Yes(%) y2 (p-value)
2.44 (0.296) 18.0 3.97 (0.138)
_ 10.2 —
— | _
1.55 (0.213) 7.1 3.23 (0.064)
— 14.6 —
3.34 (0.188) 10.5 1.53 (0.466)
— 15.1 —
— 6.7 -
8.75 (0.013) 10.3. 10.40 (0.006)
— 17.8 —
- oe —
1.28 (0.529) 7.8 3.89 (0.143)
— 16.0 —
— TA —
0.08 (0.775) 10.2 0.00 (0.994)
- 10.1 -
0.90 (0.637) 13.0 3.50 (0.174)
— 8.0 —
— 21.1 —
1.67 (0.196) 13.8 3.41 (0.065)
— 6.0 -
0.3 (0.864) 9.0 3.68 (0.055)
~ 18.8 —
2.74 (0.098) oat 29.28 (0.000)
10.76 (0.001) 8.5 7.93 (0.005)
— 24.3 —
18.60 (0.000) 7.0 13.90 (0.000)
— 25.5 —
3.58 (0.058) 22.0 0.26 (0.610)
- 13.8 —
215
Monitor Lizards
44.0
29.9
23°3
28.3
38.2
34.6
30.2
333
30.8
43.0
25.3
37.7
35.1
26.2
329
34.8
37.0
32.8
oA Wel |
375
26.2
34.8
32.9
213
17.6
40.7
19.3
3250
34.0
32.6
Yes(%) 2 (p-value)
3.32 (0.191)
2.59 (0.108)
0.35 (0.839)
8.64 (0.013)
2.28 (0.319)
0.08 (0.784)
1.84 (0.398)
3.11 (0.078)
0.08 (0.780)
5.47 (0.019)
12.25 (0.000)
28.62 (0.000)
0.051 (0.822)
November 2021 | Volume 15 | Number 2 | e289
Human perceptions toward herpetofauna in northwestern Bangladesh
Table 3. Estimates of regression parameters with standard error (SE), 95% confidence interval (C,), p-value, and odds ratio (OR)
obtained from logistic regression model: Frog and toad killing.
Variables Category Estimates SE 95% CI p-value OR
(Intercept) -4.697 1.467 (-7.57,-1.82) 0.001 0.009
<20 — = - — —
Age 20-40 -0.330 0.873 (-2.04, 1.38) 0.705 0.719
40+ -1.053 1.483 (-3.96, 1.85) 0.477 0.349
Female — — — — —
Sex
Male 1.089 0.936 (-0.74, 2.92) 0.244 2.972
Islam — — — - —
Religion Sonaton 0.407 0.847 (-1.25, 2.07) 0.631 1.502
Christian 0.119 1.039 (-1.92, 2.15) 0.909 1.126
Farmer - — — — —
Occupation Non-farmer 1.951 1.307 (-0.61, 4.51) 0.135 T1035
Students 1.798 2.028 (-2.18, 5.77) 0.375 6.037
No Education _ — — - —
Education Primary and Secondary -0.730 0.961 (-2.61, 1.15) 0.447 0.482
Higher -1.925 1.574 (-5.01, 1.16) 0.221 0.146
Rural — — — — —
Place of Residence
Urban 0.499 0.865 (-1.20, 2.19) 0.564 1.647
Low — — — — —
Landholding Status Medium -1.509 0.881 (-3.24, 0.22) 0.087 0.221
High -0.941 1.343 (-3.57, 1.69) 0.483 0.390
| | No - - - - ~
Media Connection
Yes 0.605 1.471 (-2.28, 3.49) 0.681 1.832
No - 7 a = os
Believe preconception
Yes 1.692 0.762 (0.20, 3.19) 0.026 5.432
Hindus were devoted to the worship of snakes. The work
of Uyeda et al. (2014) on the role of traditional beliefs for
the conservation of herpetofauna in Indonesia revealed
that the Water Monitor Lizard (Varanus salvator) and
the Reticulated Python (Python reticulatus) were being
conserved by the locals because of their existing positive
beliefs toward these animals. This study also found that
Hindus were not eager to kill snakes because of their
religious views, but Muslims and Christians often had
the opposite view (negative).
Electronic media, such as television, has played
a negative role in reinforcing the erroneous beliefs
about herpetofauna among rural people. The cinema,
mythical dramas, documentaries, and other forms
which depict herpetofauna, especially snakes and
lizards, often influence local people to believe in
misconceptions. For example, the Ornate-flying Snake
(Chrysopelea ornata, locally called ‘Kalnagini’), is a
non-venomous snake but it 1s shown and represented
as a venomous snake in many cinematic productions
in Bangladesh. Snakestone (locally called ‘Moni’)
is believed to have magical and healing powers
shown in many Indian and Bangladeshi cinemas for
entertainment as well as imposed by snake charmers
Amphib. Reptile Conserv. 216
(Jaman et al. 2020). Some people believe that
snakestones (1.e. a stone which is believed to be made
by the snake and carried on its head) can heal snakebites
and it is practiced in many countries of Asia, Africa,
and Latin America (Baldwin 1995). These beliefs
possibly inspire people to kill snakes for collecting
snakestone. In addition, the transformation of human
to snake and vice-versa is often shown in mythical
dramas and people subconsciously acclimatize their
minds to believe in this fantasy. Some documentaries
of the Discovery Channel and Animal Planet show
that saliva of Komodo Dragons is poisonous. Local
people who watched these documentaries mistakenly
compare Komodo Dragons with other monitor
lizards of Bangladesh and consider them as equally
poisonous and harmful as Komodos. This perception
influences people to kill native monitor lizards. The
present study showed a significant relationship in
killing lizards and monitor lizards with these negative
media connections (Table 2).
Lack of education on the importance and role
of herpetofaunas in ecosystems among people was
responsible for holding many misconceptions and
negative thoughts toward these animal groups. While
November 2021 | Volume 15 | Number 2 | e289
Rabbe et al.
illiterate people in the survey often ruled out the
importance of herpetofauna, on the other hand, literate
people can have superficial ideas on herpetofauna,
and hence negative attitudes arise as a result. Literate
people often considered some species as aggressive,
lethal, or harmful. For example, respondents considered
monitor lizards as snakes since they show the protruding
bifurcate tongue, though they are actually lizards. Of
the respondents, 73% considered monitor lizards as
a poisonous animal (Fig. 2). Almost all respondents
believed that all snakes found in their locality were
venomous, except for the Checkered Keelback
(Xenochrophis piscator). Lizards, frogs, and toads were
also erroneously considered as poisonous animals.
Although, most respondents possessed false ideas
about herpetofauna, students were more rational in some
cases. They stated that wild animals have the right to
roam freely in nature such as humans do. Students also
mentioned the importance of herpetofauna, such as them
helping maintain an ecological balance and controlling
pest animals. Individual interests on wildlife education
played a role in creating positive attitudes toward them.
Herpetofauna as well as other animals usually interact
more with farmers. In this study, we found that farmers
had a more rational approach toward these animals than
other professions. Generally, farmers are more attached
with nature and other wild animals. This attachment and
interaction creates affection (or bitterness in some cases)
among this group and we found mostly positive results
with farmers (Table 2).
Impact of human perceptions in killing herpetofauna.
Negative opinions were actually an outcome of different
myths and misconceptions about herpetofauna which
have been practiced by local communities for ages. Some
of these beliefs people had are that dead frogs and toads
could come to their dreams, snakes bear snakestone on
their head which is thought by many to have magical
and healing powers, snakes could take revenge after
death, garden lizards could suck blood, monitor lizards
could spray poisonous saliva causing skin rot, and so on.
Some believed that diseases of humans were related to
the activity of lizards.
Negative attitudes and misbeliefs were more acute
for reptiles than amphibians (Ceriaco 2012). These
negative attitudes and misbeliefs are more pronounced
for snakes and monitor lizards, than other types of
amphibians and reptiles (Fig. 2). Being larger and
more visible than amphibians, reptiles interact with
humans more frequently. For this, people showed
less of a negative attitude toward frogs and toads.
Respondents claimed they faced economical loss due
to monitor lizards and snakes as these creatures often
eat their domestic cockerel and snake bite causes death
of domestic animals, as well as humans. Hence, people
were willing to eradicate snakes and monitor lizards
from their homestead areas. The study of Nolan et al.
Amphib. Reptile Conserv.
(2006) suggested that snails, crabs, snakes, lizards,
and turtles were the most neglected animals, much
more than mammals, birds, or fish. Significant results
were observed for killing amphibians in relation to
habitat sharing and believing superstitions (Table 2) by
participants of the study. Results for killing reptiles were
significant with all variables and this suggests reptiles
were more phobia-inducing animals than amphibians.
This reflects the idea that reptiles caused more of a
threat to humans, than either mammals or amphibians
(Ohman and Soares 1994; Ohman and Mineka 2003;
Sagan 1977).
Society, community, and killing. Bangladesh has a total of
27 ethnic communities and among them, eight reside in
the four districts surveyed (BBS 2011). We interviewed
42 (about 18% of total respondents) Santals people, the
largest ethnic group in the Dinajpur and Thakurgaon
regions, to learn about their attitudes toward amphibians
and reptiles. According to IUCN Bangladesh (2015),
ethnic communities of both hill and plain lands use to
hunt Bull Frog (Hoplobatrachus tigerinus), Marbled
Cascade Frog (Amolpos marmoratus), large snakes,
monitor lizards (Varanus sp.), and turtles for protein
consumption. Santals of Dinajpur and Thakurgaon were
personally asked if this kind of act was performed by
them. They stated that killing of herpetofauna especially
reptiles were considered an act of heroism in their
communities and they often hunted traditionally. Bull
frogs and monitor lizards are larger in size than their
corresponding groups of animals and considered as a
potential source of meat and one of the primary reasons
for hunting them by Santals. Ethnic communities living
inside forest areas were reported to hunt Tokay Gecko
(Gekko gecko) for producing medicines and pythons and
cobras for use in the lucrative skin and tannery industries
by the forest department (IUCN Bangladesh 2015).
Indigenous people kill herpetofauna for food but other
people kill them for pleasure and gaining credit among
locals. Especially killing of snakes and monitor lizards
was considered as creditable work by individuals. This
study reported four killing incidents of reptiles during
the survey: two in Thakurgaon (Korna1), one in Dinajpur
(Singra), and one in Rangpur (Posurum). Three snakes
(Binocellate Cobra, Naja naja; Checkered Keelback,
Fowlea_ piscator, Common Wolf Snake, Lycodon
aulicus) and one monitor lizard (Yellow Monitor,
Varanus flavescens) were killed. People, especially
children, were interested in catching and killing Bull
and Skipper frogs considered a “fun” activity during
the rainy season. People’s negative attitudes toward
herpetofauna had promoted killing activities in this
region for decades.
Recommendations. To replace misconceptions with
positive attitudes, we suggest a two-way model: 1) local
community participation in herpetofauna conservation
November 2021 | Volume 15 | Number 2 | e289
Human perceptions toward herpetofauna in northwestern Bangladesh
Table 4. Estimates of regression parameters with standard error (SE), 95% confidence interval (CI), p-value, and odds ratio (OR)
obtained from logistic regression model: Snake killing.
Variables Category Estimates
(Intercept) -2.540
<20 _
Age 20-40 -0.626
40+ -0.270
Female _-
Sex
Male 0.628
Islam —
Religion Sonaton -0.467
Christian -0.243
Farmer —
Occupation Non-farmer 0.696
Students -0.343
No Education _
Education Primary and 0.0398
Secondary
Higher 1.038
Rural —
Place of Residence
Urban 0.048
Low —
Landholding Status Medium 0.056
High 0.107
No —
Media Connection
Yes -0.083
No -
Fearful
Yes -0.515
No —-
Poisonous
Yes 0.625
Sharing human No =
habitat is harmful Yes 1.352
No —
Believe preconception
Yes 1.093
Seen attack oo .
een attacking people
epee Yes 0.346
and oversight by the government, and 2) increased
effort of the scientific community to educate the public
regarding the non-threat of herpetofauna and their many
positive benefits. The first step enumerated could follow
the steps below:
1) Awareness program: The most important task is
to educate people about animals, with a focus on
herpetofauna. The Forest Department under the Ministry
of Environment, Forest, and Climate Change is the
authority for the protection and conservation of wildlife
in Bangladesh. They should take the lead role in raising
national awareness about herpetofauna by involving the
various stakeholders in the community.
Amphib. Reptile Conserv.
SE 95% CI p-value OR
1.297 (-5.08, 0.00) 0.05 0.079
0.417 (-1.44, 0.19) 0.133 0.535
0.650 (-1.54, 1.00) 0.677 0.763
0.387 (-0.13, 1.39) 0.105 1.873
0.389 (-1.23, 0.29) 0.231 0.627
0.493 (-1.21, 0.72) 0.622 0.784
0.514 (-0.31, 1.70) 0.176 2.006
0.779 (-1.87, 1.18) 0.659 0.709
0.424 (-0.79, 0.87) 0.927 1.039
0.623 (-0.18, 2.26) 0.096 2.822
0.372 (-0.68, 0.78) 0.898 1.049
0.326 (-0.58, 0.70) 0.863 1.058
0.583 (-1.04, 1.24) 0.855 1.113
0.488 (-1.04, 0.87) 0.865 0.920
0.509 (-1.51, 0.48) 0.311 0.597
1.273 (-1.87, 3.12) 0.623 1.867
0.474 (0.42, 2.28) 0.004 3.863
0.315 (0.47, 1.71) 0.0005 2.984
0.372 (-0.38, 1.07) 0.353 1.412
11) Positive use of media: The media can play an
important role in educating the public by producing
news and documentaries regarding untrue myths
about herpetofauna and other wild animals. Cinemas
and dramas that more likely than not broadcast false
information should be barred from airing or at the
very least have oversight groups of experts (trained
biologists) that monitor information being aired
to help decrease the flow of negative and/or untrue
statements being propagated and reinforcing untrue
myths. Using social media to raise public awareness
might be a promising strategy to increase educate of
the public to the true nature of animals as nonthreats.
November 2021 | Volume 15 | Number 2 | e289
Rabbe et al.
Table 5. Estimates of regression parameters with standard error (SE), 95% confidence interval (CI), p-value, and odds ratio (OR)
obtained from logistic regression model: Lizard killing.
Variables Category Estimates SE 95% CI p-value OR
(Intercept) -5.497 1.267 (-7.98, -3.01) 0.000 0.004
<20 — — — — —
Age 20-40 -1.132 0.725 (-2.55, 0.29) 0.118 0.322
40+ -0.875 1.134 (-3.09, 1.35) 0.440 0.417
Female — — — — —
Sex
Male 1.17 0.695 (-0.19, 2.53) 0.092 3.222
Islam — — — — —
Religion Sonaton 0.912 0.676 (-0.41, 2.24) OLE 2.490
Christian -0.194 0.964 (-2.08, 1.69) 0.841 0.824
Farmer - — — — —
Occupation Non-farmer 0.511 0.872 (-1.20, 2.22) 0.558 1.667
Students -2.142 1.472 (-5.03, 0.74) 0.146 0.117
No Education — — — — -
Education Roupais sane 2.081 0.824 (0.47, 3.69) 0.012 8.013
Secondary
Higher 3.253 1.167 (0.97, 5.54) 0.005 25.872
Rural - — — — —
Place of Residence
Urban 0.078 0.698 (-1.29, 1.44) 0.911 1.081
Low — a - — —
Landholding Status Medium -0.759 0.621 (-1.98, 0.46) 0.221 0.468
High -0.488 1.034 (-2.52, 1.54) 0.637 0.614
| , No - - ~ - -
Media Connection
Yes -0.106 0.948 (-1.96, 1.75) 0.911 0.899
No — - — — —
Fearful
Yes Sy bee 0.638 (-1.07, 1.43) 0.781 1.194
No — — — — —
Poisonous
Yes 22 0.708 (0.93, 3.71) 0.001 10.178
| we No - : - - -
Sharing human habitat is harmful
Yes 1.970 0.707 (0.59, 3.36) 0.005 7.174
No = = = = =
Believe preconception
Yes 0.687 0.615 (-0.52, 1.89) 0.264 1.988
111) Addition of wildlife education in existing curriculum:
In Bangladesh, the current primary and secondary school
curricula do not include any information about wild
animals and nature conservation. As a result, animal
attachment and affection are rare from an early age. This
should be changed by including adequate fundamental
information into the existing curriculum. Nature and
animal-based education can be gained by including
it as a formal learning component in textbooks and
implementing structured activities in schools or on field
trips. Informal learning can also occur during free play,
backyard nature exploration, and green schoolyards on
the grounds or in any other natural settings.
The scientific community’s involvement is essential in
spreading a positive message to the public. This can be
accomplished by the following measures:
Amphib. Reptile Conserv.
1v) Individual involvement: Individual participation
of researchers, students, and teachers in ethnographic
research is needed. Perceptions and attitudes will differ
depending on location, race, tradition, and other factors.
General measures to increase the public’s education
cannot be implemented without knowing the current
state of human attitudes and perceptions in all parts
of the country. We encourage scholars and students
to conduct research on this vast topic. The research
findings can be used to choose the best techniques in
helping change the public’s attitude toward wildlife,
and especially herpetofaunas.
V) Organization involvement: Universities, nature-
based organizations like the International Union
for Conservation of Nature (IUCN), NGOs, and
volunteer organizations should show interest in
November 2021 | Volume 15 | Number 2 | e289
Human perceptions toward herpetofauna in northwestern Bangladesh
Table 6: Estimates of regression parameters with standard error (SE), 95% confidence interval (CI), p-value, and odds ratio (OR)
obtained from logistic regression model: Monitor lizard killing.
Variables Category Estimates
(Intercept) -2.321
<20 _
Age 20-40 -0.424
40+ -0.508
Female —
Sex
Male 0.498
Islam —
Religion Sonaton -0.237
Christian -0.011
Farmer —
Occupation Non-farmer 0.762
Students 0.039
No Education _
Education Primary and Secondary 0.138
Higher 0.304
Rural -
Place of Residence
Urban 0.263
Low _
Landholding Status Medium 0.051
High -1.099
. No =
Media Connection
Yes -0.022
No —
Fearful
Yes -0.596
; No —
Poisonous
Yes 0.420
Sharing human habitat No —
is harmful Yes 1.049
No o
Believe preconception
Yes 1.147
doing research as well as participate in education,
training, and awareness programs. Ethnozoology
should be the priority of research, and organizations
should focus on small, neglected animals that are
often declining worldwide such as amphibians. These
organizations are acceptable to the general public.
Increased research will generate more interest, and
these organizations could produce comprehensible
material for illiterate locals, resulting in better and
more positive perceptions by the general public and
thus improved conservation of animals.
Acknowledgements.—We are grateful to Professor
Dr. Wasimul Bari for his help analyzing data. For
assistance during fieldwork, we are indebted to
Mr. Md. Hasibul Islam, Mr. Poritosh Roy, Mr. Md.
Rayhan Kabir, and Mr. Dipu Roy. We thank the
Ministry of Science and Technology, Bangladesh
Amphib. Reptile Conserv.
220
SE 95% CI p-value OR
0.758 (-3.81, -0.84) 0.002 0.098
0.436 (-1.28, 0.43) 0.331 0.655
0.655 (-1.79, 0.78) 0.438 0.601
0.399 (-0.29, 1.28) 0.213 1.646
0.407 (-1.03, 0.56) 0.561 0.789
0.512 (-1.02, 0.99) 0.983 0.989
0.555 (-0.33, 1.85) 0.170 2.142
0.809 (-1.55, 1.63) 0.961 1.040
0.444 (-0.73, 1.01) 0.755 1.148
0.611 (-0.89, 1.50) 0.619 1.356
0.383 (-0.49, 1.01) 0.494 1.301
0.343 (-0.62, 0.72) 0.881 1.053
0.684 (-2.44, 0.24) 0.108 0.333
0.502 (-1.01, 0.96) 0.964 0.978
0.388 (-1.36, 0.16) 0.124 0.551
0.444 (-0.45, 1.29) 0.344 1.522
0.396 (0.27, 1.83) 0.008 2.854
0.346 (0.47, 1.83) 0.0009 3.149
for partial funding of this work under the project
title “Ecology, Species Diversity and Conservation
Issues of Herpetofauna of Northern Region (Greater
Dinajpur and Nilphamari District) of Bangladesh.”
Literature Cited
Ahsan MF, Uddin MM. 2014. Human-Rhesus monkey
conflict at Rampur village under Monohardi upazila
in Narsingdi district of Bangladesh. Journal of
Threatened Taxa 6(6): 5,905—5,908.
Alves RRN, Souto WM. 2011. Ethnozoology in
Brazil: current status and perspectives. Journal of
Ethnobiology and Ethnomedicine 7(22): 1-18.
Alves RRN, Vieira WLS, Santana GG, Vieira KS,
Montenegro PFGP. 2013. Herpetofauna used in
traditional folk medicine: conservation implications.
Pp. 109-133 In: Animals in Traditional Folk
November 2021 | Volume 15 | Number 2 | e289
Rabbe et al.
Medicine. Editors, Alves R, Rosa I. Springer,
Berlin/Heidelberg, Germany. 492 p.
Azad MAK, Hashem MA, Hossain MM. 2005. Study
on human-Royal Bengal Tiger interaction of in-situ
and ex-situ in Bangladesh. Journal of Biological
Sciences 5(3): 250-252.
Baldwin M. 1995. The snake stone experiments: an
early modern medical debate. Jsis 86: 394-418.
Bangladesh Bureau of Statistics (BBS). 2011.
Population Census — 2011, Preliminary Report.
Bangladesh Bureau of Statistics, Ministry of
Planning, Dhaka, Bangladesh. 19 p.
Bkerke T, Kaltenborn BP, Thrane C. 2001.
Sociodemographic correlates of fear related
attitudes toward the wolf (Canis /upus lupus).
Fauna Norvegica 21: 33-35.
Ceriaco LMP. 2012. Human _ attitudes toward
herpetofauna: the influence of folklore and negative
values on the conservation of amphibians and
reptiles in Portugal. Journal of Ethnobiology and
Ethnomedicine 8(8): 1-12.
Chowdhury MAW, Rahman MM, Khan MAG. 2016.
Influence of habitat parameters on Common Skipper
Frog (Euphlyctis cyanophlyctis) in Chittagong.
Bangladesh Journal of Zoology 44(1): 133-146.
Collins JP, Crump ML. 2009. Extinction in Our Times:
Global Amphibian Decline. Oxford University
Press, New York, New York, USA. 272 p.
Czech B, Krausman PR. 2001. The Endangered Species
Act: history, conservation biology, and public
policy. Johns Hopkins University Press, Baltimore,
Maryland, USA. 215 p.
Fernandes-Ferreira H, Mendonca SV, Cruz RL,
Borges-Nojosa DM, Alves RRN. 2013. Hunting
of herpetofauna in montane, coastal, and dryland
areas of Northeastern Brazil. Herpetological
Conservation and Biology 8(3): 652-666.
Ferrand N, Ferrand de AP, Gongalves H, Sequeira F,
Teixeira J, Ferrand de AF. 2001. Guia dos Anfibios
e Répteis de Portugal Porto, Portugal. GuiasFapas/
Camara Municipal do Porto, Porto, Portugal. 430 p.
Green KM. 1981. Preliminary observations on the
ecology and behavior of the Capped Langur,
Presbytis pileatus, in the Madhupur forest of
Bangladesh. International Journal of Primatology
2(2): 131-151.
Hasan MK, Feeroz MM 2014. Species diversity and
habitat preferences of amphibian fauna in six
protected areas of Bangladesh. Bangladesh Journal
of Zoology 42(1): 105-116.
Hasan MK, Khan MMH, Feeroz MM. 2014.
Amphibians and Reptiles of Bangladesh: a Field
Guide. Arannayk Foundation, Dhaka, Bangladesh.
191 p.
Hasan MS, Rabbe MF, Alam MM. 2017. Geographic
distribution of Uperodon globulosus (Ballon Frog).
Herpetological Review 48(4): 808.
Amphib. Reptile Conserv.
Hosmer DW, Lemeshow S, Sturdivant RX. 2013.
Applied Logistic Regression. Wiley, Hoboken, New
Jersey, USA. 511 p.
Inskip C, Ridout M, Fahad Z, Tully R, Barlow A,
Barlow CG, Islam MA, Roberts T, MacMillan D.
2013. Human-tiger conflict in context: risks to
lives and livelihoods in the Bangladesh Sundarbans.
Human Ecology 41(2): 169-186.
IUCN Bangladesh. 2015. Red List of Bangladesh,
Volume 4: Reptiles and Amphibians. YUCN,
International Union for Conservation of Nature,
Bangladesh Country Office, Dhaka, Bangladesh.
320 p.
Jaman MF, Rabbe MF, Alam MM, Shome AR, Hossain
MA, Sarker MAR 2020. Students’ perceptions on
snakes in Northwestern Bangladesh. Asian Journal
of Ethnobiology 3(2): 62-69.
Kellert SR. 1996. The Value of Life: Biological
Diversity and Human _ Society. Island Press,
Washington, DC, USA. 262 p.
Khan MMH. 2008. Protected Areas of Bangladesh: a
Guide to Wildlife. Bangladesh Forest Department,
Nishorgo Program, Dhaka, Bangladesh. 304 p.
Khatun UH, Ahsan MF, Roskaft E. 2012. Attitudes of
the local community towards the conservation of
the Common Langur (Semnopithecus entellus) in
Keshabpur, Bangladesh. /nternational Journal of
Biodiversity and Conservation 4(11): 385-399.
Khatun UH, Ahsan MF, Roskaft E. 2013. Local
people’s perceptions of crop damage by Common
Langurs (Semnopithecus entellus) and human-
Langur conflict in Keshabpur of Bangladesh.
Environment and Natural Resources Research 3(1):
111-126.
Knight AJ. 2008. “Bats, snakes and spiders, Oh my!”
How aesthetic and negativistic attitudes, and other
concepts predict support for species protection.
Journal of Environmental Psychology 28(1): 94-
103.
Lee S, Hoover C, Gaski A, Mills J. 1998. A World
Apart? Attitudes towards traditional Chinese
Medicine and Endangered Species in Hong Kong
and the United States. TRAFFIC East Asia,
TRAFFIC North America, and World Wildlife
Fund-US, Washington, DC, USA. 80 p.
Mahony S, Reza AHMA. 2008. A_herpetofaunal
collection from the Chittagong Hill Tracts,
Bangladesh, with two new species records for the
country. Hamadryad 32: 34-45.
Manstead A. 2018. The psychology of social class: how
socioeconomic status impacts thought, feelings, and
behaviour. The British Journal of Social Psychology
57(2): 267-291.
Nolan JM, Jones KE, McDougal KW, McFarlin MJ.
2006. The lovable, the loathsome, and the liminal:
emotionality in ethnozoological cognition. Journal
of Ethnobiology 26: 126-138.
November 2021 | Volume 15 | Number 2 | e289
Human perceptions toward herpetofauna in northwestern Bangladesh
Ohman A, Mineka S. 2003. The malicious serpent:
snakes as a prototypical stimulus for an evolved
module of fear. Current Directions in Psychological
Science 12: 5-9.
Ohman A, Soares JJF. 1994. Unconscious anxiety:
phobic responses to masked stimuli. Journal of
Abnormal Psychology 103: 231-240.
Palash A, Akash M, Islam MA. 2018. Sociological
dimensions of human-elephant conflict with trans-
boundary herds in Northern Bangladesh. Gajah 48:
12-19.
Pooley JA. 2000. Environmental education and
attitudes: emotions and beliefs are what is needed.
Environment and Behavior 32: 711-723.
Pough FH, Andrews RM, Cadle JE, Crump ML,
Savitzky AH, Wells KD. 1998. Herpetology.
Prentice Hall, New York, New York, USA. 544 p.
Rabbe MF, Alam MM, Rahman MM. 2017a.
Geographic distribution of Eutrophis dissimilis
(Striped Grass Skink). Herpetological Review
48(4): 811.
Rabbe MF, Alam MM, Rahman MM. 2017b.
Geographic distribution of Hemidactylus bowringii
(Oriental Leaf-toed Gecko). Herpetological Review
48(4): 811.
Rahman MM, Alam MM, Rabbe MF. 2018a. First
record of Uperodon globulosus (Gunther, 1864)
(Anura, Microhylidae) in Rajshahi Division,
Bangladesh. Check List 14(1): 277-280.
Rahman MM, Rabbe MF, Alam MM. 2018b.
Reproductive biology of the Assam_ Forest
Frog, Hydrophylax leptoglossa (Cope 1868)
(Anura: Ranidae), from Lawachara_ National
Park, Bangladesh. IRCF Reptiles & Amphibians
25(2):139-141.
Reza AHMA, Feeroz MM, Islam MA. 2002. Man-
in Bangladesh.
Amphib. Reptile Conserv. 222
tiger interaction in the Bangladesh Sundarbans.
Bangladesh Journal of Life Science 14(1-2): 75-
82.
Reza AHMA, Mukul S. 2009. Geographic distribution
of Rhacophorus bipuctatus (Twin-spotted Tree
Frog). Herpetological Review 40(4): 447.
Reza AHMA, Perry G. 2015. Herpetofaunal species
richness in the tropical forests of Bangladesh. Asian
Journal of Conservation Biology 4(2): 100-108.
Sagan C. 1977. Dragons of Eden. Random House,
London, United Kingdom. 263 p.
Sarker AHMR, Roskaft E. 2010. Human-wildlife
conflicts and management options in Bangladesh,
with special reference to Asian elephants (E/ephas
maximus). International Journal of Biodiversity
Science, Ecosystem Services, and Management
6(3—4): 164-175.
Stanford CB. 1991. The Capped Langur in Bangladesh:
Behavioural Ecology and Reproductive Tactics.
Karger Medical and Scientific Publishers, Basel,
Switzerland. 179 p.
Uyeda LT, Iskandar E, Purbatrapsila A, Pamungkas J,
Wirsing A, Kyes RC. 2014. The role of traditional
beliefs in conservation of herpetofauna in Banten,
Indonesia. Oryx 50(2): 296-301.
Valencia-Aguilar A, Cortes-Gomez AM, Ruiz-
Agudelo CA. 2013. Ecosystem services provided
by amphibians and reptiles in Neotropical
ecosystems. /nternational Journal of Biodiversity
Science, Ecosystem Services, and Management
9(3): 257-272.
Wahed MA, Ullah MR, Irfanullah HM. 2016. Human-
Elephant Conflict Mitigation Measures: Lessons
from Bangladesh. IUCN, International Union
for Conservation of Nature, Bangladesh Country
Office, Dhaka, Bangladesh. 30 p.
Md. Fazle Rabbe graduated in Zoology from the University of Dhaka, Bangladesh in
2016, and in 2017 received a Master’s degree in Zoology with a wildlife specialization
from the same institution. He has worked as a research assistant in the wildlife laboratory
of the zoology department. Recently, Fazle has arranged awareness and training programs
to mitigate human-reptile conflict in northwestern Bangladesh with the help of other team
members. Fazle is interested in studying anthrozoology, wildlife diseases, herpetofaunal
diversity, wildlife outside protected areas, co-management, and conservation.
Mohammad Firoj Jaman is a Professor of Zoology at the University of Dhaka, Bangladesh.
He is currently studying urban wildlife and island wildlife particularly focusing on
amphibians, reptiles, and birds. He 1s particularly interested in primate ecology and behavior,
and completed his Ph.D. from the Primate Research Institute at Kyoto University, Japan in
2010. Presently, Mohammad is actively involved in wildlife conservation and management
November 2021 | Volume 15 | Number 2 | e289
Amphib. Reptile Conserv.
Rabbe et al.
Md. Mahabub Alam is currently working as a Lecturer of Zoology at the University of
Dhaka, Bangladesh. Mahabub is working on projects of herpetofaunal diversity and
distribution, human-herpetofauna interactions, and conflicts and mitigation measures. He has
guided three M.S. research students as a co-supervisor who actually worked on amphibians
and reptiles. Mahabub is interested in wildlife conservation and management, sustainable use
of wildlife resources, species distribution, and behavioral ecology of wild animals, especially
primates, amphibians, and reptiles.
Md. Mokhlesur Rahman is currently working toward a Ph.D. at Durham University, United
Kingdom. He has been working as a lecturer of Zoology, University of Dhaka since 2015.
Recently, he has conducted research projects on amphibian physiology and disease entitled
“Identification of the presence of antimicrobial substances in skin secretions of anurans of
Bangladesh” and “Prevalence of chytridiomycosis disease in amphibians of Bangladesh.”
Since 2012, Mokhlesur has been involved in various research projects on amphibians,
mammals, and other taxa. His main areas of research interest are physiology, adaptation,
behavior, disease, ecology, and evolution of wildlife.
M A Razzaque Sarker has recently joined the University of New England, Australia, as a
research student. Since 2016, Razzaque worked in the Padma Multipurpose Bridge Project
(PMBP) as a field officer and museum assistant. After beginning work as a graduate student at
the University of Dhaka, he focused on the herpetofauna of Bangladesh. His fields of interest
include herpetofaunal diversity, conservation and management of sea snakes, acoustic
analysis of amphibian calls, and genetic analysis of cryptic species.
Ahsan Rahman Jamee graduated with a degree in Statistics from the University of Dhaka
in 2016. In 2017, Ahsan received a Master’s degree from the same institution with a thesis
entitled “Truncated Poisson-exponential survival regression model: illustration to BDHS-
2014 data” under the supervision of Professor Dr. Wasimul Bari. Currently, he is working on
survival analysis and bioscience. He is mainly interested in survival analysis, public health,
and epidemiology.
223 November 2021 | Volume 15 | Number 2 | e289
Human perceptions toward herpetofauna in northwestern Bangladesh
— ¢6S'0
= I
= €8Z0
Tr6 = 856
gs TP
— 67z0°0
= I
— 09L'F
Li6- 88
67 TI
= 87200
= I
— LES 'b
876 68
CL 9ST
— 9r'0
= I
— -9€5°0
C16 88
L8 ZI
= A910
= I
— 696'1
668 978
Tol Zl
— €91°0
= I
= _.0S6'I
I'8 06
6S1 96
a u
AW]BIOT
ATYsty = H ‘poyeonps MOT = J ‘ayeIOI [I] = '] “WUOpNys = 1S “OUNJ-UON = N JOWey = 1y SuensiyD = dD “UoyeUuOS = S “WRIST = |
- $ss'0
= I
- 8re0
Ly6 196
es Of
- ol€0
= I
— 620
1% 1°88
6L 61l
- £870
- I
= CEE
678 1°88
TLl 611
- 8zEe0
=: I
— 8s6'0
SL8 L'16
STI €8
- 100
I
— g¢9°9
E08 66
Lol UL
3. WET LO
- I
—" gfe
T98 66
gel TL
N A
as(] PIPI.
[e190S
- = 640'0
Se Lat 4
| =) 209
Lv6 86 €16
Ge. SO dg
= "2" OREO
mrs 4
ie Gr eee s 6
Ly6 968 €16
ec vol L8
- = = Ost
= 4
= |S. ote
$68 88 €6L
SOI TI L0z
= = PEO
= ie 4
= Os, Mesiz
$68 6 88
SOl 8 TSI
- - 6br'0
> ©S E
==" 668'T
Ly6 8 LE€8
ec Ol €9I
=) = REE
> OF 4
aS TES
$68 716 88
COL =S'S aw CET
H WT
snyeis
SUIP]OH puey
£86
8:06
8 £6
LL8
tcl
— ose
= Z
— 001
Lt6 S £6
ee. oO
= £060
- Z
— 6SEl
E88 $6
LIL 9
— gee
- Z
— OLIZ
608 Ls
V6l €¢l
— £670
= Z
= .%SV%
€88 LS8
LIL € Pl
— 9820
- Z
— ro
rss LB
OTe £1
— 7r'0
- Z
— 09r'l
S16 LS8
$8 €Fl
ai ‘T
uoneonpy
L96
[16
© 6
[16
c C6
8L
77 OSV 0
7. G
i S6$ I
$6 VL6
¢9 OG.
= 0000
rs ec
= Esc Ol
€96 Vt
LY OSC
7 S170
im G
= vLO€
Tvs 692
6 SI EES
7; Ove 0
cr C
a OS8'C
98 CL8
vl 8Ccl
i €v0 0
= iG
7 6L79
ces 6 bl
891 OSE
or O8c 0
a Cc
in 67S C
$8 L 68
al € Ol
N ‘d
uonednss9
€ €6
og
OL
O€
€ 76
LS
€8
a |
Go)
UOIST[OY
6vL 0
¢
6LS 0
1°96
6€
Tel 0
C
€LOV
c 06
36
LE0 0
¢
609°9
C88
8 I
€900
¢
COSS
c 06
36
IIv0
C
ELAN
9°S8
vvi
Lv8 0
C
Se 0
C88
8 Il
— 1910
= I
— 796
€L6 S$ £6
LZ. “$9
— 7r0'0
- I
— 6tl'r
Lr6 ~~ L8
cio I
— 600°0
= I
— — 08g°9
ZT16 «6 8L
8g LIZ
— IST0
= I
— 190°7
7 = 798
8 = SEl
— 1r7'0
- I
— LET
918 18
y7l 6LI
— 900°0
= I
— 100L1
96L L%6
v0 €€
A ‘W
“OS
6 16
£6
9°96
8 16
asV
Ip
1 }IPoI9
i ® SI SUID
(%) ON
(%) SOX
d
Ip
x ajdood
c SuLyoeye uso
ryoey S
(%) ON
(%) SOX
d
Ip
1 uondaouose1d
¢ dAdIOG
(%) ON
(%) SOX
d
Ip
jnyusey st
x yejiqey ueUNY
(mon SUHPUS
(%) SOX
d
Ip
xX snouosIog
(%) ON
(%) SOA
d
Ip
x [njsesy
(%) ON
(%) SOX
(Speo]/Ss0o1)
uondosiog ueuny
‘uegiQ = 9 ‘yeIny = y “USI = 'H “wnIpsypy = zl ‘MOT = "7 ‘poyeonpo
‘OVUID] = J “OTR = "J “WUdOSaTOpy = 'V ‘pose I[PpI = W ‘pesV=V
‘SJUNPUOdSAI 9Y} JO SNILIS STUIOUNDI-O1DOS JUDIOYIP 0} UOTLISI UI SpBO} pu SBOIJ PIBMO} SUOTJdddJOd UBUNY *][ squy, Arvjyuowslddng
November 2021 | Volume 15 | Number 2 | e289
4
N
N
Amphib. Reptile Conserv.
Rabbe et al.
- CLL0. — 9610
- I - |
- 1g00 - IL91
SoS SHS tS L09
Sth SSh 8h €6E
= 1000 — +9920
- I -
— gsrol - 6800
LLE 81 OE HE «OO
679 7 LSL PLL
— Ist0 — 8000
- I - |
- woz - ILOL
e79 cs L8r L99
bis. ini 19 “€e€
— €eh0 = 8180
- I -
- 9190 - €s00
LIZ Ll V6l 6LI
€8L 978 608 IZ
— Ito - zEz0
- I -
- 190 - 6H
ep ve 6€ TI
LS6 9L6 «196 8°86
— tro - 80r0
- $90 - €890
Srl 80l ZEl $6
SS8 T6888 $06
A oY i int
Ayypeo0] sae
snye1g SUIPJOH pueyT
— 6750
= G
ESL |
966 61S
rOr 8p
=. SEL
- Z
= See
LLZ 9
ETL vb
— LLVO
- Z
— 99r'€
yLS $9F
9tp TES
— $980
= Z
— 0670
ZTOT 781
S6L $18
— 79€0
= Z
— 6107
“Lt Zs
616 86
— 6r9'0
— $980
LIL € 4
E88 L'S8
1 iT
uoneonp”
vere Iss IP
— 6rd
= C
= shel
8ic 90C Te
CCL V6L O69L
— $100
* C
> €9E'8
vv9 6b S19
Oey WSS « 8.8
Oc
08
CC
= =ele®
= C
7 = <OCCC
cl OSC
$8 tl
-— ¢99°0
az ¢
= “ORO
8c Ts
8146 CL6 696
-— 1890
-— OLL0
Tcl vSl
648 98
N ‘d
uonedns09
OV
09
= BETH
= 7
= “pee
99 9S
pe 8p
— T9L°0
= (6
— 960
y9T TT
QEL SLL
= Sih
= E
— 0tE'r
60S $6
16p S$ 0b
— §9L'0
= Z
=. “Le9'0
681 OLI
118 78
— IP
= (4
mre TOre
0 OF
O01 56
— 3000
— 6096
ge sil
796 «788
S I
UOISI[OY
Cle 9¢
88L tL
C86 686
8 vsl
c =O 8
SUTyOR}e Ud
(ep)
— 9670 d 0
®
= 7 Jp ey
- Leper x Wposo og
Bsr sul §€
S9S 9F (%)ON Z
Ke)
Sep pS (%)SA 3
; =
-— 6L70 d 3
- Z jp Pe aa
oTadoo a
= a9 96¢E7 x Ss
N
©
Q
=
®
3
— €€8'0 d Zz
= Z JP
_ ; 1 uondaouoseid
cos oS (%) ON
SEp 9b = (M) SAH
- L6r0 d wl
N
= Z JP
pnyusey
“ 262. 1 x ST yeyIQey
ueuny suleys
=“ 1se@ d
a 4 Jp
- gcoz xX snouosiog
- wLo 4 >
— 3650 x 2
nyse, 5
601 TI (%) ON 2
168 88 (%)SxXA rt
W Vv ee
(soyeus) i=
oy uondosiog uewny E
uegin = 9 ‘feng = y Ys ='H ‘umIpeyy = SW ‘MoT = "FT ‘poreonpe
ATYSIH = H ‘poreonps MoT = J ‘oqesouyyy = 'T uepms —'s ‘Iowey-uON = N ‘owes = ' 4 SuenstyD = <d ‘uoyeuOS = S ‘WRIST = | ‘oyeUID.J = J ‘oye = 'W ‘Ueosajopy = ‘Vv ‘pose sIPpI = W ‘pes V=V
‘SJUDPUOdSAI DY} JO SNILIS STUIOUODI-O1D0S JUDSIOYIP 0} UOTLIOI UI SOYeUS PIeMO} SUOIdddIOd UBUIN]] °7 Bquy, ArvyUsUNAfddng
— 660
— I
— 9000
668 868
10. ZOl
— ¢Eg'0
— I
- - rr00
© 78s 8
eo)
&
= .
EF 9 9
ao - 9190
7
oD — if
® — FL10
a
& L6L 78
(oe)
c
£ cot 8i
© - z790
=)
WON I
oS
> - LITO
2.
2 ock S8
<
Sri sl
5
ELT‘0
=,
Oake I
ies ESS |
O
5 IL LI9
oO. ;
Ore SE
o
= - sr
=)
= - I
— 6840
SOL $08
SEC CHI
a
AY]EIOT
- TIT0
- I
— 6€ST
CL8 6
STI 9
— €s0°0
- I
- SLE
8:06 178
T6 OO LI
— 0z0'0
= I
— -LO¥'S
LL €68
Col ROT
— 910
- I
— 960'0
618 €£€8
Ist LOI
— §z0'0
= I
— 0€0's
ZT6S = SEL
80h 79
- 1670
- I
— 980°
QLL €€8
yw LOI
N A
Osi)
RIPSI [PID0g
- = 9€10
= G
= == 66's
68L 876 88
Tle Cl . @l
= -» e690
= Z
= = 660
16> CES. “LS
eo Tl €l
= = "690i
= i G
= “se. 079%
$68 968 SEL
SOl rrl 797
= Se OEZIO
= a Z
pe eas
68L 918 168
11% sl 601
= = SSG
= Z
-— = 7607
97S 89 7%
ply te 8E
- = §sLr0
= Z
Fe AGS PT
$68 08 TLL
SOL 0% 87
H W (I
snye1s
SUIP[OH pur]
08
Oc
C98
8 el
= $60 = = 2000
= E = + Z
= 260T = = ere
798 TU L196 TB 6F6
Ctin BL> 2 SER Ts
= 6600 - = 0cf0
= Z = Z
— $109 - — br
E88 SE6 E€€8 ST IP
LIL $9 LOL SL YS
- g100 - - Oof00
= Z = Z
- 0708 - = €rr9
S6L tL 688 Srl IZ
202. 9% AST UST OAT
= 910 = = 9590
= Z > 4 Z
- Zi9o - = tio
798 SIS €98 IPB TL
Sel T8l LOL OSI ZI
-— Tso = “& 9200
= Z = 8S Z
= “65T —- = egey
ETe €20. S2L 18 Sy
E8E LLE Slt 6h T8T
- $970 = > 61S
= Z =f 5 Z
> .9697> SD A ZIET
L8L €SL TIS 99L 9'b8
ET Let O81 VET VSI
1 ‘T ‘Sy ON ‘d
uorjeonpy uoryedns99
L96
06
Ol
€8
LI
6 C6
uegiQ =) ‘Teiny = yf ‘USI = H “wNIpsy =" ‘MOT = TJ :poyeonpa
ATYSIH = H ‘poyeonpe mo7T = J ‘ayesouyyy =|] uepms —'¢ ouuej-uON = N Jouuey —' 4 SuensuyD = <9 ‘uoyeuoS = g ‘WRIS] = | ‘oyeWIa| — J ‘oye —'W ‘Jueosajopy = Vv ‘pose sIppIW = W ‘pesv=V
‘SJUDPUOdSdI DY} JO SNILIS STUIOUNDI-O1D0S JUSIOYIP 0} UONLISI UI SpIeZI] pleMO} SUONddoJod UBUIN] *¢ BqUy, AreyUsUNOTddng
v L6
€ C6
£06
d
Jp
x
G
(%) ON
(%) S9A —- Hposo B st SUTIN]
d
JP
x
(%) ON
(%) sox : a,dood
uTyoRye UddS
d
JP
x
(%) ON
(%) sox uondasuoseid
dAdTPOG
d
JP
x
(%) ON
Ge, Nema
d
JP
x
(%) ON
(0%) SOA snouosiog
d
JP
x
(%) ON
(%) SOA [hjieof
(spiezi'T) Uondoosiog ueUINn}{
November 2021 | Volume 15 | Number 2 | e289
226
Amphib. Reptile Conserv.
Rabbe et al.
Sle 18C £0€
SCL 61IL L69
820 0
I
LOLE
8 EL
CIC
1c0'0
I
V6e S$
CAS
8 87
000°0
I
O0€ El
8 EL
C9C
SEE 0
I
1€60
LSE
€ 9
9S 0
I
css 0
8 €C
COL
06c 0
I
6ll I
8 €C
COL
L99
o Ee
08
Oc
O€
OL
== Gi os - 1610 d
= I = = 6 IP
= BoC a ge = SLE XM ~ eae
LIL 819 L99 TOL 9S (%)ON _
E8C T8E E€€ 667 PH (%)SA
- 910 - - OIL0 d
= I = 7 ré IP
a,dood
—WE HOG = =. a B89°0 x
SUTYOR}e UDO
Q9€E Gf SBE PLE th (%)SA
-—= [6006 = Se JOCEO d
= I = = j IP
uondaouo0sa1d
+ 898-C- = LOE oh “OAOTIOg
LE9 87S 9S 619 8F (%) ON
€9E Tlh MEF TBE TS (%)SA
— 0860 = = £20 d
= I = = Z IP
jnguey
- 1000 - - P6TL x Seralerat
ueuny Sulieys
= 65-0 == - 00r'0 d
= I 5 = Z IP
= ASTI'G. = = £68" x SNOUOSIOd
LSt GLE OLI Y8T 8% (%)ON
EpL VTL 78 VIL TL (%)S%A
960 = Te MIGECEO d
= I c= = Z IP
= £601 <= = “Soo xX [njieoq
SPT 6O0E S8E 6ST 9 (%) ON
TSL 169) «6S 19 «CTL OL (%) SOK
AyyeooT «RIP [e190g
= = "g6e6
7 = 4
to SSL ea
68L TL9 €9
TIz@ ze LE
NETS
OS ‘6
ee
TE9 OLE TSO
89€ Tr Pre
A tS. SEO.
— 4
=. "6re
6LS 7TE9 TIS
[tp 89€ 68¢
- = 6r'0
a od 4
ae OLS
11% TIE sre
68L 889 7S9
= = “Grdio
= tS 6
i = OSes
Vt % TL?
6LS OL BTL
= Oy BSED
a rs
- = $6r0
TIZ 88% €87
OSE TE LL
H WT
snye1sg
SUIP|OH pue’y
— 61€0
= Cc
= «880°C
679 €79
LSe. LLE
= Jeko
Cc
-— €90'P
869 C99
C9t« Be
— — 160°0
= Cc
— CO8'P
ess 6s
Ley 18
— 990'0
— Cc
— 6cr's
L8C 9%
€IL vl
— 1cr0
7 Cc
— Tel I
ee CGe EOrke
LLL 889
— — 189°0
= Cc
— 69L°0
60€ E€L7
169 LCL
T II
uoneonpy
= €100
7 6
= 9€98
LS c 69
eV 8 0€
- €00°0
a é
-— $s6r IT
GL 9 EL
8C v9S
= 000 0
Hs Cc
— v8slel
ev V9
LS 6 SE
= LVE 0
5 ¢
me ITC
PiG= 46 -e
OGL. «E99
‘3 vr6 0
= é
a VITO
Ege “ESC
6cL BAL
= 769 0
=. (6
= I€Z 0
CIO «EE
Ste “£99
Nod
uoredns9Q
— 6€80
= G
= IS€0
869 VS9
COE OPE
— 0€00
7 C
Se LOL
99: “OSS
ve vr
me 1978-0
= G
-— LOVO
995 GLS
ver SCV
— 8£¢0
= 6
= OSC
voc =~ IE
OSL. 989
AOR
ia (6
=— $660
SVC 89C
Cobh Gh
m= ~ 69¢.0
= (é
= “Seo?
€8c ST
blk, oS VL
NS) I
UOISI[DY
ATysiy{ = H ‘poyeonps MoT = 7 ‘ayes II] = "J WUOpNS = 1S “IOWUeJ-UON = N “JOWIe] = 1 SueSLYD = d ‘UOJBUOS = S “WRIST = |
‘SJUDPUOdSdI DY} JO SNILIS STUIOUODI-O1D0S JUDSIOYIP 0} UONLISI UI SPILZI] JOPUOW psJeMO} SUOT}ddoJ0d UeUNY “pf spquy, Arvjuowafddns
(SpI@ZI'T JOWUOP)
XaS osV uondosiag uewny
‘uegiQ = 9 ‘yeIny = y “USI = 'H “wNIpsypy = JI ‘MOT = "7 ‘payeonpo
‘gyeway = J ‘OTe = WW ‘Juaosajopy = ‘Vv ‘pase sIPpI = WW ‘pos v= V
November 2021 | Volume 15 | Number 2 | e289
227
Amphib. Reptile Conserv.
Official journal website:
amphibian-reptile-conservation.org
Amphibian & Reptile Conservation
15(2) [General Section]: 228— 237 (e290).
Updating the distributions of four Uruguayan hylids (Anura:
Hylidae): recent expansions or lack of sampling effort?
'2Gabriel Laufer, **Noelia Gobel, ‘Nadia Kacevas, ‘Ignacio Lado, '°Sofia Cortizas, 7*Magdalena
Carabio, °Diego Arrieta, °Carlos Prigioni, °Claudio Borteiro, and °*Francisco Kolenc
‘Area Biodiversidad y Conservacion, Museo Nacional de Historia Natural, MEC, Miguelete 1825, 11800 Montevideo, URUGUAY *Vida Silvestre
Uruguay, Canelones 1198, 11100 Montevideo, URUGUAY +Sistema Nacional de Areas Protegidas, DINAMA-MVOTMA, Galicia 1133, 11100
Montevideo, URUGUAY *Departamento de Ecologia y Biologia Evolutiva, Departamento de Biodiversidad y Genética, Instituto de Investigaciones
Biologicas Clemente Estable, Av. Italia 3318, 11600 Montevideo, URUGUAY °Instituto Tecnolégico Regional Centro Sur, Universidad Tecnologica
del Uruguay, Francisco Antonio Maciel s/n, 97000 Durazno, URUGUAY °Seccién Herpetologia, Museo Nacional de Historia Natural, MEC,
Miguelete 1825, 11800 Montevideo, URUGUAY
Abstract.—This study reviews the geographic distributions of four hylid frogs native to Uruguay:
Dendropsophus nanus, D. minutus, Lysapsus limellum, and Scinax nasicus. Their current conservation status
in Uruguay, according to the IUCN red listing criteria, is Endangered, as few locality records were available and
published in the herpetological literature to date. Herein, new field data and observations from citizen science
were gathered to review their occurrence in Uruguay more comprehensively. New records are provided that
significantly expand their distribution ranges and the numbers of known populations. This information, along
with the apparent tolerance of these species to habitat disturbance associated with agriculture, allowed us
to reconsider their conservation status in Uruguay. Recent southward range expansions in this country were
observed for D. minutus and S. nasicus, and similar phenomena are discussed for Physalaemus riograndensis
and Scinax fuscovarius. According to new new data presented here, we recommend considering D. nanus,
D. minutus, and S. nasicus, as Least Concern species locally, given their large distribution areas and many
locality records in different environments. We also recommend downgrading L. /imellum to the Vulnerable
category, as it is currently known from less than ten localities in Uruguay. These examples emphasize the
importance of fieldwork and citizen science for considering the conservation status of poorly known taxa, and
the potential impacts of climate change scenarios.
Keywords. Climate change, IUCN conservation status, Dendropsophus nanus, Dendropsophus minutus, Lysapsus
limellum, range expansion, Scinax nasicus
Citation: Laufer G, Gobel N, Kacevas N, Lado |, Cortizas S, Carabio M, Arrieta D, Prigioni C, Borteiro C, Kolenc F. 2021. Updating the distributions
of four Uruguayan hylids (Anura: Hylidae): recent expansions or lack of sampling effort? Amphibian & Reptile Conservation 15(2) [General Section]:
228-237 (e290).
Copyright: © 2021 Laufer et al. This is an open access article distributed under the terms of the Creative Commons Attribution License [Attribution
4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction in any
medium, provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced, are
as follows: official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 30 November 2020; Published: 14 November 2021
Introduction associated with other adjacent biomes (i.e., Espinal,
Chaco, and Atlantic Forest), reaching the southern
The Neotropical Region is characterized by its high
diversity of amphibians, especially anurans. This large
biogeographic region has important numbers of endemic
species and families (Duellman 1999). The herpetofauna
of Uruguay, in the southern region of the Neotropics, is
mainly composed of species associated with the Pampas
biome, which comprises Uruguay, part of northeastern
Argentina, and the extreme south of Brazil (Achkar et
al. 2016). However, some taxa occurring in northern
Uruguay are widely distributed in central South America,
Correspondence. *[email protected]
Amphib. Reptile Conserv.
boundaries of their distributions in Uruguay. Examples
include the anuran hylids Dendropsophus minutus,
Dendropsophus nanus, Lysapsus limellum, and Scinax
nasicus. These frogs are conspicuous and abundant
species throughout their geographic ranges, but the
categorization of their conservation status in Uruguay
has been controversial. For instance, Gonzalez (2001)
did not consider them as imperiled species based on field
observations, but Canavero et al. (2010) indicated that
L. limellum would be endangered because of a restricted
November 2021 | Volume 15 | Number 2 | e290
Laufer et al.
distribution range. Coincidently, Arrieta et al. (2013) only
listed the last species as being of conservation priority
at the national level because of the scarcity of available
information at that time. In contrast, these four species
were recently considered as Endangered in Uruguay
according to the IUCN categorization scheme because
of their restricted geographic distributions, relatively low
numbers of known populations, and the possible threat of
intensive land use for agriculture (Carreira and Maneyro
2019).
It must be noted that scarce and geographically biased
field survey efforts for amphibians have been carried out
historically in Uruguay, which is made evident by the
relatively recent discovery of unknown populations of
several poorly known species, e.g., Julianus uruguayus
by Kolenc et al. (2003), Pleurodema bibroni by Kolenc
et al. (2009), and Ololygon aromothyella by Laufer et al.
(2009). The distributions of some of these poorly known
and putatively endangered amphibians in Uruguay have
been underestimated, and for this reason, this work
reviews the local occurrence of D. minutus, D. nanus, L.
limellum, and S. nasicus. Fieldwork and citizen science
observations over the last 20 years have allowed us to
become familiar with these species in their habitats,
collect new data that extend their national ranges, increase
the numbers of known populations, estimate the impacts
of land use and modification on them, and reconsider the
local conservation status of these frogs. Based on this
data, the possibility that some of these species may be
experiencing a recent and rapid southward expansion of
their geographic distributions is also discussed.
Materials and Methods
The field surveys consisted of night encounters for the
detection of adult amphibians, by direct sighting and/
or listening to nuptial calls (Dodd 2010). Some voucher
specimens were collected, euthanized with an overdose of
Eugenol or intracoelomic injection of lidocaine, fixed in
formalin, and deposited in the herpetological collections
of the Departamento de Zoologia Vertebrados (ZVCB),
Facultad de Ciencias, and Museo Nacional de Historia
Natural (MNHN), Montevideo, Uruguay. Although this
communication is based on our own fieldwork data,
complementary information was obtained from the
Uruguayan Biodiversidata database (available from
https://biodiversidata.org) and the iNaturalist citizen
science database (available from https://www.inaturalist.
org). Biodiversidata is an open database, managed by
experts from national and international institutions
working on biodiversity (Grattarola et al. 2019). The
iNaturalist database includes images and sound records
from community-based surveys, which are added to
the iNaturalist website, and confirmed by international
specialists. When a record reaches confirmation by at
least two specialists, it is classified as being of “Research
Grade” (Van Horn et al. 2018). All records of the studied
Amphib. Reptile Conserv.
species included here are ones that presented this
qualification. In addition, previously published records
were included, such as those in regional publications not
widely available, and in online literature databases.
The records were mapped for each of the four species,
and their extent of occurrence in Uruguay were obtained
by joining the most peripheral record points in a polygon.
For records located very close to the country borders,
these limits were considered in building the polygon. The
resulting distributions were used for a reassessment of
the species conservation status at the national level using
the JUCN Red List of Threatened Species criteria (IUCN
2012).
With the objective of evaluating whether any of these
four hylids specialized in habitat use, information about
the environment was collected whenever possible. Three
main types of environments were considered for this
attribute: Crops (rainfed crops, rice, and Eucalyptus and/
or Pinus afforestation), Natural (grasslands, wetlands,
and native forests with low anthropic influence including
extensive cattle farms), and Urban (urbanized and peri-
urban areas, routes or industrial facilities). In this way,
the percentages of records corresponding to each one
of these characteristic environments were calculated.
The Chi-square test (v7) was used to assess whether the
records for each species were evenly distributed among
the three environment types (Rayat 2018). Data analyses
were done in R open software, and a < 0.05 was the
criterion for achieving significance (R Core Team 2019).
Results and Discussion
New Records
For better visualization of new geographical data and
the discussion of conservation status, the updated
distributions of the studied taxa in Uruguay are pictured
considering previously published records of accessions
in herpetological collections (Fig. 1). The new species
records are as listed here, where NV indicates non-
vouchered specimens represented by call and/or visual
records in the surveys.
Dendropsophus minutus. Departamento de Cerro Largo:
Acegua (NV, 11 July 2011; NV, 22 October 2012:
MNHN 9551, 6 February 2013; NV, 23 November
2018); Paso de la Mina (NV, 11 November 2017);
Isidoro Noblia (NV, 19 December 2016); Paso Centurion
(Biodiversidata, 2015, day and month not available);
Melo (MNHN 9922, 22 October 2003); Melo, National
Route 8, 2 km southeast from Melo (Biodiversidata,
23 October 2003); Surroundings of Rio Branco city
(Biodiversidata, 22 January 2014). Departamento de
Treinta y Tres: access to the protected area Quebrada de
los Cuervos (MNHN 9925, 2 December 2001); Quebrada
de los Cuervos (MNHN 9923, 1 October 2001; MNHN
9304, 9 November 2002; MNHN 8503 and MNHN
November 2021 | Volume 15 | Number 2 | e290
Distribution and conservation status of four hylids in Uruguay
D. minutus
L. limellum
D. nanus
/ @
AR
,
:
SA
<
z
za
i}
oO
| Of
lx
S. nasicus
J
ARGENTINA
F
ee
v3]
Zz
Aaa a |
Fig. 1. Distribution of Dendropsophus minutus, D. nanus, Lysapsus limellum, and Scinax nasicus in Uruguay. Shaded areas
correspond to estimated distributions according to Carreira and Maneyro (2019, yellow), and the closest national protected areas
(green). Black dots indicate previous literature records from Gudynas and Rudolf (1983), Langone and Basso (1987), Olmos et
al. (1997), Kolenc et al. (2003), Nufiez et al. (2004), and Prigioni et al. (2011). New records in the present study are indicated in
red. Department names are indicated as follows: AR, Departamento de Artigas; SA, Departamento de Salto; PA, Departamento de
Paysandu; RN, Departamento de Rio Negro; CL, Departamento de Cerro Largo; and TT, Departamento de Treinta y Tres.
8068, 2 March 2009; MNHN 9933, 25 November 2014;
NV, 5 March 2015); National Route 8, 5 km northward
from Ciudad de Treinta y Tres (NV, 15 January 2020);
National Route 8, 20 km northward from Ciudad de
Treinta y Tres (MNHN 9924, 2 November 2009); Route
98, ca. 7 km northward from Isla Patrulla (MNHN 9926,
2 November 2009).
Dendropsophus nanus. Departamento de Artigas: ALUR,
ponds on roadsides of industrial facilities (MNHN
9929-9930, 15 January 2004); Arroyo Falso Mandiyu
at National Route 3, artificial pond for irrigation of
sugarcane (NV, 12 March 2002); Arroyo Itacumbu,
marshes satellite to main course (NV, 11 March 2002);
Arroyo Lenguazo, CALPICA, dam on main stream
(NV, 12 February 2003); Arroyo Yacaré, close to Rio
Amphib. Reptile Conserv.
230
Cuareim (ZVCB 8281-8282, 15 January 1999); Bella
Union, pond in urban area (MNHN 9428-9430, 9
February 2011); CAINSA, National Route 3 km 615,
pond on the roadside (MNHN 9931, 13 January 2003);
CALVINOR, artificial pond for irrigation of intensive
crops (NV, 13 January 2001); Colonia Vifiar, National
Route 30 km 5, artificial dam on creek for irrigation of
sugar cane (MNHN 9927 and ZVCB 10248, 19 January
2002); COPCABU, close to the Uruguay River, dammed
creek for irrigation of rice (MNHN 9928, 13 January
2003); Establecimiento Amoros, National Route 3 km
609 (ZVCB 10246, 13 December 2001); Paso del Leon
(MNHN 9480 and MNHN 9481, 5 December 2012).
Departamento de Salto: pools for wastewater treatment
and lagoon edge, Salto Grande Dam (MNHN 9934, 16
November 2019); surrounding area of Salto Grande Dam
November 2021 | Volume 15 | Number 2 | e290
Laufer et al.
(Biodiversidata, 15 February 2013).
Lysapsus limellum. Departamento de Artigas: Bella
Union, outskirts of urban area (NV, February 2001);
Bella Union, Los Pinos, cattle pond (MNHN 9919, 10
February 2011); CAINSA, National Route 3 km 615,
artificial pond (NV, 25 March 2019); COPCABU, close
to Uruguay River, artificial pond for rice irrigation
(MNHN 9920, 13 January 2003); Paso del Leon (MNHN
9482-9484, 4 December 2012, and Biodiversidata);
Rincon de Franquia, marshes (NV, February 2011).
Scinax nasicus. Departamento de Artigas: ALUR, ponds
on roadsides of industrial facilities (MNHN 9914, 14
December 2001); Arrocera Conti, human habitation and
rice crops area(MNHN 9126, MNHN 9128-9133, MNHN
9137-9138, 13 October 1981; MNHN 9235-9236, 28
November 1981); Arroyo Naquifia, los Espinillos farm,
dammed creek for cattle and irrigation of rice (NV, 9
January 2003); Arroyo Tigre when joining the Uruguay
River (MNHN 9921, 6 March 2004); Bella Union, Parque
Rivera, on roadside ponds (MNHN 9917, 8 January
2001); Bella Union, Los Pinos (MNHN 9916, 10 February
2011); CAINSA, National Route 3 km 615, artificial
pond (NV, 15 January 2004); Colonia Vifiar, National
Route 30 km 5, artificial dam on creek for irrigation of
rice (MNHN 9913, 19 January 2002); National Route 3
km 596 (MNHN 9918, 13 March 2002); National Route
30 km 4, artificial pond for livestock (MNHN 9915, 18
March 2002); Paso del Leon (Biodiversidata, 4 December
2012). Departamento de Salto: Arroyo Boicua, gallery
forest (MNHN 9349); surrounding area of Salto Grande
Dam (Biodiversidata, 15 February 2013). Departamento
de Paysandu: Paysandu city (Naturalist, 9 January 2020);
Rio Queguay, close to Lorenzo Geyres (MNHN 9912,
January 1989); surroundings of Meseta de Artigas, natural
forest (Naturalist, 14 February 2020); Termas de Guaviyu
(MNHN 8213, December 1998). Departamento de Rio
Negro: Route 24, south of Arroyo Negro (Naturalist,
22 December 2019); Route 24, south of Arroyo Negro
(iNaturalist, 2 February 2020); crops surrounding Esteros
de Farrapos e Islas del Rio Uruguay National Park (MNHN
9932, 3 November 2018); M’Bopicua (NV, 18 November
2002).
Species Distributions
Dendropsophus minutus was first included in the
Uruguayan herpetofauna by Olmos and collaborators
(1997), who found it at a few localities in Cerro Largo
Department in 1996. Previous citations of this species
from Uruguay correspond to specimens of Julianus
uruguayus, When the two taxa were considered
synonymous (1.e., Braun and Braun 1974, as Ayla
minuta). More recently, new records of D. minutus were
available from the protected area Quebrada de los Cuervos
y Sierras del Yerbal, in Treinta y Tres Department, where
Amphib. Reptile Conserv.
the species occupies natural and artificial lentic water
bodies (Kolenc et al. 2003; Prigioni et al. 2011). It is
noteworthy that D. minutus was reported quite recently
from northeastern Uruguay, given its current abundance,
high population density, and the fact that it can be easily
identified and detected by its conspicuous advertisement
call. Furthermore, males can be heard vocalizing for an
extended period during the entire spring and summer
(Prigioni et al. 2011). This frog was not detected during
inventory systematic surveys of vertebrates in the
protected area Quebrada de los Cuervos y Sierras del
Yerbal, held between October 1988 and January 1991
(Sim6 et al. 1994). However, the species was established
in the area at least since the early 2000s, being one of the
most common amphibians during night acoustic surveys
in the warmest periods of the year (e.g., Prigioni et al.
2011; Laufer et al. 2015). Currently, D. minutus can be
found farther south. These historical and new observations
suggest that D. minutus is expanding its geographic range
in Uruguay, in a southward direction. This expansion first
occurred over hilly landscapes of the ecoregion Serranias
del Este, but more recently in adjacent lowland areas
close to Treinta y Tres city. This range expansion may
have been aided by climate change and/or the ability of
the species to colonize both natural and artificial ponds
constructed for cattle, and also altered areas such as those
with exotic forest plantations of Pinus and Eucalyptus
(G. Laufer, pers. obs.) (Fig. 2). The same phenomenon
has possibly occurred with the hylid Scinax fuscovarius
which is associated with the hilly landscapes of northern
Uruguay. Examples of this species were not known in the
country until the early 1990s (see Arrieta and Maneyro
1999), but currently it 1s a fairly common and abundant
frog in much of Rivera, eastern Artigas, and northern
Tacuarembo Departments (C. Borteiro and F. Kolenc,
pers. obs.). Although this area was not thoroughly
surveyed historically, it is unlikely that this relatively
100
xe 75
§
Ee a Crops
5 50 [J Natural
= | Urban
iT
25
0
D. minutus D.nanus L. limellum S. nasicus
Fig. 2. Occurrence of Dendropsophus minutus (n = 15), D.
nanus (n = 15), Lysapsus limellum (n = 6), and Scinax nasicus
(n = 21) in different types of environments. Crops include
rainfed crops, rice, sugar cane, and Eucalyptus and/or Pinus
afforestations; Natural includes the grasslands, wetlands, and
native forests with low anthropic influence (i.e., extensive
livestock farming); and Urban refers to urban and peri-urban
areas, routes, or industrial plants.
November 2021 | Volume 15 | Number 2 | e290
Distribution and conservation status of four hylids in Uruguay
large, conspicuous, and common peri-domiciliary hylid,
if present, would have passed uncollected. Monitoring of
the distributions of these hylid frogs in Uruguay merit
future studies.
Another frog that apparently underwent a significant
range expansion in Uruguay is the _ leptodactylid
Physalaemus riograndensis. This small and noisy species,
whose advertisement call can be heard mostly during the
summer months, was first cited for northern Uruguay by
Cei and Roig (1961). This was later corroborated by the
observations of Prigioni and Langone (1983), who also
listed specimens from the east (Placido Rosas, Cerro
Largo), collected in 1982. Later, Prigioni and Garcia
Sanchez (2002) described the tadpole of P. riograndensis
based on specimens collected in 1988, ca. 130 km farther
south at La Coronilla, Rocha Department. The species 1s
currently a conspicuous component of wetlands of the
Laguna Merin basin in much of eastern Uruguay, and
over sandy habitats of the Atlantic coast of Rocha in the
southeast from the locality Barra de Valizas to the border
with Brazil (Borteiro and Kolenc 2007; Prigioni et al.
2011). Barra de Valizas (its southernmost known locality;
Borteiro and Kolenc 2007) was thoroughly surveyed by
one of the authors (F. Kolenc) during the second half of
the 1980s and the species was not present there at that
time (see also Vaz-Ferreira et al. 1966). These historical
records and surveys by the authors suggest a range
expansion of P. riograndensis over the wetlands in the
eastern plains of Uruguay, at least since the 1980s.
Three additional species of amphibians recently
known from only a few specimens collected in less
than five localities in northern Uruguay, are widely
distributed in adjacent areas of Brazil and Argentina:
Boana_ albopunctata, Leptodactylus furnarius, and
Physalaemus cuvieri (Canavero et al. 2001; Kwet et al.
2002; Maneyro and Beheregaray 2007). In these cases, it
is difficult to assess whether a range expansion took place
or, alternatively, if those findings are just evidence of a
lack of sampling effort close to the border with Brazil.
Three of the species studied here, D. nanus, L. limellum,
and S. nasicus, are widely distributed in association with
the Chaco and Espinal biomes, and they marginally
reach northwestern Uruguay in a narrow lowland area of
grasslands adjacent to the Uruguay River, and westward
from the hilly formation Cuchilla de Haedo.
The presence of D. nanus in this country was first
communicated by Langone and Basso (1987) through
evidence of two localities in the northern Artigas
Department, at Barra del Arroyo Yacui, and 6 km NW
from Belén. It was recently categorized as Endangered
because of its limited distribution, agricultural land use,
and the construction of the Salto Grande hydroelectric
dam in the Uruguay River (Carreira and Maneyro 2019).
However, it is fairly abundant at the several localities
cited above for the Artigas and Salto Departments and
also in their surroundings. This frog is almost invariably
present in cattle ponds and the shallow areas in hundreds
Amphib. Reptile Conserv.
of medium to large artificial lagoons used for agriculture,
which are produced by dams built on creeks and streams,
that range from a few to hundreds of ha in area (Uruguay
2000; Fig. 2). Besides, it is commonly found in the water
bodies which are satellites to the main lake of the Salto
Grande Dam (G. Laufer and N. Gobel, pers. obs.).
Gudynas and Rudolf (1983) were the first to report the
collection of a specimen of L. /ime/lum in northwestern
Uruguay, at Termas del Arapey in 1973, and the species
has been viewed as a rarity in the Uruguayan herpetofauna
since then. We observed during field surveys that this
frog mostly inhabits vegetated man-made water bodies.
It colonizes cattle ponds and small dams built as water
reservoirs for the irrigation of rice and sugarcane (Fig. 2).
Large choruses were detected in shallow waters, and up
to approximately 2 m depth, in rice crop water reservoirs.
Specimens of L. /imellum were reported to disperse from
the Parana River system in Argentina across the De la
Plata River in large masses of floating vegetation, mainly
composed of water hyacinths (Eichhornia crassipes) that
occasionally aggregate in southern Uruguay (Achaval
et al. 1979), but we do not know of any successfully
established populations near the De la Plata River shores
in Uruguay.
The new locality reported in this work for S. nasicus
at M’Bopicua, is about 193 km (straight-line distance)
south from the previous southernmost record in Uruguay
by Nufiez and collaborators (2004, Fig. 1). Other
encounters south from the previously known distribution
are also reported here. The behavioral ecology of S.
nasicus in northern Uruguay suggests wide plasticity
in habitat use, as also observed elsewhere (Kacoliris et
al. 2006; Entiauspe-Neto et al. 2016). Our data indicate
that it is frequent and abundant in northwestern Uruguay,
inhabiting natural water bodies but also anthropized and
urban areas, even inside human habitations (Fig. 2).
This was expected considering its latitudinal distribution
in Argentina, on the other side of the Uruguay River
(Agostini et al. 2016).
Conservation Status and Threat Considerations
The conservation assessment of Uruguayan amphibians
has rarely been based on systematic field surveys (.e.,
Kolenc et al. 2009), but has relied mostly on previous
records in herpetological collections or a researcher’s
perception of species status (Carreira and Maneyro 2019).
In this case study, the several new records for each of the
four studied species significantly extend their ranges and
known populations. These records were obtained from
a wide diversity of environments, such as urbanized
areas, human habitations, backyards, grasslands, the
edges of native forests, and areas of intensive agriculture
and cattle production (Fig. 2). In fact, in most cases, the
records were distributed approximately evenly among
the environments. The distributions of D. nanus (97 =
0.2, df = 2, P = 0.9), L. limellum (x? = 0.5, df = 2, P
November 2021 | Volume 15 | Number 2 | e290
Laufer et al.
= 0.8), and S. nasicus (y? = 0.9, df = 2, P = 0.6), were
equiprobable among the three different environment
types. The greatest difference appears for D. minutus,
for which the records corresponded mostly to the Natural
environment type (7? = 8.9, df = 2, P = 0.01; Fig. 2).
The distribution of this species 1s mainly associated with
Serranias del Este, an ecoregion characterized by a low
grade of urbanization and extent of intensive agriculture
(Evia and Gudynas 2000).
The lack of previous data does not allow the
differentiation between episodes of recent dispersal and
low sampling effort, at least in D. nanus and L. limellum.
In the case of S. nasicus, its presence in southern Paysandu
and Rio Negro Departments seems to be recent. In any
case, they are each common and abundant species. Their
distributions in Uruguay largely overlap with those of
the toad Rhinella diptycha and the frog Lepatodactylus
chaquensis (Nufiez et al. 2004), species currently not
considered as Endangered, and that eventually may face
similar threats due to habitat alterations.
It should be noted that for all the studied species,
the potential threats to their conservation are mainly
related to habitat alteration and biological invasions.
Another significant potential hazard for amphibians
in northwestern Uruguay is the strong and increasing
advance of intensive agriculture, especially soybean
crops and Eucalyptus plantations (Brazeiro et al. 2020;
Soutullo et al. 2020). In fact, there is already evidence that
agrochemicals and the eutrophication of lentic systems
(breeding sites) negatively affect individual fitness, with
empirical regional evidence in S. nasicus (Peltzer et al.
2008), L. limellum (Attademo et al. 2015), D. nanus
(Suarez et al. 2016), and D. minutus (Goncalves et al.
2015). However, the widespread construction of ponds
and dams for cattle and irrigation of rice and sugarcane
crops have favored the persistence of these and several
other amphibian species and reptiles in agricultural areas
with intensive land use, including those studied herein
(Borteiro 2005; Borteiro et al. 2008). Furthermore, like
other congeners (1.e., S. granulatus and S. fuscovarius),
S. nasicus 1s commonly found in_ peridomestic
environments and breeds in artificial water bodies as
we observed in the study area. Carreira and Maneyro
(2019) indicated that the Salto Grande Dam constitutes a
threat to local populations of amphibians, particularly D.
nanus and S. nasicus. However, the construction of that
dam produced minimal habitat loss as compared to total
potential habitat of the studied species in northwestern
Uruguay. In addition, studies on the possible impact
following the construction of the dam indicated the use
of its available new habitats by some amphibian species,
such as Leptodactylus luctator, Melanophryniscus
atroluteus, Rhinella diptycha, and R. dorbignyi, also as
breeding sites (Vaz-Ferreira et al. 1981, 1982).
Another major threat to the studied species is the
invasive American Bullfrog (Lithobates catesbeianus),
that is rapidly expanding in Uruguay (Laufer et al. 2018).
Amphib. Reptile Conserv.
Although there are records of this invader near the coast
of the Uruguay River, its greatest expansion was recorded
in the east. In Cerro Largo Department, D. minutus 1s
present at sites that are being colonized by this invasive
anuran (Laufer and Gobel 2017).
The new records indicate that the studied species are
present in larger extents of occurrence than previously
considered in Uruguay (D. minutus 7,685 km?*, D. nanus
3,046 km?, L. limellum 3,116 km’, and S. nasicus 7,329
km7), with each one occurring in more than ten different
localities (except for L. /imellum), and showing plasticity
in habitat use, which merit reconsiderations of their
current local conservation status levels. Additionally,
there is no evidence of reductions in the number of
populations or range retractions for any of them. None
of these four species qualify for their currently assigned
categories in the JUCN Red List of Threatened Species
at our national level. We consider that D. minutus, D.
nanus, and Scinax nasicus should be considered locally
as Least Concern, and only L. Jime/llum as Vulnerable,
due to its restricted distribution in a few localities in
northern Uruguay. These assumptions are reinforced by
the fact that the studied species were identified in several
national SNAP protected areas (Sistema Nacional
de Areas Protegidas): Rincon de Franquia (Artigas
Department, except for D. minutus), Esteros de Farrapos
e Islas del Rio Uruguay (Rio Negro Department, S.
nasicus), Esteros y Algarrobales del Rio Uruguay and
probably in Montes del Queguay (Paysandt' Department,
S. nasicus), the projected protected area Humedales e
Islas del Hum (Soriano and Rio Negro Departments,
S. nasicus), and Quebrada de los Cuervos y Sierras del
Yerbal, and Paso Centurion y Sierra de Rios (Cerro Largo
and Treinta y Tres Departments, D. minutus). These areas
have great potential for the conservation of many of the
poorly known components of the native herpetofauna in
Uruguay.
Niche modelling projections under presumed future
climate change scenarios show that the four hylid species
studied in this work, and also S. fuscovarius and P.
riograndensis, show potential range expansions at a 50-
year time projection (Toranza 2011). According to our
field observations, we believe that this range expansion
has already been happening over the past 20-30 years, at
least for some of these species.
Conclusions
This work underscores the need for continuing amphibian
monitoring surveys in much of northern and eastern
Uruguay. Despite the small size of this country, there
is still a strong geographical bias in the knowledge of
its biodiversity (Grattarola et al. 2019). We conclude
that although it is laborious, the extensive collection
of fieldwork data and collaborative work among
herpetologists 1s mandatory for accurate assessments
of the conservation needs of our native amphibians.
November 2021 | Volume 15 | Number 2 | e290
Distribution and conservation status of four hylids in Uruguay
We also reinforce the importance of open biological
databases and citizen science projects to increase the
scientific knowledge and awareness to conserve native
biodiversity.
Acknowledgments.—The authors acknowledge the
valuable support during field surveys from the CTM Salto
Grande team, Valentin Leites, and Gonzalo Machado;
and the Esteros de Farrapos e Islas del Rio Uruguay team,
Fabricio Mendieta, Graciela Viera, Ricardo Merni, Angel
Rosano, Gabriel Pineda, and Francisco Bergos. Other
friends that participated in field surveys were: Marcelo
Tedros, Francisco Gutiérrez, Enrique Gonzalez, Miguel
Silva, and Sergio Ripoll. Some records and voucher
specimens were provided by Franco Teixeira de Mello,
Lucia Ziegler, Sabrina Clavijo, Enrique Gonzalez, Ivan
Gonzalez-Bergonzoni, and Juan Villalba. We are grateful
to SNAP, CTM Salto Grande, the NGO Vida Silvestre
Uruguay, the MNHN, and the Biodiversidata (especially
to Florencia Grattarola), for their support, logistics, and
financial assistance. GL, FK, and CB are members of
Sistema Nacional de Investigadores (SNI-ANII), and GL
of PEDECIBA — Universidad de la Republica; NG and
NK are postgraduate scholars of the ANII.
Literature Cited
Achaval F, Gonzalez JG, Meneghel M, Melgarejo AR.
1979. Lista comentada de material recogido en costas
uruguayas, transportado por camalotes desde el rio
Parana. Acta Zoologica Lilloana 35: 195-200.
Achkar M, Diaz I, Dominguez A, Pesce F. 2016.
Uruguay: Naturaleza, Sociedad, Economia: una
Vision desde la Geografia. Ediciones de la Banda
Oriental, Montevideo, Uruguay. 374 p.
Agostini MG, Saibene PE, Roesler CI, Bilenca DN. 2016.
Amphibians of northwestern Buenos Aires province,
Argentina: checklist, range extensions, and comments
on conservation. Check List 12: 1-10.
Arrieta D, Maneyro R. 1999. Sobre la presencia de
Scinax fuscovarius (A. Lutz, 1925) (Anura, Hylidae)
en Uruguay. Boletin de la Sociedad Zooldgica del
Uruguay (2° Epoca) 10: 15-19.
Arrieta D, Borteiro C, Kolenc F, Langone JA. 2013.
Anfibios. Pp. 112-127 In: Especies Prioritarias para
la Conservacion en Uruguay. Sistema Nacional de
Areas Protegidas, Montevideo, Uruguay. 222 p.
Attademo AM, Peltzer PM, Lajmanovich RC, Cabagna-
Zenklusen M, Junges CM, Lorenzatti E, Ard C, Grenon
P. 2015. Biochemical changes in certain enzymes
of Lysapsus limellium (Anura: Hylidae) exposed
to chlorpyrifos. Ecotoxicology and Environmental
Safety 113: 287-294.
Borteiro C. 2005. Abundancia, estructura poblacional
y dieta de Yacarés (Caiman latirostris. Crocodylia,
Alligatoridae) en ambientes antropicos del
Departamento de Artigas, Uruguay. M.S. Thesis,
Amphib. Reptile Conserv.
Facultad de Ciencias, Universidad de la Republica,
Montevideo, Uruguay.
Borteiro C, Kolenc F. 2007. Redescription of the tadpoles
of three species of frogs from Uruguay (Amphibia:
Anura: Leiuperidae and Leptodactylidae), with notes
on natural history. Zootaxa 1638: 1—20.
Borteiro C, Gutiérrez F, Tedros M, Kolenc F. 2008.
Conservation status of Caiman latirostris (Crocodylia:
Alligatoridae) in disturbed landscapes of northwestern
Uruguay. South American Journal of Herpetology 3:
244-250.
Brazeiro A, Achkar M, Toranza C, Bartesaghi L. 2020.
Agricultural expansion in Uruguayan grasslands
and priority areas for vertebrate and woody plant
conservation. Ecology and Society 25: 15.
Braun PC, Braun CAS. 1974. Fauna da frontera Brasil-
Uruguai, lista dos anfibios dos Departamentos de
Artigas, Rivera e Cerro Largo. [heringia (Zoologia)
45: 34-49.
Canavero A, Naya DE, Maneyro R. 2001. Leptodactylus
furnarius Sazima and Bokermann, 1978 (Anura:
Leptodactylidae). Cuadernos de Herpetologia 15:
89-91.
Canavero A, Carreira S, Langone JA, Achaval F, Borteiro
C, Camargo A, da Rosa I, Estrades A, Fallabrino A,
Kolenc F, et al. 2010. Conservation status assessment
of the amphibians and reptiles of Uruguay. /heringia
(Zoologia) 100: 5-12.
Carreira S, Maneyro R. 2019. Libro Rojo de los Anfibios
y Reptiles del Uruguay. DINAMA-MVOTMA,
Montevideo, Uruguay. 206 p.
Dodd CK. 2010. Amphibian Ecology and Conservation:
a Handbook of Techniques. Oxford University Press,
Oxford, United Kingdom. 556 p.
Duellman WE. 1999. Patterns of Distribution of
Amphibians: a Global Perspective. Johns Hopkins
University Press, Baltimore, Maryland, USA. 633 p.
Entiauspe-Neto O, Perleberg T, de Freitas MA. 2016.
Herpetofauna from an urban Pampa _ fragment
in southern Brazil: composition, structure, and
conservation. Check List 12: 1-15.
Evia G, Gudynas E. 2000. Ecologia del Paisaje en
Uruguay. DINAMA-Junta de Andalucia, Montevideo,
Uruguay. 147 p.
Goncalves MW, Vieira TB, Maciel NM, Carvalho WE,
Lima LSF, Gambale PG, da Cruz AD, Nomura F,
Bastos RP, Silva DM. 2015. Detecting genomic
damage in the frog Dendropsophus minutus: preserved
versus perturbed areas. Environmental Science and
Pollution Research 22: 3,947—3,954.
Gonzalez EM. 2001. Especies en peligro: marco teorico
y resultados de una década de trabajo de campo con
vertebrados tetrapodos en Uruguay. Pp. 11-21 In:
Ill Jornadas sobre Animales Silvestres, Desarrollo
Sustentable y Medio Ambiente: Noviembre 2001,
Montevideo. Editor, Facultad de Veterinaria, Comision
Ambientalista Aoniken, Montevideo, Uruguay. 46 p.
November 2021 | Volume 15 | Number 2 | e290
Laufer et al.
Grattarola F, Botto G, da Rosa I, Gobel N, Gonzalez
EM, Gonzalez J, Hernandez D, Laufer G, Maneyro
R, Martinez-Lanfranco JA. 2019. Buiodiversidata:
an open-access biodiversity database for Uruguay.
Biodiversity Data Journal 7. e36226.
Gudynas E, Rudolf JC. 1983. Nota sobre la presencia
de Lysapsus limellus limellus en Uruguay (Anura:
Pseudidae). Centro Educativo Don Orione,
Contribuciones en Biologia 9: 1-7.
IUCN. 2012. Guidelines for Application of IUCN Red
List Criteria at Regional and National Levels, Version
4.0. IUCN, Gland, Switzerland and Cambridge,
United Kingdom. 48 p.
Kacoliris F, Horlent N, Williams J. 2006. Herpetofauna.
Coastal dunes, Buenos Aires Province, Argentina.
Check List 2: 15-21.
Kolenc F, Borteiro C, Tedros M. 2003. La larva de
Ayla uruguaya Schmidt, 1944 (Anura: Hylidae), con
comentarios sobre su biologia y en Uruguay y su
status taxondmico. Cuadernos de Herpetologia 17:
87-100.
Kolenc F, Borteiro C, Baldo D, Ferraro D, Prigioni
C. 2009. The tadpoles and advertisement calls of
Pleurodema bibroni Tschudi and Pleurodema kriegi
(Miller), with notes on their geographic distribution
and conservation status (Amphibia, Anura,
Leiuperidae). Zootaxa 1969: 1-35.
Kwet A, Solé M, Miranda T, Melchiors J, Naya D,
Maneyro R. 2002. First record of Hyla albopunctata
Spix, 1824 (Anura: Hylidae) in Uruguay, with
comments on the advertisement call. Boletin de la
Sociedad Herpetologica Espafiola 13: 15-19.
Langone JA, Basso NG. 1987. Distribucion geografica
y sinonimia de Hyla nana Boulenger, 1989 y de
Hyla sanborni Schmidt, 1944 (Anura, Hylidae) y
observaciones sobre formas afines. Comunicaciones
Zoolégicas del Museo Nacional de Historia Natural
de Montevideo 11: 1-17.
Laufer G, Pifieiro-Guerra JM, Pereira-Garbero R,
Barreneche JM, Ferrero R. 2009. Distribution
extension of Scinax aromothyella (Anura, Hylidae).
Biota Neotropica 9: 275-277.
Laufer G, Gobel N, Etchebarne V, Carabio M, Loureiro
M, Altesor A, Pereira-Garbero R, Gallego F, Costa B,
Serra WS, et al. 2015. Monitoreo de Biodiversidad
del Paisaje Protegido Quebrada de los Cuervos.
DINAMA-MVOTMA, Montevideo, Uruguay. 55 p.
Laufer G, Gobel N. 2017. Habitat degradation and
biological invasions as a cause of amphibian richness
loss: a case report in Acegua, Cerro Largo, Uruguay.
Phyllomedusa 16: 289-293.
Laufer G, Gobel N, Borteiro C, Soutullo A, Martinez-
Debat C, de Sa RO. 2018. Current status of the
American Bullfrog, Lithobates catesbeianus, invasion
in Uruguay and exploration of chytrid infection.
Biological Invasions 20: 285-291.
Maneyro R, Beheregaray M. 2007. First record of
Amphib. Reptile Conserv.
Physalaemus cuvieri Fitzinger, 1826 (Anura,
Leiuperidae) in Uruguay, with comments on the
anuran fauna along the borderline Uruguay-Brazil.
Boletin de la Sociedad Zoologica del Uruguay (2°
Epoca) 16: 36-41.
Nufiez D, Maneyro R, Langone J, De Sa RO. 2004.
Distribucion geografica de la fauna de anfibios del
Uruguay. Smithsonian Herpetological Information
Service 134: 1-34.
Olmos A, Prigioni CM, Achaval F. 1997. Hyla minuta
Peters, 1872. Un nuevo Hylidae para el Uruguay
(Amphibia: Anura: Hylidae). Acta Zooldgica Platense
balan
Peltzer PM, Lajmanovich RC, Sanchez-Hernandez JC,
Cabagna MC, Attademo AM, Basso A. 2008. Effects
of agricultural pond eutrophication on survival and
health status of Scinax nasicus tadpoles. Ecotoxicology
and Environmental Safety 70: 185-197.
Prigioni CM, Garcia Sanchez JE. 2002. Descripcion de
la larva de Physalaemus riograndensis Milstead, 1960
(Anura: Leptodactylidae). Acta Zoologica Platense 1:
L=5:
Prigioni CM, Langone JA. 1983. Nuevo hallazgo de
Physalaemus riograndensis Milstead, 1960, (Anura,
Leptodactylidae). Boletin de la Sociedad Zoologica
del Uruguay (2" Epoca) 1: 81-84.
Prigioni C, Borteiro C, Kolenc F. 2011. Amphibia and
Reptilia, Quebrada de los Cuervos, Departamento de
Treinta y Tres, Uruguay. Check List 7: 763-767.
R Core Team. 2019. R: A language and environment for
Statistical computing. R Foundation for Statistical
Computing, Vienna, Austria. Available: https://
www.R-project.org/ [Accessed: 12 May 2020].
Rayat CS. 2018. Statistical Methods in Medical Research.
Springer, Singapore. 173 p.
Simo M, Pérez-Miles F, Ponce de Leon AFE, Achaval
F, Meneghel M. 1994. Relevamiento de fauna de la
Quebrada de los Cuervos; area natural protegida
(Dpto. Treinta y Tres, Uruguay). Boletin de la
Sociedad Zooldgica del Uruguay (2a Epoca) 2: 1-20.
Soutullo A, Rios M, Zaldua N, Teixeira de Mello F.
2020. Soybean expansion and the challenge of the
coexistence of agribusiness with local production and
conservation initiatives: pesticides in a Ramsar site in
Uruguay. Environmental Conservation 47: 1-7.
Suarez RP, Zaccagnini ME, Babbitt KJ, Calamari
NC, Natale GS, Cerezo A, Codugnello N, Boca T,
Damonte MJ, Vera-Candioti J, et al. 2016. Anuran
responses to spatial patterns of agricultural landscapes
in Argentina. Landscape Ecology 31: 2,485-2,505.
Toranza C. 2011. Riqueza de anfibios de Uruguay:
determinantes ambientales y posibles efectos del
cambio climatico. M.S. Thesis, Universidad de
la Republica, Facultad de Ciencias, Montevideo,
Uruguay.
Uruguay. 2000. Aprovechamiento de los Recursos
Hidricos Superficiales. Inventario Nacional 1998-
November 2021 | Volume 15 | Number 2 | e290
Distribution and conservation status of four hylids in Uruguay
1999. Direcci6n Nacional de Hidrografia, Ministerio
de Transporte y Obras Publicas, Montevideo,
Uruguay. 97 p.
Van Horn G, Mac Aodha O, Song Y, Cui Y, Sun C,
Shepard A, Adam H, Perona P, Belongie S. 2018.
The iNaturalist species classification and detection
dataset. Pp. 8,769-8,778 In: Proceedings of the
IEEE Conference on Computer Vision and Pattern
Recognition: 18-23 April 2018, Salt Lake City, Utah.
IEEE, Piscataway, New Jersey, USA.
Vaz-Ferreria R, Achaval F, Gonzalez J. 1981. Reacciones
y cambios de la fauna en un area de represa. Pp.
175-180 In: XV Congreso Internacional de Fauna
Cinegética y Silvestre: 1981, Trujillo (Caceres),
Cartuja, Sevilla, Spain. 917 p.
Vaz-Ferreria R, Achaval F, Gonzalez J. 1982. Evolucion
y situacion actual de la fauna de vertebrados del area
de Salto Grande (margen uruguaya). Pp. 114 In: ///a
Reunion Iberoamericana de Conservacion y Zoologia
de Vertebrados, 1982, Buenos Aires. Museo Argentino
de Ciencias Naturales “Bernardino Rivadavia”,
Buenos Aires, Argentina. 578 p.
Vaz-Ferreira R, Sierra de Soriano B, Soriano Sefiorans
J. 1966. Integracion de la fauna de vertebrados en
algunas masas de agua dulce temporales del Uruguay.
Compendios de Trabajo del Departamento de
Zoologia Vertebrados de la Facultad de Humanidades
y Ciencias 25: 1-20.
Espana. Estacion Bioldgica de Dofiana, Isla de la
Gabriel Laufer has a Ph.D. in Ecology from the University of the Republic, Uruguay (UdelaR).
Gabriel is currently an Adscript Researcher at the National Natural History Museum (MNHN)
in Montevideo, Uruguay, works for the NGO Vida Silvestre Uruguay (VSUy) in conservation
biology, and is a member of the Uruguayan National System of Researchers (SNI). Gabriel has
authored several articles in international journals on the ecology and natural history of vertebrates.
His research interests are in biodiversity conservation, biological invasions, protected areas, and
amphibian ecology.
Noelia Gobel is a Ph.D. student in Ecology at the UdelaR and an honorary researcher of the National
Natural History Museum (MNHN) in Montevideo, Uruguay. Her topics of interest and studies focus
on the conservation of biodiversity and the effects of global change, community ecology, and food
webs. Noelia has authored several publications on these topics.
Nadia Kacevas is a postgraduate student at the UdelaR, currently working as a Research
Assistant in the Instituto de Investigaciones Biologicas Clemente Estable (IIBCE), and as an
honorary collaborator at the MNHN. Her interests are focused on behavior, ecology, genetics, and
contributing to the development of conservation strategies for the biodiversity of Uruguay through
multidisciplinary approaches.
Ignacio Lado is a postgraduate student of the UdelaR. His interests are related to biodiversity
conservation, biological invasions, geographic information systems, and biodiversity monitoring.
Ignacio currently works as a biodiversity consultant for wind farms.
Sofia Cortizas is a Professor at the Technological University of Uruguay (UTEC) and she has
an M.Sc. in Biodiversity Conservation from the University of Barcelona, Spain. Sofia has been
participating in several projects on biological invasions, in which she has been working to understand
the American Bullfrog’s trophic niche and how it overlaps with those of native amphibian species.
Magdalena Carabio works in conservation biology at the NGO Vida Silvestre Uruguay (VSUy)
and in environmental education at the NGO Julana. Magdalena has an M.Sc. in Environmental
Sciences from the UdelaR. She has worked on projects related to anuran ecology, conservation
management, conservation status indicators, environmental education, and citizen science, and she
leads a private land protection program.
Amphib. Reptile Conserv. 236 November 2021 | Volume 15 | Number 2 | e290
Amphib. Reptile Conserv.
Laufer et al.
Diego Arrieta is currently working as the herpetological curator in the National Natural History
Museum (MNHN) in Montevideo, Uruguay. Diego was trained in the Faculty of Sciences, UdelaR,
in vertebrate biology. With a keen interest in the natural history of the amphibians of Uruguay, he
has authored several articles in international journals and book chapters on this topic.
Carlos Prigioni worked in the Vertebrate Zoology Section of the Faculty of Sciences, UdelaR; in
the Technical Department of Fauna of the Ministry of Livestock, Agriculture and Fisheries; in the
Fisheries Management Group, National Directorate of Aquatic Resources of the same ministry;
and as a Zoological Technician of the National Natural History Museum (MNHN) in Montevideo,
Uruguay. He is currently retired and is an Associate Researcher at the MNHN in Uruguay. With his
biological training, Carlos is the author of more than 170 works on vertebrate zoology, published in
national and international journals. His interests are in the taxonomy, distribution, and biology of
vertebrates, especially amphibians.
Claudio Borteiro is an Adscript Researcher in Herpetology at National Natural History Museum
(MNHN) in Montevideo, Uruguay. He graduated as a Veterinarian from the Veterinary Faculty of
UdelaR, working mainly as a small animal and exotic pet veterinary practitioner. He obtained a
Ph.D. in Zoology at the Faculty of Sciences, and is currently a member of the National System of
Researchers (SNI). With broad research interests in the natural history of Neotropical amphibians
and reptiles, his scientific works focus mainly on systematics, taxonomy, conservation, and
amphibian diseases.
Francisco Kolenc is currently an Adscript Researcher in the Herpetology Department of the
National Natural History Museum (MNHN) in Montevideo, Uruguay, and a member of the National
System of Researchers (SNI) of Uruguay. Francisco has authored several articles in international
journals on Neotropical amphibians and reptiles. His main research interests are in the natural
history, systematics, taxonomy, evolution, and larval forms of Neotropical amphibians.
237 November 2021 | Volume 15 | Number 2 | e290
Official journal website:
amphibian-reptile-conservation.org
Amphibian & Reptile Conservation
15(2) [General Section]: 238-243 (e291).
Rapid endangerment of the lizard Podarcis pityusensis by
an invasive snake demands an immediate conservation
response
1*Elba Montes, 7Juan M. Pleguezuelos, and *Fred Kraus
'Department of Zoology, Faculty of Biological Sciences, University of Valencia, c/ Dr. Moliner, 50, Burjassot, E-46100, Valencia, SPAIN ? Department
of Zoology, Faculty of Sciences, Granada University, E-18071 Granada, SPAIN *Department of Ecology and Evolutionary Biology, University of
Michigan, Ann Arbor, Michigan, 48109, USA
Abstract.—Fifteen years have elapsed since the arrival of the invasive snake Hemorrhois hippocrepis to the
island of Ibiza (Balearic Islands, Spain). In that time, the only endemic vertebrate, the Ibiza Wall Lizard (Podarcis
pityusensis), has disappeared across half of the island, a subspecies restricted to an offshore islet has
vanished, and its extinction in its native range is likely to happen in the next several years if managers do not
implement conservation measures with alacrity and decisiveness. In light of these findings, our re-assessment
of the IUCN extinction risk category for this lizard shows that its risk status has increased by two levels since
its last assessment in 2008, from Near Threatened to Endangered. We also classify this snake as producing
a Massive (MA) impact under the Environmental Impact Classification for Alien Taxa. Lastly, we suggest six
management measures to prevent the extinction of the majority of genetic and taxonomic diversity of this lizard
on Ibiza, Formentera, and the numerous surrounding islets.
Keywords. Balearic Islands, Europe, extinction, Ibiza, invasive species, management
Citation: Montes E, Pleguezuelos JM, Kraus F. 2021. Rapid endangerment of the lizard Podarcis pityusensis by an invasive snake demands an
immediate conservation response. Amphibian & Reptile Conservation 15(2) [General Section]: 238-243 (e291).
Copyright: © 2021 Montes et al. This is an open access article distributed under the terms of the Creative Commons Attribution License [Attribution
4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction in any
medium, provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced, are
as follows: official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 21 July 2021; Published: 25 November 2021
Introduction
The prominent role of invasive predators in leading
to species extinction on islands is well known (e.g.,
Ebenhard 1988; Courchamp et al. 2003; Blackburn et
al. 2004; Reaser et al. 2007). However, most attention
has historically focused on the impacts from mammalian
predators. With respect to reptiles, the devastation of
Guam’s native species by the Brown Treesnake (Boiga
irregularis) was admitted too late to save most of that
island’s bird and lizard species (Jaffe 1994), but the
snake has since become famous for its wide-ranging
ecological impacts (Fritts and Rodda 1998; Rodda and
Savidge 2007; Rogers et al. 2012; Caves et al. 2013).
Subsequently, snake predation has been inferred as
contributing to species losses on other islands (Deso and
Probst 2007; Cheke and Hume 2008; Smith et al. 2012),
though those invasions have been studied less intensively.
Because the impacts from invasive snakes on islands can
develop quickly, it is imperative that the introductions of
snakes to islands be studied soon after establishment.
Ibiza is the largest of the Pityusic Islands, the
Correspondence. “e/[email protected]
Amphib. Reptile Conserv.
southwestern portion of the Balearic Islands, and a
small archipelago in the western Mediterranean that is
politically part of Spain (Fig. 1A). Ibiza has an area of
572 km’, maximum elevation of 486 m, mean annual
temperature of 18.3 °C, and mean yearly rainfall of 413
mm. The island is covered by native pine and juniper
forests (Pinus halepensis and Juniperus phoenicea),
cultivated lands, and native shrubland. The Pityusic
Islands currently have one endemic vertebrate, the
lacertid lizard Podarcis pityusensis (Fig. 1B), though
an endemic Dwarf Viper (Vipera latastei ebusitana)
went extinct with the human colonization of Ibiza 4,000
years ago (Torres-Roig et al. 2020). This lizard occupies
Ibiza, Formentera, and most of the surrounding rocks of
the Pityusic Islands, a total land area of 656 km/?. Ibiza
comprises the large majority of this lizard’s native range,
although there are introduced populations in the Iberian
Peninsula (Carretero et al. 1991; Garcia-Porta et al. 2001;
Gosa et al. 2015; Colodro et al. 2020). The species has
been divided into 23—28 subspecies using morphological
criteria, most of which are restricted to individual small
rocks surrounding Ibiza and Formentera (Salvador 2015;
November 2021 | Volume 15 | Number 2 | e291
Montes et al.
BALEARIC
IsLANDS cy
ae
}
" IBERIAN
Co PENINSULA
@
AN SEA
AG AN er
Fig. 1. Basic elements of the system. (A) Map showing the
location of Ibiza island in relation to the nearest mainland areas
in the Iberian Peninsula and northern Africa. (B) The endemic
lacertid lizard, Podarcis pityusensis. (C) The invasive colubrid
snake, Hemorrhois hippocrepis. Photos by: Javier Pleguezuelos
(A), Juan M. Pleguezuelos (B), and Federico Rey (C).
Rodriguez et al. 2013). These islet populations are likely
evolutionarily significant units (ESU) and, therefore,
deserve separate management actions (Pérez-Mellado
et al. 2017); however, genetic divergences among the
populations are relatively shallow and estimated at
~100,000—300,000 years ago (Rodriguez et al. 2013).
In 2003, the colubrid snake Hemorrhois hippocrepis
(Fig. 1C) was first reported as introduced to Ibiza via
imported olive trees, and it rapidly expanded 1n numbers
and range (Silva-Rocha et al. 2018). Although the exact
date of introduction is unknown, it 1s presumed to be
soon before 2003. The primary diet of this snake on
Ibiza consists of lizards (Hinckley et al. 2017), which
is of concern because of the documented and inferred
Amphib. Reptile Conserv.
ability of invasive snakes to exterminate endemic
insular vertebrates, including lizards (Fritts and Rodda
1998; Rodda and Savidge 2007; Cheke and Hume 2008;
Smith et al. 2012). Consequently, in 2018, we conducted
surveys for P. pityusensis along 29 500-m line transects
in areas with and without established snake populations
(Montes et al. 2021). The lizards were found to have
disappeared in all but one of the transects with snakes,
whereas they maintained healthy populations in areas
without snakes. The snakes were found to be expanding
their geographic range at a linear rate (Area = 3,189.5 x -
1,384.3, where x = year since 2010, adjusted R? = 0.9800,
p < 0.0000), conservatively occupying 28,200 ha (49.3%
of Ibiza) by 2018 and projected to occur island-wide by
2027-2028. Those surveys also found snakes swimming
far from shore, snakes which had reached some of the
offshore islets, and that the lizard subspecies P. p. hortae,
restricted to S’Ora (0.4 ha), became extinct in the space
of 10 months (Montes et al. 2021).
Materials and Methods
Based on our demographic findings (Montes et al.
2021), here we apply the standard threat-assessment
methodology (IUCN 2012) to update the red-list status
of P. pityusensis, and we use the criteria of Blackburn et
al. (2014) and IUCN (2019) to assess the impact of the
invasive snake. These findings lead us to propose several
conservation actions to secure the future of the endemic
lizard.
Results
In the current JUCN Red List of Threatened Species, P.
pitvusensis is considered Near Threatened (NT) due to
hunting and trapping, human intrusions and disturbance,
and invasive rats and feral cats (Pérez-Mellado and
Martinez-Solano 2009). However, this species was last
assessed in 2008, before H. hippocrepis had become
widespread on Ibiza (range at that time < 1,000 ha).
Extrapolating from the rate of range loss in P. pityusensis
discovered by Montes et al. (2021), bearing in mind that
the data in that paper are current to 2018, the lizard is
expected to have lost more than 50% of its global range
(33,700 + 1,244 Ha) by the end of 2020—a period of
17 years since the snake was first detected on Ibiza, and
only 10 years since the snake occupied only 1,080 ha
comprising tree-nurseries and surrounding agricultural
and residential areas. The lizard species has been almost
completely removed from that range, with just one out
of 15 sampled transects in areas inhabited by snakes
still containing some lizards (see Table 1 in Montes
et al. 2021). Thus, we conclude that P pitvusensis
should now be classified as globally Endangered, EN
A4(bce), based on the observed and projected population
reductions, where the cause of reduction is ongoing and,
indeed, expanding. This observed population reduction
November 2021 | Volume 15 | Number 2 | e291
Invasive snake threatens endemic lizard on Ibiza, Balearic Islands
is based on our transect surveys (Montes et al. 2021),
which constitute an index of abundance appropriate to
the taxon (b), a quantified decline in extent of occurrence
(c), and effects of introduced taxa (e) (UCN 2012). It
is remarkable that this species would have jumped two
IUCN categories (NT to EN) in just a decade.
Using the IUCN Environmental Impact Classification
for Alien Taxa (EICAT), we recognize H. hippocrepis
as producing a Massive (MA) impact, given that local
extinction of the native populations is now widespread,
including the endemic subspecies on S’Ora Islet, a
harmful irreversible impact (IUCN 2019).
Discussion
In a review of the impacts from invasive herpetofauna,
Kraus (2015) noted that massive impacts were often
caused by these species, but only rarely via the mechanism
of predation. Indeed, only two species—a snake, B.
irregularis, and a lizard, Anolis carolinensis—have been
documented to exert these impacts via predation (F.
Kraus, unpub. data), though others have retrospectively
been inferred to have done so (Cheke and Hume 2008;
Smith et al. 2012). Thus, H. hippocrepis joins this small
contingent of damaging reptiles, being only the third
reptile documented during an ongoing invasion to impose
massive predation impacts.
It is remarkable that the endemic Ibizan lizard has been
virtually extirpated from roughly one-half of its range in
less than a decade (Montes et al. 2021). The Brown Tree
Snake (B. irregularis) required approximately 30-40
years to decimate the native vertebrates on the slightly
smaller island of Guam (Fritts and Rodda 1998; Rodda
and Savidge 2007), perhaps because there was a greater
number of prey items to consume. The rapidity of decline
in P. pitvusensis, and its clear relationship to the expansion
of the invasive snake (Hinckley et al. 2017; Montes et
al. 2021), demand that immediate conservation actions
be taken to save this lizard from extinction. Clearly,
the existing trapping and removal efforts implemented
by the Balearic Government (COFIB 2017, 2018) are
insufficient to protect the lizard.
We suggest six necessary measures if there is to be
any hope of preserving P. pityusensis from the invasive
snake.
1. Establish captive assurance colonies of P. pityusensis
(in situ or ex situ). Our assessment is that P. pityusensis
could be extinct on Ibiza within a decade, with further
extinctions likely on Formentera and the offshore islets
as the snake continues trans-marine dispersal. Therefore,
it seems critical to develop captive populations of
this species as assurance colonies in the event of
its extinction in the wild. These colonies should be
designed to safeguard the species from extinction,
conserve its genetic diversity, and possibly be used to
repopulate certain areas should future snake management
Amphib. Reptile Conserv.
achievements make this feasible (see Hedrick 1992). It is
clearly questionable whether all named subspecies could
be conserved in this way, so the first priority should be
given to the populations on Ibiza and its nearest islets.
2. Control the introduction pathway. Ideally, trade
in landscaping trees should be banned to defend
against further invasions of snakes and other species.
The European Union compels member countries to
implement mechanisms to prevent the entrance of
invasive species, e.g., EU Regulation 1143/2014 on the
prevention and management of introduction and spread
of invasive alien species. However, simultaneously, the
1% article of the Council Regulation 2679/98 demands
the contradictory goal of removing any obstacle to “free”
trade throughout EU territory. This makes it virtually
impossible to implement meaningful biosecurity
measures that could prevent pest importation, inasmuch
as effective biosecurity necessarily imposes a cost to
“free” trade. Given that this legal obstruction will not
be immediately addressed, we suggest an alternative
approach permitting the importation of large trees
only from 1 April to 15 June. This would avoid the
movement of trees during the cold season (15 October to
15 March), when H. hippocrepis hibernates inside such
trees (Feriche 2017), as well as during summer (July
to September) when eggs are incubating in those same
refuges (Pleguezuelos and Feriche 1999). We further
suggest that during this 2.5-month period imported trees
must also pass quarantine for at least four weeks in an
enclosure surrounded by snake-proof fencing (Rodda
et al. 2007) containing baited traps (Engeman and Vice
2002). It is essential that the enclosure be located within
the Ibiza entrance port facilities, because trees can be sent
from many different points of origin in mainland Spain.
While in quarantine, the trees should also be searched
with detector dogs to minimize any chances of further
snake incursions (Clark et al. 2017).
3. Reinforce existing eradication campaigns with a
greater number of permanent traps, which are showing
high capture rates (COFIB 2018) compared to trapping
studies in the literature—e.g., 0.0825 snakes/trap-night
in high-density locations in this system, compared
to 0.044 for aquatic snakes in South Carolina (Durso
et al. 2011), 0.0005 for Python molurus bivittatus in
the Florida Everglades (Reed et al. 2011), 0.127 for
B. irregularis on Guam (Clark et al. 2012), and 0.019
for Nerodia fasciata in southern California (Reed et al.
2016). This measure would aim to reduce snakes in their
core area and, hopefully, reduce emigration pressure.
Canine teams have demonstrated high detectability of
individual snakes (see Ballouard et al. 2019); however,
the rock walls used as shelter by these snakes make
capturing them virtually impossible. We suggest field
testing canine-team effectiveness in concert with thermal
fumigation (Kraus et al. 2015) to drive the snakes from
November 2021 | Volume 15 | Number 2 | e291
Montes et al.
these shelters when detected.
4. Develop a rapid-response protocol for snake sightings
in new Satellite localities across the southwestern part of
Ibiza (where the invasive snake is not yet widespread)
and on the islets. This is necessary because the snakes
can disperse discontinuously in transported nursery
materials and construction materials, or by swimming.
This protocol could follow methods developed for
other snakes (Stanford and Rodda 2007). We suggest
surrounding the area of any new record with baited traps
separated at a maximum of 20 m from each other and
maintained for four weeks (Engeman and Vice 2002).
5. Promote scientific research in concert with the above-
mentioned actions to solve the problems impeding
effective lizard conservation and snake control. Research
is needed to optimize the captive management procedures
for the lizards, monitor their population trends and range
shifts, deepen our understanding of the snake’s natural
history, and identify biological weaknesses of the snake
that may lead to the development of more effective
tools to manage it (Andersen et al. 2004). Topics in
tool development that require further study include
determining optimal spacing among traps, optimal set
time for maximizing capture probability per unit area,
optimal use of canine teams, possible development of
snake toxicants, and the use of thermal fumigation to
drive snakes from refuges in stone walls.
6. Develop public-education programs to improve the
reporting of snake sightings and increase the likelihood
of snake removal. Immediate reporting of snakes 1s
essential to their successful capture by management
personnel, and improved public engagement is needed
for this. The Balearic and Ibiza Island governments carry
out various campaigns focused on trapping and educating
the public by delivering traps and pamphlets to citizens.
However, the conflicting system of authorities among the
different national, regional, and local administrations—
along with fluctuating political interests—make these
efforts discontinuous, uncoordinated, and of uncertain
duration. We recommend that the already-functioning
campaigns become unified and consistent so that Ibiza
inhabitants and visitors are provided with a unified
message about the problem, the need for continuous and
immediate reporting, and the option to place traps around
their homes.
Literature Cited
Andersen MC, Adams H, Hope B, Powell M. 2004. Risk
analysis for invasive species: general framework and
research needs. Risk Analysis 24: 893-900.
Ballouard JM, Gayraud R, Rozec F, Besnard A, Caron
S, Bech N, Bonnet X. 2019. Excellent performance
of dogs to detect cryptic tortoises in Mediterranean
Amphib. Reptile Conserv.
scrublands. Biodiversity Conservation 28: 4,027-
4,045.
Blackburn TM, Cassey P, Duncan RP. 2004. Avian
extinction and mammalian introduction on oceanic
islands. Science 305: 1,955—1,958.
Blackburn TM, Ess! F, Evans T, Hulme PE, Jeschke
JM, Kuhn I, Kumschick S, Markova Z, Mrugala A,
Nentwig W, etal. 2014. A unified classification of alien
species based on the magnitude of their environmental
impacts. PLoS Biology 12(5): e1001850.
Carretero MA, Arribas O, Llorente GA, Montori A,
Fontanet X, Llorente C, Santos X, Rivera J. 1991.
Una poblacion de Podarcis pityusensis en Barcelona.
Boletin de la Asociacion Herpetologica Espanola 2:
18-19.
Caves EM, Jennings SB, HilleRisLambers J, Tewksbury
JJ, Rogers HS. 2013. Natural experiment demonstrates
that bird loss leads to cessation of dispersal of native
seeds from intact to degraded forests. PLoS ONE 8:
©65618
Cheke AS, Hume J. 2008. Lost Land of the Dodo: an
Ecological History of Mauritius, Réunion and
Rodrigues. Yale University Press, New Haven,
Connecticut, USA. 464 p.
Clark L, Savarie PJ, Shivik JA, Breckck SW, Dorr
BS. 2012. Efficacy, effort, and cost comparisons
of trapping and acetaminophen-baiting for control
of Brown Treesnakes on Guam. Human-Wildlife
Interactions 6(2): 222-236.
Clark L, Clark C, Siers S. 2017. Brown Tree Snakes:
methods and approaches for control. Pp 107—134 In:
Ecology and Management of Terrestrial Vertebrate
Invasive Species in the United States. Editors, Pitt
WC, Beasley J, Witmer GW. CRC Press, Boca Raton,
Florida, USA. 455 p.
COFIB. 2017. Consorci de Recuperacio de Fauna de
les Illes Balears (COFIB). Informe control d ofidis
a Pititises, SCF-COFIB 2017. Conselleria Medi
Ambient i Territori, Balearic Government, Palma,
Spain. 23 p.
COFIB. 2018. Consorci de Recuperacio de Fauna de les
Illes Balears (COFIB). Resumen de la Campaiia de
Control de Ofidios en las Islas Baleares. Conselleria
Medi Ambient 1 Territori, Balearic Government,
Palma, Spain. 16 p.
Colodro I, Atienzar F, Sancho V, Santos JL, Carretero
MA. 2020. Nueva poblacion peninsular de lagartija
de las Pitiusas, Podarcis pityusensis (Bosca, 1883).
Boletin de la Asociacién Herpetolégica Espatiola
31(1):; 155-159.
Courchamp F, Chapuis JL, Pascal M. 2003. Mammal
invaders on islands: impact, control, and control
impact. Biological Review 78: 347-383.
Deso G, Probst JM. 2007. Lycodon aulicus Linnaeus,
1758 et son impact sur Vherpétofaune insulaire a
La Réunion (Ophidia: Colubridae: Lycodontinae).
Bulletin Phaethon 25: 29-36.
November 2021 | Volume 15 | Number 2 | e291
Invasive snake threatens endemic lizard on Ibiza, Balearic Islands
Durso AM, Willson JD, Winne CT. 2011. Needles in
haystacks: estimating detection probability and
occupancy of rare and cryptic snakes. Biological
Conservation 144: 1,508—1,515.
Ebenhard T. 1988. Introduced birds and mammals and
their ecological effects. Viltrevy 13: 1-107.
Engeman RM, Vice DS. 2002. Objectives and
integrated approaches for the control of Brown Tree
Snakes. Journal of Integrated Pest Management 6:
59-76.
Feriche M. 2017. Culebra de herradura, Hemorrhois
hippocrepis. In: Enciclopedia Virtual de _ los
Vertebrados Espafioles. Editors, Sanz JJ, Martinez-
Freiria F. Museo Nacional de Ciencias Naturales
(MNCN), Madrid, Spain. Available: http://www.
vertebradosibericos.org [Accessed: 21 January 2020].
Fritts TH, Rodda GH. 1998. The role of introduced
species in the degradation of island ecosystems: a
case history of Guam. Annual Review of Ecology,
Evolution, and Systematics 29: 113-140.
Garcia-Porta J, Bargall6 F, Fernandez M, Filella E,
Riviera X. 2001. Nueva poblacion introducida de
Podarcis pityusensis en la Peninsula Ibérica. Boletin
de la Asociacion Herpetologica Espatiola 12: 59-62.
Gosa A, Garin-Barrio I, Sanz-Azkue I, Cabido C. 2015.
La lagartija de las Pitiusas (Podarcis pityusensis) en la
peninsula ibérica y Mallorca. Boletin de la Asociacion
Herpetologica Espatiola 26(2): 68-71.
Hedrick PW. 1992. Genetic conservation in captive
populations and endangered species. Applied
Population Biology 67: 45-68.
Hinckley A, Montes E, Ayllon E, Pleguezuelos JM.
2017. The fall of a symbol? A high predation rate by
the introduced Horseshoe Whip Snake, Hemorrhois
hippocrepis, paints a bleak future for the endemic
Ibiza Wall Lizard, Podarcis pityusensis. European
Journal of Wildlife Research 63: 1-8.
IUCN. 2012. International Union for Conservation of
Nature (IUCN) Red List Categories and Criteria:
Version 3.1. 2" Edition. YUCN, Gland, Switzerland
and Cambridge, England. tv + 32 p.
IUCN. 2019. Consultation Document. Proposed IUCN
Standard Classification of the Impact of Invasive
Alien Taxa. Version 2.3. July 2019. TYUCN, Gland,
Switzerland and Cambridge, England. 27 p.
Jaffe M. 1994. And No Birds Sing. Simon and Schuster,
New York, New York, USA. 283 p.
Kraus F. 2015. Impacts from invasive reptiles and
amphibians. Annual Review of Ecology, Evolution,
and Systematics 46: 75-97.
Kraus F, Stahl R, Pitt W. 2015. Thermal fumigation
provides a simple and effective solution for sanitizing
cargo from invasive snakes. Journal of Pest Science
88: 331-341.
Montes E, Kraus F, Chergui B, Pleguezuelos JM. 2021.
Collapse of the endemic lizard Podarcis pityusensis
on the island of Ibiza mediated by an invasive snake.
Amphib. Reptile Conserv.
Current Zoology 2021: zoab022.
Pérez-Mellado V, Martinez-Solano I. 2009. Podarcis
pitvusensis. The IUCN Red List of Threatened
Species 2009: e.T17800A7482971.
Pérez-Mellado V, Pérez-Cembranos A, Rodriguez V,
Buades JM, Brown RP, Bohme W, Terrassa B, Castro
JA, Picornell A, Ramon C. 2017. The legacy of
translocations among populations of the Ibizan Wall
Lizard, Podarcis pityusensis (Squamata: Lacertidae).
Biological Journal of the Linnean Society 121(1):
82-94.
Pleguezuelos JM, Feriche M. 1999. Reproductive ecology
of the Horseshoe Whip Snake, Coluber hippocrepis,
in the Iberian Peninsula. Journal of Herpetology 33:
202-207.
Reaser JK, Meyerson LA, Cronk Q, De Poorter M,
Eldredge LG, Green E, Kairo M, Latashi P, Mack
RN, Mauremootoo J, et al. 2007. Ecological and
socioeconomic impacts of invasive alien species in
island ecosystems. Environmental Conservation 34:
98-111.
Reed RN, Hart KM, Rodda GH, Mazzotti FJ, Snow RW,
Cherkiss M, Rozar R, Goetz S. 2011. A field test of
attractant traps for invasive Burmese Pythons (Python
molurus bivittatus) in southern Florida. Wildlife
Research 38: 114-121.
Reed RN, Todd BD, Miano OJ, Canfield M, Fisher RN,
McMartin L. 2016. Ecology and control of an intro-
duced population of Southern Watersnakes (Nerodia
fasciata) in southern California. Herpetologica 72:
130-136.
Rodda GH, Savidge JA. 2007. Biology and impacts of
Pacific island invasive species. 2. Boiga irregularis,
the Brown Tree Snake (Reptilia: Colubridae). Pacific
Science 61: 307-325.
Rodda GH, Farley JL, Bischof R, Reed RN. 2007. New
developments in snake barrier technology: fly-ash
covered wall offers a feasible alternative for permanent
barriers to Brown Treesnakes (Boiga irregularis).
Herpetological Conservation and Biology 2: 157—
163.
Rodriguez V, Brown RP, Terrasa B, Pérez-Mellado
V, Castro JA, Picornell A, Ramon MM. 2013.
Multilocus genetic diversity and __ historical
biogeography of the endemic Wall Lizard from Ibiza
and Formentera, Podarcis pityusensis (Squamata:
Lacertidae). Molecular Ecology 22: 4,829-4,841.
Rogers H, HilleRisLambers J, Miller R, Tewksbury JJ.
2012. ‘Natural experiment’ demonstrates top-down
control of spiders by birds on a landscape level. PLoS
ONE 7: e43446
Salvador A. 2015. Lagartija de las Pitiusas, Podarcis
pitvusensis. In: Enciclopedia Virtual de los Vertebrados
Espafioles. Editors, Salvador A, Marco A. Museo
Nacional de Ciencias Naturales (MNCN), Madrid,
Spain. Available: http://www. vertebradosibericos.org/
[Accessed: 1 June 2020].
November 2021 | Volume 15 | Number 2 | e291
Montes et al.
Silva-Rocha I, Montes E, Salvi D, Sillero N, Mateo JA,
Ayllon E, Pleguezuelos JM, Carretero MA. 2018.
Herpetological history of the Balearic Islands: when
aliens conquered these islands and what to do next.
Pp. 105-131 In: Histories of Bioinvasions in the
Mediterranean. Editors, Queiroz AI, Pooley SP.
Springer, Cham, Switzerland. 260 p.
Smith MJ, Cogger H, Tiernan B, Maple D, Boland C,
Napier F, Detto T, Smith P. 2012. An oceanic island
reptile community under threat: the decline of reptiles
on Christmas Island, Indian Ocean. Herpetological
Conservation and Biology 7: 206-218.
Stanford JW, Rodda GH. 2007. The Brown Treesnake
rapid response team. Pp. 175-187 In: Managing
Vertebrate Invasive Species: Proceedings of an
International Symposium. Editors, Witmer GW, Pitt
WC, Fagerstone KA. United States Department of
Agriculture/Animal and Plant Health Inspection
Service/Wildlife Services, Fort Collins, Colorado,
USA. 448 p.
Torres-Roig E, Mitchell KJ, Alcover JA, Martinez-
Freiria F, Bailon S, Heiniger H, Williams M, Cooper
A, Pons J, Bover P. 2020. Origin, extinction, and
ancient DNA of a new fossil insular viper: molecular
clues of overseas immigration. Zoological Journal of
the Linnean Society 192: 144-168.
Elba Montes recently finished her Ph.D. at the University of Valencia (Spain), studying the
natural history and impacts of the invasive Horseshoe Whip Snake (Hemorrhois hippocrepis) on
the island of Ibiza. She worked for 11 years in the Ibiza Island Council, and during this time she
led the pilot project to control these invasive snakes. She has visited Gran Canaria and Guam
to learn about the California Kingsnake (Lampropeltis californiae) and the Brown Treesnake
(Boiga irregularis) invasions and management actions, respectively. Elba is a board member of
the Society for Island Biology, an international association that focuses on island biodiversity
conservation. Photo by Federico Rey.
Fred Kraus is an evolutionary biologist, with about 25 years of experience specializing in
the biology and conservation management of invasive species and the systematics of Papuan
reptiles and amphibians. He is especially interested in working at the intersection of science
and practical conservation. Fred has conducted research in several countries in North America,
South America, the Caribbean, Asia, and the Pacific, and he has led 18 biotic-survey expeditions
to Papua New Guinea. In addition to conservation work in mainland USA, Hawaii, Fiji, and the
Caribbean, he has written a scientific book on invasive reptiles and amphibians, and has many
other publications in the field of invasion biology. Photo by Dickson.
Juan M. Pleguezuelos was born in northern Africa (in the city of Melilla), and was raised in
southern Spain, where he graduated with a Ph.D. in Biology at Granada University. He then
taught Zoology and Conservation Biology there for 40 years, and is now retired. Juan’s Ph.D.
dissertation focused on bird distributions, and for 15 years he worked on the conservation of a
large diurnal raptor. From 1985 to the present, his research has focused on reptiles, particularly
on the natural history of snakes. But what best defines Juan’s career and concerns as a researcher
and naturalist is the conservation of biodiversity, mainly in the Western Mediterranean. Most of
his studies on the biology and ecology of reptiles were undertaken to understand those traits that
would best help the conservation of these animals. Juan has also led the effort to develop the
Red List of Spanish and Moroccan amphibians and reptiles. Photo by Monica Feriche.
Amphib. Reptile Conserv. 243 November 2021 | Volume 15 | Number 2 | e291
Official journal website:
amphibian-reptile-conservation.org
Amphibian & Reptile Conservation
15(2) [General Section]: 244—278 (e292).
Contributions to the herpetofauna of the Angolan Okavango-
Cuando-Zambezi river drainages. Part 1: Serpentes (snakes)
12.3* Werner Conradie, **°*Ninda L. Baptista, *”*Luke Verburgt,
31°.12Chad Keates, *°James Harvey, *"Timoteo Julio, and *"Gotz Neef
'Port Elizabeth Museum (Bayworld), Beach Road, Humewood, Port Elizabeth 6013, SOUTH AFRICA Department of Nature Conservation
Management, Natural Resource Science and Management Cluster, Faculty of Science, George Campus, Nelson Mandela University, George,
SOUTH AFRICA ?National Geographic Okavango Wilderness Project, Wild Bird Trust, SOUTH AFRICA ‘Instituto Superior de Ciéncias da
EducagdGo da Huila (ISCED-Huila), Rua Sarmento Rodrigues, Lubango, ANGOLA °CIBIO/InBio, Centro de Investigagdo em Biodiversidade e
Recursos Genéticos, Laboratorio Associado, Universidade do Porto, Campus Agrdrio de Vairdo, Rua Padre Armando Quintas, 4485-661 Vairdao,
PORTUGAL °Faculdade de Ciéncias, Universidade do Porto, Porto, PORTUGAL ‘Enviro-Insight CC, Unit 8 Oppidraai Office Park, Pretoria
0050, SOUTH AFRICA *Department of Zoology and Entomology, University of Pretoria, Pretoria, 0001, SOUTH AFRICA °Harvey Ecological, 41
Devonshire Avenue, Howick, 3290, SOUTH AFRICA '°Zoology and Entomology Molecular Lab, Department of Zoology and Entomology, Rhodes
University, Grahamstown, SOUTH AFRICA ''Fundagao Kissama, Rua 60 Casa 560, Lar do Patriota, Luanda, ANGOLA ‘South African Institute
for Aquatic Biodiversity (SAIAB), Makhanda, SOUTH AFRICA
Abstract.—The herpetofauna of Angola has been neglected for many years, but recent surveys have revealed
previously unknown diversity and a consequent increase in the number of species recorded for the country. Most
historical surveys focused on the north-eastern and south-western parts of the country, while mostly neglecting
the central and south-eastern parts, comprising the provinces of Bieé, Moxico, and Cuando Cubango. To address
this sampling bias and investigate the conservation importance of the region, a series of rapid biodiversity
surveys of the upper Cuito, Cubango, Cuando, Zambezi, and Cuanza river basins were conducted by the National
Geographic Okavango Wilderness Project between 2015 and 2019. The first part of those survey results are
presented here as an updated checklist of current and historical snake records from the south-eastern region
of Angola. In summary, 160 new specimens were collected from the region, comprising 36 species, bringing the
total number of recognized snake species for the region to 53. These surveys revealed three new country records
(Amblyodipsas ventrimaculata, Crotaphopeltis barotseensis, and Dasypeltis confusa) and led to the description
of two novel species in previous publications (Boaedon branchi and B. fradel), increasing the total number
of snake species in Angola to 133. Finally, updated geographic distribution maps are provided for all species
encountered in this study for the whole country. This contribution increases our knowledge of this poorly known
region of Africa and highlights the need for and importance of similar studies in other undersampled areas.
Keywords. Africa, Cobra, Cuanavale, Cuito, headwater, Okavango Delta, reptile
Resumo—A herpetofauna de Angola foi negligenciada durante muitos anos. A maior parte dos levantamentos
realizados a nivel historico incidiram no nordeste e sudoeste do pais, sendo o centro e 0 sudeste, englobando
as provincias do Bié, Moxico e Cuando Cubango, menos estudado. Para resolver este enviesamento de
amostragem, foram realizados uma série de levantamentos rapidos de biodiversidade das nascentes do alto
Cuito, Cubango, Okavango, Cuando, Zambeze e Cuanza pelo National Geographic Okavango Wilderness Project
entre 2015 e 2019. Aqui apresentamos a primeira parte dos nossos resultados, uma lista actualizada de registos
novos e historicos de cobras do sudeste de Angola. 160 novos registros de espécimes foram documentados
na regiao, incluindo 36 espécies, e elevando o numero total de espécies reconhecidas da regiao para 53. Estes
levantamentos revelaram trés novos registos para Angola (Amblyodipsas ventrimaculata, Crotaphopeltis
barotseensis, e Dasypeltis confusa) e levaram a descrigao de duas novas espécies (Boaedon branchi e B.
fradei), aumentando o numero de espécies do pais para 133. Por fim, produzimos mapas de distribuigao
atualizados de todas as espécies encontradas neste estudo para todo o territorio de Angola. Este estudo e
uma contribuicgao significativa para o conhecimento desta regiao pouco estudada do continente africano, e
destaca a necessidade e importancia de estudos semelhantes em areas subamostradas.
Palavras-chave. Africa, cobra, Cuanavale, Cuito, Delta do Okavango, nascente, réptil
Citation: Conradie W, Baptista NL, Verburgt L, Keates C, Harvey J, Julio T, Neef G. 2021. Contributions to the herpetofauna of the Angolan Okavango-
Cuando-Zambezi river drainages. Part 1: Serpentes (snakes). Amphibian & Reptile Conservation 15(2) [General Section]: 244-278 (e292).
Copyright: © 2021 Conradie et al. This is an open access article distributed under the terms of the Creative Commons Attribution License [Attribution
4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction in any
medium, provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced, are
as follows: official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 6 September 2021; Published: 28 November 2021
Correspondence. *[email protected]
Amphib. Reptile Conserv. 244 November 2021 | Volume 15 | Number 2 | e292
Conradie et al.
Introduction
Studies on the historical synthesis of the knowledge
on Angolan herpetofauna date back to the 19" century
(Bocage 1895), with subsequent updates by Monard
(1937a,b). The relatively poor historical documentation
of the Angolan herpetofauna is complicated further by
the fact that most of the early explorations were restricted
to the western regions of the country. Studies in the 20"
century, including those of Schmidt (1933, 1936), Parker
(1936), Mertens (1938), Bogert (1940), FitzSimons
(1959), Hellmich (1957a,b), Poynton and Haacke (1993),
Ruas (1996, 2002), and Haacke (2008), did little to
correct this geographical bias. The checklists of Laurent
(1950, 1954, 1964), Thys van den Audenaerde (1966),
and Manacas (1963, 1973, 1982), did however provide
some insight into the herpetofauna of north-eastern
Angola and its affinity with the Congolian fauna.
Angola experienced one of the most brutal and
protracted civil wars after achieving independence from
Portugal, which lasted for nearly three decades (1975—
2002). In this period, the country’s biodiversity was
neglected and over-exploited for its natural resources
(Huntley and Matos 1992). Following the cessation of
hostilities and the ongoing redevelopment of regional
infrastructure, the modern biodiversity surveys have
begun to focus on poorly surveyed regions of the country
in the south-west (Huntley 2009; Ceriaco et al. 2016a;
Baptista et al. 2018, 2019a; Butler et al. 2019), north-
east (Branch and Conradie 2015; Huntley and Francisco
2015), south-east (Brooks 2012, 2013; Conradie et
al. 2016; NGOWP 2017), central (Ceriaco et al. 2014,
2016b, 201 8a), and north-west (Ernst et al. 2020) regions.
Some of these surveys have targeted areas that had never
been scientifically surveyed until recently, leading to
the discovery and description of several new species of
amphibians (Conradie et al. 2012a, 2013; Ceriaco et al.
2018b, 2021; Nielsen et al. 2020) and reptiles (Conradie
et al. 2012b, 2020; Stanley et al. 2016; Branch et al.
2019, 2021; Marques et al. 2019 a,b, 2020; Ceriaco et
al. 2020a—c; Hallermann et al. 2020; Lobon-Rovira et
al. 2021; Parrinha et al. 2021). Other targeted surveys
resulted in the addition of new country records (Branch
and Conradie 2013; Conradie and Bourquin 2013; Ernst et
al. 2014, 2015; Ceriaco et al. 2014, 2016a; Branch 2018)
or resolved previous taxonomic confusion (Channing et
al. 2013; Channing and Baptista 2013; Ernst et al. 2015;
Marques et al. 2018). Recent synopses of the Angolan
herpetofauna include an atlas of all the herpetofauna
of Angola (Marques et al. 2018), a checklist of snakes
(Branch 2018), and overviews of the reptiles (Branch
et al. 2019) and amphibians (Baptista et al. 2019b) of
Angola. These works thoroughly present the history
of herpetofaunal studies in the country and provide
updated checklists for these groups. To date, about 427
herpetofauna species have been recorded within Angolan
borders (~293 reptiles and 134 amphibians; Marques
Amphib. Reptile Conserv.
et al. 2018; Baptista et al. 2019b; Branch et al. 2019;
Ernst et al. 2020, and the publications with new species
descriptions listed above). The documented endemism
in Angola is regarded as being relatively low at present
(~12% of reptiles and ~15% of amphibians), but it is
expected to increase as the knowledge of the country’s
biodiversity improves.
Subsequent to the reviews of Angolan snakes by
Branch (2018) and Marques et al. (2018), four new
species have been described for Angola (Conradie et al.
2020; Hallermann et al. 2020), five species have been
elevated or resurrected out of synonymy (Branch et al.
2019; Hallermann et al. 2020), and six species were
recorded for the first time in the country (Branch 2018;
Baptista et al. 2019a; Hallermann et al. 2020; this study);
bringing the total number of recognized species of snakes
for Angola to 133. Nearly 50% of the Angolan squamate
diversity is represented by snakes, of which only nine
(6.8%) are regarded as being endemic to the country
(Marques et al. 2018; Branch et al. 2019; this study). The
Angolan snake richness is just slightly higher than that for
South Africa (127 species), a country almost equivalent
in size and biome diversity (Branch et al. 2019). The
snake richness is higher than in neighboring countries
to the east and south (e.g., Botswana 75, Namibia 89,
and Zambia 107), but much lower than the more tropical
northern countries (e.g., Democratic Republic of the
Congo 185 species) (Uetz et al. 2021).
The headwaters of some of southern Africa’s major
rivers such as the Cubango, Cuito, Cuanavale, and
Cuando, which comprise the main Okavango Delta
drainage system, are located in the center of the country
(Fig. 1). The sources of the Cuanza and Cunene rivers,
which drain southward and westward, respectively, into
the Atlantic Ocean, as well as major tributaries of the
Zambezi River, which drains south and eastward into the
Indian Ocean, lie in this same area. For this reason, the
area is regarded as the “Heart of Angola.” The headwater
system of the Okavango Delta drainage system 1s locally
known as “Lisima Lya Mono,” which means “Source
of Life” and comprises most of the geographic focus of
our surveys. This region comprises extensive wetland
systems, and has large tracts of intact Miombo woodland,
yet it remains one of the most poorly studied regions in
Angola, and Africa as a whole. Some of these rivers,
namely the Cubango, Cuito, Cuanavale, and Cuando,
drain southward into the Okavango Delta system, and
provide its main source of water. The Okavango Delta is a
major feature in Africa and is a critical water source in the
adjacent Kalahari Desert, where animals congregate and
create a biodiversity rich region famous for its tourism.
While the Okavango Delta 1s afforded official protected
status by Botswana, the Angolan headwaters are not
afforded any protected status. Given that the Okavango
Delta was identified as a World Heritage Site in 2014
(UNESCO 2014), it is imperative that the delta and its
tributaries are conserved to ensure the preservation of
November 2021 | Volume 15 | Number 2 | e292
Snakes of the Okavango Delta headwater area in Angola
Legend
@ NGOWP 2019
@ NGOWP 2018
A&A NGOWP 2017
@ NGOWP 2016
© Historical Records
(2)Zambezi River Basin
+ (7) cuando River Basin
(-) Okavango River Basin
[alt
: Provincial Boundaries
Major Rivers
Elevation (m a.s.I.)
+ 0-200
Ml 201-400
Ml 401-600
fl 601-800
801-1000
+ | 1001-1200
1) 1201-1400
1401-1600
{1601-1800
1801-2000
4 2001-2200
above 2201
Namibia
8°E 10°E 12°E 14°E 16°E
18°E 20°E 22°E 24°E
Fig. 1. Map of Angola showing the sampling localities of the National Geographic Okavango Wilderness Project (NGOWP)
surveys from 2016 to 2019 and historical herpetofauna records.
this natural wonder. A crucial step for justifying the need
to confer protected status on this area is to document its
biodiversity.
During the last eight years, the authors and others
have been actively documenting the herpetofauna of
south-eastern Angola (Brooks 2012, 2013; NGOWP
2015-2019; Conradie et al. 2016). Prior to this, no
formal herpetological surveys had been undertaken in
south-eastern Angola. Historical material from the region
included only opportunistic collections, most of which
were confined to the western tributaries of the Cubango
River (Bocage 1895; Monard 1931, 1937a,b), with very
few records from either the Cuito and Cuando river
basins (Angel 1923; Branch and McCartney 1992) or
eastern Moxico Province (Laurent 1964; Managas 1963,
1973).
The aim of this overall study is to document and
quantify the herpetofaunal diversity and richness of south-
eastern Angola to better understand the conservation
importance of this area in regional and national contexts.
This paper focuses exclusively on snakes, while similar
papers on the sauria (lizards), chelonians (tortoises), and
amphibians are currently in preparation.
Materials and Methods
Surveys. This study presents the herpetofauna material
and data collected during four main National Geographic
Okavango Wilderness Project (NGOWP) expeditions
Amphib. Reptile Conserv.
to south-eastern Angola (2016-2019): (1) two 2016
expeditions to the Cuito, Cuanavale, and Cuando river
sources; (2) a 2017 expedition to upper Cubango River;
(3) a 2018 expedition to Lungwebungu River; and (4) a
2019 expedition to Mussuma region in eastern Angola
(Fig. 1). In addition, updated results from a previous
study of south-eastern Angola (Conradie et al. 2016) are
included to produce a comprehensive checklist of snakes
for the Angolan Okavango-Cuando-Zambezi River
drainages.
Study area. The geographical scope of the study area
consists of the main Angolan Okavango River Basin
(Cuito and Cubango rivers), the Cuando River (and its
tributaries), and the Lungwebungu River (tributary of
the larger Zambezi River) in south-central and eastern
Angola, collectively referred to here as the Angolan
Okavango-Cuando-Zambezi River drainages (Fig. 1).
Ad hoc records from the Cuanza and Cunene rivers
are also included in this study, as they contribute to
the knowledge of the region. The Cubango River and
its tributaries form the western extent of the study
area, and are underlain in their headwaters by granite
outcrops, characterized in places by rocky substrates,
rapids, and waterfalls. In contrast, the Cuito River and
its major tributary, the Cuanavale River located in the
center of the study area, have wider valleys with water
courses that meander across deep Kalahari sands.
They are characterized by extensive wet grasslands,
November 2021 | Volume 15 | Number 2 | e292
Conradie et al.
peatlands, and oxbow wetlands (Mendelsohn and Obeid
2004). The impeded drainage and high precipitation in
the rainy season cause temporarily waterlogged soils
that prevent the development of woodlands along the
drainage lines, but support moist grasslands with humic
topsoils and dwarf shrubs. These areas act as “sponges”
that slowly release water, leading to seasonal flooding in
the Okavango Delta towards the end of the rainy season.
The Cuando (including its tributary Quembo River) and
Lungwebungu rivers have a similar topography to the
upper Cuito River, but with west-to-east drainage lines
which form a series of floodplains and pans. In the upper
reaches of the rivers, the surrounding hills are dominated
by various forms of woodland, particularly Miombo
woodland (Fig. 2). The core study area surrounding
the source lakes is characterised by Angolan Miombo
Woodland, while the southern and eastern regions of the
rivers are characterised by the drier Zambezian Baikiaea
woodlands (Burgess et al. 2004). Higher elevation ridges
are represented by woodland that is more sparse with
scattered proteas and grassland, while the river courses
consist of Zambezian flooded grasslands. The elevation
varies from 1,850 m above sea level (asl) at the river
sources to just below 1,000 m asl in the south and east
(Fig. 1), which creates clear north-south and east-west
climate gradients. Average rainfall decreases southward,
while the average temperature increases (Huntley 2019).
Sampling. Diurnal searches involved active investigation
of specific microhabitats, particularly searching beneath
rocks and decaying logs, and digging in loose soil or
leaf litter. Nocturnal surveys were undertaken around
wetlands and the surrounding woodlands with the use of
torches. Additionally, all opportunistic visual encounters
(e.g., driving between sites) were also recorded. At several
base camps during four of the surveys (Table 1), standard
Y-shaped intercept drift fence funnel trap arrays were
deployed to passively collect specimens. Each Y-shaped
trap array consisted of three drift fences (each 10 m long
and 50 cm high) radiating from a central pitfall trap, with
six two-way funnel traps placed on adjacent sides of
each drift fence and three one-way funnels placed at the
terminal ends of each drift fence. The trap arrays were
installed in varied habitats to ensure the highest possible
richness of captured species. Following McDiarmid et al.
(2012), the trapping effort was quantified as “trap nights,”
where the deployment of a single trap array (comprising
a single pitfall, 6 x 2-way and 3 x 1-way funnel traps)
for one night was considered to represent one trap night.
Snakes retained for subsequent study were humanely
euthanized by subcutaneous injection of tricaine
methanesulfonate (MS222) solution (Conroy et al.
2009), after which they were formalin-fixed for 48
hours and transferred to alcohol for long-term storage.
Prior to formalin fixation, tissue samples (either liver or
% oe
Fig. 2. Habitat associated with the different source lakes: (A) Cuito River, (B) Cuanavale River, (C) Quembo River, and (D)
Cuando River. Photos by Kostadin Luchansky.
Amphib. Reptile Conserv.
November 2021 | Volume 15 | Number 2 | e292
Snakes of the Okavango Delta headwater area in Angola
Table 1. Drift fence funnel trap array sites for the 2016—2019 surveys, with brief habitat descriptions, numbers of days installed, and
capture rates. R = river. Coordinates are presented in the WGS 84 datum.
Trap:site Latitude Longitude | Elevation Descunion Trap Snakes
Z (°S) (°E) (m asl) P nights | captured
Marginal
Cuito R. 1 -12.688693 | 18.360164 1,426 vegetation at 15-25 Feb 2016 10 2
source lake
Cuito R. 2 -12.688956 | 18.361870 1,438 Miombo 15-25 Feb 2016 10
woodland
Grassy south-
Cuito R. 3 -12.686020 | 18.364500 1,414 facing slope with | 16-25 Feb 2016
scattered shrubs
Marginal grassy
Cuanavale R. 1 -13.088937 | 18.892570 1,360 eecotion atm | Hee z nat
source lake
Marginal grassy 7 Feb-15 Mar
Cuanavale R. 2 -13.092677 | 18.895518 1,357 vegetation at 016
source lake
Open Miombo
Cuanavale R. 3 -13.092813 | 18.894921 1,361 woodland and | 7° bees ze Me
grass
Cuanavale R. 4 SE31050780> | FESERGTASG | Beezoae Peery ase | a? Rete Mar
scattered grass 2016
Marginal grassy
Quembo R. 1 -13.135917 | 19.044167 1,369 wekeuiional | °° ve as Hey
source lake
Miombo 27 Oct-11 Nov
Quembo R. 2 -13.135444 | 19.043972 1,375 016
Miombo 29 Oct-11 Nov
Quembo R. 3 -13.130725 | 19.037245 1,443 016
Marginal grassy
Quembo R. 4 -13.135863 | 19.047088 1,368 vegetation at ail sae ; : o%
source lake
Marginal grassy
Cuando R. 1 -13.003929 | 19.128079 1,351 vegetation at 12-23 Nov 2016
source lake
Marginal grassy
Cuando R. 2 -13.004259 | 19.127187 1,350 vegetation at 12—23 Nov 2016
source lake
Cuando R. 3 -13.003337 | 19.135640 | 1,360 13-23 Nov 2016
Cuando R. 4 -13.001637 | 19.129598 y374° | BrokenMIOMbO: 13 54 Now aoIé
woodland
Lungwebungu R. 1 | -12.580126 | 18.667396 1,298 Bheniee 21-25 Apr 2018
woodland
LungwebunguR.2 | -12.581990 | 18.665616 1,208 onthe 21-25 Apr 2018
woodland
LungwebunguR.3 | -12.580561 | 18.664190 | _ 1,302 21-25 Apr 2018 oe
LungwebunguR.4 | -12.578694 | 18.664674 | _ 1,305 21-25 Apr 2018
Marginal grassy
Lower Quembo R. | -13.52801 19.28147 1,236 vegetation next 23-29 Nov 2019 vi 1
to river
Lower Quembo R.2 | -13.52816 | 19.28067 1,240 Miompe 23-29 Nov 2019 7 1
woodland
Lower Quembo R.3 | -13.52778 | 19.27455 | 1,256 23-29Nov2019 | 7 | 0 |
o,e) o,e)
~“
Ue)
BK
N
oO
— — — — — —
N ies) N
Amphib. Reptile Conserv. 248 November 2021 | Volume 15 | Number 2 | e292
Conradie et al.
Table 1 (continued). Drift fence funnel trap array sites for the 2016—2019 surveys, with brief habitat descriptions, numbers of days
installed, and capture rates. R = river. Coordinates are presented in the WGS 84 datum.
Trap site
Latitude | Longitude | Elevation Description Trap Snakes
(°S) (°E) (m asl) P nights | captured
Lower Quembo R.4 | -13.25658 | 19.27810 1,248 oe ea 23-29 Nov 2019
Luanguinga R. 1
Lake Hundo 1
Lake Hundo 2
Lake Hundo 3
muscle) were preserved in 96% ethanol for subsequent
genetic analysis. Voucher specimens are held in the
herpetological collection of Port Elizabeth Museum
(PEM) and a representative collection will be returned
to the Ministry of Culture, Tourism, and Environment,
Luanda, Angola (MCTA, formerly MINAMB).
Specimen identification and morphology. Upon
completion of the fieldwork component of the study,
preliminary species identifications were made using
relevant field guides or published identification keys
(Broadley 1983; Branch 1998; Broadley et al. 2003)
and through comparison with material housed in the
Port Elizabeth Museum. Nomenclature was based on an
established online database (The Reptile Database: Uetz
et al. 2021) and was updated where needed.
Snout-vent length (SVL, measured from the tip of
the snout to the posterior end of the cloacal scale or vent
opening) and tail length (TL, measured from the cloacal
opening to the tip of the tail) were measured to the nearest
1 mm using a flexible ruler or a tape measure. Size is
reporded as SVL + TL and truncated tails are indicated
by a ‘t’. The following basic scale counts were also
documented using a Nikon SMZ1270 binocular stereo
microscope: number of longitudinal scale rows (counted
one head length behind the head, at midbody, and one
head length anterior to the cloacal scale), preoculars,
postoculars, temporal scale arrangement, supralabials,
supralabials entering orbit, infralabials, infralabials in
contact with 1“ sublinguals, presence of loreal, ventral
scales (following Dowling 1951), subcaudal scales
(counted from the posterior edge of the cloaca and
excluding the terminal spine), and cloacal scale condition
(divided or entire).
Mapping. Geographic distribution maps were produced
for all the species of snakes documented during this
project for all of their known observation localities
within Angola. Data were sourced from published
datasets (e.g., Marques et al. 2018), museum databases
(e.g., PEM and Ditsong National Museum of Natural
History, formerly Transvaal Museum, TM), and online
Amphib. Reptile Conserv.
-14.97279 21.62890 1,102
-14.97002 21.63139 1,106
-13.70885 | 21.26234 1,116 Broken MIGmDO=) | 4455 WekogT9
woodland
Miombo
woodland aie oe
Broken Miombo 4-6 Dec 2019
woodland
virtual museum platforms (http://www. inaturalist.org
and http://vmus.adu.org.za). All virtual museum records
were checked for diagnostic features to confirm species
identifications and only verifiable records were included
in the mapping. The online GeoNames gazetteer (http://
www.geonames.org/) and GEOLocate Web Application
(https://www.geo-locate.org/web/WebGeoref.aspx) were
used to georeference historical records. Distribution
data were mapped using QGIS v.3.2 (http://qgis.org).
We regarded “historical records” as those published in
Marques et al. (2018), and all subsequent records were
regarded as new.
Se
-14.99158 | 2163096 1,100 4-6 Dec 2019
pz foo
EE..
Results
The surveys documented a total of 160 individual
snake records from 78 unique localities in south-eastern
Angola, particularly around the source lakes of the Cuito,
Cuanavale, Cuando, and Quembo rivers (Fig. 1). Trap
arrays deployed for a total of 240 trap nights resulted
in the capture of 60 specimens representing 14 species
(Table 1), of which seven species were not recorded by
other means. A total of 36 snake species (comprising
seven families and 23 genera) were recorded during this
study (Table 2) and updated species distribution maps
in Angola are provided for each of the 36 species (see
below). For the mapping exercise, a total of 935 records
were collated: 549 historical records from Marques
et al. (2018), 118 additional literature records, 35
citizen science platform records, 91 records from other
sources (personal photographs, confirmed sightings, and
unpublished records of the PEM and TM collections),
and 129 records mostly from our surveys. This mapping
exercise increased the number of new or previously
undocumented records of snakes for Angola by 41.3%.
The following is a checklist of all snake species
found during these surveys, including a list of material
examined, brief comments on taxonomy, and natural
history notes observed when noteworthy. Detailed
morphological data and notes on stomach contents and
reproduction can be found in Supplementary Table 1
at: https://doi.org/10.6084/m9.figshare. 17057663. New
November 2021 | Volume 15 | Number 2 | e292
Snakes of the Okavango Delta headwater area in Angola
Table 2. Snake species recorded in the Angolan Okavango, Cuando, and Zambezi River basins.
Species
SCOLECOPHIDIA
Leptotyphlophidae
Leptotyphlops scutifrons (Peters, 1854)
Leptotyphlops kafubi (Boulenger, 1919)
Namibiana rostrata (Bocage, 1886)
Typhlopidae
Afrotyphlops angolensis (Bocage, 1866)
Afrotyphlops anomalus (Bocage, 1873)
Afrotyphlops schmidti (Laurent, 1956)
PYTHONOIDEA
Pythonidae
Python natalensis Smith, 1840
COLUBROIDEA
Colubridae
Crotaphopeltis barotseensis Broadley, 1968
Crotaphopeltis hotamboeia (Laurenti, 1768)
Dasypeltis confusa Trape and Mané, 2006
Dasypeltis scabra (Linnaeus, 1758)
Dipsadoboa shrevei (Loveridge, 1932)
Dispholidus typus punctatus Laurent, 1955
Dispholidus typus viridis (Smith, 1828)
Philothamnus angolensis Bocage, 1882
Philothamnus heterolepidotus (Gunther,
1863)
Philothamnus hoplogaster (Gunther, 1863)
Philothamnus semivariegatus (Smith, 1840)
Philothamnus ornatus (Bocage, 1872)
Thelotornis capensis oatesi (Gunther, 1881)
Natricidae
Limnophis bangweolicus (Mertens, 1936)
Limnophis bicolor (Gunther, 1865)
Amphib. Reptile Conserv.
Okavango
Cuando
250
Zambezi
x x KK
Source of records
Conradie et al. 2016: 23; Monard 1937:
106
This study; Laurent 1964: 91
This study
This study; Managas 1973: 189
Monard 1937: 103
This study; Laurent 1964: 89
This study; Conradie et al. 2016: 23;
Monard 1937: 108
This study
This study; Conradie et al. 2016: 19;
Branch and McCartney 1992: 2; Laurent
1964: 110; Monard 1937: 129
This study
Managas 1973: 192; Monard 1937: 114
Laurent 1964: 110
Laurent 1964: 114; Managas 1973: 193
This study; Branch and McCartney
1992: 2
This study; Monard 1937: 121; Managas
1973: 191
This study; Conradie et al. 2016: 19;
Managas 1973: 191; Laurent 1964: 105
This study
This study; Laurent 1964: 107; Monard
1937: 114
This study; Conradie et al. 2016: 19;
Monard 1937: 114
This study; Conradie et al. 2016: 19;
Monard 1937: 128
Conradie et al. 2020: 16; Conradie et al.
2016: 22: Laurent 1964: 100
This study; Conradie et al. 2020: 14
November 2021 | Volume 15 | Number 2 | e292
Conradie et al.
Table 2 (continued). Snake species recorded in the Angolan Okavango, Cuando, and Zambezi River basins.
Species
Natriciteres olivacea (Peters, 1854)
ELAPSOIDEA
Atractaspididae
Atractaspis congica Peters, 1877
Aparallactidae
Amblyodipsas polylepis polylepis (Bocage,
1873)
Amblyodipsas ventrimaculata (Roux, 1907)
Aparallactus capensis Smith, 1849
Xenocalamus mechowii Peters, 1881
Lamprophiidae
Boaedon angolensis Bocage, 1895
Boaedon branchi Hallermann, Ceriaco,
Schmitz, Ernst, Conradie, Verburegt,
Marques, and Bauer, 2020
Boaedon fradei Hallermann, Ceriaco,
Schmitz, Ernst, Conradie, Verburgt,
Marques, and Bauer, 2020
Limaformosa capensis (Smith, 1847)
Lycophidion multimaculatum Boettger,
1888
Prosymnidae
Prosymna ambigua ambigua (Bocage,
1873)
Prosymna angolensis Boulenger, 1915
Psammophiidae
Kladirostratus acutus (Gunther, 1888)
Psammophis angolensis (Bocage, 1872)
Psammophis jallae Peracca, 1896
Psammophis mossambicus Peters, 1882
Psammophis zambiensis Hughes and Wade,
2002
Psammophis subtaeniatus Peters, 1882
Psammophylax tritaeniatus (Gunther, 1868)
Pseudaspidae
Pseudaspis cana (Linnaeus, 1758)
Elapidae
Dendroaspis polylepis Ginther, 1864
Amphib. Reptile Conserv.
Okavango
Cuando
254
x
Zambezi Source of records
x This study; Conradie et al. 2016: 22
xX Laurent 1964: 122
This study
This study
Branch and McCartney 1992: 2
x This study; Branch and McCartney
1992: 2
This study
This study; Conradie et al. 2016: 22
xX This study; Conradie et al. 2016: 22
x Laurent 1964: 94; Branch and
McCartney 1992: 2
This study; Branch and McCartney
1992: 1
Monard 1937: 114
This study
x This study; Managas 1973: 194
x Laurent 1964: 114
This study; Angel 1922: 116
x This study; Conradie et al. 2016:
22; Branch and McCartney 1992: 2:
Managas 1973: 191; Laurent 1964: 113;
Monard 1937: 128
x This study
x Conradie et al. 2016: 22
x Laurent 1964: 110
Monard 1937: 113
This study; Conradie et al. 2016: 22
November 2021 | Volume 15 | Number 2 | e292
Snakes of the Okavango Delta headwater area in Angola
Table 2 (continued). Snake species recorded in the Angolan Okavango, Cuando, and Zambezi River basins.
Species Okavango
Elapsoidea guentherii Bocage, 1866
Elapsoidea semiannulata semiannulata xX
Bocage, 1882
Naja (Uraeus) anchietae (Bocage, 1879) x
Naja (Afronaja) mossambica (Peters, 1854) xX
Naja (Afronaja) nigricollis Reinhards, 1843 x
Viperidae
Bitis (Bitis) arietans (Merrem, 1820) x
Bitis (Macrocerastes) gabonica (Dumeril,
Bibron, and Duméril, 1854)
Causus bilineatus (Boulenger, 1905) xX
Causus rhombeatus (Lichtenstein, 1823) xX
Species totals: 53 40
distributional data used to compile the distribution maps
can be found in Supplementary Table 2 at: https://doi.
org/10.6084/m9.figshare.17057678. Two abbreviations
used in these listings are: asl — above sea level, and DOR
— dead on road. This checklist follows the higher-level
taxonomic classification suggested by Zaher et al. (2019).
Superfamily: Typhlopoidea
Family: Leptotyphlopidae
Leptotyphlops kafubi (Boulenger, 1919)
Shaba Thread Snake (Fig. 3, Map 1)
Material: PEM R27372, Camp at tributary (Luandai
River) of the Luanguinga River, Moxico Province,
-13.70885° 21.26234°, 1,116 m asl. Description:
Midbody scale rows 14; 223 middorsal scales; 21
subcaudals, 10 scales around tail; supraoculars separated
from the rostral by a discrete prefrontal; anterior
supralabial present; cloacal scale is heart-shaped. Size:
128 + 12 mm. Habitat and natural history notes:
Collected in Miombo woodland. Comments: The new
specimen is only the third record for the country. Laurent
(1964) assigned two specimens from Moxico Province
(Calundo and ‘Chutes de la Luisavo, Cabinda, Haut
Zambeze’) to Leptotyphlops emini emini (Boulenger,
1890). Later, Broadley and Watson (1976) re-assigned this
material to Leptotyphlos nigricans nigricans (Schelgel,
1839), but Broadley and Broadley (1999) subsequently
transferred it to Leptotyphlops kafubi. Leptotyphlopid
snakes show deep genetic divergences and comprise
numerous cryptic taxa that still await formal description
(Adalsteinsson et al. 2009; Busschau et al. 2021). Cryptic
Amphib. Reptile Conserv.
Cuando Zambezi Source of records
xX Laurent 1964: 117
x This study; Managas 1981: 23
Monard 1937: 136
Conradie et al. 2016: 22
This study; Monard 1937: 136
x This study; Branch and McCartney
1992: 2: Conradie et al. 2016: 23;
Monard 1937: 141
x This study; Laurent 1964: 128
xX x This study; Laurent 1964: 125
xX This study; Conradie et al. 2016: 23;
Laurent 1964: 123; Manacas 1973: 197;
Monard 1937: 141
20 ZW
diversity is expected among Angolan Leptotyphlopidae
and warrants further studies.
Namibiana rostrata (Bocage, 1886)
Angolan Beaked Thread Snake (Fig. 4, Map 2)
Material: PEM R23261, Cuchi Gorge, Cuando
Cubango Province, -14.59000° 16.90758°, 1,350 m asl.
Description: Midbody scale rows 15; 245 middorsal
scales; 20 subcaudals, 12 scales around tail; supraoculars
present; rostral fused with prefrontal; beak hooked;
anterior supralabial present; cloacal scale heart-shaped.
Size: 132 + 9 mm. Habitat and natural history notes:
A single specimen was collected from the Cuchi River, a
tributary of the Cubango River, under a rock in Miombo
woodland. Comment: This is an Angolan endemic,
restricted to southern Angola (Branch 2018). The new
record represents the eastern-most locality for this
species and the first record for the larger Okavango Delta
system. This species was recently recorded from Bicuar
National Park and surroundings (Baptista et al. 2019a;
Butler et al. 2019).
Family: Typhlopidae
Afrotyphlops angolensis (Bocage, 1866)
Angolan Blind Snake (Fig. 5, Map 3)
Material: PEM R23357, en route to Cuito River source,
Moxico Province, -12.43405° 18.43603°, 1,533 m
asl. Description: Midbody scale rows 23; 318 ventral
scales; 11 subcaudals. Size: 215 + 3.6 mm. Habitat
and natural history notes: A single specimen was
collected when a fallen tree obstructing the road was
252 November 2021 | Volume 15 | Number 2 | e292
Conradie et al.
Elevation (m)
=}
=
o
Fig. 3. Leptotyphlops kafubi from the camp at a tributary Map 1. Distribution of Leptotyphlops kafubi in Angola. Historical
(Luandai River) of the Luanguinga River. Photo by Werner __ records are indicated by white dots while all new records are
Conradie. indicated by black dots. Axis values are in degrees (°).
©
oOo
: 2000
2 4 |} 1500
s
x ® || 1000
“ra a
Ww
500
Sigel
/ 0
© |
2 |
Fig. 4. Namibiana rostrata from Cuchi River Gorge. Photo by Map 2. Distribution of Namibiana rostrata in Angola.
Werner Conradie.
© |
oOo _
! 2000
a E|} 1500
5
7 @ | 1000
chal an
Wu
500
+ |
0
© |
2 |
t 5 as: “
bi = a, ‘ ; \
rs et a Cl ng es SLY Pig % iy ' Ny
Fig. 5. Afrotyphlops angolensis en route to Cuito River source. Map 3. Distribution of Afrotyphlops angolensis in Angola.
Photo by Werner Conradie.
removed in pristine Miombo woodland. Comment: The — throughout much of the Democratic Republic of the
specimen was identified as A. angolensis using the key | Congo (DRC) through to Uganda, Kenya, Tanzania, and
provided by Broadley and Wallach (2009), but this needs = Zambia (Broadley and Wallach 2009). Many historical
to be confirmed using genetic data. This species was names are currently subsumed under this name (Broadley
originally described from Angola by Bocage (1866) but and Wallach 2009), and given its large geographical
is represented by fewer than 10 records from the country range, there is a need to investigate this species complex
(Marques et al. 2018). Outside of Angola, itis widespread _—_ ina phylogenetic framework.
Amphib. Reptile Conserv. 253 November 2021 | Volume 15 | Number 2 | e292
Snakes of the Okavango Delta headwater area in Angola
ee sce Pe ae
r. Pike < f
my # ae? ag a
ates, * ae = “4 : 7 es
i ter aes : re
% ¥
om S. 3 mgt . rons te Ser te Po
" ~ : Pm. irae "5
A ine” atch “ - =
Fig. 6. Afrotyphlops schmidti from Lungwebungu River. Photo
by Werner Conradie.
-
Afrotyphlops schmidti (Laurent, 1956)
Schmidt’s Blind Snake (Fig. 6, Map 4)
Material: PEM R23993, en route to Lungwebungu
River, Moxico Province, -12.44190° 18.62826°, 1,419
m asl; PEM R23979, Lungwebungu River, -12.58131°
18.66378°, 1,298 m asl. Description: Midbody scale
rows 22 and 24; 347 and 336 ventral scales; 9 and 10
subcaudals. Largest specimen: 435 + 5.9 mm. Habitat
and natural history notes: Two specimens were
collected in Miombo woodland, both actively moving in
the early morning. Comment: One of these specimens
was featured in Branch (2018), but under the incorrect
name A. mucruso. Re-examination of the material
confirms it to be assignable to A. schmidti based on the
key provided by Broadley and Wallach (2009). Broadley
and Wallach (2009) discussed the complex taxonomic
history of the species. Broadley et al. (2003) mention that
material from western Zambia and the DRC, including
the holotype from Katanga, are blotched, similar to our
material. The only other material for Angola is from
the eastern part of the country (Calundo and Cazombo:
Laurent 1964).
Superfamily: Pythonoidea
Family: Pythonidae
Python natalensis Smith, 1840
Southern Rock Python (Map 5)
Material: Quembo River, -13.48626° 19.24775°,
1,243 m asl (sighting only); Quembo River, -13.93008°
19.41776°, 1,198 m asl (sighting only); Cuando River,
-13.46214° 19.54561°, 1,229 m asl (sighting only);
10 km south of Cuanavale River source, approx.
-13.17192° 18.85896°, 1,544 m asl (sighting only).
Additional photographic record: Cuatir, Cuando
Cubango Province, -16.48523° 18.20304°, Stefan van
Wyk. Habitat and natural history notes: Specimens
were sighted sunning themselves next to main rivers.
Comments: Three species of pythons are known from
Angola (P. anchietae, P. sebae, and P. natalensis; Branch
2018; Marques et al. 2018). We assigned our material
Amphib. Reptile Conserv.
Elevation (m)
Map 4. Distribution of Afrotyphlops schmidti in Angola.
to P. natalensis based on head coloration and scalation
(Broadley 1984, 1999). This species is widespread
south of -10° latitude, approximately the latitude of the
lower Cuanza River in Angola. This is the largest snake
Species occurring in the study area, but it was seldom
encountered. Although it is considered as a protected
species in Angola (Decreto Executivo No. 201/16, 26 de
Abril de 2016), we observed a python being cooked in
a hunter’s camp, 10 km south of the Cuanavale River
source (Chris Boyes, pers. comm.). Pythons are often
found in the local Angolan markets or sold on the side
of the road in the form of live animals, fresh meat,
smoked meat, and leather products (Marques et al. 2018;
Gongalves et al. 2019).
Superfamily: Colubroidea
Family: Colubridae
Crotaphopeltis barotseensis Broadley, 1968
Barotse Water Snake (Fig. 7, Map 6)
Material: PEM R23271, Cuanavale River source,
Moxico Province, -13.09033° 18.89396°, 1,356 m asl:
PEM R23348, small tributary source lake 6 km SE
of Cuito River source, Moxico Province, -12.73675°
18.39310°, 1,446 m asl; PEM R23323, Cuito River
Source Lake, Moxico Province, -12.68935° 18.36012°,
Elevation (m)
rs}
oOo
oO
Map 5. Distribution of Python natalensis in Angola.
November 2021 | Volume 15 | Number 2 | e292
Conradie et al.
= Stes a SON Maes Lal oe i is os ee ev £4
Fig. 7. Crotaphopeltis barotseensis from Cuando River source.
Photo by Werner Conradie.
1,435 m asl; PEM R23466, Quembo River source,
Moxico Province, -13.13592° 19.04417°, 1,369 m asl;
PEM R23406, dammed tributary of Cuando River,
Moxico Province, -13.06838° 19.34366°, 1,287 m asl:
PEM R23439, Cuando River Source, Moxico Province,
-13.00393° 19.12808°, 1,351 m asl; PEM R27360,
Quembo River right tributary (Micongo River) past
village, Moxico Province, -13.51877° 19.28487°, 1,248
m asl. Description: Dorsal scales smooth and in 17 rows
at midbody; 151-168 ventrals; 29—42 paired subcaudals;
1 preocular; 2 postoculars; 1+2 temporals; 8 supralabials,
the 3—5" entering the orbit; 10 infralabials, the first five
in contact with the anterior chin shield; cloacal scale
entire. Largest female: 279 + 37 mm (PEM R23348);
largest male: 407 + 47 mm (PEM R27360). Habitat
and natural history notes: All specimens were found
in grassland associated with large water sources. One
specimen had an unidentified Ptychadena in its stomach,
while another had frog eggs (possibly Hyperolius) in
its stomach. Comment: These are the first records of
this aquatic snake for Angola. Although some minor
morphological differences were observed among the
newly collected Angolan material, the specimens agree
with those observed by Rasmussen (1997). The new
material increases the maxium number of ventral scales
and provides both the lowest and highest subcaudal scale
Fig. 8. Crotaphopeltis hotamboeia from west of Menongue.
Photo by Luke Verburet.
Amphib. Reptile Conserv.
Elevation (m)
S
=}
ro)
Map 6. Distribution of Crotaphopeltis barotseensis in Angola.
counts. The holotype is unique in that the upper postocular
is excluded from the supraocular by the parietal, while
in all the new material the upper postocular is in broad
contact with the supraocular. Our collection has already
been included in the previous checklist of Angolan snakes
(Branch 2018) and the recent Angolan biodiversity book
(Branch et al. 2019). The closest previous record is the
type specimen from Kalabo in Zambia (~450 km to
the east; Broadley 1968). This material has also been
used in a recent phylogenetic study of the genus and C.
barotseensis was recovered as the sister lineage to all
other Crotaphopeltis (Engelbrecht et al. 2019).
Crotaphopeltis hotamboeia (Laurenti, 1768)
White-lipped Snake (Fig. 8, Map 7)
Material: PEM R23301, HALO Menongue, Cuando
Cubango Province, -14.66317° 17.66521°, 1,372 m asl;
PEM R23349-50, small tributary source lake 6 km SE
of Cuito River source, Moxico Province, -12.73675°
18.39310°, 1,446 m asl; PEM R23532, EN280 West
of Menongue, Cuando Cubango Province, -14.67908°
17.19325°, 1,415 m asl; PEM R27361-9, INBAC:
WC-7063, Lake Hundo, Moxico Province, -14.97431°
21.62966°, 1,100 m asl. Description: Dorsal scales
smooth anteriorly and weakly keeled posteriorly, and
in 19 rows at midbody; 139-158 ventrals; 31-41 paired
Elevation (m)
ra
oO
oO
Map 7. Distribution of Crotaphopeltis hotamboeia in Angola.
November 2021 | Volume 15 | Number 2 | e292
Snakes of the Okavango Delta headwater area in Angola
Fig. 9. Dasypeltis confusa from Cuito River source. Photo by
Werner Conradie.
subcaudals; 1 preocular; 2 postoculars; temporals 1+2; 8
supralabials, the 3°—5“" entering the orbit; 10 infralabials,
first five in contact with the anterior chin shield; cloacal
scale entire. Largest female: 465 + 66 mm (PEM
R27361); largest male: 485 + 76 mm (PEM R23532).
Habitat and natural history notes: Specimens were
found in grassland associated with large water sources,
and these populations lack the red/orange lip coloration
typical of snakes found further south. Five specimens had
frogs (Hyperolius angolensis or Kassina senegalensis) in
their stomachs. Comment: A common and widespread
species in Angola (Marques et al. 2018). Surprisingly, a
recent study showed only shallow genetic divergences
among C. hotamboeia across its range (Engelbrecht et
al. 2019).
Dasypeltis confusa Trape and Mané, 2006
Confusing Egg Eater (Fig. 9, Map 8)
Material: PEM R23272, Cuanavale River source,
Moxico Province, -13.09033° 18.89396°, 1,356 m asl:
PEM R27745, Lake Hundo, Moxico Province, -14.9700°
21.6314°, 1,106 m asl. Description: Dorsal scales
strongly keeled and in 25 and 26 rows at midbody; 196
and 209 ventrals; 63 paired subcaudals; 1 preocular; 2
postoculars; 2 temporals; 7 supralabials, with 3™—5"
entering the orbit; 7 and 8 infralabials, with first three in
contact with the anterior chin shield; cloacal scale entire.
Largest male: 396 + 78 mm (PEM R27745). Habitat
and natural history notes: PEM R23272 exhibited the
typical threat display by rubbing its scales and opening
its mouth to show the black interior (https://www.
facebook.com/pemherp/videos/1083042281853751/).
Comment: A new lower range for the number of ventral
scales is provided. Records of Dasypeltis spp. are known
from all over Angola, from western to central and eastern
Angola (Marques et al. 2018), but species identification
to date has been confused. This widespread distribution
includes a range of habitats, such as coastal floodplains
and the central plateau. Unpublished barcoding results
of the Cuanavale River source specimen confirms
the identification of the species as D. confusa. This
Amphib. Reptile Conserv.
Elevation (m)
rs)
i=]
oO
Map 8. Distribution of Dasypeltis confusa in Angola.
represents the first genetically confirmed record of this
recently described species for Angola. Other material
from Cangandala (Ceriaco et al. 2016b, as D. scabra,
see Branch 2018) and from the Humpata Plateau (PEM
R22056; field number NB0738; Baptista et al. 2018) can
be assigned to this species as they all exhibit the typical
‘SL’ color pattern (Gans 1959; Trape and Mané 2006).
We also tentatively assign an unpatterend reddish-orange
specimen photographed (Fig. 10) at the Cuando River to
this species.
Dispholidus typus viridis (Smith, 1828)
Boomslang (Fig. 11, Map 9)
Material: PEM R23346, Village Fio, 30 km_ north
of Menongue (DOR), Cuando Cubango Province,
-14.05786° 17.46992°, 1,445 m asl; PEM R23542,
EN140 north of Menongue (DOR), Cuando Cubango
Province, -14.05786° 17.46992°, ~1,504 m asl; PEM
R23519, Quembo River source, Moxico Province,
-13.11452° 19.02469°, 1,512 m asl. Description: Dorsal
scales elongated and keeled, in 18—19 rows at midbody;
174-186 ventrals; 116 paired subcaudals; 1 preocular;
2 postoculars; temporals 1+2; 7 supralabials, with 34
and 4" entering the orbit; 10 infralabials, the first five
Fig. 10. Dasypeltis cf. confusa from Cuando River. Photo by
Gotz Neef.
November 2021 | Volume 15 | Number 2 | e292
Conradie et al.
Fig. 11. Juvenile Dispholidus typus viridis from Quembo River
source. Photo by Werner Conradie.
in contact with the anterior chin shield; cloacal scale
divided. Largest female: 804 + 228 mm (PEM R23346);
largest male: 233 + 89 mm (PEM R23519). Habitat
and natural history notes: Juvenile specimen found
in mature Miombo. Comment: This is a common and
widespread venomous species of snake throughout most
of Africa, and comprises numerous forms (D. ¢. typus,
D. t. viridis, D. t. punctatus, and D. t. kivuensis). The
Angolan material is often restricted to two subspecies,
D. t. punctatus (mostly northern Angola) and D. t. viridis
(mostly southern and central Angola; see Marques et al.
2018; Baptista et al. 2019a). The elevation of these two
forms to full species was proposed in the unpublished
thesis by Eimermacher (2012), but awaits formal
publication. The new material can be assigned to D. t.
viridis based on uniform coloration and higher subcaudal
scale counts.
Philothamnus angolensis Bocage, 1882
Angolan Green Snake (Fig. 12, Map 10)
Material: PEM R23518, 33 km W of Menongue,
Cuelei River, Cuando Cubango Province, -14.70511°
17.38014°, 1,500 m asl; PEM R23263, Cuchi Gorge,
Cuando Cubango Province, -14.59000° 16.90758°,
1,350 m asl. Description: Dorsal scales smooth and
in 15 rows at midbody; 132-175 ventrals; 88—103
Fig. 12. Philothamnus angolensis from Cueli River, west of
Menongue. Photo by Luke Verburgt.
Amphib. Reptile Conserv.
Elevation (m)
r=)
oO
oO
Map 9. Distribution of Dispholidus typus viridis in Angola.
paired subcaudals; weak posterior ventral keeling; 1
preocular; 2 postoculars; temporals 1+1; 9 supralabials,
with 46" entering the orbit; 10 infralabials, with first
five in contact with the anterior chin shield; cloacal
scale divided. Largest female: 588 + 262 mm (PEM
R23518); largest male: 290 + 130 mm (PEM R23392).
Habitat and natural history notes: All specimens were
collected from the Cubango River and its tributaries to
the west of the study area, which is dominated by rockier
substrate and dry Miombo woodland. Comment: First
described from Capangombe in Angola as Philothamnus
angolensis (Bocage 1882), but later considered to be part
of Philothamnus irregularis by most authors, including
Bocage himself (Bocage 1895; Parker 1936; Monard
1937b; Bogert 1940; Hellmich 1957b; Laurent 1964).
Hughes (1985) resolved the taxonomic confusion by
restricting P. irregularis to West Africa and reinstating
P. angolensis for the southern and eastern populations.
Many of the historical records from Angola referred
to as P. irregularis are now assignable to either P
angolensis or P. hoplogaster. Philothamnus angolensis
is widespread across most of southern, central, and
eastern Africa (Branch 1998; Spawls et al. 2018). Within
Angola, the species is known mostly from central and
western Angola, with isolated records in the north-east
(Marques et al. 2018). Although no records are known
Elevation (m)
ro)
Co
Co
Map 10. Distribution of Philothamnus angolensis in Angola.
November 2021 | Volume 15 | Number 2 | e292
Snakes of the Okavango Delta headwater area in Angola
Fig. 13. Philothamnus heterolepidotus from Cuanavale River
source. Photo by Werner Conradie.
from south-eastern Angola, there are records from the
Okavango Delta in Botswana and the Zambezi Region
(= Caprivi Strip) in Namibia (Auerbach 1987; Broadley
and Blaylock 2013), and thus the presence of this species
is expected in south-eastern Angola. A recent virtual
museum record (ReptileMap 166590) from the Angolan
side of the Cubango River, just west of Calai, fills the gap
between the southern Angolan and Namibian records.
Philothamnus heterolepidotus (Gunther, 1863)
Slender Green Snake (Fig. 13, Map 11)
Material: PEM R23281-3, Cuanavale River source
lake, Moxico, -13.09330° 18.89396°, 1,356 m asl; PEM
R27374, INBAC: WC-7094, Luvu River camp, Moxico,
-13.71200° 21.83538°, 1,082 m asl; PEM R23470-4,
INBAC: WC-4619, Quembo River Source, Moxico,
-13.13592° 19.04417°, 1,369 m asl; PEM R23413,
road east of Cuando River Source, Moxico, -13.00118°
19.15739°, 1,335 m asl. Description: Dorsal scales
smooth and in 15 rows at midbody; 171-186 angular
ventrals; 110-130 paired smooth subcaudals; 1 preocular;
2 postoculars; temporals 1+1; 9 supralabials, the 4-6"
entering the orbit; 10 infralabials, the first five in contact
with the anterior chin shield; cloacal scale divided. Largest
female: 529 + 249 mm (PEM R23474); largest male: 520
+ 270 mm (PEM R23283). Habitat and natural history
Fig. 14. Philothamnus hoplogaster from Luvu River. Photo by
Werner Conradie.
Amphib. Reptile Conserv.
Elevation (m)
o
i=]
o
Map 11. Distribution of Philothamnus heterolepidotus in
Angola.
notes: Commonly found and trapped near water sources.
Three specimens had reed frogs (Hyperolius sp.) in their
stomachs. One female (PEM R23472) had four eggs,
largest measuring 29.0 x 7.8 mm. A few individuals were
captured at night while sleeping in trees near the water.
Comment: In the literature, P. heterolepidotus is recorded
to have either smooth or angular ventral scales (Broadley
et al. 2003; Spawls et al. 2018; Chippaux and Jackson
2019). All of the new material presented here exhibited
weakly developed angular ventral scales. The species is
known from a number of localities in Angola (Marques
et al. 2018). The record referred to as P. hoplogaster in
Conradie et al. (2016) is actually a P. heterolepidotus.
Philothamnus hoplogaster (Gunther, 1863)
Green Water Snake (Fig. 14, Map 12)
Material: PEM R23392, Malova Village next to
Mipanha River, Huila Province, -14.09140° 16.41476°,
1,569 m asl; PEM R23999, Lake Tchanssengwe, Moxico,
-12.41402° 18.64418°, 1,393 m asl; PEM R27375, Luvu
River camp, Moxico Province, -13.71200° 21.83538°,
1,082 m asl. Description: Dorsal scales smooth and 1n 15
rows at midbody; 157—158 smooth ventrals; 79-88 paired
subcaudals; 1 preocular; 2—3 postoculars; temporals
1+1; supralabials 8, with 4" and 5" entering the orbit;
9 infralabials, the first five in contact with the anterior
Elevation (m)
2
oO
oO
12 14 #16 18 20 22 24
Map 12. Distribution of Philothamnus hoplogaster in Angola.
November 2021 | Volume 15 | Number 2 | e292
Conradie et al.
Fig. 15. Philothamnus ornatus from Cuito River source. Photo
by Werner Conradie.
chin shield; cloacal scale divided. Largest female: 420
+ 63 mm (PEM R27375); largest male: 290 + 130 mm
(truncated; PEM R23992). Habitat and natural history
notes: Found near waterbodies in Miombo woodland.
One specimen had a Kassina senegalensis in its stomach.
Comment: Among all the green snakes collected from
the study area, only three specimens were assignable to
typical P. hoplogaster. Often confused with P. angolensis
and P. heterolepidotus, with which they share a similar
temporal arrangement (1 + 1), but this species differs in
the number of supralabials (2 vs. 3) entering the orbit
and the absence of any ventral keeling (vs. weakly
keeled in the other two). In a recent phylogenetic study
of Philothamnus, a single Angolan sample was used
from Lunda-Sul Province (Engelbrecht et al. 2019).
These records represent the first for Moxico Province
and south-eastern Angola, but records are known from
adjacent western Zambia (Broadley 1971). This species
was found sympatrically with P. heterolepidotus at Luvu
River.
Philothamnus ornatus Bocage, 1872
Ornate Green Snake (Fig. 15, Map 13)
Material: PEM R23284—5, Cuanavale River source
lake, Moxico Province, -13.09330° 18.89396°, 1,357 m
asl; PEM R27376, Cuanavale River source lake, Moxico
Province, -13.09052° 18.8939°, 1,357 m asl; PEM
R23441-3, INBAC: WC-4806, Cuando River Source
Trap 1, Moxico Province, -13.00393° 19.12808°, 1,351
m asl; PEM R23430-2, Cuando River Source Trap 2,
Moxico Province, -13.00426° 19.12719°, 1,350 m asl;
PEM R23330, Cuito River Source Lake, Moxico Province,
-12.68935° 18.36012°, 1,435 m asl. Description: Dorsal
scales smooth and in 15 rows at midbody; 146-159
smooth ventrals; 97-112 paired subcaudals; 1 preocular;
2 postoculars; temporals 1+1; supralabials 8, with
3_5 entering the orbit; 10 infralabials, the first five
in contact with the anterior chin shield; cloacal scale
divided. Largest female: 496 + 238 mm (PEM R23285);
largest male: 412 + 126 mm (PEM R23431). Habitat
and natural history notes: All specimens were found
near waterbodies surrounded by grassland and mature
Amphib. Reptile Conserv.
Elevation (m)
3
o
3
00
if 8. “Ge ABe. “eos” Wal) iad
Map 13. Distribution of Philothamnus ornatus in Angola.
Miombo woodland. This species lacks ventral keeling
and has never been observed climbing, unlike sympatric
P. heterolepidotus. The stomachs of four snakes
contained frogs of the genera Ptychadena and Hyperolius.
Comment: Philothamnus ornatus was described by
Bocage (1872) from two specimens collected at Huila.
Although subsequently recorded from Zambia and
Zimbabwe (Broadley 1971; Broadley et al. 2003) and
recently from Botswana (Naturalist 35448603), it is
known in Angola from only 10 localities (Marques et al.
2018). The species was recently documented for the first
time from the Cuito River basin (Conradie et al. 2016),
and here we document it from three more localities: Cuito
River source, Cuanavale River source, and Cuando River
source. These collections fill the gap between the records
from western Angola and the Zambian populations.
Philothamnus semivariegatus (Smith, 1840)
Spotted Bush Snake (Fig. 16, Map 14)
Material: PEM R23549, Quembo River source camp,
Moxico Province, -13.14104° 19.05426°, 1,369 m
asl; PEM R23563, west of Cuemba town, Moxico
Province, -11.97027° 17.84878°, 1,319 m asl; PEM
R24278, Cuando River, Camp 20, Moxico Province,
-14.88452° 20.29548°, 1,116 m asl; PEM R27377, en
route from Cangamba to Luio River, Moxico Province,
-13.24037° 20.16443°, 1,312 m asl; PEM R27378,
PEM R27379, INBAC: WC-7055, PEM R27380, Lake
Hundo, Moxico Province, -14.97431° 21.62966°, 1,100
m asl. Description: Dorsal scales smooth and in 15
rows at midbody; 181-193 strongly keeled ventrals;
121-131 paired, keeled subcaudals; 1 preoculars; 2
postoculars; temporal formula variable, but mostly
2+2+2:; supralabials 8—10, with mostly 4-6" entering
the orbit; 10 infralabials, the first five in contact with
the anterior chin shield; cloacal scale divided. Largest
female: 866 + 384 mm (PEM R27377); largest male:
847 + 367 (truncated) mm (PEM R23563). Habitat and
natural history notes: All specimens exhibit distinct
ventral keeling and were often encountered in elevated
positions (arboreal) near waterbodies. Three individuals
had Hyperolius angolensis in their stomachs. Comment:
November 2021 | Volume 15 | Number 2 | e292
Snakes of the Okavango Delta headwater area in Angola
Fig. 16. Philothamnus semivariegatus from Quembo River
source. Photo by Werner Conradie.
Material collected from the study area are uniform lime
green without any black spots or bars, and have a yellow
ventrum and ventral keeling. Recently, Engelbrecht et al.
(2019) showed deep divergence within P. semivariegatus
and identified four distinct lineages. The material from
Angola was grouped with the Central African clade,
comprising mostly material from the DRC, Zambia,
Zimbabwe, Mozambique, Namibia, and ‘Tanzania.
Further taxonomic work is needed to resolve the status
of these four groups.
Thelotornis capensis oatesi (Gunther, 1881)
Oates’ Vine Snake (Fig. 17, Map 15)
Material: (photographic record only) Munhango region,
Moxico Province, -12.17042° 18.55931°, ~1,443 m asl.
Comment: Although Broadley (2001) distinguished 7:
c. oatesi based on head coloration and the high number
of ventral scales, the status of this taxon was not fully
resolved with phylogenetic analysis (Eimermacher 2012)
and thus remains problematic. Our record represents the
first record for Moxico Province, although this species is
widespread within the country (Marques et al. 2018) and
in adjacent western Zambia (Broadley 1971; Pietersen et
al. 2017).
Fig. 17. Thelotornis capensis oatesi en route to Cuito River
source, east of Muhango. Photo by Gotz Neef.
Amphib. Reptile Conserv.
Elevation (m)
=}
oO
o
Map 14.
Angola.
Distribution of Philothamnus semivariegatus in
Family: Natricidae
Limnophis bicolor (Ginther, 1865)
Bicoloured Swamp Snake (Fig. 18, Map 16)
Specimens: PEM R23297, Delala River, near Samunanga
village, Moxico Province, -12.93169° 18.81458°,
1,363 m asl; PEM R23454, Quembo River source trap
4, Moxico Province, -13.13586° 19.04709°, 1,368
m asl; PEM R23992, Rio Cuquema, upstream, Bié
Province, -12.46902° 16.82415°, 1,640 m asl; PEM
R24000, Upstream of Lungwebungu River bridge,
Moxico Province, -12.56330° 18.64470°, ~1,307 m
asl. Description: Dorsal scales smooth and in 19 rows
at midbody; 127-136 smooth ventrals; 37-55 paired
subcaudals; 1 preocular; 2 postoculars; temporals 1+2;
parietal not touching the 6" supralabial, nasal sutures
touching 1“ supralabial; supralabials 8, with mostly 3 and
4" entering the orbit; infralabials 9, with first five in contact
with the anterior chin shield; cloacal scale divided. Largest
female: 471 + 108 mm (PEM R23992): largest male: 333
+ 93 mm (PEM R24000). Habitat and natural history
notes: One specimen (PEM R23297) was observed
swallowing a fish (Zilapia sparrmanii [Cichlidae]), which
was regurgitated upon capture. Another specimen (PEM
Elevation (m)
°
o
oO
Map 15. Distribution of The/otornis capensis oatesi in Angola.
November 2021 | Volume 15 | Number 2 | e292
Conradie et al.
Fig. 18. Limnophis bicolor from Delala River, near Samunanga
village. Photo by Werner Conradie.
R2400) contained a suckermouth catlet (Chiloglanis
sp.) in its stomach. All material are females, except
PEM R2400. All females collected showed early egg
development (March and April), except a female (PEM
R23454) collected in November which contained eight
well-developed eggs. Comment: The new material
represents only the second set of published records for
Moxico Province and the first for the Cuando River
system (Laurent 1964; Conradie et al. 2020). Limnophis
bangweolicus is also known to occur in eastern Moxico
Province (Laurent 1964), and can easily be distinguished
by different gular and subcaudal coloration patterns,
head shape, and scalation (Conradie et al. 2020).
Natriciteres olivacea (Peters, 1854)
Olive Marsh Snake (Fig. 19, Map 17)
Material: PEM R27373, Lake Hundo, Moxico Province,
-14.97431° 21.62966°, 1,100 m asl. Description:
Dorsal scales smooth and in 19 rows at midbody; 140
smooth ventrals; 55 paired subcaudals; 2 preoculars;
3 postoculars; temporals 1+2; supralabials 8, with 4"
and 5" entering the orbit; infralabials 9, with first five
in contact with the anterior chin shield; cloacal scale
divided. Female: 431 + 114 mm (PEM R27373). Habitat
and natural history notes: A single gravid female was
encountered being active at night at the edge of the lake
Fig. 19. Natriciteres olivacea from Lake Hundo. Photo by
Werner Conradie.
Amphib. Reptile Conserv.
Elevation (m)
S
So
o
Map 16. Distribution of Limnophis bicolor in Angola.
surrounded by Miombo woodland. Comment: This new
record represents the first record for Moxico Province
and, overall, only the ninth record for Angola (Marques
et al. 2018; Ernst et al. 2020). It is expected to be much
more widely distributed, as it occupies habitat similar to
that favored by Limnophis bicolor.
Superfamily: Elapoidea
Family: Atractaspididae
Subamily: Aparallactinae
Amblyodipsas polylepis polylepis (Bocage, 1873)
Common Purple-glossed Snake (Fig. 20, Map 18)
Material: PEM R23535, EN280 West of Menongue,
Cuando Cubango Province, -14.68858° 17.22208°,
~1,453 m asl. Description: Dorsal scales smooth and
in 19 rows at midbody; 173 smooth ventrals; 26 paired
subcaudals; 1 postocular; 2 temporals; 6 supralabials,
the 3% and 4" entering the orbit; 7 infralabials, the first
five in contact with the anterior chin shield; cloacal scale
divided. Male: 448 + 51 mm (PEM R23535). Habitat
and natural history notes: An adult male was collected
live on the road west of Menongue. Comment: This
species is known from a handful of Angolan records
(Marques et al. 2018). Recently, Portillo et al. (2018)
used the above specimen in a phylogenetic study on the
Elevation (m)
=)
(=)
°
Map 17. Distribution of Natriciteres olivacea in Angola.
November 2021 | Volume 15 | Number 2 | e292
Snakes of the Okavango Delta headwater area in Angola
Fig. 20. Amblyodipsas polylepis polylepis from west of
Menongue. Photo by Luke Verburgt.
Aparallactinae and documented some genetic structure
among the limited samples available to them. Loveridge
(1944) divided A. polylepis into four distinct groups and
documented the Angolan population to have a higher
midbody scale row count. Our specimen had 17-19-
19 scale rows, which conforms to the paratypes from
Cazengo and Quissange (fide Broadley 1971). This
represents the first record from south-eastern Angola,
although it is known from adjacent Zambia, Namibia,
and Botswana (Broadley 1971; Auerbach 1987; Broadley
and Blaylock 2013).
Amblyodipsas ventrimaculata (Roux, 1907)
Kalahari Purple-glossed Snake (Fig. 21, Map 19)
Material: PEM R23320, Cuito River Source Lake,
Moxico Province, -12.68935° 18.36012°, 1,435 m asl.
Description: Dorsal scales smooth and in 15 rows at
midbody; 174 smooth ventrals; 19 paired subcaudals; 1
postocular; 1 temporal; 5 supralabials, with 2™ and 3%
entering the orbit; 5 infralabials, the first three in contact
with the anterior chin shield; cloacal scale divided.
Female: 266 + 20 mm (PEM R23320). Habitat and
natural history notes: An adult female was collected
in the grasslands above the Cuito River source. The
snake contained three embryos. Comment: This
specimen represents the first record of this species for
= : Hf x 2 oh) :
Fig. 21. Amblyodipsas ventrimaculata from Cuito River source.
Photo by Werner Conradie.
Amphib. Reptile Conserv.
Elevation (m)
S
oO
oO
Map 18. Distribution of Amblyodipsas polylepis polylepis in
Angola.
Angola (Branch 2018) and confirms the prediction of its
occurrence in south-eastern Angola made by Conradie et
al. (2016), which was based on the occurrence of suitable
habitat and an abundance of food resources for the
species. Recently, Portillo et al. (2018) used the specimen
mentioned above and found no genetic differences
between the Angolan population and the distant South
African population. Butler et al. (2019) and Baptista et
al. (2019a) documented the presence of this species from
Bicuar National Park in Huila Province.
Xenocalamus mechowii Peters, 1881
Elongate Quill-snouted Snake (Fig. 22, Map 20)
Material: PEM R23463, Quembo River source, Moxico
Province, -13.13586° 19.04709°, ~1,440 m asl; PEM
R23533, alive on road, West of Menongue, Cuando
Cubango Province, -14.67794° 17.23322°, 1,368
m asl; PEM R27385, grasslands west of Luo River,
Moxico Province, -13.72468° 21.69403°, 1,009 m asl.
Description: Dorsal scales smooth and in 17 rows
at midbody; 228-254 smooth ventrals; 27—28 paired
subcaudals; 2 postoculars; 1 temporal; 6 supralabials, the
3 and 4" entering the orbit; 5 infralabials, the first two in
contact with the anterior chin shield; cloacal scale divided.
Largest male: 438 + 40 mm (PEM R23533). Habitat and
natural history notes: PEM R23463 had the remains of
f
Elevation (m)
S
oO
oOo
Map 19. Distribution of Amblyodipsas ventrimaculata in
Angola.
November 2021 | Volume 15 | Number 2 | e292
Conradie et al.
Fig. 22. Xenocalamus mechowii from west of Menongue.
Photo by Luke Verburet.
a Zygaspis nigra in its stomach. Comment: Broadley
(1971) assigned material from western Zambia to a hybrid
form between the two subspecies, X. m. mechowii and _X.
m. inornatus, due to scale counts overlapping with the
two recognized subspecies. Our northernmost specimen
has scalation within the range of X. m. inornatus (PEM
R23463 and PEM R27385: 247 and 254 ventrals and
27 and 28 subcaudals), while our southern sample is in
range of X. m. mechowi (PEM R23533: 228 ventrals and
28 subcaudals) and thus could also be allocated to these
transitional populations. Recently, Portillo et al. (2018)
used the material mentioned above and found no genetic
differences between the two samples, but that study did
not include material from the northern populations of the
nominal form (1.e., outside of the purported hybrid zone).
These inconsistencies in morphology coupled with low
genetic divergence cast doubt on the validity of these two
subspecies. Further investigation is needed to assess the
validity of the taxa in question, but here we treat them by
their binomial name.
Family: Lamprophiidae
Boaedon angolensis Bocage, 1895
Angolan House Snake (Fig. 23, Map 21)
Material: PEM R23251, 65 km south of Menongue
(DOR),
Cuando Cubango Province, -15.26050°
Fig. 23. Boaedon angolensis from west
by Luke Verburgt.
of Menongue. Photo
Amphib. Reptile Conserv.
263
m)
Elevation (
Map 20. Distribution of Xenocalamus mechowii in Angola.
17.677614°, 1,246 masl; PEM R23403, Menongue HALO
compound, Cuando Cubango Province, -14.66313°
17.66522°, 1,385 m asl; PEM R23536, 60 km West
of Menongue on EN280, Cuando Cubango Province,
-14.67253°, 17.14700°, 1,378 m asl. Description: Dorsal
scales smooth and in 28 rows at midbody; 203-224
smooth ventrals; 51-67 paired subcaudals; 1 preocular; 2
postoculars; temporals 1+2; 8 supralabials, the 4" and 5"
entering the orbit; 9 infralabials, the first four in contact
with the anterior chin shield; cloacal scale divided.
Largest female: 882 + 134 mm (PEM R23403); largest
male: 460 + 140 mm (PEM R23251). Habitat and
natural history notes: Specimens were only found in the
Cubango River drainage. Comment: The name Boodon
lineatus var. angolensis Bocage, 1895 was reinstated for
most of the material from central and western Angola
(Hallermann et al. 2020). This species is widespread in
Angola and endemic to the country.
Boaedon branchi Hallermann, Ceriaco, Schmitz, Ernst,
Conradie, Verburgt, Marques, and Bauer, 2020
Branch’s House Snake (Fig. 24, Map 22)
Material: PEM R21846, 47.5 km E of Menongue on
road to Cuito Cuanavale, Cuando Cubango Province,
-14.59517° 18.07111°, 1,497 m asl; PEM R23538, Longa
River, Cuando Cubango Province, -14.55956° 18.41406°,
1,319 m asl. Description: Dorsal scales smooth and in
Elevation (m)
“14
-16
-18
Map 21. Distribution of Boaedon angolensis in Angola.
November 2021 | Volume 15 | Number 2 | e292
Snakes of the Okavango Delta headwater area in Angola
Fig. 24. Boaedon branchi from Longo River east of Menongue.
Photo by Bill Branch.
29 rows at midbody; 197 and 210 smooth ventrals; 64
and 67 paired subcaudals; 1—2 preoculars; 2 postoculars;
temporals 1+2; 8 supralabials, the 4" and 5“ entering
the orbit; 9 infralabials, the first four in contact with
the anterior chin shield; cloacal scale divided. Largest
male: 508 + 123 mm (PEM R21846). Habitat and
natural history notes: The stomach of the subadult male
contained an unidentified rodent. Comment: The unusual
pale-yellow specimen previously identified as Boaedon
cf. angolensis in Conradie et al. (2016, Fig. 9G) is here
referred to as the recently described Boaedon branchi,
which is only known from two specimens from east of
Menongue, Cuando Cubango Province (Hallermann et
al. 2020).
Boaedon fradei Hallermann, Ceriaco, Schmitz, Ernst,
Conradie, Verburgt, Marques, and Bauer, 2020
Zambezi/Frade’s House Snake (Fig. 25, Map 23)
Material: PEM R23486—7, Quembo River source lake,
Moxico Province, -13.13544° 19.04397°, 1,375 m asl:
PEM R23985, bridge over Lungwebungu River, Moxico
Province, -12.58013° 18.66740°, 1,304 m asl; PEM
R25338, Lake Hundo, Moxico Province, -14.97431°
21.62966°, 1,100 m asl; PEM R27746, lower Cuando
River, -16.50574° 22.10673°, 1,023 m asl. Description:
Dorsal scales smooth and in 28-29 rows at midbody;:
201-214 smooth ventrals; 50-74 paired subcaudals:
1 preocular; 2 postoculars; temporals mostly 1+2+3; 8
o Si é' 4 WO pert 7 . = a hy es i : Ae i e Ag € os
Fig. 25. Boaedon fradei from Quembo River source. Photo by
Werner Conradie.
Amphib. Reptile Conserv.
Elevation (m)
3
oO
Oo
12 14 16 18 20 22 24
Map 22. Distribution of Boaedon branchi in Angola.
supralabials, 3-5" entering the orbit; 9 infralabials, the
first four in contact with the anterior chin shield; cloacal
scale entire. Largest female: 738 + 122 mm (PEM
R23486); largest male: 608 + 143 mm (PEM R239835).
Habitat and natural history notes: All specimens
were associated with Angolan Miombo Woodland and
Zambezian Baikiaea woodlands. Comment: Material
collected from this study comprised the type series
of the newly described B. fradei from eastern Angola
(Hallermann et al. 2020). A photographic record
mentioned in the text of Conradie et al. (2016) under the
heading Boaedon cf. angolensis can be assigned to this
new species based on overall coloration and distribution
(see iNaturalist 1727921). Boaedon fradei is widespread
in the southern DRC, and is found throughout western
and northern Zambia to the Zambezi Region (= Caprivi
Strip) in Namibia and adjacent Botswana (Conradie et
al., In Prep.)
Lycophidion multimaculatum Boettger, 1888
Spotted Wolf Snake (Fig. 26, Map 24)
Material: PEM R23399, Cubango River Source Site,
Huambo Province, -12.66388° 16.09385°, 1,771 m
asl; PEM R23455, Quembo trap 4, Moxico Province,
-13.13586° 19.04709°, 1,368 m asl; PEM R23467-8,
Quembo trap 1, Moxico Province, -13.13592° 19.04417°,
1,369 m asl. Description: Dorsal scales smooth and in 17
rows at midbody; 160—176 smooth ventrals; 22—27 paired
if
Elevation (m)
3
oO
Oo
Map 23. Distribution of Boaedon fradei in Angola.
November 2021 | Volume 15 | Number 2 | e292
Conradie et al.
source. Photo by Werner Conradie.
subcaudals; 2 postoculars; temporals mostly 1+2+3; 8
supralabials, the 35“ entering the orbit; 8 infralabials,
the first four in contact with the anterior chin shield;
cloacal scale entire. Largest female: 446 + 37 mm (PEM
R23399); largest male: 236 + 38 mm (PEM R23468).
Habitat and natural history notes: Stomach contents
of two snakes contained Trachylepis and Ichnotropis
remains. One female (PEM R23467; collected 3 Nov
2016) contained five fully developed eggs. Comment:
Broadley (1996) reassigned all historical L. capense
material from Angola to L. multimaculatum. Elsewhere,
this species is widely distributed in western and northern
Zambia (Broadley 1971; Broadley et al. 2003) and the
Zambezi Region (= Caprivi Strip) of Namibia (Branch
1998).
Family: Prosymnidae
Prosymna angolensis Boulenger, 1915
Angola Shovel-snout Snake (Fig. 27, Map 25)
Material: PEM R27381, Quembo River bridge camp,
Trap 4, Moxico Province, -13.52658° 19.27810°,
1,248 m asl; PEM R23456—8, Quembo trap 4, Moxico
Province, -13.13586° 19.04709°, 1,368 m asl; PEM
R23483, Cuando River Source Trap 4, Moxico Province,
-13.00164° 19.1296°, 1,372 masl; PEM R23510-—2, Cuito
ee 3
os
7 Vike
Cuando River source.
4 See a, Rae f BS nae ~ See
ig. 27. Prosymna angolensis from
Photo by Werner Conradie.
Amphib. Reptile Conserv.
Elevation (m)
S
Oo
o
Map 24.
Angola.
Source Lake, Moxico Province, -12.68866° 18.36025°,
1,426 m asl. Description: Dorsal scales smooth and
in 15 rows at midbody; 116-124 smooth ventrals;
18-26 paired subcaudals; 1 (rarely 2) preoculars; 2
postoculars; temporals mostly 1+2; 6 supralabials, with
2™4_4t" entering the orbit; 7 infralabials, the first three in
contact with the anterior chin shield; cloacal scale entire;
21-36 fused dark dorsal spots. Largest female: 200
+ 21 mm (PEM R23456); largest male: 198 + 25 mm
(PEM R23458). Habitat and natural history notes: All
specimens were captured in traps in sandy areas next to
source lakes. Comment: Boulenger (1915) described
this species from Angola, but did not designate a precise
type locality. Loveridge (1958) was the first to propose
designating Huila as the type locality, but 1t was Broadley
(1980) that finally restricted it to Caconda, since the
Huila material could not be found. This species is mostly
distributed in central and western Angola, with isolated
records from western Zambia, the Zambezi Region
(=Caprivi Strip) in north-eastern Namibia, and northern
Botswana (Broadley 1980). Material from south-eastern
Angola exhibits the same dorsal coloration (large black
fused blotches, similar to P. janii, which 1s restricted to
Mozambique and north-eastern South Africa), lower
ventral and subcaudal scale counts, and two postoculars
as described for specimens from western Zambia, which
Distribution of Lycophidion multimaculatum in
Elevation (m)
S
So
5
Map 25. Distribution of Prosymna angolensis in Angola.
November 2021 | Volume 15 | Number 2 | e292
Snakes of the Okavango Delta headwater area in Angola
Fig. 28. Kladirostratus acutus from Cuando River source.
Photo by Werner Conradie.
differ from the type material from Caconda (Broadley
1980). Despite these differences, Broadley (1980) did
not make any taxonomic changes but stated that a larger
series was needed to resolve this issue. The taxonomic
status of this material is under investigation, and it may
prove to be a separate species from the western and
southern populations.
Family: Psammophiidae
Kladirostratus acutus (Gunther, 1888)
Branch’s Beaked Snake (Fig. 28, Map 26)
Material: PEM R23496, Cuanavale River source
lake, Moxico Province, -13.09442° 18.89372°, 1,396
m asl; PEM R23288, Cuanavale River source lake,
Moxico Province, -13.09330° 18.89396°, 1,367 m
asl; PEM R23445-6, Cuando River Source Trap 1,
Moxico Province, -13.00393° 19.12808°, 1,351 m asl;
PEM R23434—6, Cuando River Source Trap 2, Moxico
Province, -13.00426° 19.12719°, 1,350 m asl; PEM
R23449-50, Cuando River Source Trap 3, Moxico
Province, -13.00334° 19.13564°, 1,364 m asl; PEM
R23315, Cuito River Source Lake, Moxico Province,
-12.66825° 18.35282°, 1,407 m asl; PEM R27371,
Quembo River bridge camp, Trap 1, Moxico Province,
-13.528005° 19.281466°, 1,236 m asl; PEM R23476,
Quembo trap 1, Moxico Province, -13.13592° 19.04417°,
Fig. 29. Psammophis jallae from west of Cuanavale River
source. Photo by Werner Conradie.
Amphib. Reptile Conserv.
Elevation (m)
S
So
oO
Map 26. Distribution of Kladirostratus acutus in Angola.
1,369 m asl; PEM R23459, INBAC: WC-4726, Quembo
trap 4, Moxico Province, -13.13586° 19.04709°, 1,368 m
asl. Description: Dorsal scales smooth and in 17 rows
at midbody; 170-189 smooth ventrals; 57—72 paired
subcaudals; 1 preocular; 2 postoculars; temporals mostly
2+3; 8 supralabials, the 4" and 5™ entering the orbit; 9
infralabials, the first five in contact with the anterior chin
shield; cloacal scale divided. Largest specimen: 677 +
170 mm (male, PEM R23315). Habitat and natural
history notes: One specimen had some mammal hair in
the stomach, while others contained frogs (Hyperolius
sp., Breviceps ombelanonga, and Kassina senegalensis).
Comment: A widespread species recorded mostly from
the Angolan plateau (Marques et al. 2018). Manacas
(1973) was the first to record this species from Moxico
Province under the name Psammophis acutus. We
recorded numerous new records for Moxico Province,
and the new material formed the basis of the description
of the new genus Kladirostratus (Keates et al. 2019). The
status of K. a. jappi from adjacent Zambia, and whether
its distribution extends into eastern Angola, still need to
be clarified (Broadley 1971).
Psammophis jallae Peracca, 1896
Jalla’s Sand Snake (Fig. 29, Map 27)
Material: PEM R23523, just west of Cuanavale River
source (DOR), Moxico Province, -13.01347° 18.81669°,
Elevation (m)
3S
oO
Oo
Map 27. Distribution of Psammophis jallae in Angola.
November 2021 | Volume 15 | Number 2 | e292
Conradie et al.
Ei pas
Fig. 30. Psammophis mossambicus from Quembo River source.
Photo by Werner Conradie.
153 m asl. Description: Dorsal scales smooth and in
15 rows at midbody; 176 smooth ventrals; 97 paired
subcaudals; 1 preocular; 2 postoculars; temporals
2+3+3; 7 supralabials, the 3 and 4" entering the orbit;
9 infralabials, the first four in contact with the anterior
chin shield; cloacal scale divided. Female: 460 + 191 mm
(PEM R23523). Habitat and natural history notes:
Single specimen collected DOR with adjacent open
grassland. The specimen had an /chnotropis sp. in its
stomach. Comment: This is only the second record of the
species for Angola. The only other record from Angola 1s
from Lumuna River (Angel 1921). Marques et al. (2018)
incorrectly assigned the material from Bigondo and
‘Benguella to Bihe,’ recorded by Loveridge (1940), to
P. jallae, when in fact it actually refers to the P. ansorgii
material reported by Boulenger (1905; see Branch et al.
2019). The former locality is not mentioned in Boulenger
(1905), but Monard (1937b) implied that it originated
from Boulenger (1905). At that stage, Loveridge (1940)
regarded P. ansorgii as a junior synonym of P. jallae.
Later, Broadley (1977) reinstated both as valid species.
Loveridge (1940) also synonymized Angel’s (1921) P
rohani with P. jallae, and this was followed by subsequent
authors (Broadley 1977).
Psammophis mossambicus Peters, 1882
Olive Grass Snake (Fig. 30, Map 28)
Material: PEM R23402, DOR near Katchiungo,
Huambo Province, -12.65341° 16.02845°, 1,828 m asl;
PEM R23286, Cuanavale River source lake, Moxico
Province, -13.09330° 18.89396°, ~1,367 m asl; PEM
R23448, Cuando River Source Trap 3, Moxico Province,
-13.00334° 19.13564°, 1,364 m asl; PEM R23491,
Quembo trap 2, Moxico Province, -13.13544° 19.04397°,
1,375 m asl; PEM R27382, Quembo River bridge camp,
Trap 2, Moxico Province, -13.52816° 19.28067°, 1,240
m asl; INBAC: WC-5186, DOR 1, near Cauanga,
-12.73778° 15.94731°, 1,777 m asl. Description:
Dorsal scales smooth and in 17 rows at midbody;
162-174 smooth ventrals; 81-98 paired subcaudals;
1 preocular; 2 postoculars; temporals mostly 2+3 or
Amphib. Reptile Conserv.
Elevation (m)
3
oO
oO
12 14 16 18 20 22 24
Map 28. Distribution of Psammophis mossambicus in Angola.
2+3+3; 8 supralabials, the 4" and 5" entering the orbit;
10 infralabials, the first four in contact with the anterior
chin shield; cloacal scale divided. Largest female: 867 +
350 mm (PEM R20024); largest male: 1,000 + 398 mm
(PEM R23286). Habitat and natural history notes: The
remains of Trachylepis sp. and Panaspis sp. were found
in the stomachs of two of the specimens. Comment:
Although Trape et al. (2019) recently made substantial
progress in resolving most of the taxonomical issues
surrounding the P. sibilans complex, historical Angolan
material assigned to either P. brevirostris, P. leopardinus,
P. mossambicus, P. phillipsi, or P. sibilans needs to be
re-examined and genetically assessed (Conradie et al.
2016).
Psammophis zambiensis Hughes and Wade, 2002
Zambian Whip Snake (Fig. 31, Map 29)
Material: PEM R23287, Cuanavale River source lake,
Moxico Province, -13.09330° 18.89396°, ~1,367 m
asl; PEM R23444, INBAC: WC-4793, Cuando River
Source Trap 1, Moxico Province, -13.00393° 19.12808°,
1,351 m asl; PEM R23433, Cuando River Source Trap
2, Moxico Province, -13.00426° 19.12719°, 1,350 m
asl; PEM R23331, Cuito River Source Lake, Moxico
Province, -12.68935° 18.36012°, 1,435 m asl; PEM
R27384, Quembo River bridge camp, Trap 4, Moxico
Province, -13.52658° 19.27810°, 1,248 m asl; PEM
R23475, Quembo trap 1, Moxico Province, -13.13592°
19.04417°, 1,369 m asl. Description: Dorsal scales
smooth and in 17 rows at midbody; 150-160 smooth
ventrals; 75-86 paired subcaudals; 1 preocular; 2
postoculars; temporals 2+3; 8 supralabials, with 4"
and 5" entering the orbit; 9 infralabials, the first four
in contact with the anterior chin shield; cloacal scale
divided. Largest female: 524 + 78 mm (PEM R23433),;
largest male: 656 + 237 mm (PEM R23444). Habitat and
natural history notes: One specimen had a Pitychadena
uzungwensis in its stomach, while another contained the
remains of a Trachylepis sp. Comment: This species
was only recently described from northern Zambia and
adjacent DRC (Hughes and Wade 2002), and very little is
November 2021 | Volume 15 | Number 2 | e292
Snakes of the Okavango Delta headwater area in Angola
Fig. 31. Psammophis zambiensis from Cuando River source.
Photo by Werner Conradie.
known about its full distribution. These new records are
the first confirmed records of P zambiensis for Angola
and extend the species’ distribution westward. Marques
et al. (2018) assigned material from Calombe (Manag¢as
1973), Dundo (Laurent 1950, 1954, 1964; Thys van
den Audenaerde 1966), ‘Dundo, R. Mussungue, aff.
Luachimo’ (Thys van den Audenaerde 1966), ‘Barrage
de la Luachimo’ (Thys van den Audenaerde 1966),
and “Muita (Lumebe)’ (Laurent 1954) as potentially
belonging to this species, but the ventral (168-177) and
subcaudal (83-98) counts listed are much higher than
those recorded by Hughes and Wade (2002; 148-165
ventrals and 75-90 subcaudals) for P. zambiensis and
groups closer with the P. ‘sibilans’ group (e.g., 167-177
ventrals and 81-103 subcaudals). In addition to the
lower scale counts, this species has diagnostic ventral
black barring which distinguishes it from the sympatric
P. mossambicus (Hughes and Wade 2002). A genetically
confirmed record from Lubango, Huila Province (PEM
R22074) extends the known distribution of this species
600 km further west (Keates 2021). It has also recently
been recorded as far east as Malawi (Brown 2019).
Family: Elapidae
Dendroaspis polylepis Gunther, 1864
Black Mamba (Fig. 32, Map 30)
Fig. 32. Dendroaspis polylepis from Cuando River. Photo by
Gotz Neef.
Amphib. Reptile Conserv.
Elevation (m)
12 14 #16 18 20 22 24
Map 29. Distribution of Psammophis zambiensis in Angola.
Material: PEM R24277, Cuando River, Camp 20,
Moxico Province, -14.88452° 20.29548°, ~1,116 m
asl; DOR (photo and DNA), near Caiundo, Cuando
Cubango Province, -15.32121° 17.651610°, ~1,306 m
asl; LVA2 (DNA), EN140 north of Menongue, Cuando
Cubango Province, -13.08367° 16.75083°, ~1,710 m
asl. Additional photographic records: Cuatir, Cuando
Cubango Province, -16.48523° 18.20304°, Stefan
van Wyk; Menongue, Cuando Cubango Province,
-14.63015° 17.63465°, Stefan van Wyk. Description:
Dorsal scales smooth and in 21 rows at midbody; 273
smooth ventrals; 121 paired subcaudals; 3 preoculars; 4
postoculars; temporals mostly 1+2; 8 supralabials, the 4"
entering the orbit; 12 infralabials, the first four in contact
with the anterior chin shield; cloacal scale divided.
Female: 1,570 + 460 mm (PEM R24277). Habitat and
natural history notes: The specimen from Cuando
River shared a hole with a Philothamnus semivariegatus
(PEM R24278). Two adult specimens were seen mating
near the Khula River source in April 2017. Comment:
Two species of Mamba are known to occur in Angola,
D. jamesoni and D. polylepis (Branch 2018; Marques et
al. 2018). Most historical material of D. polylepis from
Angola was wrongly referred to as D. angusticeps (see
citations within Marques et al. 2018), which was only
rectified by Bayhman (2010). Fewer than 10 records
of D. polylepis were mapped in Marques et al. (2018).
-14
Elevation (m)
3
So
Oo
-16
-18
Map 30. Distribution of Dendroaspis polylepis in Angola.
November 2021 | Volume 15 | Number 2 | e292
Conradie et al.
Fig. 33. Elapsoidea semiannulata semiannulata from Quembo
River bridge site. Photo by Werner Conradie.
Since then, numerous new records have been documented
from Angola (Baptista et al. 2019a; iNaturalist 32281228,
32523446; this study). As predicted by Conradie et al.
(2016), this species appears to be widespread in central
and southern Angola, with an isolated record from the
extreme north-western section of Angola (Bayhman
2010). The record mapped in Marques et al. (2018) from
Lake Carumbo, Lunda-Norte Province is based on a sight
record that cannot be properly verified to the species level
(Branch and Conradie 2015). It should thus be omitted
until new material can be collected, and the validity of the
record confirmed. The absence of this species from north-
eastern Angola is further supported by Laurent (1950,
1954, 1964) and Thys van den Audenaerde (1966) who
failed to document this species in their extended works.
Elapsoidea semiannulata semiannulata Bocage, 1882
Angolan Garter Snake (Fig. 33, Map 31)
Material: PEM R23561, en route to Kulu River source,
approx. -12.73915° 18.39236°, 1,453 masl; PEM R27370,
lower Quembo River, -13.52988° 19.28340°, 1,242 m
asl. Description: Dorsal scales smooth and in 13 rows at
midbody; 146 and 148 smooth ventrals; 23 and 25 paired
subcaudals; 1 preocular; 2 postoculars; temporals 1+2; 7
supralabials, 3 and 4" entering the orbit; 7 infralabials,
the first four in contact with the anterior chin shield (4"
in narrow contact); cloacal scale divided. Thirty faint
bands present on the dorsum, extending onto the flanks
but absent from the venter. Largest male: 393 + 43 mm
(PEM R27370). Habitat and natural history notes:
Members of the logistic team stumbled upon a scene
where a larger unidentified snake was busy consuming
a smaller snake (E/apsoidea s. semiannulata). The larger
snake then regurgitated its prey and disappeared into the
bush. The second specimen was found active at night in
grassland next to the Quembo River. Comment: This
material represents only the second and third record for
Moxico Province. The only other record for the country
is from 200 km northeast of Lunea = Vila Luso (Manag¢as
1981). Outside of Angola, the species is known from
Zambia west of the Zambezi River and northern Namibia
(Broadley 1971).
Amphib. Reptile Conserv.
Elevation (m)
Map 31. Distribution of E/apsoidea semiannulata semiannulata
in Angola.
Elevation (m)
S
Oo
oO
Map 32. Distribution of Naja (Afronaja) nigricollis in Angola.
Naja (Afronaja) nigricollis (Reinhardt, 1843)
Black-necked Spitting Cobra (Map 32)
Material: PEM R23250, near Caiundo, Cuando
Cubango Province, -15.68460° 17.47872°, 1,190 m asl;
PEM R23556, EN140 North of Menongue, Bié Province,
-13.08633° 16.75083°, ~1,710 m asl. Description:
Dorsal scales smooth and in 19 rows at midbody; 188
smooth ventrals; 62 paired subcaudals; | or 2 preoculars;
3 postoculars; temporals 2+4 and 2+5; supralabials 6,
the 3" entering the orbit; 8 infralabials, the first four in
contact with the anterior chin shield; cloacal scale entire.
Male: 311 + 24 mm (PEM R23561). For PEM R23250
we only have the head. Habitat and natural history
notes: Both specimens had mammal hair in the gut or
in their mouths. Comment: It is a widespread species
in central and western Angola (Marques et al. 2018).
The only specimens we encountered were 1n the western
part of the study area, associated with drier Miombo
woodlands. They seem to be absent from the wetter
Miombo woodlands around the source lakes area.
Family: Viperidae
Bitis (Bitis) arietans (Merrem, 1820)
Puff Adder (Fig. 34, Map 33)
Material: PEM R23296, Delala River, near Samunanga
village, Moxico Province, -12.93169° 18.81458°, 1,363
November 2021 | Volume 15 | Number 2 | e292
Snakes of the Okavango Delta headwater area in Angola
a Saree : a ia Oe: =
Bitis (Bitis) arietans from D
Fig. 34.
elala River, near
Samunanga village. Photo by Luke Verburgt.
5S 4 =
oe
masl; PEM R23373, en route from Quembo to Cuanavale,
Moxico Province, -13.50839° 19.14667°, 1,389 m
asl; PEM R23394, Cubango River Source, -12.66068°
16.09468°, 1,763 m asl. Additional photographic
record: Cuatir, Cuando Cubango Province, -16.48523°
18.20304°, Stefan van Wyk. Description: Dorsal
scales heavily keeled, in 28-31 rows at midbody; 121-
129 smooth ventrals; 23-29 paired subcaudals; 7-9
interorbitals; 3 interoculabials; 13-15 circumorbitals;
13-16 supralabials; 16 infralabials, the first four in
contact with the anterior chin shield; cloacal scale
entire. Largest female: 309 + 36 mm (PEM R23394);
largest male: 631 + 98 mm (PEM R23296). Habitat and
natural history notes: The specimens from the source
lakes area were found in open grassland associated with
the drainage lines. Comment: This venomous species is
common and widespread throughout Angola (Marques et
al. 2018).
Bitis (Macrocerastes) gabonica (Dumeéril, Bibron, and
Dumeril, 1854)
Gaboon Adder (Fig. 35, Map 34)
Material: PEM R23374, near Samunanga village,
Moxico Province, -12.89228° 18.8605°, 1,363 m asl;
Sight record, road east of Luena, -13.17558° 21.17988°,
~1,146 m asl. Additional photographic records:
Fig. 35. Bitis (Macrocerastes) gabonica from near Samunanga
village. Photo by Werner Conradie.
Amphib. Reptile Conserv.
Elevation (m)
°
oS
oO
Map 33. Distribution of Bitis (Bitis) arietans in Angola.
22 km east of Longa, Cuando Cubango Province,
-14.68680° 18.66540°, John Mendelson; 2.8 km south-
east of Longa, Cuando Cubango Province, -14.61600°
18.50380°, John Mendelson; Cusseque/Chitembo, Bié
Province, -13.51863° 16.75419°, Manfred Finckh.
Description: Dorsal scales heavily keeled, in 42 rows
at midbody; 129 smooth ventrals; 29 paired subcaudals;
13-15 interorbitals; 4 interoculabials; 15 circumorbitals;
15 supralabials; 19 infralabials, the first four in contact
with the anterior chin shield; cloacal scale entire. Size
male: 1,100 + 135 mm (PEM R23374). Habitat and
natural history notes: This specimen was caught in a
pitfall trap dug by the locals for catching animals in the
Angolan Miombo woodland. Comment: Previously,
this species was mostly known from northern Angola,
with some records from Benguela and Moxico provinces
(Marques et al. 2018), later being recorded as far south as
Caimbambo, Benguela Province (Oliveira et al. 2016) and
Tchivinguiro, Huila Province (Branch, unpub. data). The
new records from this study as well as unpublished TM
records, virtual museum records (ReptileMap 166065;
iNaturalist 33760143, 34126489), and photographic
records (J. Mendelsohn) extend the distribution of
this species as far south as Longa in Cuando Cubango
Province, filling the gap between the northern and
southern records. The new material documented from
Elevation (m)
5
ao
So
12 14 16 18 20 22 24
Map 34. Distribution of Bitis (Macrocerastes) gabonica in
Angola.
November 2021 | Volume 15 | Number 2 | e292
Conradie et al.
a, : eT a, ES alee
Fig. 36. Causus bilineatus from Quembo River source. Photo
by Luke Verburgt.
aS
ue Nt
teow g S
this study is the first for south-eastern Angola and the
Okavango Delta system.
Causus bilineatus Boulenger, 1905
Two-lined Night Adder (Fig. 36, Map 35)
Material: PEM R23268—70, Cuanavale River source
lake, Moxico Province, -13.09330° 18.89396°, 1,367
m asl; PEM R23321, Cuito River Source Lake, Moxico
Province, -12.68935° 18.36012°, 1,435 m asl; PEM
R23428-9, Cuando River Source Trap 2, Moxico
Province, -13.00426° 19.12719°, 1,350 m asl; PEM
R23437, Cuando River Source Trap 1, Moxico Province,
-13.00393° 19.12808°, 1,351 m asl; PEM R23451-2,
Quembo trap 4, Moxico Province, -13.13586° 19.04709°,
1,368 m asl; PEM R23464—-5, INBAC: WC-4727,
Quembo trap 1, Moxico Province, -13.13592° 19.04417°,
1,369 m asl. Additional photographic record: Cuatir,
Cuando Cubango Province, -16.48523° 18.20304°,
Stefan van Wyk. Description: Dorsal scales smooth
and in 17 rows at midbody; 129-135 smooth ventrals;
24-32 paired subcaudals; 2 preoculars; 2 postoculars;
temporals mostly 2+3; 6 supralabials; 9 infralabials,
the first four in contact with the anterior chin shield;
cloacal scale entire. Largest female: 337 + 38 mm (PEM
R23321); largest male 350 + 53 mm (INBAC: WC-
4727). Habitat and natural history notes: This species
- ara
~,
“A
“A
Fig. 37. Causus rhombeatus from Quembo River source. Photo
by Werner Conradie.
Amphib. Reptile Conserv.
Elevation (m)
3S
oO
o
Map 35. Distribution of Causus bilineatus in Angola.
is associated with wetlands and rivers. The stomachs
of specimens contained various frogs (Ptychadena
taenioscelis, P. uzungwensis, Hyperolius nasutus, and
Breviceps ombelanonga). One female (PEM R23429)
collected in November 2015 had four fully developed
eggs, the largest measuring 12.8 x 6.5 mm. Comment:
This species has mostly been recorded from central and
western Angola (Marques et al. 2018) with the only
known record from eastern Angola being from Lake
Calundo, Moxico Province (Laurent, 1964). Marques
et al. (2018) assigned Bogert’s (1940) C. rhombeatus
specimen from Capelongo to C. bilineatus following
Managas (1981), however Rasmussen (2005) examined
the same material and assigned it to C. rhombeatus. The
recently collected material is the first from the Okavango
Delta system. The southernmost record of this species is
from Cuatir, Cuando Cubango Province.
Causus rhombeatus (Lichtenstein, 1823)
Rhombic Night Adder (Fig. 37, Map 36)
Material: PEM R23405, Cuando region, Moxico
Province, -13.66494° 19.51381°, 1,277 m asl; PEM
R23438, Cuando River Source Trap 1, Moxico Province,
-13.00393° 19.12808°, 1,351 m asl; PEM R23488,
Quembo trap 2, Moxico Province, -13.13544° 19.04397°,
1,375 m asl; PEM R27358, Cuanavale River source
7 2000
1500
1000
Elevation (m)
500
0
Map 36. Distribution of Causus rhombeatus in Angola.
November 2021 | Volume 15 | Number 2 | e292
Snakes of the Okavango Delta headwater area in Angola
lake, Moxico Province, -13.09052° 18.89394°, 1,357
m asl; PEM R27359, wetland near old quarry west of
Quemba, Bié Province, -12.16960° 18.22965°, 1,353 m
asl. Additional photographic records: Cuatir, Cuando
Cubango Province, -16.48523° 18.20304°, Stefan van
Wyk; Menongue, Cuando Cubango Province, -14.63015°
17.63465°, Stefan van Wyk. Description: Dorsal scales
smooth and in 18—20 rows at midbody; 136-146 smooth
ventrals; 26-36 paired subcaudals; 2 preoculars; 2
postoculars; temporals 2+3; 6 supralabials; 9 infralabials,
the first four in contact with the anterior chin shield;
cloacal scale entire. Largest female: 652 + 82 mm (PEM
R23488); largest male 611 + 93 mm (PEM R27358).
Habitat and natural history notes: One specimen was
found preying upon a Sclerophrys pusilla. Comment:
This venomous species is widespread throughout Angola
(Marques et al. 2018). Adult material from eastern
Angola lacks the distinct dark vertebral black blotches
and 1s more olive in coloration than the southern African
material, while juveniles are greyish with distinct black
vertebral blotches.
Discussion
This study covers an extensive area in south-eastern
Angola that was previously very poorly surveyed. It
increases the total number of snake species recorded
for the country to 133. At a regional level, the results
raise the total number of species known from the
Angolan Okavango-Cuando-Zambezi river system to
53 species, an increase of 16 species from a previously
compiled checklist for the region (Conradie et al. 2016).
This survey confirms the presence of four species
previously predicted to occur in the region (Elapsoidea
s. semiannulata, Amblyodipsas p. polylepis, A.
ventrimaculata, and Crotaphopeltis barotseensis, the
latter two representing the first country records (Branch
2018)). The first genetically confirmed records of
Dasypeltis confusa and Psammophis zambiensis (Keates
2021; W. Conradie, unpub. data) and the second record
of the rarely sighted Psammophis jallae for Angola are
also documented here.
Material collected in this under-surveyed region led
to the description of two new snake species for Angola
(Hallermann et al. 2020), contributed substantialy to
several studies on African snake genera over the last few
years (e.g., Portillo et al. 2018, 2019; Engelbrecht et al.
2019, 2020; Keates et al. 2019; Conradie et al. 2020;
Deepak et al. 2021), and will certainly be used in further
studies. These publications highlight the relevance at
both the national and continental levels of such surveys
in undersampled regions of Angola, as they not only help
document the area and justify its conservation value, but
also contribute to the clarification of taxonomic issues
and biogeographical patterns at broader scales.
A compilation of all the snake species previously
recorded from adjacent Zambia, Namibia, and Botswana
Amphib. Reptile Conserv.
(Auerbach 1987; Branch 1998; Broadley et al. 2003;
Broadley and Blaylock 2013) shows that we have
recorded at least 10 new species for the Okavango Delta
system: Bitis gabonica, Boaedon angolensis, B. branchi,
B. fradei, Causus bilineatus, Dasypeltis confusa,
Namibiana_ rostrata, Philothamnus heterolepidotus,
Prosymna_ angolensis, and Psammophis zambiensis.
Additional surveys in south-eastern Angola will likely
add more entries to the growing list of species known
from the Angolan Okavango-Cuando-Zambezi river
drainages, among which the following are expected:
Afrotyphlops mucruso, A. schlegelii, Atractaspis bibroni,
Gracililima nyassae, Grayia tholloni, Hemirhagerrhis
nototaenia, Hypoptophis wilsoni, Limaformosa capensis,
Psammophis angolensis, P. lineatus, Psammophylax
tritaeniatus, Pseudaspis cana, Telescopus semiannulatus,
and Xenocalamus bicolor.
Updated geographic distribution maps for the whole
country of the snake species occurring in south-eastern
Angola are presented here, and they include substantially
increased numbers of records and distribution ranges
for certain species, such as Bitis gabonica, Causus
bilineatus, Dendroaspis polylepis, and Python natalensis.
The results fill large gaps in the geographic distributions
of many snake species in central and eastern Angola (see
Maps 1-36).
Until recently, south-eastern Angola and its river
sources had been relatively protected from human
exploitation, mostly due to their remoteness (Mendelsohn
and Obeid 2004). After the end of the war in Angola,
this scenario started to change gradually (Mendelsohn
and Obeid 2004), and the current accessibility of the
region is leading to rapid urban growth (Mendelsohn
and Weber 2015; NGOWP 2017) and illegal commercial
logging, which has escalated during the last few years
(Mendelsohn and Martins 2018). The development plans
for the region include agriculture, fish farming, and
livestock production, among others (Mendelsohn and
Martins 2018). All of these developments pose a serious
threat to conservation in Angola, and consequently to
what lies downstream, including the Okavango Delta
(Mendelsohn and Obeid 2004), an UNESCO World
Heritage site. Documenting the biodiversity in the region
is an essential step in justifying the urgent need for
the protection of this unique and vulnerable section of
Angola and Africa.
Acknowledgments.—We thank Steve Boyes and John
Hilton of the Wild Bird Trust, which administers the
National Geographic Okavango Wilderness Project
(2016-2019; National Geographic Society grant
number EC0715-15). Material was collected and
exported under the following export permits issued
by the Angolan Ministry of Environment Institute of
Biodiversity (MINAMB): 31/GGPCC/2016, 89/INBAC.
MINAMB/2017, and 002/GGPTBOK/18. The project
is endorsed and supported by the Governors of Cuando
November 2021 | Volume 15 | Number 2 | e292
Conradie et al.
Cubango, Bié, and Moxico provinces. Various colleagues
are thanked for collecting herpetological material during
their fieldwork, including Roger Bills, Paul Skelton,
Maans Booysens, Kerllen Costa, and Alex Rebelo. Stefan
van Wyk kindly provided additional records for Cuatir. WC
thanks the Eastern Cape Province Department of Sport,
Recreation, Arts, and Culture (DSRAC) and Port Elizabeth
Museum (Bayworld) for granting special leave to take part
in these surveys. We thank Enviro-Insight for constructing
and donating the drift fences required for the trapping
exercise. Ethical clearance for the study was obtained from
the Port Elizabeth Museum (Bayworld) ethics committee
(Ethical Clearance no. 2013 and 2017-2).
Literature Cited
Adalsteinsson SA, Branch WR, Trape S, Vitt LJ, Hedges
SB. 2009. Molecular phylogeny, classification, and
biogeography of snakes of the family Leptotyphlopidae
(Reptilia, Squamata). Zootaxa 2244: 1-50.
Angel MF. 1921. Description d’un ophidien nouveau de
Angola appartenant au genre Psammophis. Bulletin
de la Societé Zoologique de France 46: 116-118.
Angel MF. 1923. Reptiles. Pp. 157-169 In: Mission
Rohan-Chabot, Angola et Rhodésia (1912-1914),
Tome IV, Histoire Naturelle, Fascule 1 (Mammiferes
— Oiseaux — Reptiles — Poissons). Imprimerie
Natsionale, Paris. 176 p., 18 pls., 1 folding map.
Auerbach RD. 1987. The Amphibians and Reptiles of
Botswana. Okepa Consultants, Gaborone, Botswana.
295 p.
Baptista N, Antonio T, Branch WR. 2018. Amphibians
and reptiles of the Tundavala region of the Angolan
escarpment. Biodiversity & Ecology 6: 397-403.
Baptista N, Antonio T, Branch WR. 2019a. The
herpetofauna of Bicuar National Park and
surroundings, south-western Angola: a preliminary
checklist. Amphibian & Reptile Conservation |3(2)
[Special Section]: 96-130 (e203).
Baptista N, Conradie W, Vaz Pinto P, Branch WR.
2019b. The amphibians of Angola: early studies
and the current state of knowledge. Pp. 243-281 In:
Biodiversity of Angola. Science and Conservation: a
Modern Synthesis. Editors, Huntley BJ, Ferrand N,
Russo V, Lages F. Springer, Cham, Switzerland. 552
p.
Bayhman T. 2010. Geographic distribution: Reptilia:
Squamata: Dendroaspis polylepis polylepis. African
Herp News 51: 432-440.
Bocage JVB. 1866. Lista dos repteis das possessdes
portuguezas d’Africa occidental que existem no
Museu de Lisboa. Jornal de Sciencias Mathematicas,
Physicas e Naturaes |: 37-56.
Bocage JVB. 1872. Diagnoses de quelques espéces
nouvelles de Reptiles d’Afrique occidentale. Jornal
de Sciencias Mathematicas, Physicas e Naturaes 4:
72-82.
Amphib. Reptile Conserv.
Bocage JVB. 1882. Notice sur les especes du genre
“Philothamnus” qui se trouvent au Muséum de
Lisbonne. Jornal de Sciencias Mathematicas,
Physicas e Naturaes 9(33): 1—20.
Bocage JVB. 1895. Herpétologie d‘Angola et du Congo.
Imprimerie Nationale, Lisbon, Portugal. 203 p.
Bogert CM. 1940. Herpetological results of the Vernay
Angola expedition. Bulletin of the American Museum
of Natural History 77. 1-107.
Boulenger GA. 1905. A list of the batrachians and
reptiles collected by Dr. W.J. Ansorge in Angola, with
a description of new species. Annals and Magazine of
Natural History, Series 7 16: 105-115.
Boulenger GA. 1915. A list of snakes of the Belgian and
Portuguese Congo, Northern Rhodesia, and Angola.
Proceedings of the Zoological Society of London
1915: 193-223.
Branch WR. 1998. Field Guide to the Snakes and other
Reptiles of Southern Africa. Revised Edition. Struik
Publishers, Cape Town, South Africa. 399 p.
Branch WR. 2018. Snakes of Angola: an annotated
checklist. Amphibian & Reptile Conservation 12(2)
[General Section]: 41-82 (e159).
Branch WR, Conradie W. 2013 Naja annulata annulata
(Bucholtz and Peters, 1876). African Herp News 59:
50-53.
Branch WR, Conradie W. 2015. Herpetofauna da regiao
da Lagoa Carumbo. Pp. 194-209 In: Avaliagdo
Rapida da Biodiversidade da Regido da Lagoa
Carumbo, Lunda Norte — Angola. Editors, Huntley
B, Francisco P. Ministerio do Ambiental de Angola,
Luanda, Angola. 219 p.
Branch WR, McCartney CJ. 1992. A report on a small
collection of reptiles from southern Angola. Journal
of the Herpetological Association of Africa 41: 1-3.
Branch WR, Baptista N, Vaz Pinto P, Conradie W. 2019.
The reptiles of Angola: history, updated checklists,
endemism, hot spots, and future directions for research.
Pp. 283-326 In: Biodiversity of Angola. Science and
Conservation: a Modern Synthesis. Editors, Huntley
BJ, Ferrand N, Russo V, Lages F. Springer, Cham,
Switzerland. 552 p.
Branch WR, Schmitz A, Lobon-Rovira J, Baptista NL,
Antonio T, Conradie W. 2021. Rock island melody:
a revision of the Afroedura bogerti Loveridge, 1944
group, with descriptions of four new endemic species
from Angola. Zoosystematics and Evolution 97(1):
55-82.
Broadley DG. 1968. A new species of Crotaphopeltis
(Serpentes: Coulubridae) from Barotseland, Zambia.
Fieldiana, Zoology 51(10): 135-139.
Broadley DG. 1971. The reptiles and amphibians of
Zambia. The Puku 6: 1-143.
Broadley DG. 1977. A review of the genus Psammophis
in southern Africa (Serpentes: Colubridae). Arnolidia
(Rhodesia) 8(12): 1-12.
Broadley DG. 1980. A revision of the African snake
November 2021 | Volume 15 | Number 2 | e292
Snakes of the Okavango Delta headwater area in Angola
genus Prosymna Gray (Colubridae). Occasional
Papers of the National Museums of Rhodesia, Series
B. Natural Sciences 6(7): 481-556.
Broadley DG. 1983. FitzSimons’ Snakes of Southern
Africa. (Revised Edition). Delta Books, Johannesburg,
South Africa. 376 p.
Broadley DG. 1984. A review of geographical variation
in the African python, Python sebae (Gmelin). British
Journal of Herpetology 6: 359-367.
Broadley DG. 1996. A revision of the genus Lycophidion
Fitzinger (Serpentes: Colubridae) in African south of
the Equator. Syntarsus 3: 1-3.
Broadley DG. 1999. The southern African python,
Python natalensis A. Smith 1840, is a valid species.
African Herp News 29: 31-32.
Broadley DG. 2001. A review of the genus 7helotornis
A. Smith in eastern Africa, with the description
of a new species from the Usambara Mountains
(Serpentes: Colubridae: Disphilidini). African Journal
of Herpetology 50(2): 53-70.
Broadley DG, Blaylock R. 2013. Snakes of Zimbabwe
and Botswana. Edition Chimaira, Frankfurt am Main,
Germany. 387 p.
Broadley DG, Broadley S. 1999. A review of the African
Worm Snakes from south of latitude 12°S (Serpentes:
Leptotyphlopidae). Syntarsus 5: 1-36.
Broadley DG, Wallach V. 2009. A review of the eastern
and southern African Blind-snakes (Serpentes:
Typhlopidae), excluding Letheobia Cope, with the
description of two new genera and a new species.
Zootaxa 2255: 1-100.
Broadley DG, Watson G. 1976. A revision of the
Worm Snakes of Southern Africa (Serpentes:
Leptotyphlopidae). Occasional Papers of the National
Museums and Monuments of Rhodesia 5: 465-510.
Broadley DG, Doria CT, Wigge J. 2003. Snakes of
Zambia. An Atlas and Field Guide. Edition Chimaira,
Frankfurt am Main, Germany. 280 p.
Brooks C. 2012. Biodiversity Survey of the Upper
Angolan Catchment of the Cubango-Okavango River
Basin. USAid-Southern Africa, Pretoria, South Africa.
LS p:
Brooks C. 2013. Trip Report: Aquatic Biodiversity
Survey of the Lower Cuito and Cuando River Systems
in Angola. USAid-Southern Africa, Pretoria, South
Africa. 43 p.
Brown G. 2019. Photographic Guide to Reptiles of
Malawi. Njoka Books, Lilongwe, Malawi. 292 p.
Burgess N, Hales JD, Underwood E, Dinerstein E, Olson
D, Itoua I, Schipper J, Ricketts T, Newman K. 2004.
Terrestrial Ecoregions of Africa and Madagascar — a
Conservation Assessment. Island Press, Washington,
DC, USA. 501 p.
Busschau T, Conradie W, Daniels SR. 2021. One
species hides many: molecular and morphological
evidence for cryptic speciation in a Thread Snake
(Leptotyphlopidae: Leptotyphlops sylvicolus
Amphib. Reptile Conserv.
Broadley and Wallach, 1997). Journal of Zoological
Systematics and Evolutionary Research 59: 195-221.
Butler BO, Ceriaco LP, Marques MP, Bandeira S, Julio T,
Heinicke MP, Bauer AM. 2019. Herpetological survey
of Huila Province, southwest Angola, including first
records from Bicuar National Park. Herpetological
Review 2: 225—240.
Ceriaco LMP, Bauer AM, Blackburn DC, Lavres ACF.
2014. The herpetofauna of the Capanda Dam Region,
Malanje, Angola. Herpetological Review 45(4): 667—
674.
Ceriaco LMP, de Sa SC, Bandeira S, Valério H, Stanley
EL, Kuhn AL, Marques M, Vindum JV, Blackburn
DC, Bauer AM. 2016a. Herpetological survey of Iona
National Park and Namibe Regional Natural Park,
with a synoptic list of the amphibians and reptiles of
Namibe Province, southwestern Angola. Proceedings
of the California Academy of Sciences 63(2): 15-61.
Ceriaco LMP, Marques MP, Bandeira S. 2016b. Anfibios
e Répteis do Parque Nacional da Cangandala.
Cafilesa-Solucées Grdaficas, Lda., Lisbon, Portugal.
97 p.
Ceriaco LMP, Marques MP, Bandeira S, Blackburn
DC, Bauer AM. 2018a. Herpetological survey of
Cangandala National Park, with a synoptic list of the
amphibians and reptiles of Malanje Province, Central
Angola. Herpetological Review 49(3): 408-431.
Ceriaco LMP, Marques MP, Bandeira S, Agarwal I,
Stanley EL, Bauer AM, Heinicke MP, Blackburn DC.
2018b. A new earless species of Poyntonophrynus
(Anura, Bufonidae) from the Serra da Neve Inselberg,
Namibe Province, Angola. ZooKeys 780: 109-136.
Ceriaco LMP, Agarwal I, Marques MP, Bauer AM.
2020a. A review of the genus Hemidactylus Goldfuss,
1820 (Squamata: Gekkonidae) from Angola, with the
description of two new species. Zootaxa 4746(1):
1-71.
Ceriaco LMP, Heinicke MP, Parker KL, Marques MP,
Bauer AM. 2020b. A review of the African Snake-
eyed Skinks (Scincidae: Panaspis) from Angola, with
the description of a new species. Zootaxa 4747(1):
77-112.
Ceriaco LMP, Agarwal I, Marques MP, Bauer AM.
2020c. A correction to a recent review of the
genus Hemidactylus Goldfuss, 1820 (Squamata:
Gekkonidae) from Angola, with the description of two
additional species. Zootaxa 4861(1): 92-106.
Ceriaco LMP, Santos BS, Marques MP, Bauer AM,
Tiutenko A. 2021. Citizen science meets specimens
in old formalin filled jars: a new species of Banded
Rubber Frog, genus Phrynomantis (Anura:
Microhylidae) from Angola. A/ytes 38(1—4): 18-48.
Channing A, Baptista N. 2013. Amietia angolensis and A.
fuscigula (Anura: Pyxicephalidae) in southern Africa:
a cold case reheated. Zootaxa 3640: 501-520.
Channing A, Hillers A, Lotters S, Rodel MO, Schick
S, Conradie W, Rodder R, Mercurio V, Wagner P,
November 2021 | Volume 15 | Number 2 | e292
Conradie et al.
Dehling MJ, et al. 2013. Taxonomy of the super-
cryptic Hyperolius nasutus group of Long Reed Frogs
of Africa (Anura: Hyperoltidae), with descriptions of
Six hew species. Zootaxa 3620(3): 301-350.
Conradie W, Bourquin S. 2013. Geographical
distributions: Acontias kgalagadi kgalagadi (Lamb,
Biswas, and Bauer, 2010). African Herp News 60:
29-30.
Conradie W, Branch WR, Measey JG, Tolley KA. 2012a.
A new species of Hyperolius Rapp, 1842 (Anura:
Hyperoliidae) from the Serra da Chela mountains,
southwestern Angola. Zootaxa 3269: 1-17.
Conradie W, Branch WR, Measey GJ, Tolley KA. 2012b.
Revised phylogeny of Sand Lizards (Pedioplanis)
and the description of two new species from south-
western Angola. African Journal of Herpetology
60(2): 91-112.
Conradie W, Branch WR, Tolley KA. 2013. Fifty shades
of grey: giving color to the poorly known Angolan
Ashy Reed Frog (Hyperoliidae: Hyperolius cinereus),
with the description of a new species. Zootaxa
3635(3): 201-223.
Conradie W, Bills IR, Branch WR. 2016. The herpetofauna
of the Cubango, Cuito, and lower Cuando river
catchments of south-eastern Angola. Amphibian &
Reptile Conservation 10(2) [Special Section]: 6-36
(e126).
Conradie W, Deepak V, Keates C, Gower DJ. 2020.
Kissing cousins: a review of the African genus
Limnophis Gunther, 1865 (Colubridae: Natricinae),
with the description of a new species from north-
eastern Angola. African Journal of Herpetology 69:
79-107.
Conroy CJ, Papenfuss T, Parker J, Hahn NE. 2009. Use
of tricaine methanesulfonate (MS222) for euthanasia
of reptiles. Journal of the American Association for
Laboratory Animal Science 48(1): 28-32.
Deepak V, Maddock ST, Williams R, Nagy
ZT, Conradie W, Rocha S, Harris DJ, Perera A,
Gvozdik V, Doherty-Bone TM, et al. 2021. Molecular
phylogenetics of sub-Saharan African natricine
snakes, and the biogeographic origins of the Seychelles
endemic Lycognathophis seychellensis. Molecular
Phylogenetics and Evolution 2021: 107152.
Dowling HG. 1951. A proposed standard system of
counting ventral scales in snakes. British Journal of
Herpetology 5: 97-99.
Eimermacher TG. 2012. Phylogenetic systematics of
dispholidine colubrids (Serpentes: Colubridae).
Ph.D. Dissertation, University of Texas at Arlington,
Arlington, Texas, USA. 109 p.
Engelbrecht HM, Branch WR, Greenbaum E, Alexander
GJ, Jackson K, Burger M, Conradie W, Kusamba C,
Zassi-Boulou A-G, Tolley KA. 2019. Diversifying
into the branches: species boundaries in African
green and bush snakes, Philothamnus (Serpentes:
Colubridae). Molecular Phylogenetics and Evolution
Amphib. Reptile Conserv. 275
130: 357-365.
Engelbrecht HM, Branch WR, Greenbaum E, Burger M,
Conradie W, Tolley KA. 2020. African Herald snakes,
Crotaphopeltis, show population structure for a
widespread generalist but deep genetic divergence for
forest specialists. Journal of Zoological Systematics
and Evolutionary Research 58: 1,220—1,233.
Ernst R, Nienguesso ABT, Lautenschlager T, Bare} MF,
Schmitz A, Holting M. 2014. Relicts of a forested
past: southernmost distribution of the Hairy Frog
genus Trichobatrachus Boulenger, 1900 (Anura:
Arthroleptidae) in the Serra do Pingano region of
Angola with comments on its taxonomic status.
Zootaxa 3779(2): 297-300.
Ernst R, Schmitz A, Wagner P, Branquima MF, Holting
M. 2015. A window to Central African forest history:
distribution of the Xenopus fraseri subgroup south
of the Congo Basin, including a first country record
of Xenopus andrei from Angola. Salamandra 52(1):
147-155.
Ernst R, Lautenschlager T, Branquima MF, Holting M.
2020. At the edge of extinction: a first herpetological
assessment of the proposed Serra do Pingano
Rainforest National Park in Uige Province, northern
Angola. Zoosystematics and Evolution 96: 237-262.
FitzSimons VFM. 1959. Some new reptiles from southern
Africa and southern Angola. Annals of the Transvaal
Museum 23: 405-409.
Gans C. 1959. A taxonomic revision of the African snake
genus Dasypeltis (Reptilia: Serpentes). Annales du
Musée Royal du Congo Belge, Tevuren (Belgique),
Série in-S°, Sciences Zoologique 74: 1-237.
Goncalves FMP, Luis JC, Tchamba JJ, Cachissapa MJ,
Chisingui AV. 2019. A rapid assessment of hunting
and bushmeat trade along the roadside between five
Angolan major towns. Nature Conservation 37: 151—
160.
Haacke WD. 2008. A new leaf-toed gecko (Reptilia:
Gekkonidae) from south-western Angola. African
Journal of Herpetology 57(2): 85-92.
Hallermann J, Ceriaco LMP, Schmitz A, Ernst R,
Conradie W, Verburgt L, Marques MP, Bauer AM.
2020. A review of the Angolan House Snakes, genus
Boaedon Dumeéril, Bibron, and Dumeéril (1854)
(Serpentes: Lamprophiidae), with description of three
new species in the Boaedon fuliginosus (Boie, 1827)
species complex. African Journal of Herpetology 69:
29-78.
Hellmich W. 1957a. Die Reptilien ausbeute der
hamburgischen Angola Expedition. Mitteilungen aus
dem Hamburg Zoologischen Museum Institut 55:
39-80.
Hellmich W. 1957b. Herpetologlsche Ergebnisse einer
Forschungsreise in Angola. Verdéffentlichungen der
Zoologischen Staatssammlung Miinchen 5: \—92.
Hughes B. 1985. Progress on a taxonomic revision of
the African Green Tree Snakes (Philothamnus spp.).
November 2021 | Volume 15 | Number 2 | e292
Snakes of the Okavango Delta headwater area in Angola
Pp. 511-530 In: Proceedings of the International
Symposium on African Vertebrates. Editor,
Schuchmann KL. Zoologisches Forschungsinstitut
und Museum Alexander Koenig, Bonn, Germany. 585
p.
Hughes B, Wade E. 2002. On the African Leopard
Whip Snake, Psammophis leopardinus Bocage, 1887
(Serpentes, Colubridae), with the description of a
new species from Zambia. Bulletin Natural History
Museum London (Zoology) 68(2): 75-81.
Huntley BJ. 2009. Projecto de Estudo da Biodiversidade
de Angola. Biodiversity Rapid Assessment - Huila/
Namibe. Report on Pilot Project. SANBI, Cape Town,
South Africa. 97 p.
Huntley BJ. 2019. Angola in outline: physiography,
climate, and patterns of biodiversity. Pp. 15—42 In:
Biodiversity of Angola. Science and Conservation: a
Modern Synthesis. Editors, Huntley BJ, Ferrand N,
Russo V, Lages F. Springer, Cham, Switzerland. 552
p.
Huntley BJ, Francisco P. (Editors). 2015. Relatorio sobre
a Expedicdo Avaliagdo Rapida da Biodiversidade de
Regiado da Lagoa Carumbo, Lunda Norte — Angola
/ Biodiversity Rapid Assessment of the Carumbo
Lagoon Area, Lunda Norte, Angola. Ministerio do
Ambiente, Luanda, Angola. 219 p.
Huntley BJ, Matos L. 1992. Biodiversity: Angolan
Environmental Status Quo Assessment Report.
IUCN Regional Office for Southern Africa, Harare,
Zimbabwe. 55 p.
Keates C. 2021. Integrative systematic structuring of the
widespread psammophiid snakes (Psammophiidae):
a multi-evidence species delineation approach. Ph.D.
Dissertation, Rhodes University, Department of
Zoology and Entomology, Makhanda, South Africa.
214 p.
Keates C, Conradie W, Greenbaum E, Edwards S. 2019.A
snake in the grass: genetic structuring of the widespread
African Grass Snake (Psammophylax Fitzinger, 1843),
with the description of a new genus and a new species.
Journal of Zoological Systematics and Evolutionary
Research 57: 1,039-1,066.
Laurent RF. 1950. Reptiles et Batraciens de la region de
Dundo (Angola du Nord-Est). Publicagées Culturais
da Companhia de Diamantes de Angola 10: 7-17.
Laurent RF. 1954. Reptiles et Batraciens de la région
de Dundo (Angola) (deuxieme note). Publicagées
Culturais da Companhia de Diamantes de Angola 23:
35-84.
Laurent RF. 1964. Reptiles et Amphibiens de I’Angola
(troisieme contribution). Publicagées Culturais da
Companhia de Diamantes de Angola 67: 11-165.
Lobon-Rovira J, Conradie W, Buckley Iglesias D, Ernst R,
Verisimmo L, Baptista N, Vaz Pinto P. 2021. Between
sand, rocks, and branches: an integrative taxonomic
revision of Angolan Hemidactylus Goldfuss, 1820,
with description of four new species. Vertebrate
Amphib. Reptile Conserv.
Zoology 71: 465-501.
Loveridge A. 1940. Revision of the African snakes of
the genera Dromophis and Psammophis. Bulletin of
Museum of Comparative Zoology 87. 1-69.
Loveridge A. 1944. Further revisions of African snake
genera. Bulletin of Museum of Comparative Zoology
98: 1469, pls. i-vii.
Loveridge A. 1958. Revision of five African snake
genera. Bulletin of Museum of Comparative Zoology
119: 1-198.
Managas S. 1963. Saurios de Angola. Memorias da Junta
de Investigacées do Ultramar, Lisboa, Segunda Série.
Estudos de Zoologia 43(2): 223-240.
Managas S. 1973. Alguns ofideos de Angola. Memorias
da Junta de Investigacées do Ultramar, Lisboa,
Segunda Série. Estudos de Zoologia 58(2): 187—200.
Managas S. 1982. Ofideos venenosos da Guinée, S. Tomé,
Angola, e Mocambique. Garcia de Orta: Série de
Zoologica 101(1/2): 13-46.
Marques MP, Ceriaco LMP, Blackburn DC, Bauer AM.
2018. Diversity and distribution of the amphibians
and terrestrial reptiles of Angola: atlas of historical
and bibliographic records (1840-2017). Proceedings
of the California Academy of Sciences 65(Supplement
IT): 1-501.
Marques MP, Ceriaco LMP, Bandeira S, Pauwels OSG,
Bauer AM. 2019a. Description of a new Long-tailed
Skink (Scincidae: Trachylepis) from Angola and the
Democratic Republic of the Congo. Zootaxa 4568(1):
51-68.
Marques MP, Ceriaco LMP, Stanley EL, Bandeira SA,
Agarwal I, Bauer AM. 2019b. A new species of
Girdled Lizard (Squamata: Cordylidae) from the Serra
da Neve Inselberg, Namibe Province, southwestern
Angola. Zootaxa 4668(4): 503-524.
Marques MP, Ceriaco LMP, Buehler MD, Bandeira
SA, Janota JM, Bauer AM. 2020. A revision of the
Dwarf Geckos, genus Lygodactylus (Squamata:
Gekkonidae), from Angola, with the description of
three new species. Zootaxa 4853(3): 301-352.
McDiarmid RW, Foster MS, Guyer C, Chernoff N,
Gibbons JW. (Editors). 2012. Reptile Biodiversity:
Standard Methods for Inventory and Monitoring.
University of California Press, Berkeley, California,
USA. 412 p.
Mendelsohn J, El Obeid S. 2004. Okavango River: the
Flow of a Lifeline. Struik, Cape Town, South Africa.
176 p.
Mendelsohn J, Martins A. 2018. River Catchments and
Development Prospects in South-eastern Angola for
World Wildlife Fund (WWF), The Nature Conservancy
(TNC) and National Geographic Okavango
Wilderness Project (NGOWP). World Wildlife Fund,
Gland, Switzerland.
Mendelsohn J, Weber B. 2015. An Atlas and Profile of
Moxico, Angola. Raison, Windhoek, Namibia. 44 p.
Mertens R. 1938. Amphibien und Reptilien aus Angola
November 2021 | Volume 15 | Number 2 | e292
Conradie et al.
gesmmelt von W. Shack. Senckenbergiana 20(6):
425-443.
Monard A. 1931. Reptiles. Mission scientifique Suisse
dans Angola, resultats scientifiques. Bulletin de la
Société Neuchételoise des Sciences Naturelles 55:
89-111.
Monard A. 1937a. Contribution a la_ batrachologie
d’Angola. Bulletin de la Société Neuchételoise des
Sciences Naturelles 62: 5—59.
Monard A. 1937b. Contribution a lherpétologie
d’Angola. Arquivos do Museu Bocage 8(1937): 19-
154.
National Geographic Okavango Wilderness Project.
2017. Initial Findings from Exploration of the Upper
Catchments of the Cuito, Cuanavale, and Cuando
Rivers, May 2015 to December 2016. Unpublished
report.
Nielsen SV, Conradie W, Ceriaco LMP, Bauer AM,
Heinicke MP, Stanley EL, Blackburn DC. 2020. A
new species of Rain Frog (Brevicipitidae, Breviceps)
endemic to Angola. ZooKeys 979: 133-160.
Oliveira PS, Rocha MT, Castro AG, Betancourt IR, Wen
FH, Neto AP, Bastos ML, Tambourg DV, Sant’Anna
SS. 2016. New records of Gaboon Viper (Bitis
gabonica) in Angola. Herpetological Bulletin 136:
42-43,
Parker HW. 1936. Dr. Karl Jordan’s expedition to
Southwest Africa and Angola: herpetological
collections. Novitates Zoologicae Tring 40: 115-146.
Parrinha D, Marques MP, Heinicke MP, Khalid F, Parker
KL, Tolley KA, Childers JL, Conradie W, Bauer
AM, Ceriaco LMP. 2021. A revision of Angolan
species in the genus Pedioplanis Fitzinger (Squamata:
Lacertidae), with the description of a new species.
Zootaxa 5032(1): 146.
Pietersen DW, Pietersen EW, Conradie W. 2017.
Preliminary herpetological survey of the Ngonye Falls
and surrounding regions in south-western Zambia.
Amphibian & Reptile Conservation 11(1) [Special
Section]: 24—43 (e148).
Portillo F, Branch WR, Conradie W, Rodel M-O, Penner
J, Bare, MF, Kusamba C, Muninga WM, Aristote MM,
Bauer AM, etal. 2018. Phylogeny and biogeography of
the African burrowing snake subfamily Aparallactinae
(Squamata: Lamprophiidae). Molecular Phylogenetics
and Evolution 127: 288-303.
Portillo F, Stanley EL, Branch WR, Conradie W, Rodel
M-O, Penner J, Bare; MF, Kusamba C, Muninga
WM, Aristote MM, et al. 2019. Evolutionary history
of Burrowing Asps (Lamprophiidae: Atractaspidinae)
with an emphasis on fang evolution and prey selection.
PLoS ONE 14(4): e0214889.
Poynton JC, Haacke WD. 1993. On a collection of
amphibians from Angola, including a new species of
Amphib. Reptile Conserv.
Bufo Laurenti. Annals of the Transvaal Museum 36:
9-16.
Rasmussen JB. 1997. On two little-known African water
snakes (Crotaphopeltis degeni and C. barotseensis).
Amphibia-Reptilia 18: 191-206.
Rasmussen JB. 2005. On the identification and
distribution of the Two-striped Night Adder (Causus
bilineatus) and related forms. African Journal of
Herpetology 54(1): 1-15.
Ruas C. 1996. Contribui¢do para o conhecimento da fauna
de batraquios de Angola parte I: familias Pipidae,
Bufonidae, Microhylidae, Ranidae, Hemisidae e
Arthleptidae. Garcia de Orta. Series Zoology 21(1):
19-41.
Ruas C. 2002. Batraquios de Angola em colec¢ao no
Centro de Zoologia. Garcia de Orta. Series Zoology
24(1-2): 139-146.
Schmidt KP. 1933. The reptiles of the Pulitzer Angola
expedition. Annals of Carnegie Museum 22(1): 1-15.
Schmidt KP. 1936. The amphibians of the Pulitzer
Angola Expedition. Annals of Carnegie Museum 25:
127-133.
Spawls S, Howell K, Hinkel H, Menegon M. 2018.
Field Guide to East African Reptiles. 2" Edition.
Bloomsbury Publishing, London, England. 624 p.
Stanley EL, Ceriaco, LMP, Bandeira S, Valerio H,
Bates MF, Branch WR. 2016. A review of Cordylus
machadoi (Squamata: Cordylidae) in southwestern
Angola, with the description of a new species from
the Pro-Namib desert. Zootaxa 4061(3): 201-226.
Thys van den Audenaerde DFE. 1966. Les serpents des
environs de Dundo (Angola) (note complémentaire).
Publicagées Culturais da Companhia de Diamantes
de Angola 76: 31-37.
Trape JF, Crochet PA, Broadley DG, Sourouille P, Mané
Y, Burger M, BOhme W, Saleh M, Karan A, Lanza
B, et al. 2019. On the Psammophis sibilans group
(Serpentes, Lamprophiidae, Psammophiinae) north of
12°S, with the description of a new species from West
Africa. Bonn Zoological Bulletin 68(1): 61-91.
Uetz P, Freed P, HoSek J. (Editors). 2021. The Reptile
Database. Available: http://www.reptile-database. org
[Accessed: 11 April 2021].
UNESCO. 2014. Twenty-six new properties added to
World Heritage List at Doha meeting. Available:
https://whc.unesco.org/en/news/1162 [Accessed: 12
April 2021].
Zaher H, Murphy RW, Arredondo JC, Graboski R,
Machado-Filho PR, Mahlow K, Montingelli GG,
Quadros AB, Orlov NL, Wilkinson M, et al. 2019.
Large-scale molecular phylogeny, morphology,
divergence-time estimation, and the fossil record of
advanced caenophidian snakes (Squamata: Serpentes).
PLoS ONE 14(5): e0216148.
November 2021 | Volume 15 | Number 2 | e292
Snakes of the Okavango Delta headwater area in Angola
Werner Conradie has a Masters in Environmental Science (M.Env.Sc.) and 17 years of experience
working with the southern African herpetofauna, with his main research interests focusing on the taxonomy,
conservation, and ecology of amphibians and reptiles. Werner has published numerous principal and
collaborative scientific papers, and has served on a number of conservation and scientific panels, including
the Southern African Reptile and Amphibian Relisting Committees. He has undertaken research expeditions
to many African countries including Angola, Botswana, Lesotho, Malawi, Mozambique, Namibia, South
_ Africa, Zambia, and Zimbabwe. Werner is currently the Curator of Herpetology at the Port Elizabeth
Museum (Bayworld) in South Africa.
Ninda Baptista is an Angolan biologist, with an M.Sc. degree in Conservation Biology from the University
of Lisbon (Portugal), and she is currently pursuing a Ph.D. in Biodiversity, Genetics, and Evolution in
the University of Porto (Portugal), addressing the diversity of Angolan amphibians. Over the last 12
years, she has worked on environmental consulting, research, and in-situ conservation projects in Angola,
including priority areas for conservation such as Kumbira, Mount Moco, and the Humpata plateau. She has
conducted herpetological surveys throughout the country and created a herpetological collection (Colec¢ao
Herpetologica do Lubango) that is currently deposited in the Instituto Superior de Ciéncias da Educacao
da Huila (ISCED — Huila) in Angola. Ninda is an author of scientific papers and book chapters on Angolan
herpetology and ornithology. She also works on scientific outreach, producing magazine articles, books for
children, and posters about the country’s biodiversity in collaboration with Funda¢gao Kissama.
Luke Verburgt is a consulting herpetologist living in South Africa with over 18 years of herpetofauna
survey experience across 20 African countries (Angola, Botswana, Cameroon, Democratic Republic of the
Congo, Ghana, Ivory Coast, Lesotho, Liberia, Madagascar, Malawi, Mali, Morocco, Mozambique, Namibia,
Republic of Guinea, SAo Tomé and Principe, South Africa, Swaziland, Uganda, and Zimbabwe). He is a
co-owner of Enviro-Insight, holds an M.Sc. in Zoology from the University of Pretoria (South Africa) and
is a registered scientific professional with the South African Council for Natural Scientific Professions
iw (SACNASP). Luke has published more than 30 scientific articles, which include descriptions of several new
African herpetofauna species, and is the author of the book Snakes and other Reptiles of Zambia and Malawi
published by Struik Random House Publishers.
Chad Keates is a post-doctoral fellow at the Wetland Ecology Lab, Rhodes University (Grahamstown, South
Africa). Having recently completed his Ph.D. in Zoology, Chad’s research focuses on African herpetofauna
and their evolutionary and ecological structuring. In Chad’s short professional career, he has published
several principal and collaborative peer-reviewed scientific papers and book chapters. Chad is also a strong
advocate for reptile and amphibian awareness, and he regularly conducts walks, talks, and presentations,
and produces numerous popular scientific materials on the subject. He has undertaken many expeditions to
several African countries such as Angola, Zambia, and South Africa, with a variety of both professional and
scientific organizations.
James Harvey works as an independent herpetologist, ecological researcher, and consultant, and lives in
South Africa. He holds degrees in Zoology, Hydrology, and Environmental Management, and has performed
herpetological fieldwork widely, primarily within Africa, in countries such as South Africa, Botswana,
Zimbabwe, Angola, Malawi, Kenya, Mali, Democratic Republic of Congo, Madagascar, and Vietnam.
His interests are diverse but center on the taxonomy, ecology, and conservation of herpetofauna and other
organisms. James has contributed to conservation assessments, workshops, and Red Data publications for
reptiles, amphibians, mammals, and plants, for the southern and eastern African regions. He regularly attends
herpetological conferences, has published several scientific papers, and has been a contributing author to a
number of herpetological publications.
Timoteo Julio has a degree in Biology and is an Angolan junior researcher with four years of experience
with the Angolan herpetofauna, in which his research is directed towards the study of conservation and
ecology of reptiles and amphibians. He has worked on a survey of snake bite incidents in Angola, in the
_ region of Luanda and Uige, and is a co-author of scientific articles published on work done in southern and
eastern Angola. He has worked with the herpetological collection of the Kissama Foundation and Holisticos
(Coleccaéo Herpetologica da Funda¢aéo Kissama e Holisticos) in Luanda, and as a collaborator with the
Amphibian Survival Alliance in Angola.
Gotz Neef is a Namibian-born coordinator of all the research data and sample collections for the National
Geographic Okavango Wilderness Project (NGOWP). During expeditions he works with the various
specialists and research assistants undertaking sampling, trapping, and recordings.
Amphib. Reptile Conserv. 278 November 2021 | Volume 15 | Number 2 | e292
Official journal website:
amphibian-reptile-conservation.org
Amphibian & Reptile Conservation
14(2) [General Section]: 279-288 (e293).
Captive breeding program for Scinax alcatraz (Anura:
Hylidae): introducing amphibian ex situ conservation in Brazil
‘Cybele S. Lisboa, Renata |. Vaz, and *Cinthia A. Brasileiro
‘Department of Reptiles, Amphibians, and Invertebrates, Fundagado Parque Zooldégico de SGo Paulo (Sao Paulo Zoo), 04301-905, SGo Paulo,
BRAZIL *Department of Physiology, Bioscience Institute, University of Sao Paulo (USP), 05508-090, Sao Paulo, SP, BRAZIL *Department of
Ecology and Evolutionary Biology, Federal University of Sao Paulo (UNIFESP), 09972-270, Diadema, BRAZIL
Abstract.—Scinax alcatraz is endemic to a small island (“Ilha dos Alcatrazes”), and is threatened by restricted
distribution and habitat loss. Here, we present present the establishment of a captive breeding program for
S. alcatraz at Sao Paulo Zoo, and introduce ex situ conservation as a strategy for amphibians in Brazil. We
recorded 125 breeding events with about 10,200 eggs laid. We also observed that S. alcatraz does not have a
marked breeding season, laying eggs throughout the year, and that breeding events are positively correlated
with relative humidity and negatively correlated with temperature. This program has shown great success in
the maintenance and reproduction of S. a/catraz in captivity, and has great potential for conducting research
relevant to amphibian conservation and for the development of educational materials to share information
about the global amphibian crisis, using S. alcatraz as a flagship species.
Keywords. Alcatrazes Island, artificial environments, threatened species, amphibian decline, conservation strategy
Citation: Lisboa CS, Vaz RI, Brasileiro CA. 2021. Captive breeding program for Scinax alcatraz (Anura: Hylidae): introducing amphibian ex situ
conservation in Brazil. Amphibian & Reptile Conservation 15(2) [General Section]: 279-288 (e293).
Copyright: © 2021 Lisboa et al. This is an open access article distributed under the terms of the Creative Commons Attribution License [Attribution
4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction in any
medium, provided the original author and source are credited. The offcial and authorized publication credit sources, which will be duly enforced, are
as follows: official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 4 October 2021; Published: 31 December 2021
reversed in situ (McFadden et al. 2013; Pavajeau et al.
2008; Zippel et al. 2011).
Brazil is considered to be the most diverse country for
amphibian species, being home to 1,136 species (Segalla
etal. 2019). Similar to other countries, amphibian declines
in Brazil began at the end of the 1980s in the Atlantic
Forest, and initially, the suggested cause was climate
change (Heyer et al. 1988; Weygoldt 1989). Recently,
such declines (e.g., Cycloramphus, Crossodactylus,
Hylodes, and Phrynomedusa species) and the extinction
of Thoropa petropolitana and T. lutzi were associated
with the infectious disease chytridiomycosis caused by
the fungus Batrachochytrium dendrobatidis (Carvalho et
al. 2017). Currently, the Brazilian Red List of Threatened
Introduction
During the last few decades, populations and species
of amphibians have been facing extinction and
declines worldwide (Chanson et al. 2008; Halliday
2008; Mendelson 2011) due to many causes such as
habitat destruction, overexploitation, and infectious
diseases (Berger et al. 2004; Cushman 2006; La Marca
et al. 2005; Wake and Vredenburg 2006). In 2005,
these troubling circumstances led herpetologists and
conservationists around the world to implement a global
strategy to minimize or stabilize declines and extinctions,
which resulted in the first version of the Amphibian
Conservation Action Plan (ACAP) (Gascon et al. 2007),
updated in 2015 (Wren et al. 2015). This plan incorporated
actions to understand, reduce, and reverse declines
and generated 11 thematic guidelines necessary for the
conservation of amphibians (Gascon et al. 2007). Two
of these (captive programs and reintroduction) deal with
ex situ conservation, which has been considered essential
for some threatened amphibian species, especially
those suffering from threats that cannot be controlled or
Correspondence. '[email protected]
Amphib. Reptile Conserv.
Amphibian Species contains one extinct and 41 threatened
species (ICMBio 2018).
Based on the national scenario, the Brazilian
Amphibian Conservation Action Plan (BACAP) was
created in 2012, and following the ACAP guidelines it
is aimed at developing specific conservation strategies
for Brazilian amphibians, including ex situ strategies
(Verdade et al. 2012). Previously, a list of priority
species to be included in ex situ conservation actions was
December 2021 | Volume 15 | Number 2 | e293
Captive breeding program for Scinax alcatraz
Fig. 1. Adult male of Scinax alcatraz. Photo by Cybele Lisboa.
created during a Conservation Needs Assessment (CNA)
workshop in 2009 (Amphibian Ark 2009).We know
Scinax alcatraz was the first and only species where
the ex situ recommendation from the CNA has been
implemented until 2019, when a similar ex situ action
was included for Nyctimantis pomba (Zoologico de Sao
Paulo 2019).
Scinax alcatraz is listed as Critically Endangered both
in the National (Ministério do Meio Ambiente 2014) and
IUCN Red List (Rodrigues and Cruz 2004). This is due
to the fact the species is endemic to a single small island
(1.35 km/, Ilha dos Alcatrazes) (Brasileiro 2008) and its
area of occupancy Is less than 10 km?, with a continuing
decrease of extent and quality of habitat. Until recently,
the Brazilian Navy used the island as a target for heavy
artillery practice, threatening the habitat of S. alcatraz. In
2004, as a result of this training activity, a fire destroyed
a significant part of the island’s vegetation (Bataus and
Reis 2011), and because of this fire, the development of
a captive breeding program for S. alcatraz was deemed
urgent and necessary as the population was facing an
imminent risk of extinction (Bataus and Reis 2011;
Zippel and Mendelson 2008). This action was included
as one of the goals of the Plano de Acdo Nacional para
a Conservacdo da Herpetofauna Insular Ameacada de
Amphib. Reptile Conserv.
Extincdo (National Conservation Plan for the Endangered
Island’s Herpetofauna, Bataus and Reis 2011), a national
strategy managed by the governmental agency Instituto
Chico Mendes de Conservacéo da _ Biodiversidade
(ICMBio). The captive breeding program for S. alcatraz
was implemented in 2009 at the Fundacao Parque
Zooldgico de S40 Paulo (Sado Paulo Zoo) and fortunately
in 2013 the artillery practice at the island ended due
to an agreement between the Navy, government, and
environmental protectionists (ICMBio 2013).
Since Scinax alcatraz had never been kept in
captivity previously, from 2009 to 2011 we conducted
a pilot study using S. perpusillus as a surrogate (Lisboa
and Vaz 2012). Scinax perpusillus is categorized as
Least Concern by the IUCN, is the closest species
phylogenetically to S. alcatraz, and has the same
breeding behavior (Peixoto 1987). Both species belong
to the perpusillus group and depend on certain types
of vegetation, specifically bromeliads, to complete their
life cycle (Peixoto 1987). After two years of learning and
developing management and reproductive techniques
with this surrogate species (see Lisboa and Vaz 2012),
we were able to apply the knowledge acquired to the
Critically Endangered S. alcatraz. Here, we present the
establishment of the ex situ population of S. alcatraz at
December 2021 | Volume 15 | Number 2 | e293
Lisboa et al.
Sao Paulo Zoo. We also present data obtained regarding
the reproductive biology and the longevity of Scinax
alcatraz in captivity.
Materials and Methods
Founder acquisition. Ilha dos Alcatrazes (24°05’25”S,
45°41’00”"W) is the main island of the Alcatrazes
archipelago located about 35 km from the coast of the
State of Sao Paulo in southeastern Brazil and included
in the Atlantic Forest domain (Bataus and Reis 2011).
We visited the island twice to acquire founders of Scinax
alcatraz for the captive colony (N = 22; Fig. 1). Our first
visit took place October 2011 and we collected three
females and eight males (referred to as “2011 founders”).
Our second visit was in October 2013 and we collected
two females, six males, and three juveniles (“2013
founders”).
Captive management. Between October 2011 and
December 2017, we maintained the founders and their
progeny in 11 glass terrariums in an isolated laboratory
at Sao Paulo Zoo. We followed biosecurity standards
according to Pessier and Mendelson (2010) to avoid
the introduction of potential diseases to the ex situ
population. Staff sanitized their arms and hands with
chlorhexidine and 70% alcohol, and used dedicated
clothing in the laboratory. Powder-free latex gloves were
used when handling animals, enclosures, or equipment.
We disinfected all equipment that entered the laboratory
with sodium hypochlorite.
Two different sizes of terrariums were used (30 x 30
x 45 cm and 45 x 45 x 60 cm) with no substrate (Fig.
2a) since this species is not associated with floor litter
in nature. Water was provided ad /ibitum in flat pots and
i a
ae
Fig. 2. Laboratory colony of Scinax alcatraz at Sao Paulo Zoo. a) Aquariums for maintanance of juveniles and adults. b)
plastic cups with submerged plants for refuge (Fig. 2b).
For adults, tadpoles, and eggs we used tap water filtered
with activated carbon to reduce chlorine. The water
quality presented pH levels of ~7.2, 80 ppm alkalinity,
0 mg/L of ammonia, and 0 mg/L of nitrite. The water
temperature was not measured.
The population density of the founders in each
terrarium varied during the study period from 2 to 10
frogs. We fed the animals with pinhead-sized crickets
(Gryllus sp.) dusted with Repashy Superfoods Calcium
Plus ICB® vitamins twice per week directly on the
terrarium floor. Artificial heat or cooling sources were
not provided to the laboratory since Sao Paulo Zoo
facilities are located within an Atlantic Forest fragment,
the same morphoclimatic domain of S. alcatraz. Average
air temperature was 21.3 + 2.6 °C (10.2-30.4 °C), and
relative air humidity was 71.4 + 4.8% (25-97%). As
the exposure to radiation in nature 1s unknown for this
species, we decided to be conservative, and provided
animals with only six hours per week of UVB lighting
with an Exo Terra® Repti Glo 2.0 compact fluorescent
bulb (20 watts), since this sort of radiation has proven
to be important in the synthesis of vitamin Ds for
amphibians (Michaels et al. 2014a). The natural light
that came through the window dictated the laboratory’s
photoperiod.
To stimulate the 2011 founders to breed, and given
that there is no information on the natural breeding
trigger regime for S. alcatraz, we used the same strategy
applied to the surrogate species S. perpusillus. The
technique consisted of utilizing an ultra-sonic fogger
on the terrariums to increase the night-time humidity
(see Lisboa and Vaz 2012) every other night for 33
days between December 2011 and January 2012. This
procedure was not applied to the 2013 founders since
LL
=. 4
Plastic cups with filtered water and submerged plants for refuge. Photos by Cybele Lisboa.
Amphib. Reptile Conserv.
December 2021 | Volume 15 | Number 2 | e293
Captive breeding program for Scinax alcatraz
they started reproducing spontaneously without artificial
stimulus. Breeding information was collected from the
captive-born group which started reproducing without
artificial stimulus. The term “breeding events” was
used for clutches found on the same day, in the same
terrarium, due to the fact that some terrartums had more
than one female and it was not possible to identify which
one laid the eggs. We only kept 12 clutches from all the
breeding events, which were enough to generate frogs
to constitute a controlled ex situ population and for
research and educational purposes.
When females deposited eggs in the water of the
plastic cups we transferred the cups to an empty
terrarium and monitored these eggs until they hatched.
Subsequently, we transferred the tadpoles to plastic
round containers (1.3 L; maximum of 30 tadpoles per
container) with no substrate and containing 3-4 cm of
filtered water (Fig. 3).
Tadpole feeding began the day after hatching and
they were fed daily with Alcon® Spirulina Flakes. After
metamorphosis, froglets were maintained in groups of
four to seven individuals in plastic round containers (1.3
L), with a small pot of filtered water and no substrate,
for 30 days. Subsequently, we transferred the groups of
froglets to terrariums similar to those used for the adults
(with 6 to 14 individuals per aquarium). Measurements
of 10 eggs (diameter), nine tadpoles (body and tail
length), and 97 froglets (snout-vent length) were taken
using a digital caliper (0.01 mm).
Data analyses. The data were expressed as mean +
SD. Multiple Linear Regression based on Pearson’s
Correlation Coefficient (7) was performed to assess
whether breeding events were correlated with
environmental conditions (air temperature and relative
humidity), based on data obtained from August 2013
(when the captive-born group began to reproduce) until
December 2017 (53 months). The total of breeding events
for the three groups (2011 founders, 2013 founders, and
captive-born) occurring each month was considered
and tested for correlations with monthly average air
temperature and relative humidity. We also verified
which ranges of relative humidity and temperature
were optimal, comparing the number of breeding events
that occurred between 60 and 69% relative humidity
with those between 70 and 80%, and up to 22 °C with
those above this temperature. Analyses were performed
using the software Past 2.17 (Hammer et al. 2001) with
significance set at the 0.05 confidence level.
Results
Captive breeding. The first breeding event of the 2011
founders occurred in January 2012, after three months in
captivity and 33 days of the fogger stimulus. The second
breeding event for this group occurred in July 2013. After
that, the 2011 founders began to breed frequently (Fig. 4),
Amphib. Reptile Conserv.
without the fogger stimulus. The first breeding event of the
2013 founders occurred in July 2014, after nine months in
captivity without fogger stimulus. In total, we recorded 88
breeding events with 7,743 eggs from the 2011 founders,
and 37 events with 2,494 eggs from the 2013 founders
(Table 1). From the 2011 and 2013 founders, we kept
only the clutches from 12 breeding events (1.6% of total)
through complete development. From these clutches, we
obtained a total of 1,012 eggs, from which 327 (33%)
tadpoles hatched and 184 (56%) metamorphosed. From
the 327 tadpoles, 93 died at different stages immediately
after water exchange on two different occasions.
Juveniles from the same clutch were kept in groups
until adulthood when they started to breed. From the
captive-born frogs, we recorded a total of 609 breeding
events (37,976 eggs; Table 1), but we did not keep any of
these clutches until 2018 when we separated siblings and
paired new groups with animals from different parents.
Some females laid unfertilized eggs without the presence
of males in the same enclosure.
Scinax alcatraz laid eggs throughout the year in
captivity with an average temperature of 20.6 °C + 2.6
(13.1-29.5 °C) and relative humidity of 74.4% + 6.4
(25-94%). Relative humidity and temperature were not
correlated (7 = 0.08; p = 0.57), but breeding events were
correlated with both humidity and temperature (7 = 0.323;
p <0.001). The number of breeding events occurring each
month were positively related to relative humidity (r =
0.467; p < 0.001; Fig.5 a), and negatively related to air
temperature (7 = -0.286; p = 0.04; Fig.5 b). More breeding
events occurred in the range of relative humidity between
70-80% (N = 611) than between 60-69% (N = 121), and
at temperatures below 22 °C (N = 517) than above this
temperature (N = 215; Fig.6).
In terms of life history and sexual maturity, the
youngest female laying eggs was six months old after
metamorphosis and the oldest female was 20 months
old (mean = 12 + 5 months, N = 5 females). Males were
observed producing advertisement calls at ages as young
as three months post-metamorphosis.
Eggs and tadpoles. Eggs were small, black, and
enveloped in a gelatinous capsule, measuring 1.7 + 0.06
mm in diameter (N = 10). The clutch size ranged from
11-142 eggs (mean = 54.6 + 35 eggs; N = 18 clutches).
Females deposited their clutches mainly in water in
plastic cups with plants (Fig. 3b), but we also discovered
some eggs scattered throughout the terrarium (walls,
floor, leaves).
The development of the eggs lasted 6 + 1 days (4—7
days; N = 12 clutches) before the tadpoles hatched. The
body length of tadpoles (stages 25—26; Gosner 1960) was
2.1 + 0.2 mm and tail length 4.5 + 0.1 mm (N = 9). The
development of tadpoles (Fig. 3c) until metamorphosis
lasted an average of 84.7 + 14.1 days (N = 97). The snout-
vent length of post-metamorphic froglets (Fig. 3d) was
12.5 + 0.7 mm (N = 107).
December 2021 | Volume 15 | Number 2 | e293
Lisboa et al.
, . Se.N
Fig. 3. Breeding of Scinax alcatraz at Sio Paulo Zoo. a) A pair in amplexus. b) Eggs deposited in the water. c) Maintanance of
tadpoles in plastic pots with filtered water. d) Post-metamorph individuals (SVL x=12.49 mm). Photos by Cybele Lisboa.
@ 2011 founders
2013 founders
Number of breeding events
2012 2013 2014 2015 2016 2017
Year
Fig. 4. Frequency of the founder Scinax alcatraz breeding events from 2012 to 2017.
Amphib. Reptile Conserv. 283 December 2021 | Volume 15 | Number 2 | e293
Captive breeding program for Scinax alcatraz
Table 1. Breeding events of Scinax alcatraz from individuals collected in the wild (2011 and 2013 founders)
and by captive-born individuals, which occurred at Sao Paulo Zoo from 2012 to 2017.
Groups
2011 Founders (N = 8)
2013 Founders (N = 9)
Captive-born (N = 148)
Total
Mortality. Of the 2011 founders, one female and two
males died on the first day after collection. Two other
males died a few years later (in July 2013 and May
2017). As of the current date (December 2021), two
females and four males from the 2011 founders group are
living. From the 2013 founders, two individuals died in
June 2014, and one in July 2015.
From the 184 captive-born frogs, 58 died during
the period of this study (ages ranging from one month
to five years) and 15 were used for research purposes.
In December 2017, the captive-born group comprised
111 adult frogs (19 males, 85 females, and seven sex-
unknown).
Discussion
The maintenance and reproduction of Scinax alcatraz in
captivity have proven to be very successful. Our results
showed that within only three months in captivity, the
founders started to breed. The skills acquired during the
pilot study (Lisboa and Vaz 2012) using S. perpusillus
as a surrogate species accelerated the results obtained
for S. alcatraz. The use of a non-threatened surrogate to
develop amphibian maintenance and breeding protocols
is recommended in the absence of data on a target species
(Michaels et al. 2014b). This is especially important
for those species with specific ecological requirements
(Crump and Grow 2007), as with S. alcatraz. Wild
Number of breeding events
T T
66 72
Relative Humidity (%)
Number of breeding events
Total eggs
88 7,743
oe 2,494
609 37,976
737 48,213
populations of threatened species are usually small
and have limited geographic ranges (McGowan et al.
2017), and the surrogate approach is extremely helpful
to develop adequate skills and experience before the
acquisition of target founder specimens (Michaels et al.
2014b), which may prevent the loss of these specimens
and reduce routine difficulties with captive maintenance.
We consider S. perpusillus as an appropriate
surrogate species for S. alcatraz. However, other studies
have shown limitations in using the surrogate species
approach (Michaels et al. 2015, 2016), since even closely
related species with similar husbandry have specific
requirements for survival and reproduction (Michaels
et al. 2015). Therefore, we highlight the importance of
making the correct determination of whether the selected
surrogate species 1s the most suitable one, considering
existing knowledge, mainly about native climate and
microhabitat selection (Michaels et al. 2016), for both
surrogate and target species.
Captive breeding and reproductive biology. As
observed with S. perpusillus (Lisboa and Vaz 2012), the
high humidity produced by a fogger stimulated breeding
activity in S. alcatraz and after a period in captivity this
stimulus was no longer necessary. The captive population
of S. alcatraz does not show a marked breeding season
and lays eggs throughout the year. In contrast, wild
reproductive activity of S. alcatraz seems to be more
T T T T T T
17,6 19,2 20,8 22,4 24,0 25,6
Air Temperature (°C)
Fig. 5. Correlation between breeding events of Scinax alcatraz and environmental conditions (a) relative humidity and (b) air tem-
perature from August 2013 to December 2017. Pearson product-moment Correlation Coefficient: r = 0.323; p< 0.001; N = 732.
Amphib. Reptile Conserv.
284
December 2021 | Volume 15 | Number 2 | e293
Lisboa et al.
concentrated between October and April, during the rainy
season (Brasileiro 2008). In our findings, the correlation
between relative humidity, air temperature, and number
of breeding events suggests that high relative humidity
(between 70-80%) associated with temperatures below
22 °C are indicators of suitable conditions for breeding
in S. alcatraz.
Although S. alcatraz is a bromeligenous species
(Brasileiro 2008), 1.e., eggs and tadpoles develop in
the water of bromeliads (reproductive mode 6, Haddad
and Prado 2005), the presence of these plants were not
essential for breeding in captivity. In fact, the most
important factor for the reproduction of S. alcatraz is
the availability of water, and we simply provided it in
captivity with the supply of water pots, which replaced
the bromeliads and ensured an ideal environment for the
development of tadpoles.
The clutch size in captivity (up to 142 eggs) is a
much larger number than recorded in the field, on
average four to seven eggs (Brasileiro 2008). The
difference may be due to the difficulty of making
accurate counts in bromeliads under wild conditions,
by the high predation rate of eggs in the wild, and/
or by the size of the water pool available (water pots
vs. bromeliad axil). Other species of the S. perpusillus
group distribute eggs of one clutch among multiple
bromeliad leaf-tanks by depositing a small number of
eggs in each tank (Alves-Silva and Silva 2009), since
there are insufficient resources in each leaf-tank to
support a large number of tadpoles (Lehtinen 2004).
Thus, S. alcatraz probably exhibits the same behavior,
indicating that the clutch size recorded in nature may
refer to only part of the entire clutch deposited among
possibly many different leaves and bromeliads during
one reproductive event. In captivity, clutches were
found both shared among pots and aggregated in one
portion, and it was common to find eggs scattered
around the aquarium. As we offered only two or three
pots per enclosure, less than the number of tanks found
in a bromeliad, and with more water, this could explain
the higher aggregation of eggs in each pot compared
with wild conditions.
The high egg/embryo and tadpole mortality
rates (67% and 47%, respectively) should be better
investigated to promote improvements in husbandry
of S. alcatraz in the future. One possible explanation
may be the presence of unfertilized eggs, as they
were included in the total count. However, this
observation must be analyzed with caution because
the exact numbers of fertilized and unfertilized
eggs were not known. Another explanation could be
the water conditions, since the two massive tadpole
mortalities reported in 2014 occurred after water
exchange, suggesting some possible toxicity in
the water, including the observation of shuddering
behavior of tadpoles before they died. The simple
parameters like pH, chlorine, and ammonia were
Amphib. Reptile Conserv.
700
611
600
517
500
400
300
200
121
i =
0
60 - 69%
Number of breeding events
BI
="
uw
70-80% Upto 22°C Above 22°C
i Relative Humidity Air Temperature
Fig. 6. Range of environmental conditions (relative humidity
and air temperature) most favorable for reproduction of Scinax
alcatraz in captivity.
within expected standards, but we did not measure any
other parameters that could also be toxic. Therefore,
the cause of the high mortality of tadpoles remains
uncertain. In conclusion, we consider it necessary to
determine the parameters of water in which tadpoles
develop in nature, to adjust the water in captivity and
improve the survivorship rate (Poole and Grow 2012).
Lifespan. Currently, six individuals of the 2011 founders
group remain alive so they are at least ten years old.
The mean longevity for anurans is 8.4 years and it is
positively correlated with body size and negatively
correlated with mean annual temperature (Stark and
Meiri 2018). Scinax alcatraz shows that a small species
(~23—28 mm; Brasileiro 2008) can potentially live more
than one decade, indicating a relatively long lifespan
for a small and tropical amphibian species. However, it
is relevant to highlight that captive amphibians live, in
general, 17% longer than their wild counterparts (Stark
and Meiri 2018).
Fifteen of the captive-born individuals reached the age
of eight years old in 2020. During this study, the mortality
rate of specimens after metamorphosis was 31.5%, and
they died individually, not in groups. The cause of death
for most of them was inconclusive and their age varied
from froglets to adults at the time of death.
The future of the program. During the development of
the ex situ conservation program for S. alcatraz, in situ
actions occurred in parallel by the Brazilian Government.
Ilha dos Alcatrazes became a protected area in 2016
(Brasil 2016) and the bombing practice by the Navy
was discontinued at the beginning of 2013. Nonetheless,
the limited occurrence area of S. alcatraz on the island
still demands the maintenance of a safe population in
captivity (McGowan et al. 2017; Murray et al. 2017).
The wild population of S. alcatraz is abundant and
December 2021 | Volume 15 | Number 2 | e293
Captive breeding program for Scinax alcatraz
stable (Brasileiro 2008), therefore the release of captive-
bred individuals is not necessary at the present time.
Due to this, we usually discard most new clutches to
avoid overpopulation in captivity. As this species breeds
easily in captivity and generates numerous offspring,
we are conducting several scientific studies to improve
our knowledge of the behavior, physiology, and disease
resistance that can be used to conserve S. alcatraz in
nature as well as other species, and thus avoid the need
to collect additional specimens from the wild. The
maintenance of a captive population allows long-term
studies to be conducted, which is important because the
access and logistics for working on Ilha dos Alcatrazes
depend largely on appropriate sea conditions for
navigation and landing, which hinders or even prevents
long term studies in nature.
Another opportunity that has been provided by the
program is the development of educational actions. The
Sao Paulo Zoo receives about 1.5 million visitors per
year, making it a great place to share information about
the biology and conservation of amphibians, using S.
alcatraz as a flagship species. Brazilian zoos and citizens
are usually unaware of the importance of preserving
amphibians, so an exclusive educational space has been
created to exhibit some captive-born individuals of S.
alcatraz (Rancura and Lisboa 2016) and educate the
public.
Conclusions
At least to our knowledge, this was the first ex situ
conservation initiative for an amphibian in Brazil,
which has now guaranteed an assurance population of
Scinax alcatraz at the Sao Paulo Zoo. From a practical
perspective, numerous offspring can be produced if there
is a need to reintroduce this species back to the wild.
This captive population has shown great potential for
amphibian conservation research since the species is
very prolific. Finally, the use of a protocol developed
with a surrogate species was very useful for the results
achieved in the captive breeding program of S. alcatraz.
Acknowledgments.—We are very thankful to the
Amphibian Ark team for supporting this program since
the beginning, for orientation, and for the Seed Grant
provided in 2011, which allowed us to equip the lab;
and especially to Kevin Johnson for reviewing the
manuscript. We are thankful to Cecilia Kierulff, Marina
Bueno, and Catia Dejuste for starting this program
with us. We thank Karin Saito, Janaina Moraes, Rachel
Venturini, and Thatiane Antunes for assisting in the
husbandry of the frogs, and ROmulo Bertuzzi for
helping in data analyses. We are thankful to Kelen Leite
from Estacao Ecologica Tupinambas (ICMBio) for her
support during field expeditions, Marinha do Brasil for
permission to access Ilha dos Alcatrazes, RAN/ICMBio
and providing the collection permits SISBIO (No.
Amphib. Reptile Conserv.
19200 and 38518), as well as Conselho Nacional de
Desenvolvimento Cientifico e Tecnologico CNPq (No.
130218/2013-8), and Fundacéo de Amparo Pesquisa
do Estado de Sao Paulo FAPESP for financial support.
Finally, we are very thankful to FPZSP for funding this
work and supporting this initiative.
Literature Cited
Alves-Silva R, Silva HR. 2009. Life in bromeliads: re-
productive behavior and the monophyly of the Sci-
nax perpusillus species group (Anura: Hylidae).
Journal of Natural History 43(3): 205-217.
Amphibian Ark. 2009. Conservation Needs Assessments:
Identifying priority species for conservation actions.
Available: https://www.conservationneeds.org [Ac-
cessed: 11 April 2020].
Bataus YSL, Reis ML (Organizers). 2011. Plano de
Acdo Nacional para a Conservacdo da Herpetofau-
na Insular Ameacada de Extincdo. Series: Espécies
Ameacadas, Volume 21. Instituto Chico Mendes de
Conservacao da Biodiversidade, ICMBio. Brasilia,
DF, Brasil. 124 p.
Berger L, Speare R, Hines HB, Marantelli G, Hyatt
AD, McDonald KR, Skerratt LF, Olsen V, Clarke
JM, Gillespie G, et al. 2004. Effect of season and
temperature on mortality in amphibians due to chy-
tridiomycosis. Australian Veterinay Journal 82(7):
434439,
Brasil. 2016. Decreto s/n, de 2 de Agosto de 2016. Es-
tabelece a criacéo do Refugio de Vida Silvestre do
Arquipélago de Alcatrazes, no litoral norte do Esta-
do de Sao Paulo, Municipio de Sao Sebastiao. Diario
Oficial da Uniao (3 August 2016). Available: http://
pesquisa.in.gov.br/imprensa/]sp/visualiza/index.}s-
p?data=03/08/2016&jornal=1 &pagina=3 &totalAr-
quivos=104 [Accessed: 9 April 2020].
Brasileiro CA. 2008. Scinax alcatraz. Pp. 305-306 In:
Livro Vermelho da Fauna Brasileira Ameacada
de Extincdo. Editors, Machado ABM, Drummond
GM, Paglia AP) MMA, Brasilia, DF. Fundacao
Biodiversitas, Belo Horizonte, Minas Gerais, Brazil.
645 p.
Carvalho T, Becker CG, Toledo LF. 2017. Historical
amphibian declines and extinctions in Brazil linked
to chytridiomycosis. Proceedings of the Royal
Society B 284: 20162254.
Chanson J, Hoffmann M, Cox N, Stuart S. 2008. The
state of the world’s amphibians. Pp. 33-52 In:
Threatened Amphibians of the World. Editors, Stuart
SN, Hoffmann M, Chanson JS, Cox NA, Berridge
RJ, Ramani P, Young BE. Lynx Editions, Barcelona,
Spain. 758 p.
Crump P, Grow S. (Organizers). 2007. Action plan for
ex situ amphibian conservation in the AZA commu-
nity. Association of Zoos & Aquariums, Amphibian
Taxon Advisory Group. 46 p.
December 2021 | Volume 15 | Number 2 | e293
Lisboa et al.
Cushman SA. 2006. Effects of habitat loss and fragmen-
tation on amphibians: a review and prospectus. Bio-
logical Conservation 128(2): 231-240.
Gascon C, Collins JP, Moore RD, Church DR, McKay
JE, Mendelson J. (Editors). 2007. Amphibian Con-
servation Action Plan. \UCN/SSC Amphibian Spe-
clalist Group. Gland, Switzerland and Cambridge,
United Kingdom. 64 p.
Gosner KL. 1960. A simplified table for staging anuran
embryos and larvae with notes on identification.
Herpetologica 16(3): 183-190.
Haddad CFB, Prado CPA. 2005. Reproductive modes in
frogs and their unexpected diversity in the Atlantic
Forest of Brazil. BioScience 55(3): 207-217.
Halliday TR. 2008. Why amphibians are important.
International Zoo Yearbook 42: 7-14.
Hammer 0, Harper DAT, Ryan PD. 2001. PAST:
Paleontological Statistics Software Package
for Education and Data Analysis. Version 2.17.
Palaeontologia Electronica 4(1): 1-9.
Heyer WR, Rand AS, Cruz CAG, Peixoto OL. 1988.
Decimations, extinctions, and colonizations of
frog populations in Southeast Brazil and their
evolutionary implications. Biotropica 20: 230-235.
ICMBio (Instituto Chico Mendes de Conservacao da
Biodiversidade). 2013. MMA defende cria¢ao de
parque em Alcatrazes. Available:
http://www.icmbio.gov.br/portal/index.
php?option=com_content&view=article&id=4062
&Itemid=999 [Accessed: 9 April 2020].
ICMBio (Instituto Chico Mendes de Conservacao da
Biodiversidade). 2018. Livro Vermelho da Fauna
Brasileira Ameacgada de Extingao: Volume V -
Anfibios. In: Livro Vermelho da Fauna Brasileira
Ameagada de Extingdo. ICMBio, Brasilia, DF,
Brasil. 128 p.
La Marca E, Lips KR, Lotters S, Puschendorf R, Ibafiez
R, Rueda-Almonacid JV, Schulte R, Marty C, Cas-
tro F, Manzanilla-Puppo J, Young BE, et al. 2005.
Catastrophic population declines and extinctions in
Neotropical Harlequin Frogs (Bufonidae: Atelopus).
Biotropica 37(2): 190-201.
Lehtinen RM. 2004. Tests or competition: cannibalism,
and priority effects in two phytotelm-dwelling
tadpoles from Madagascar. Herpetologica 60(1):
1-13.
Lisboa CS, Vaz RI. 2012. Captive breeding and hus-
bandry of Scinax perpusillus at Sao Paulo Zoo: pre-
liminary action for ex situ conservation of Scinax
alcatraz (Anura: Hylidae). Herpetological Review
43(3): 435-437.
McGowan PJK, Traylor-Holzer K, Leus K. 2017. IUCN
guidelines for determining when and how ex situ
management should be used in species conservation.
Conservation Letters 10(3): 361-366.
McFadden M, Hobbs R, Marantelli G, Harlow P, Banks
C, Hunter D. 2013. Captive management and breed-
Amphib. Reptile Conserv.
ing of the Critically Endangered Southern Cor-
roboree Frog (Pseudophryne corroboree) (Moore
1953) at Taronga and Melbourne Zoos. Amphibian
& Reptile Conservation 5(3): 70-87.
Mendelson III JR. 2011. Shifted baselines, forensic
taxonomy, and Rabbs’ Fringe-limbed Treefrog: the
changing role of biologists in an era of amphibian
declines and extinctions. Herpetological Review
42(1): 21-25.
Michaels CJ, Antwis RE, Preziosi RF. 2014a. Impacts
of UVB provision and dietary calcium content on
serum vitamin Ds, growth rates, skeletal structure,
and coloration in captive Oriental Fire-bellied Toads
(Bombina orientalis). Journal of Animal Physiology
and Animal Nutrition 99(2): 1-13.
Michaels CJ, Gini BF, Preziosi RF. 2014b. The importance
of natural history and species-specific approaches
in amphibian ex-situ conservation. Herpetological
Journal 24: 135-145.
Michaels CJ, Tapley B, Harding L, Bryant Z, Grant S,
Sunter G, Gill I, Nyingchia O, Doherty-Bone T. 2015.
Breeding and rearing the Critically Endangered Lake
Oku Clawed Frog (Xenopus longipes Loumont and
Kobel 1991). Amphibian & Reptile Conservation 9
[General Section]: 100-110.
Michaels CJ, Fahrbach M, Harding L, Bryant Z, Capon-
Doyle JS, Grant S, Gill I, Tapley B. 2016. Relating
natural climate and phenology to captive husbandry
in two Midwife Toads (Al/ytes obstetricans and A.
cisternasii) from different climatic zones. Alytes 33:
2-11.
Ministério do Meio Ambiente. 2014. Portaria n°. 444, de
17 de dezembro de 2014. Lista Nacional Oficial de
Espécies da Fauna Ameagadas de Extinc¢ao. Diario
Oficial da Uniao (17 December 2014). Available:
http://pesquisa.in. gov. br/imprensa/jsp/visualiza/
index.jsp?jornal=1 &pagina=121 &data=1 8/12/2014
[Accessed: 9 April 2020].
Murray MJ, Keith DA, Bland LM, Nicholson E, Reagan
TJ, Rodriguez JP, Bedward M. 2017. The use of range
size to assess risks to biodiversity from stochastic
threats. Diversity Distribution 23: 474-483.
Pavajeau L, Zippel KC, Gibson R, Johnson K. 2008.
Amphibian Ark and the 2008 Year of the Frog
Campaign. /nternational Zoo Yearbook 42: 24-29.
Peixoto OL. 1987. Caracteriza¢gao do grupo “perpusilla”
e revalidacdo da posicao taxondmica de Ololygon
perpusilla perpusilla e Ololygon perpusilla
v-signata (Amphibia, Anura, Hylidae). Arquivos da
Universidade Federal Rural do Rio de Janeiro 10:
37-49.
Pessier AP, Mendelson III Jr. (Editors). 2010. A Manual
for Control of Infectious Diseases in Amphibian
Survival Assurance Colonies and Reintroduction
Programs. YUCN/SSC_ Conservation Breeding
Specialist Group, Apple Valley, Minnesota, USA.
229 p.
December 2021 | Volume 15 | Number 2 | e293
Captive breeding program for Scinax alcatraz
Poole VA, Grow S. (Editors). 2012. Amphibian
Husbandry Resource Guide, Edition 2.0. Association
of Zoos and Aquariums, Silver Spring, Maryland,
USA. 238 p.
Rancura K, Lisboa CS. 2016. Educational exhibit as a
conservation tool for the Alcatraz Snouted Tree
Frog. AArk Newsletter (September 2016). Available:
http://www.amphibianark.org/Newsletters/A Ark-
newsletter-36.pdf [Accessed: 8 April 2020].
Rodrigues MT, Cruz CAG. 2004. Scinax alcatraz.
The IUCN Red List of Threatened Species 2004.
Available: https://www.iucnredlist.org/spe-
cies/55924/11393985 [Accessed: 8 April 2020].
Segalla MV, Caramaschi U, Cruz CAG, Garcia PCA,
Grant T, Haddad CFB, Santana DJ, Toledo LF, Lan-
gone JA. 2019. Brazilian amphibians: list of species.
Herpetologia Brasileira 8(1): 65—96.
Stark G, Meiri S. 2018. Cold and dark captivity: drivers
of amphibian longevity. Global Ecology and Bioge-
ography 27: 1,384-1,397.
Verdade VK, Valdujo PH, Carnaval AC, Schiesari L, To-
ledo LF, Mott T, Andrade GV, Eterovick PC, Menin
M, Silvano DL, et al. 2012. A leap further: the Bra-
zilian Amphibian Conservation Action Plan. Alytes
29(1-4): 27-42.
Wake DB, Vredenburg VT. 2008. Are we in the midst of
the sixth mass extinction? A view from the world
of amphibians. Proceedings of the National Acad-
emy of Sciences of the United States of America 105:
11,466-11,473.
WeygoldtP. 1989. Changes inthe composition of mountain
stream frog communities in the Atlantic mountains
of Brazil: frogs as indicators of environmental
deteriorations? Studies on Neotropical Fauna and
Environment 24(4): 249-255.
Wren S, Angulo A, Meredith H, Kielgast J, Santos M,
Bishop P. (Editors). 2015. Amphibian Conserva-
tion Action Plan. IUCN SSC Amphibian Specialist
Group. Available: https://www.iucn-amphibians.
org/resources/acap/ [Accessed: 8 April 2020].
Zippel KC, Mendelson HI JR. 2008. The amphibian
extinction crisis: a call to action. Herpetological
Review 39: 23-29.
Zippel K, Johnson K, Gagliardo R, Gibson R, McFadden
M, Browne R, Martinez C, Townsend E. 2011. The
Amphibian Ark: a global community for ex situ con-
servation of amphibians. Herpetological Conserva-
tion and Biology 6(3): 340-352.
Zoologico de Sao Paulo. 2019. Available: http://
www.zoologico.com.br/noticias/programa-de-
conservacao-da-perereca-pintada/. [Accessed: 11
April 2020].
Cybele S. Lisboa has been the Curator of Reptiles, Amphibians and Invertebrates at Sao
Paulo Zoo since 2009. She is regional chair of the Amphibian Specialist Group-Brazil
(IUCN/SSC) and also collaborates with National Action Plans for endangered species of
herpetofauna. She received her M.S. degree from Universidade Federal de Sao Carlos
studying amphibian ex situ conservation.
Renata I. Vaz is a Ph.D. student in the Department of Physiology at the University of Sao
Paulo. She has been working on immunology, symbiotic microbiota, and conservation of
amphibians. Her current research goal is to understand the dynamics of skin microbial
communities of amphibians in the Atlantic Forest and which factors can be modulators of
this community.
Cinthia A. Brasileiro is professor at the Federal University of SAo Paulo. Her research
interests lie in field biology, behavioral ecology, community ecology and conservation,
especially of insular amphibian species.
Amphib. Reptile Conserv. 288 December 2021 | Volume 15 | Number 2 | e293
Official journal website:
amphibian-reptile-conservation.org
Amphibian & Reptile Conservation
15(2) [Taxonomy Section]: 289-310 (e294).
urn:lsid:zoobank.org:pub:B0980607-EBC4-4B57-A3E0-F140F2C263AA
A new species of Geophis (Dipsadidae) from Veracruz,
Mexico, with comments on the validity of related taxa
12.3*Christoph I. Grunwald, 2*Ilvan T. Ahumada-Carrillo, *André J. Griinwald,
23Carlos E. Montano-Ruvalcaba, and ‘Uri O. Garcia-Vazquez
'Biencom Real Estate, Carretera Chapala - Jocotepec #57-1, C.P. 45920, Ajijic, Jalisco, MEXICO *Biodiversa A.C., Avenida de la Ribera #203,
C.P. 45900, Chapala, Jalisco, MEXICO *Herp.mx A.C., Villa de Alvarez, Colima, MEXICO *Laboratorio de Sistemdtica Molecular, Unidad de
Investigacion Experimental Zaragoza, Facultad de Estudios Superiores Zaragoza, Universidad Nacional Autonéma de Mexico, Batalla 5 de mayo
s/n, Col. Ejército de Oriente, C.P. 09230, Ciudad de Mexico, MEXICO
Abstract.—A new species of the Geophis dubius group is described from the cloud forests in the mountains
north of Xalapa, Veracruz. This new species is most similar to G. turbidus and G. lorancai, from which it differs
genetically as well as by a very unique color pattern, morphological characters, and habitat use. The validity of
G. fuscus, which was described from central Veracruz, is discussed. With the description of the new species
and our assessment of G. fuscus, the number of species in the Geophis dubius group increases to 14 and the
number of species of Geophis to 52.
Keywords. Geophis dubius group, Geophis fuscus, Geophis lorancai, Geophis turbidus, montane cloud forest, new
species, Sierra de Misantla, Sierra Madre Oriental
Resumen.—Se describe una nueva especie del grupo de Geophis dubius del bosque mesofilo de montana al
norte de Xalapa, Veracruz. Esta nueva especie es mas parecido a G. turbidus y G. lorancai, de cuales se diferencia
geneticamente y por su coloracion unica, caracteres morfoldgicas y preferencia de habitat particular. También
disuctimos la validez de G. fuscus, cual tambien fue descrito del centro de Veracruz. Con la descripcion de la
nuev especies, y nuestro analisis de G. fuscus, el numero de especies del grupo Geophis dubius se aumenta
a 14 y el numero de especies de Geophis a 52.
Palabras clave. Bosque mesofilo de montafia, Geophis fuscus, Geophis lorancai, grupo de Geophis dubius, nueva
especie, Sierra de Misantla, Sierra Madre Oriental
Citation: Grunwald Cl, Anumada-Carrillo IT, Grunwald AJ, Montafho-Ruvalcaba CE, Garcia-Vazquez UO. 2021. Anew species of Geophis (Dipsadidae)
from Veracruz, Mexico, with comments on the validity of related taxa. Amphibian & Reptile Conservation 15(2) [Taxonomy Section]: 289-310 (e294).
Copyright: © 2021 Grunwald et al. This is an open access article distributed under the terms of the Creative Commons Attribution License [Attribution
4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction in any
medium, provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced, are
as follows: official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 14 October 2021; Published: 23 December 2021
Introduction Guatemala, and along the Pacific versant from western
Oaxaca to El Salvador and Guatemala. Geophis fuscus
The genus Geophis Wagler, 1830 is one of the largest
genera of Dipsadidae with 50 recognized species
(Canseco-Marquez et al. 2016). Downs (1967) recognized
seven species groups of Geophis, as the G. chalybeus, G.
championi, G. dubius, G. latifrontalis, G. omiltemanus,
G. semidoliatus, and G. sieboldi groups, and this study
follows that arrangement. While the Geophis dubius
group was considered by Downs (1967) to consist of only
five species, it has received a great deal of taxonomic
interest in recent decades and is currently composed of
at least 12 species, with a collective range from along
the Atlantic versant from southern Hidalgo to central
Correspondence. *[email protected]
Amphib. Reptile Conserv.
(Fisher 1886) was described from “Jalapa, Mexico” and
later considered synonymous with G. dubius by various
authors (Boulenger 1894; Bogert and Porter 1966; Downs
1967; Campbell et al. 1983; Nieto-Montes de Oca 2003).
Herein, we give more insight to the potential origin and
validity of G. fuscus.
The Geophis dubius group is defined by having a head
which is indistinct or slightly distinct from the neck;
snout long and bluntly pointed; rostral prominent, its
visible length is one third or more its distance from the
frontal; internasals large, rounded anteriorly; prefrontal
short; anterior edge of the frontal sharply angulate;
December 2021 | Volume 15 | Number 2 | e294
A new Geophis species from Veracruz, Mexico
parietal short; supraocular small, triangular and absent
in G. rhodogaster; eye small; postnasal enlarged; loreal
short; anterior temporal absent; dorsal scales smooth or
keeled and in 17 rows, and scales above the vent with
paired apical pits (absent in some species) according to
Downs (1967).
Species of the Geophis dubius group are mostly dark
dorsally without conspicuous patterns, although several
exceptions exist. The most remarkably colored species
is G. lorancai, which has black bands on a bright orange
background. Herein, we describe a new species of the
Geophis dubius group that is unique within the genus
in possessing bright crimson red lateral stripes on a
slate gray background. The only species we are aware
of in Mexico with bright crimson red lateral stripes are
Gyalopion quadrangulare (Gunther, 1893) and Sonora
mutabilis Stickel, 1943; however, both belong to
Colubridae, and are white and black banded snakes from
the tropical deciduous forests of western Mexico.
Materials and Methods
The specimens of the new species were compared with
specimens of all species of the Geophis dubius group
from Central Mexico, as well as the relevant information
published in the literature. The specimens examined are
listed in Appendix 1.
Scale nomenclature follows Downs (1967) and Savage
and Watling (2008). Scale counts were performed with
the aid of a dissecting microscope. Measurements were
taken with a ruler or digital calipers to the nearest 0.1 mm
(Truper, Mexico). Ventrals were counted as suggested by
Downs (1967). Bilateral characters were scored on both
sides. When the condition of a given character was not
identical on both sides, the conditions on the left and
right sides are given, in that order, separated by a slash
(/). In some instances, the conditions on the left and right
sides are given in that manner in the tables even when
they do not differ. Head length was measured from the
tip of the snout to the posterior end of the parietals, and
head width was measured at the widest point of the head
at the posterior part of the jaw. All scale dimensions
were measured at their maximum. To examine dentition
characters, the maxilla and ectopterygoid were removed
from the skull and cleansed in a dilute solution of
Proteinase K at 34 °C for approximately one hour. The
diagnosis is based on both the specimens examined and
the extensive data published on the Geophis dubius
group by Canseco-Marquez et al. (2016). Data for G.
fuscus were taken from the original description (Fischer
1886). Other relevant literature that contributed to the
diagnostics includes: Bogert and Porter (1966), Downs
(1967), Smith and Holland (1969), Campbell and
Murphy (1977), Savage (1981), Campbell et al. (1983),
Restrepo and Wright (1987), Smith and Chiszar (1992),
Smith and Flores- Villela (1993), Lips and Savage (1994),
Smith (1995), Wilson et al. (1998), Pérez-Higareda et
Amphib. Reptile Conserv.
al. (2001), Myers (2003), Nieto-Montes de Oca (2003),
Savage and Watling (2008), Townsend (2009), Townsend
and Wilson (2006), and Pavon-Vazquez et al. (2011,
2013). Abbreviations used in the text and tables are as
follows: snout-vent length (SVL), tail length (TL), total
length (TotL), head length (HL), head width (HW), and
snout-orbit length (SL).
Molecular analysis. For DNA extraction and PCR
amplification, fragments of the mtDNA gene cytochrome
b (cyt-b) were obtained for G. lorancai, G. semidoliatus,
and the holotype of the new species (Table 1). The
genomic DNA was extracted from liver or muscle tissue
with the use of the standard ammonium acetate protocol
(Fetzner 1999), and Polymerase Chain Reaction (PCR)
was used to amplify the aforementioned fragments with
the primers L14919-H15716 and L15845—-H16064
(Burbrink et al. 2000). PCR products were purified
with polyethylene glycol (Lis 1980). Purified DNA
was sequenced by Macrogen Korea (Standard-Seq of
Macrogen Inc.). Sequences of cyt-b were obtained from
GenBank for G. juarezi, G. carinosus, G. turbidus,
and G. dubius of the Geophis dubius group; while five
samples for the remaining five species groups of Geophis
(G. occabus, G. godmani, G. bicolor, G. omiltemanus,
and G. latifrontalis), and Rhadinaea flavilata were used
as outgroup (Table 1).
The alignment was performed using the Muscle
algorithm included in the software MEGA 7 (Kumar
et al. 2016; Tamura et al. 2018). The best-fitting
substitution models and partitioning schemes were
obtained simultaneously using the Bayesian Information
Criterion in the software PartitionFinder 2.1.1 (Lanfear
2016). A Bayesian phylogenetic analysis was performed
with the software MrBayes 3.2 (Ronquist et al. 2011).
The analysis was run for 30,000,000 generations with
the default settings and tree sampling every 3,000
generations. The results were evaluated for convergence
and sufficient sampling in Tracer 1.6 (Rambaut et al.
2014), and the combined trees were obtained in each run
using LogCombiner 1.8.4 (Drummond et al. 2012). The
maximum clade credibility (MCC) tree was annotated
in TreeAnnotator 1.8.4 (Drummond et al. 2012) after
specifying a burn-in of 25%. Nodes with a Posterior
probability (PP) > 0.95 were considered significantly
supported (Huelsenbeck and Rannala 2004).
Results
Geophis cansecoi sp. nov.
Figs. 1-6.
urn:|sid:zoobank.org:act:0F7EF314-A 7DC-4DC6-B7D8-9B99255A367F
Holotype (Figs. 1-2). MZFZ 4432 (field number, CIG
1161). Adult male, collected at 0.9 km south of Los
Capulines, on Misantla-Chiconquiaco Hwy., Municipio
December 2021 | Volume 15 | Number 2 | e294
Grunwald et al.
Table 1. Collection and voucher data for colubrid genetic samples used in this study. Acronyms for herpetological collections
follow Sabaj (2019). JAC, CIG, RWB, and ENS are field identifiers for un-catalogued specimens being deposited in the MZFZ,
MZFC-HE, and UTA.
[aziz 4432 | Geophis cansecosp- nox. | Mec: Veracruz: Chconguiaco _[ MZA83108
[2 [Marci 10552 | Geophiscarinons | Mevio Veracruz Wotan San Marin KOOI7314—____
Ts [Marci 27256 | Geophis bins | Mexio Oaxaca: San do Buenos aires [KOOI7319_—__—
Ts [casi78i26 | Geophis goamant | Casa Rus Punarenas Las Tabs 10598932
[9 [zrcaa 27505 | Geophisjarci | vio Oana Sata Maia lotepee KCTS
de Yecuatla, (19.811724°, -96.824587°, datum WGS84,
1,590 m asl), Veracruz, Mexico on 5 June 2017 by
Christoph I. Grunwald, André J. Griinwald, and Ivan T.
Ahumada-Carrillo.
Paratypes (n = 14, Figs. 3-6). MZFZ 4433 (CIG
01162). Adult, DOR, collected at 1.1 km south of Los
Capulines, on Misantla-Chiconquiaco Hwy., Municipio
de Yecuatla, (19.810740°, -96.824874°, datum WGS84,
1,626 m asl), Veracruz, Mexico, on 6 June 2017 by
Christoph I. Grunwald, Ivan T. Ahumada-Carrillo, and
André J. Grunwald. MZFZ 4434-35 (CIG 01378-79),
MZFZ 4436-38 (CIG 0139395), INIRENA 2811-14
(CIG 01396-99), MZFZ 4448-49 (CIG 01490-91).
Adults and juveniles, collected at Los Capulines, on
Misantla-Chiconquiaco Hwy., Municipio de Yecuatla,
(19.813360°, -96.827240°, datum WGS84, 1,570 m
asl), Veracruz, Mexico, on 8 June 2019 by Christoph I.
Grunwald, André J. Grunwald, and Carlos E. Montafio-
Ruvalcaba. INIRENA 2815-16 (CIG 01386-—87). Adults,
collected at 3.7 km S of Los Capulines, on Misantla-
Chiconquiaco Hwy., Municipio de Chinconquiaco,
(19.793370°, -96.822970°, datum WGS84, 1,763 m
asl), Veracruz, Mexico, on 8 June 2019 by Christoph I.
Grunwald, André J. Grunwald, and Carlos E. Montafio-
Ruvalcaba.
Diagnosis. A member of the Geophis dubius group, as
defined by Downs (1967) and expanded by Wilson and
Townsend (2007), and characterized by the following
combination of traits: eye relatively small; single
supraocular and postocular present on each side (with
Amphib. Reptile Conserv.
one exception, see below); no anterior temporal scale,
penultimate supralabial and parietal in contact; second
infralabials small, broadly separated from each other;
mental scale and anterior chinshields in contact; smooth
dorsal scales throughout the body arranged in 17 rows;
ventrals 134-142 in females (v = 7), and 125-131 in
males (n = 7); subcaudals 28-35 in females (” = 7), and
34-37 in males (n = 7), with ventral + subcaudal totals
163-173 in females (n= 7) and 159-165 in males (n= 7),
tail length 11.6-16.3% of TotL in females, 16.7-19.0%
of TotL in males; dorsal pattern slate gray, with crimson
red lateral stripe on each side, usually on first three or
four scale rows but occasionally occupying part of the
fifth; venter pale cream, except on the ventral surfaces of
the head and throat, which are gray; maxillary teeth 6-8.
Geophis cansecoi 1s distinct from all species in the
G. championi and G. semidoliatus groups, as well as
most species in the G. sieboldi group by possessing the
dorsal scales arranged in 17 rows (vs. 15 rows), and
from the remaining species in the G. sieboldi group by
possessing smooth dorsal scales throughout the body (vs.
dorsal scales keeled on posterior half of body). Geophis
cansecoi differs from all species in the G. omiltemanus
and G. chaylybeus groups by a small eye, 10-12% of head
length (vs. >12%); furthermore, from the species in the
G. omiltemanus group by lacking an anterior temporal
scale, thus either the fourth or fifth supralabial in contact
with parietal (vs. fifth supralabial separated from parietal
by anterior temporal scale); from some species in the
G. chalybeus group (G. dugesii, G. nigrocinctus, and
G. tarascae) by possessing dorsal scales arranged in 17
rows (vs. 15 rows) and from the remaining species by
December 2021 | Volume 15 | Number 2 | e294
A new Geophis species from Veracruz, Mexico
Fig. 1. Holotype of Geophis cansecoi sp. nov. MZFZ 4432 from Los Capulines, Municipio de Yecuatla, Veracruz, Mexico. (A)
Dorsolateral perspective in life. (B) Lateral perspective in life. (C) Ventral perspective in life.
possessing a mental and anterior chinshields in contact
(vs. separated by a pair of enlarged first infralabials, which
are in contact). Geophis cansecoi can be distinguished
from members of the G. /atifrontalis group as follows:
from G. /atifrontalis and G. mutitorques by lacking an
anterior temporal scale and possessing the fourth or fifth
supralabial in contact with parietal (vs. fifth supralabial
separated from parietal by anterior temporal scale); from
G. blanchardi and G. latifrontalis by possessing mental
and anterior chinshields in contact (vs. separated by a
Amphib. Reptile Conserv.
pair of enlarged first infralabials which are in contact),
as well as from all species by its unique color pattern of
slate gray ground coloration with two crimson red lateral
stripes (vs. variable ground coloration with or without
bands and without lateral stripes).
Geophis cansecoi can be distinguished from species
within its own Geophis dubius group, as follows: from
G. carinosus, G. juarezi, G. rostralis, and sometimes
G. turbidus by possessing smooth scales throughout
the body (vs. strongly keeled dorsal scales on posterior
December 2021 | Volume 15 | Number 2 | e294
Grunwald et al.
B
Fig. 2. Holotype of Geophis cansecoi sp. nov. MZFZ 4432 from Los Capulines, Municipio de Yecuatla, Veracruz, Mexico. (A)
Dorsal perspective in preservative. (B) Ventral perspective in preservative.
portion of the body or above vent); from G. anocularis,
G. duellmani, and G. rhodogaster by usually possessing a
supraocular scale (vs. supraocular scale absent); from G.
anocularis and G. duellmani by possessing a postocular
scale (vs. postocular scale absent); from G. dubius and
G. fuscus (see below) by possessing internasal scales
and prefrontal scales that are not fused (vs. fused); from
G. carinosus, G. dubius, G. immaculatus, G. juarezi, G.
nephodrymus, G. rhodogaster, and sometimes G. turbidus
by first infralabial scales that are broadly separated, never
in contact (vs. in contact or narrowly separated); from
G. carinosus, G. juarezi, and sometimes G. anocularis
and G. fulvoguttatus by possessing more than 125 ventral
scales in males (vs. less than 125); from G. anocularis
and usually from G. carinosus and G. immaculatus by
possessing more than 134 ventral scales in females (vs.
usually fewer); from G. dubius by possessing fewer than
142 ventral scales in females (vs. more than 144); from
G. carinosus, G. duellmani, G. juarezi, G. rhodogaster,
and G. rostralis by possessing fewer than 38 subcaudal
scales in males (vs. 39 or more); from G. nephodrymus
and G. lorancai by possessing 34 or more subcaudal
scales in males (vs. 35 or less); from G. carinosus and
G. juarezi by possessing fewer than 35 subcaudal scales
in females (vs. 37 or more); from all species in the
species group other than G. /orancai by possessing fewer
maxillary teeth 6-8 (vs. 9 or more); from G. annocularis,
G. carinosus, G. duellmani, G. juarezi, G. rhodogaster,
and G. rostralis by possessing a shorter tail in males,
17-19% of TotL (vs. more than 19% of TotL); from
G. nephodrymus by possessing a longer tail in males
17-19% of TotL (vs. less than 17% of TotL); from G.
carinosus, G. duellmani, and G. juarezi, by possessing
a shorter tail in females, 12-16% of TotL (vs. more than
16% of TotL); and from all species in the species group
by its unique color pattern of slate gray ground coloration
with two crimson red lateral stripes (vs. variable ground
coloration with or without bands and without lateral
stripes). A comparison of the diagnostic characters of all
Amphib. Reptile Conserv.
species of the G. dubius species group is given in Table 2.
Many species of Mexican Geophis are poorly understood,
and in many cases photographs of live individuals have
not been published. For comparative purposes, we have
included photos of closely related species of the Geophis
dubius group as well as sympatrically occurring species
of Geophis from other species groups (Figs. 7—9).
Description of holotype (Figs. 1-2). MZFZ 4432. Adult
male. SVL 227 mm; TL 47; TotL 274 mm. HL 8.6 mm
(from tip to posterior border of parietal); HW 5.1 mm,
head slightly (1.3 times) distinct from body. Snout long,
SL 3.7 mm, with HL 2.3 times SL, rounded from above,
obtusely pointed from lateral profile, projecting anteriorly
1.0 mm beyond the lower jaw. Rostral 1.6 times as broad
as high (2.6 mm wide, 1.6 mm high), portion visible from
above (1.0 mm) is 0.3 times as long as its distance from
frontal (3.3 mm), 1.4 times as long as common internasal
suture (0.7 mm), with posterior end approximately at
level of anterior margin of nostrils; internasals as broad
as long (length / width) = (1.2 mm /1.2 mm), angular
anteriorly, in lateral contact with anterior and posterior
nasals. Prefrontals in lateral contact with postnasal,
loreal, and eye on each side, their length 2.7 mm, 73%
of the length of SL, and their common suture 1.7 mm,
63% of the length of frontal. Frontal wider than long,
3.1 mm wide, 2.7 mm long, 1.2 times as wide as long.
Supraocular large, in contact with prefrontal, frontal,
parietal, and postocular. Postoculars moderately sized,
in contact with supraocular, parietal, and fourth and fifth
supralabials. Parietal 3.8 mm long, 2.7 mm wide, 1.4
times as long as wide, length of parietal 44% of HL, the
common suture between parietals 2.4 mm, 89% of frontal
length. Nasal divided, postnasal longer than prenasal with
combined length of both nasals (2.1 mm) longer than
loreal. Loreal 1.6 mm long, 1.1 mm high, longer than
high, and reaching orbit. Eye small, 0.9 mm, 10% of HL.
Supralabials six on both sides, first in contact with nasals,
second and third in contact with loreal, third and fourth
December 2021 | Volume 15 | Number 2 | e294
A new Geophis species from Veracruz, Mexico
- . “. = - , Le }
ne ia a a ea eae ey oe oy a Pe y A
«Se OO ES > Le
2
he so
. ; = " . :
+ PHY’
Fig. 3. Diagnostic characters of paratype Geophis cansecoi sp. nov. MZFZ 4436 from Los Capulines, Municipio de Yecuatla,
Veracruz, Mexico. (A) Dorso-lateral perspective in life. (B) Dorsal profile of head in life. (C) Lateral profile of head in life. (D)
Ventral profile of head in life. (E) Ventral surface of tail in life.
entering orbit, fifth largest and in contact with parietal © mm long), rounded anteriorly, in posterior contact with
and posterior temporal. Anterior temporal absent, one both anterior chinshields. Infralabials five left / six right,
posterior temporal. Four nuchal scales in contact with first through third in contact with anterior chinshields,
parietals. and third and fourth in contact with posterior chinshields.
Mental 1.2 times as broad as long (1.4 mm broad, 1.2. ~=Anterior chinshields irregular, left chinshield 2.4 mm
Amphib. Reptile Conserv. 294 December 2021 | Volume 15 | Number 2 | e294
Tay
—_
c)
3S
©
=
Cc
=)
Soe
O)
N
Saal
SE—-6C
9V-6E
LvI-9E1
8eI-I€l
1OR]U09 UT
«a
et
pesny 10N
quasar
quosqy
yjoours
JaJSVSOpoYysL “D
S91 0-CI1 0
le J
cE-VCE
T€-Ce
8EI-8CI
8EI-CCl
Aes yeq
poyeredas A[MOLeU
JO J9RIU0D UT
pesny 10N
oso |
oso |
yjoours
smudipoydau “5
io
v9
j=)
vel-0el
aN
on
6cl
Aeis yeq
ORJU09 UT
pesny ON
yuasalg
yuasolg
qwoous
SnDjnavUIU *D
810-910
I
9E-VE
LvI-Stl
LEI-Sel
poereredas
posny 10N
yuUdSoIg
quasar
yjoours
snjpynsoanf ‘D
cc 0-17 0
II-60
CEI-ETI
9CI-CCI
uMOlq
sep YIM
pasnyns Yuld
poyeredas
ATpeorg
posed Jo a[surs
STOT
la!
JUdA 9AOGR
popooy Apyeom.
JO YJOouS
S1LDINIOUD ‘|
1c'0-07 0
cI-0l
9E-CE
8EI-VEl
cEI—-9CI
uMmolq
ysep usu)
ATJoLoyue
STN
poreredas
ATpeorg
aa
pesny 10N
yjoours
jupuyjanp °D
eI-Il
60
vcl-8I1
vil
UMOIq
YsIppos
0} SuTuIN}
“spueqssolo
UMOIq
ysippoz
UM Wedd
10109 U]
posnj JON
yUasolg
yUasolg
Apoq jo
SpJIy}-OM}
01 Jyey-ouo
Jor1ajsod
UO poeoy
A[BUONS
rasnt “5
vo0-€T7 0
1c'0-07 0
-
TT O-LT0
81 0-ST 0
810-410
61 0-L1'0
is 6b-Sb eb-6E | 0s-9¢ ce-€€ 6£-4E LEE
€v-Le
9EI-STl Loe ile ISI-LET | oct | Ov I-61 crI-VEl (S) speaqua,
ecI-911 cel-9C1 | oc 6rI-I€l O€I-SCI 6€I-STCl TeI-scl (P) s[eayuaA,
ATJOLIOyUe
OY JO
$o0ed] YIM
uMolg
tak
MOLIeU
pue su0T]
=
Apoq
JO SPIIYI-OM}
Jor}sod
UO po]204
A[BUONS
SNSOULIDD “D)
ep YIM
pomour
UjIM weal
oyed 10
ony
poyeredas
A[peoig
|
aston
=
JUSA 9AOGR
pajaoyl
YSIMoy[o4
Weolg
ORO Ul
yjoours
poyeredas
AjMoIeU
JO
yoeyu0d UT
ported
pore,
USA
oaoqge
SQISIA
Ajoreq
SpSoy YM
Woows
dn uo
Avis JOyIep
YIM osuelo
JO YSIPpoy
poeredag
ouou
JO 9[3UuIS
Aqrens()
pesny 10N
yoous
‘dnois sorsads snignp siydoay du} Jo siojyoeseyo dArTyeseduiod 0} AY *Z 9[Quy
uMolq
pue oy
popueg
poyeredas
A[MOLeU JO
70e]U09 UT
9[3uls
Aqrens¢),
pesny 10N
Apoq jo
yUnoj-ou0
Jor1a}sod
UO poTooy
Jo yoouls
snpiqin} ‘9
dj uo Aes
Joyrep pue
spueqssolo
ACIS 1ST]
OUIOS
UIA poy
poesedas
posnj JON
yjoours
dou ‘ds
102asuvd “D
(P) ones
4} Sug] [¥}0}
/ W809] [UL
q}99}
AABTPIXETA
(3)
sjepneaqns
(P)
sjepneaqns
WOTe.10[O9
[epneoqns
s[viquyle.agur
Jo ated ,.]
posed
10 o[SUIS
AB[NS ISA
Qysioy
/gysugy se)
YQ) Sug] [va107
pasny
jou 10 pasny
S[BSvU19} UT
pue
s[eyuO.Aga1g
SUI[IOy
a[Bos [Bs0p
jo JUdIXY
December 2021 | Volume 15 | Number 2 | e294
295
Amphib. Reptile Conserv.
ICO
Mexi
I
ies from Veracruz
is spec
Anew Geoph
ySa10J YLO
-ourd prumny ySoIOJ pnola
Jopeares
Iq Wlo}somyyiou
pue seinpuoy
UIO]SOMYINOS
0} Byeuroyeny
woyyNos
Ysnoly} OTXd/I
‘sederya
woyseq
seInpuoH
uso}soOmyOU
ROUIO OP BIIAIS
soulyjno
UMOI YIM
YSIMo]oA “wed
MOTIOA IO
asuvIO YSIPpoYy
Por YoTIQ 0} WIROID
ystAvis oped wos
osueI YY} SOyd}0[qG
[eae] pue ‘spueq
[ened yosyyo
AT[esoye] “spueq
WIM poyeu
ATOATSUD]X9 0}
pewioyedun
wo SuIsUeI
‘punoisyorq ABQ
UMOIQ YSIPpor
0} YSTARID
L10-SET0
ST0-cl 0
ySOIOJ JOM
pue jsa10j pno[o
Ryewoyeny
UJO}SOMYINOS pure
Oorxapy ‘sede
ulajseoyInoS
S[PNUDA JO
sospo [e1o}e] pue
JOLIOVUe UO UMOIG
UUM SHUM.
ysIuMOoIg
ySdJOJ pno[g 4S10J pnojg
seinpuoH]
UIO}SOMYINOS
0} Jopeayes [1
UIO}SOMYLION,
OOIXOY|
BOBXEO UIO}Seo
“OXI BLIOIS
4
quowisid yep WIM
powour sospo
Jeraqe] “YS A
AjJo119ysod Joyrep
“‘punois yorq
UMOIQ YSIARIS
yep B uo sjods
[esiopprur
aSULIO Pry
ABI OYeTS Ye
901099
4SOIOJ
pnoyo pue
jsoIOJ pNo][D JSOIOF OM,
ODIXO|A
“BOBXEO,
usoyou
‘OXI
BLS pur
zorene
op BUIDIS
ODIXOII
“BOBXEO
usoyLou
“‘Zoreng
OP BIIDIS
spueqssolo
MOLL YIM
WRdID
oY JO por
‘poyrewuy,
punoisyoeq
OY 10
pol e uo
sorppes yeq | uMolq yIeq
SOJOJ JOM
pue ‘jso10j
yeo-ould
ySd10J pno[g
4SO1OJ
yeo-ourd
pram}
Rjewojyeny
UJO]SOM
0} ODTXOJAI
“ZNIOCIOA,
usayNos
pue sederya
WIOYWON
ODIXOII
“BOBXeO
uJOYINOS
“Ing [9p
pep
BLIOIS
sJops0q
Jolayue
uMOJG IM
weg
uvalo oyed
JO ovIyM
“‘poysreuuy)
poyewun
‘KeIS O4LIS
JO YsIuUMOIq
wed
poyewun
‘(d) ABN
S61 0-810
uMmouyuy),
{ZNIICIOA,
“edeyex
YSIMoy[oAd
WeoIg
poyseurun
‘KeI3
a]e]S 10
ysIumolg
4SO1OJ
yeo-ourd
pure solo}
pno[)
OOIXOI
“BOBXeO
jemusg
poyzewun
‘Keis
aqe]S 10
ystumolg
ySO10J
pno[)
OOTXO|
“ejqond
[e.u99-]svo
“UBpIXIWUIN?)
OP BLIIS
pue
“ZNIOVIOA,
yenuso
-]SOM
“eol[OSU0Z
OP BIIDIS
osuelo
JO YSIppoy
punoi3yoeq
osuvs0 10
pole uO
spueqssolo
Avis yIeEG
qSO1OJ
ould pue
4SO10J pNo[D
ODIXOJ
“eyqond
woyyoU
pue osjepiH
[emuso-jseo
‘TeWoTIO
ope
BLS
wealg aed
Ie][oo
yuid & YIM
oytusanf ovo
‘poyreuun
UMOIQ
-YSTARID
ySo10J pnojg
ZNIDVIOA,
[esyu99-JsoM
‘TeWUsIO
Ope VLIIIS
soUuI]]NO
Ysippe.
UHM OUT MA
sods [e19}e]
Por GUM
UoT}e10[09
[esiop Avis
aqeys yeq
91 0-C1'0
wWIQeH
donnqLysip
a1ydev.is09+)
UOT}B.10]09
TAELLCY.N
Wiayed
U01}B.10]09
[esi0g
(d) ones
yy Sug] [¥}0}
/ W)su9] [Tel
December 2021 | Volume 15 | Number 2 | e294
296
SLD]NIOUD “| luDUJanp ‘D
Ero-Z1'0
‘dnois sorseds snignp siydoay dy} JO Si1ojoeseYyd dATWeIeCUIOD 0} ADY °Z IIQuUyL
‘ou ‘ds
Jajsvsopoys ‘) smudspoydau ‘5 snpjnovuu "5 | snjoynsoajn{ 5 Paswnl) | snsous ‘5 | syvsjsory | snasnf{'5 | smiqnp ‘5 102aSUD) “D)
Amphib. Reptile Conserv.
Grunwald et al.
Fig. 4. Diagnostic characters of paratype Geophis cansecoi sp. nov. MZFZ 4437 from Los Capulines, Municipio de Yecuatla,
Veracruz, Mexico. (A) Dorso-lateral perspective in life. (B) Dorsal profile of head in life. (C) Lateral profile of head in life. (D)
Ventral profile of head in life. (E) Ventral surface of tail in life.
long and 1.0 mm wide (2.4 times as long as wide) and
right anterior chinshield 2.1 mm long and 1.0 mm wide
(2.1 times as long as wide). Left posterior chinshield 1.4
mm long and 1.0 mm wide (1.4 times as long as wide)
and right posterior chinshield 1.7 mm long and 1.1 mm
wide (1.5 times as long as wide). Three midgular scales.
Infralabials and scales in chin region smooth. Dorsal
scales in 17-17-17 rows, smooth throughout body; no
evident apical pits. Ventrals 125; cloacal plate single;
subcaudal scales paired, 34 on both sides.
Amphib. Reptile Conserv.
Coloration in life (Fig. 1). Dorsal coloration of head
and mid-dorsal region of body and tail slate gray, with
one crimson red lateral stripe on each side. The red
lateral stripe restricted to scale rows 1 and half of 2 at
one head length behind the neck, then expanding to cover
scale rows 1-3 and lower portions of 4 at mid-body, and
continuing to cover scale rows 1-3 and lower portions
of 4 above vent. Dorsal coloration of tail slate gray, and
red lateral stripe continues on scale | and half of 2 (with
some speckling on 3) on anterior half of tail, and then
December 2021 | Volume 15 | Number 2 | e294
A new Geophis species from Veracruz, Mexico
Sec. S
_™
a - _— —
Fig. 5. Diagnostic characters of paratype Geophis cansecoi sp. nov. INIRENA 2814 from Los Capulines, Municipio de Yecuatla,
Veracruz, Mexico. (A) Dorso-lateral perspective in life. (B) Dorsal profile of head in life. (C) Lateral profile of head in life. (D)
Ventral profile of head in life. (E) Ventral surface of tail in life.
Amphib. Reptile Conserv. 298 December 2021 | Volume 15 | Number 2 | e294
Grunwald et al.
Fig. 6. Paratypes of Geophis cansecoi sp. nov. in life. (A—B) MZFZ 4435; (CD) INIRENA 2812; (E) INIRENA 2814; (F) MZEZ.
ee.
ss aS at ahd
4434: all from the vicinity of Los Capulines, Municipio de Yecuatla, Veracruz, Mexico.
remnants of red lateral stripes continue on scale 1 and
parts of 2 on posterior half of the tail, with the tail tip
slate gray. The ventral coloration in life of the head and
neck is dark gray on the mental and anterior chinshields
and infralabials, light gray on the posterior chinshields,
gulars, and first 15 ventral scales, fading after the ninth
ventral. The ventral coloration on the body is white/pale
cream. The ventral scales are outlined in pink, which
represents the remnants of the red lateral stripe which
fades out on the ventrals. The pink ventral scale outlines
intensify in color towards the posterior portion of body
Amphib. Reptile Conserv.
and become wider, enclosing the pale cream coloration
present on the ventral scales; and the last three ventral
scales, as well as the cloacal plate, are crimson red.
Subcaudals are crimson red, barely outlined in white/
cream on anterior three-fourths of tail and then outlined
in slate gray on posterior eight subcaudal pairs. Tail tip is
slate gray above and below.
Coloration in preservative (Fig. 2). General
coloration bicolor. Dorsal surfaces of head, body, and tail
predominately dark gray; ventral surfaces of body and
tail predominately pale cream, with dark gray stippling
December 2021 | Volume 15 | Number 2 | e294
poyesedas
A[peolg
eos at
ps feo Pad leo]
a)
U9/ 719
fa
coal
Pl
Eel
6vvr
ZAZWN
Mexico
I
A new Geophis species from Veracruz
poywsedas | pojyeredas | pajeredos | pojeredas
A[peoig A[peoig A[peoig A[peolg
poysedas | poyesedas | poyeredas | pojeredas | pojeredas | pojeredas | poyeredas | poyeredas
bapredes SIpeord A[peoig A[peoig A[peoig A[peoig A[peoig A[peoig A[peoig A[peoig
[equoly
0} Soprs JO Joquiny
Jepnoovidns
JO YOR] 0} onp apis ON ON ON ON ON ON [ejorred
ouo uo Ajoreg SUIOVJUOD [eJUOJoIg
1O8JU09 UI [es
posny jou
pure sjeyuoTalg
eS ES Ee ee ee ee ee ee ee se ee ee
ZAZW VNAYINI | VNAMINI | VNAHAINI ZAZW ZAZW ZAZW VNAYINI | VNAMINI ZAZW ZAZW ZAZW uoumtsedg
“SUOTJLIADIQGe WIAUOINR JO SUOTIALIOSOP IOJ 1X9} 99S ‘SUdUIDadS “AOU “ds 1OJaSUDI siydoayH SUOW UOTeLILA [eINSUSU pu [eoIsSO[OYdIOp *¢ IIQUL
December 2021 | Volume 15 | Number 2 | e294
300
Amphib. Reptile Conserv.
Grunwald et al.
Fig. 7. Comparative photos of sympatric or nearly sympatric species of Geophis living in close proximity of Geophis cansecoi sp.
nov. (A) Dorsal perspective of juvenile Geophis turbidus from vicinity of El Damo, Municipio de Tenango de Doria, Hidalgo. Photo
by L. Ferndandez-Badillo. (B) Dorsal perspective of juvenile Geophis turbidus from vicinity of La Viejita, Municipio de Tenango
de Doria, Hidalgo (CIB 04451). Photo by R. Cruz-Elizalde. (C) Dorsal perspective of Geophis semidoliatus from the vicinity of
La Joya, Municipio de Tezonapa, Veracruz. UTA 52611. Photo by J.A. Campbell. (D) Ventral perspective of Geophis semidoliatus
from the vicinity of La Joya, Municipio de Tezonapa, Veracruz. UTA 52611. Photo by J.A. Campbell. (E) Dorsal perspective of
Geophis mutitorques from the vicinity of Chiconquiaco, Veracruz. CIG 1156. (F) Ventral perspective of Geophis mutitorques from
the vicinity of Chiconquiaco, Veracruz. CIG 1156.
on subcaudals, increasing towards tip of tail. Lateral
surfaces of body pale cream on first and lower portions
of second scale rows on anterior third of body, increasing
to first, second, third, and very bottom of fourth scale
rows on latter two-thirds of body. Light lateral stripe on
latter two-thirds of body variable but with slight amounts
of light salmon, remnants of the red lateral stripe in life.
Variation. Morphological variations observed on 13
specimens are as follows: MZFZ 4436-37 has only five
Amphib. Reptile Conserv.
supralabials on the right side (supralabials 3 and 4 are
fused or partially fused). Four midgulars in MZFZ 4434
and MZFZ 4449, and irregularly split in INIRENA 2816,
where it can be understood to represent either three or
four midgulars between the posterior chinshields and first
ventral. Supraocular absent on the right side of the head
in INIRENA 2811. Meristic variation is given in Table 3.
Color in life. An adult female paratype had the
following coloration. Dorsal coloration of head and
mid-dorsal region of body and tail slate gray, with one
December 2021 | Volume 15 | Number 2 | e294
Anew Geophis species from Veracruz, Mexico
4s ve 4 og Sf , <fi 2 8 2 ‘ ‘ i? * * 4 % : - .
, ba 2 - . i Sy, "Ae Lt. a.
fe Bo <q ah ‘ ad > ee ze a“ —_— = - aS : SS
Fig. 8. Comparative photos of similar species of the Geophis dubius group from southern Mexico. (A) Dorsal perspective of Geophis
dubius from the vicinity of Santa Maria Tlahuitoltepec, Oaxaca. CIG 00723. (B) Ventral perspective of Geophis dubius from the
vicinity of Santa Maria Tlahuitoltepec, Oaxaca. CIG 00723. (C) Dorsal perspective of Geophis dubius from the vicinity of La
Cumbre, Municipio de Santa Catarina Ixtepeji, Oaxaca. UTA 38826 (JAC 17793). Photo by J.A. Campbell. (D) Ventral perspective
of Geophis dubius from the vicinity of La Cumbre, Municipio de Santa Catarina Ixtepeji, Oaxaca. UTA 38826 (JAC 17793). Photo
by J.A. Campbell. (E) Dorsal perspective of Geophis anocularis from vicinity of Totontepec, Municipio de Totontepec Villa de
Morelos, Oaxaca. CIG 00725. (F) Ventral perspective of Geophis anocularis from vicinity of Totontepec Villa de Morelos, Oaxaca.
CIG 00725.
crimson red lateral stripe on each side. The red lateral
stripe restricted to scale rows | and 2 at one headlength
behind the neck, then expanding to cover scale rows
1—4 and lower portions of 5 at midbody, and continuing
to cover scale rows 1-4 and lower portions of 5 above
vent. Dorsal coloration of tail slate gray, and lateral
Amphib. Reptile Conserv.
stripe dissipates on anterior one-fourth of tail; however,
remnants of red lateral stripes continue to outline some
of the lower dorsal scales on the tail onto the anterior
three-fourths of the tail. The ventral coloration in life
dark gray on the mental and anterior portions of the
chinshields, light gray on the remaining gulars and first
December 2021 | Volume 15 | Number 2 | e294
Grunwald et al.
perspective of Geophis lorancai from the vicinity of Zongolica, Veracruz. ITSZ 025. (B) Ventral perspective of Geophis lorancai
from the vicinity of Zongolica, Veracruz. MZFC ITSZ 025. (C) Dorsal perspective of Geophis nasalis from the vicinity of
Quetzaltenango, Guatemala. UTA 20800. (D) Ventral perspective of Geophis nasalis from the vicinity of Quetzaltenango,
Guatemala. UTA 20800. (E) Dorsal perspective of Geophis rhodogaster from vicinity of Guatemala, Guatemala. UTA28347. (F)
Ventral perspective of Geophis rhodogaster from the Department of Quetzaltenango, Guatemala (UTA 22752). Photos by M.A. de
la Torre Loranca (A—B) and J.A. Campbell (C-F).
seven ventral scales, and then off white/pale cream on
the remaining ventral scales of the anterior one-third of
the body, changing to off white/pale cream with orange
outline on sides and borders on the remaining two-thirds
of body. Dorsal coloration of anterior half of tail red with
slate gray outlines on sides and borders, posterior half of
tail slate gray.
Two juvenile paratypes, a male and a female, had a
dorsal coloration of head and mid-dorsal region of body
and tail dark gray, with one crimson red lateral stripe
Amphib. Reptile Conserv.
present on each side. The red lateral stripe was confined
to scale rows | and 2 at one head length behind the neck,
expanding to scale rows 1—3 and the very bottom edge of
4 at mid-body, and reducing to scale rows 1—3 above vent.
Dorsal coloration of tail dark gray with red lateral stripes
fading out on anterior one-fourth of the tail. Ventral
coloration in life dark gray on the mental and anterior
portions of the chinshields, then light gray on the gulars
and first two ventral scales, changing to cream/off white
on the remaining ventrals. Ventrals on the latter one-third
December 2021 | Volume 15 | Number 2 | e294
A new Geophis species from Veracruz, Mexico
Fig. 10. Type locality of Geophis cansecoi sp. nov. at Los Capulines, Municipio de Yecuatla, Veracruz. (A) Exact location where
type specimen was collected. (B) General photo of type locality. (C) Decomposing log in clearing in cloud forest where several of
the type specimens were collected.
Geophis latifrontalis
0.69
Geophis occabus (MZFC-HE 25528)
Geophis turbidus (MZFC-HE 27253)
|
Geophis turbidus (MZFC-HE 27254)
Geophis dubius (MZFC-HE 27256)
I
0.57 9.997 Geophis dubius (MZFC-HE 27258)
“Geophis dubius” group | Geophis dubius (EBUAP 1966) S
1
ie Geophis dubius (MZFC-HE 27257)
Geophis juarezi (MZFC-HE 27525)
0.95 Geophis carinosus (MZFC-HE 10552)
Geophis lorancai (MZFC-HE 28405) sae
r Geophis lorancai (MZFC-HE 28404) D
Geophis cansecoi sp. nov. (MZFZ-4432) &LY
Geophis semmidoliatus (CIG 1138) ~G
Geophis omiltemanus (ENS 11496) ce F
0.80 0.99
Geophis bicolor (JAC 24684)
Geophis godmani
Rhadinaea flavilata
Fig. 11. Bayesian phylogenetic inference of several members of the Geophis dubius group based on the mitochondrial loci 16S
rRNA. Black circles represent nodes with a posterior support of 1. All nodes with support of less than 0.5 are collapsed. (A) Geophis
occabus, (B) G. turbidus, (C) G. dubius, (D) G. lorancai, (E) G. cansecoi, (F) G. semmidoliatus. Photos by Christoph I. Griinwald
(A, C, E, F), Raciel Cruz-Elizalde (B), and Miguel A. de la Torre-Loranca (D).
Amphib. Reptile Conserv. 304 December 2021 | Volume 15 | Number 2 | e294
Grunwald et al.
eophis anocularis
. Canseco! sp. nov.
. carinosus
. dubius
. duelimani
. fuscus
. Immaculatus
. juarezi
. lorancai
. rhodogaster
. rostralis
000008000000
ANA AAHAAHHAHHD
O
Q)
ry
5
=
a
Triangles represent type localities.
Fig. 12. Map showing the type localities and distribution of the Geophis dubius group members in southern Mexico and adjacent
Guatemala. Circles represent localities and triangles represent known type localities. Type localities which are not known or not
exact are not shown.
of the body on the male outlined in red. Subcaudals of the
tail red with dark gray outlines, turning completely dark
gray toward the tip of the tail.
Dentition. An adult female paratype (MZFZ 4434)
had six teeth visible and two spaces, which probably
represented missing teeth. The anterior maxillary tooth
was opposite the first supralabial. The holotype appears
to have 6—8 maxillary teeth visible; however, we did not
remove the jaw.
Distribution, habitat, and ecology. This species appears
to be restricted to the immediate vicinity of the type
locality in the Sierra de Misantla portion of the Sierra
Madre Oriental of Veracruz, Mexico (Fig. 10). It has been
collected between 1 ,550—1,763 m asl in mesic cloud forest.
Specimens were found beneath a variety of decomposing
logs, trash, and rocks, and also crossing the road at night.
All specimens were collected in the month of June.
Etymology. The specific epithet honors to Luis Canseco-
Marquez, a Mexican herpetologist who has dedicated a
portion of his career to the study of snakes of the genus
Geophis.
Amphib. Reptile Conserv.
305
Relationships of Geophis cansecoi. The final sequence
alignment consisted of 1,055 bp. The partitions and models
that best fit the data were GTR+G for the first and second
codon positions, and GTR+G+I for the third codon position.
The phylogenetic hypotheses support the morphological
data, which places G. cansecoi in the Geophis dubius group
and supports the genetic distinctiveness of this species from
other congeners in Mexico and northern Central America
(Fig. 11). In the Maximum Credibility Tree, the sequence
of Geophis from this population forms a strongly supported
clade (Pp = 1.0) with other species currently placed in
the Geophis dubius group (G. carinosus, G. dubius, G.
lorancai, G. juarezi, and G. turbidus). Furthermore, our
results suggest that Geophis cansecoi forms a strongly
supported clade (Pp = 0.97) with its sister group, which
includes G. carinosus, G. dubius, G. lorancai, and G.
Juarezi. Geophis turbidus appears to form the sister taxon to
all the remaining haplotypes of the Geophis dubius group.
Discussion
On the validity of G. fuscus Fischer, 1886. Geophis
fuscus was described by Fischer (1886) based on a
specimen collected by Mr. Kienast from “Jalapa”
December 2021 | Volume 15 | Number 2 | e294
A new Geophis species from Veracruz, Mexico
Fig. 13. Holotype of Geophis fuscus (BMNH 1946.1.6.48) from “Jalapa,” Mexico. (A) Dorsal perspective in preservative. (B)
Ventral perspective in preservative. Photos by Jeff Streicher.
(=Xalapa?), Mexico (Fig. 12). Generally, it has been
assumed that this specimen originated from near Xalapa,
Veracruz. Fischer (1886) recognized G. fuscus as being
closely related to G. dubius since the internasal scales
were fused with the prefrontals. He distinguished G.
fuscus from G. dubius, however, by having a longer
loreal scale, possessing a first pair of infralabials in
contact with each other, and having a single gular scale as
opposed to a pair of midgular scales as in G. dubius. For
the coloration, he described the ventral coloration of both
the body and tail as unmarked pure yellow, as opposed to
that of G. dubius, which he described as having a ventral
coloration peppered with brown (Fischer 1886). Bogert
and Porter (1966) considered G. fuscus conspecific with
G. dubius. They proposed that since there are numerous
towns in Mexico with the name Jalapa, including several
in Oaxaca, and the specimen might have come from
Oaxaca. However, the collector was M. Kienast-Zolly
of Zurich, Switzerland, a Swiss diplomat who lived for
many years on Pico de Orizaba, Veracruz, and made
various botanical collections, specifically of orchids, in
the immediate vicinity of his residence (Boyle 2019).
Amphib. Reptile Conserv.
Thus, a central Veracruz origin of the type specimen of
G. fuscus 1s more likely. Downs (1967) included the type
specimen of G. fuscus in his definition of G. dubius, as
he did specimens of G. rostralis, G. chalybeus, and G.
anocularis. The confusion of these related taxa as one
species by Downs (1967) renders his definition of G.
dubius inaccurate. Furthermore, Downs (1967) ignored
several of the diagnostic characters Fischer (1886) listed
in his description of G. fuscus, such as the first pair of
infralabials being in broad contact, the 49 subcaudal
scales, and the brown subcaudal coloration.
The snakes of the Geophis dubius group are very
habitat specific, and often partition mountain ranges
amongst species by habitat and rainfall. A few examples
of this pattern between closely related species can be
seen in northern Puebla, where G. turbidus inhabits
humid pine-oak woodland and pine forest, whereas
an undescribed Geophis sp. (Canseco-Marquez, Pers.
Comm.) inhabits cloud forest; in the Sierra Juarez of
Oaxaca where G. dubius inhabits moist pine-oak and pine
woodland, whereas G. duel/mani inhabits cloud forest;
and in the Sierra Mixe, Oaxaca where G. dubius inhabits
December 2021 | Volume 15 | Number 2 | e294
Grunwald et al.
moist pine-oak and pine woodland while G. anocularis
inhabits cloud forest (Pavon-Vazquez et al. 2013;
Canseco-Marquez et al. 2016; Canseco-Marquez, Pers.
Comm. ). In the portion of Sierra Madre Oriental roughly
between Xalapa, Veracruz, and the Oaxacan border, the
only member of the Geophis dubius group that has been
reported is the recently described G. lorancai, which
is restricted to cloud forest at intermediate elevations
(Canseco-Marquez et al. 2016). Whether any species of
the Geophis dubius group inhabits the moist pine-oak
and pine woodland in this region remains unknown but
should be considered likely.
We propose that the dismissal of the suggestion by
Bogert and Porter (1966) of a central Veracruz origin
of the type of G. fuscus was unwarranted. Taking into
consideration the presently known diversity of the
Geophis dubius group in the Sierra Madre Oriental, the
geographical distance between central Veracruz and the
closest known specimens of G. dubius in Oaxaca (Sierra
Mazateca) (Fig. 12), and evidence that relatively minor
morphological differences are generally indicative of
significant genetic divergence (Pavon-Vazquez et al.
2013), we consider G. fuscus as valid.
Geophis cansecoi can be readily distinguished from
G. fuscus as follows (character states of G. fuscus in
parenthesis): internasals and prefrontals separate (vs.
fused); second infralabials broadly separated (vs. in broad
contact); TL/TotL ratio in males 0.17—0.19 (vs. 0.16);
ventral scales in males 125-131 (vs. 142); subcaudal
scales in males 34—36 (vs. 49) (Fig. 13B).
Conservation of Geophis cansecoi. Despite collection
localities in two different municipalities, all known
individuals of this species originate from a radius of
about 2.5 km from the type locality, which happens to be
located near the boundary of Yecuatla and Chiconquiaco
municipalities. Extensive collection efforts and the
revision of DOR specimens above and below the type
locality failed to locate any additional specimens of
this species. We suspect that this species, while locally
abundant, might have an extremely restricted range.
Geophis cansecoi might be endemic to a narrow band
of extremely mesic cloud forest on the northern slopes
of the Sierra de Misantla, which we understand to be the
eastern-most extension of the Mexican Trans- Volcanic
Belt in Veracruz running east-west between the cities of
Misantla and Xalapa then dropping off into the Atlantic
Coastal Plain. This extremely small distribution, coupled
with moderate habitat modification at the type locality,
should merit the highest level of conservation attention
possible.
Acknowledgements.—We thank the lovely people of
Los Capulines, Veracruz, for their help in the field; Luis
Canseco-Marquez for generously tutoring us on how to
correctly measure Geophis and giving valuable insight
on the manuscript; and Jacobo Reyes-Velasco and
Amphib. Reptile Conserv.
Larry D. Wilson for help in reviewing the manuscript.
For providing photos, we thank Jonathan Campbell,
Leo Badillo, Raciel Cruz-Elizalde, and especially Jeff
Streicher who provided the highly detailed photographs
of the type specimen of G. fuscus. Biencom Real Estate,
Biodiversa A.C., and Herp.mx A.C. provided important
funding for the field work. Support for lab work and
general funding was provided by grants from Direccion
General de Apoyo al Personal Académico, Universidad
Nacional Autonoma de Mexico (PAPIIT grant number
IN-216619) and Consejo Nacional de Ciencia y
Tecnologia (CONACyT A1-S-37838) to UOGV. Permits
were issued by Secretaria de Media Ambiente y Recursos
Naturales (SEMARNAT) to UOGV.
Literature Cited
Bogert CM, PorterAP. 1966. The differential characteristics
of Mexican snakes related to Geophis dubius (Peters).
American Museum Novitates 2277: 1-19.
Boulenger GA. 1894. Catalogue of Snakes in the British
Museum (Natural History). British Museum, London,
United Kingdom. 382 p.
Boyle F. 1901. The Woodlands Orchids, Described
and Illustrated: with Stories of Orchid-Collecting.
MacMillan, London, United Kingdom. 274 p.
Burbrink FT, Lawson R, Slowinski JB. 2000. Mitochondrial
DNA phylogeography of the North American Rat
Snake (Elaphe obsoleta): a critique of the subspecies
concept. Evolution 54: 2,107—2,118.
Campbell JA, Murphy JB. 1977. A new species of
Geophis (Reptilia, Serpentes, Colubridae) from the
Sierra de Coalcoman, Michoacan, Mexico. Journal of
Herpetology 11: 397-403.
Campbell JA, Ford LS, Karges JP. 1983. Resurrection
of Geophis anocularis Dunn with comments on its
relationships and natural history. Transactions of the
Kansas Academy of Sciences 86: 38-47.
Canseco-Marquez L, Pavon-Vazquez CJ, Lopez-Luna
MA, Nieto-Montes de Oca A. 2016. A new species
of Earth Snake (Dipsadidae, Geophis) from Mexico.
ZooKeys 610: 131-145.
Downs FL. 1967. Intrageneric relationships among
colubrid snake genus Geophis Wagler. Miscellaneous
Publications Museum of Zoology, University of
Michigan 131: 1-193.
Drummond AJ, Suchard MA, Xie D, Rambaut A. 2012.
Bayesian phylogenetics with BEAUti and the BEAST
1.7. Molecular Phylogenetics and Evolution 29: | ,969—
1973:
Fetzner Jr JW. 1999. Extracting high-quality DNA from
shed reptile skins: a simplified method. Biotechniques
26(6): 1,052—1,054.
Fischer JG. 1886. Herpetologische Notizen. Abhandlungen
des Naturwissenschafilichen Vereins in Hamburg 9:
1-19.
Huelsenbeck JP, Rannala B. 2004. Frequentist properties
December 2021 | Volume 15 | Number 2 | e294
A new Geophis species from Veracruz, Mexico
of Bayesian posterior probabilities. Systematic Biology
53: 904-913.
Kumar S, Stecher G, Tamura K. 2016. MEGA7: Molecular
Evolutionary Genetics Analysis Version 7 for bigger
datasets. Molecular Biology and Evolution 33: 1,870—
1,874.
Lanfear R, Frandsen PB, Wrigth AM, Senfeld T, Calcott
B. 2016. PartitionFinder 2: new methods for selecting
partitioned models of evolution for molecular and
morphological phylogenetics analyses. Molecular
Biology and Evolution 34: 772-773.
Lips KR, Savage JM. 1994. A new fossorial snake of the
genus Geophis (Reptilia: Serpentes: Colubridae) from
the Cordillera de Talamanca of Costa Rica. Proceedings
of the Biological Society of Washington 107. 410-416.
Lis JT. 1980. Fractionation of DNA fragments by
polyethylene glycol induced precipitation. Methods in
Enzymology 65: 347-353.
Myers CW. 2003. Rare snakes—five new species from
eastern Panama: reviews of northern Atractus and
sourthern Geophis (Colubridae: Dipsadinae). American
Museum Novitates 3391: 1-47.
Nieto-Montes de Oca A. 2003. A new species of the
Geophis dubius group (Squamata: Colubridae) from
the Sierra de Juarez of Oaxaca, Mexico. Herpetologica
59: 572-585.
Pavon-Vazquez CJ, Garcia-Vazquez UO, Blancas-
Hernandez JC, Nieto-Montes de Oca A. 2011. A new
species of the Geophis sieboldi group (Squamata:
Colubridae) exhibiting color pattern polymorphism
from Guerrero, Mexico. Herpetologica 67: 332-343.
Pavon-Vazquez CL, Canseco-Marquez L, Nieto-Montes
de Oca A. 2013. A new species in the Geophis dubius
group (Squamata: Colubridae) from northern Puebla,
Mexico. Herpetologica 69: 358-370.
Pérez-Higareda G, Smith HM, Lopez-Luna MA.
2001. A new Geophis (Reptilia: Serpentes) from
southern Veracruz, Mexico. Bulletin of the Maryland
Herpetological Society 37: 42-48.
Rambaut A, Drummond AJ, Suchard M. 2014. Tracer
v1.6. Available: http://beast.bio.ed.ac.uk [Accessed: 6
December 2020].
Restrepo TJH, Wright JW. 1987. A new species of the
colubrid snake genus Geophis from Colombia. Journal
of Herpetology 21: 191-196.
Ronquist F, Teslenko M, Van der Mark P. 2012. MrBayes
3.2: efficient Bayesian phylogenetic inference and
model choice across a large model space. Systematic
Biology 61(3): 539-542.
Amphib. Reptile Conserv.
Saba) MH. 2019. Standard symbolic codes for institutional
resource collections in herpetology and ichthyology:
an online reference. Version 7.1. Available: http://asih.
org/sites/default/files/documents/symbolic_codes_
for_collections v6.5 _2016.pdf [Accessed: 21 March
2019].
Savage JM. 1981. A new species of the secretive colubrid
snake genus Geophis from Costa Rica. Copeia 1981:
549-553.
Savage JM, Watling JI. 2008. Not so rare snakes: a revision
of the Geophis sieboldi group (Colubridae: Dipsadinae)
in lower Central America and Colombia. Zoological
Journal of the Linnean Society 153: 561-599.
Smith EN. 1995. Geophis rhodogaster (Colubridae), an
addition to the snake fauna of Mexico. The Southwestern
Naturalist 40: 123-124.
Smith HM, Chiszar D. 1992. A second locality for Geophis
sallei (Reptilia: Serpentes). Bulletin of the Maryland
Herpetological Society 28: 16-18.
Smith HM, Flores-Villela O. 1993. Variation in two species
(Geophis bicolor, Geophis duellmani) of Mexican
Earth Snakes (Geophis). Bulletin of the Maryland
Herpetological Society 29: 20-23.
Smith HM, Holland RL. 1969. Two new snakes of the
genus Geophis from Mexico. Transactions of the
Kansas Academy of Sciences 72: 47-53.
Tamura K, Stecher G, Peterson D, Filipski A, Kumar S.
2018. MEGA7: Molecular Evolutionary Genetics
Analysis, version 7.0. Molecular Biology and Evolution
30: 2,725—2,729.
Townsend JH. 2009. Morphological variation in Geophis
nephodrymus (Squamata: Colubridae), with comments
on conservation of Geophis in eastern Nuclear Central
America. Herpetologica 65: 292-302.
Townsend JH, Wilson LD. 2006. A new species of snake
of the Geophis dubius group (Reptilia: Squamata:
Colubridae) from the Sierra de Omoa of northwestern
Honduras. Proceedings of the Biological Society of
Washington 119: 150-159.
Wilson LD, Townsend JH. 2007. A checklist and key to the
snakes of the genus Geophis (Squamata: Colubridae:
Dipsadinae), with commentary on distribution and
conservation. Zootaxa 1395: 1-31.
Wilson LD, McCranie JR, Williams KL. 1998. A new
species of Geophis of the sieboldi group (Reptilia:
Squamata: Colubridae) from northern Honduras.
Proceedings of the Biological Society of Washington
111: 410-417.
December 2021 | Volume 15 | Number 2 | e294
Amphib. Reptile Conserv.
Grunwald et al.
Christoph I. Griinwald is a German-Mexican herpetologist who specializes in conservation
through research in the field. Chris leads expeditions for the Herp.mx Field Team which have
resulted in numerous range extensions and state records, descriptions of 16 new species, and
re-discoveries of several “extinct” species. He has studied rattlesnakes and pitvipers for years,
and many important discoveries have involved this group. Recently, Chris has turned his focus
the poorly known Dipsadidae snakes, many of which are known from just a few specimens
and have no associated molecular data. Understanding the extent of biodiversity is crucial
to conservation, and Chris is currently making a push for collecting snakes that are difficult
to find in herpetologically under-sampled regions, such as the mountainous areas of central
Veracruz. As a co-founder of Biodiversa A.C., an anti-extinction non-profit, Chris is working on
developing a system of “micro-reservas” to help conserve the most vulnerable high-endemism
localities in Mexico.
Ivan T. Ahumada-Carrillo is a Mexican herpetologist from Guadalajara, who received
his degree from the University of Guadalajara (CUCBA) in Mexico. Currently, Ivan is an
independent investigator focusing on the biogeography of reptiles and amphibians in western
Mexico, and he has discovered dozens of range extensions and state records. He has authored
and co-authored various papers on biogeography, as well as the book Anfibios y Reptiles del
Bosque La Primavera. With an interest in wildlife photography, his work has been published
throughout Mexico in educational materials, web sites, scientific magazines, and books. Ivan
has now co-authored 12 new species descriptions, as well as numerous range extensions and
state records in Mexico.
André J. Griinwald was born in Guadalajara, Mexico in 2009. André was born into a family
of herpetologists and became the original “Herp.mx kid.” Since an early age, André has been
participating in exploratory field trips around Mexico, searching for “missing” species and
novel taxa. He has participated in numerous field trips and collected several undescribed taxa.
Currently in junior high school at Instituto Loyola in Chapala, Mexico, André has not quite
decided on his course of study, although he has already proven himself as a valuable asset
in herpetological field work. This is his first species description, and André was one of the
three people on the 2017 exploratory trip into the herpetologically un-sampled swathes of cloud
forest in the mountain ranges of central Veracruz which produced the type specimen of this new
species. He, his father, and Carlos returned to the type locality in 2019 to collect the entire type
series. Now he can’t wait to get back to Veracruz and discover another new species!
Carlos Montafio-Ruvalcaba is a biology student at the University of Colima in Mexico.
Originally from Colima, he has focused on the ecology, natural history, and conservation of
amphibians and reptiles of western Mexico. His current research efforts focus on an ex-situ
conservation project of rare, endemic, and threatened Mexican pitvipers such as Mixcoatlus
browni, Crotalus lannomi, C. ericsmithi, Ophryacus sphenophrys, and O. smaragdinus. Carlos
is one of the first biologists in the world to work with these species. Carlos is very skilled in
the lab, and he is currently participating in the descriptions of several new species of Mexican
herpetofauna. His other projects include an extended study of the ecology and natural history of
the enigmatic Long-tailed Rattlesnakes C. stejnegeri, C.ericsmithi, and C. lannomi.
Uri O. Garcia-Vazquez is a renowned Mexican herpetologist originally from Tlaxacala,
Mexico, and currently holds a professorship at the Universidad Nacional Autonoma de Mexico
on the FES-Zaragoza Campus. Uri’s research interests focus on the phylogenetic relationships
and biogeography of North American amphibians and reptiles. Having spent the last 10 years
studying the evolutionary relationships of Mexican colubrids, skinks, and gerrhonotid lizards,
Uri has authored or co-authored more than 100 publications on the herpetofauna of Mexico.
309 December 2021 | Volume 15 | Number 2 | e294
A new Geophis species from Veracruz, Mexico
Appendix 1. List of Geophis specimens examined in this study. Museum acronyms follow Sabaj (2019), except
ITSZ = Instituto Tecnologico Superior de Zongolica in Zongolica, Mexico, INIRENA = Instituto de Investigaciones
sobre los Recursos Naturales (INIRENA) of the Universidad Michoacana de San Nicolas de Hidalgo (UMSNH) in
Morelia, Mexico, and MZFZ = Museo de Zoologia, Facultad de Estudios Superiores Zaragoza, Universidad Nacional
Autonoma de Mexico. JAC, CIG, RWB, and ENS are field identifiers for un-catalogued specimens being deposited in
the MZFZ, MZFC-HE, and UTA.
Geophis anocularis (9 specimens): MEXICO: Oaxaca: CIG 00725—729, CIG 00797, MZFC-HE 11591, MZFC-HE
16178, MZFC-HE 16180.
Geophis bicolor (1 specimen): MEXICO: Michoacan: JAC 24684.
Geophis carinosus (1 specimen): MEXICO: Veracruz: MZFC-HE 10552.
Geophis cansecoi sp. nov. (15 specimens): MEXICO: Veracruz: MZFZ 4432-38, 4448-49, INIRENA 2811-16.
Geophis dubius (12 specimens): MEXICO: Oaxaca: CIG 00723-724, CNAR 6732, EBUAP 1966, MZFC-HE 13887,
MZFC-HE 16160, MZFC-HE 16193, MZFC-HE 16547, MZFC-HE 27255-258.
Geophis duellmani (4 specimens): MEXICO: Oaxaca: MZFC-HE 4525-527, MZFC-HE 5081.
Geophis fuscus (1 specimen): MEXICO: Veracruz: BMNH 1946.1.6.48.
Geophis godmani (1 specimen): COSTA RICA: Puntarenas: CAS 178126.
Geophis immaculatus (5 specimens): MEXICO: Chiapas: CIG 00786—787, CIG 01228, MZFC-HE 7259-260.
Geophis juarezi (2 specimens): MEXICO: Oaxaca: MZFC-HE 2236, MZFC-HE 27525.
Geophis latifrontalis (1 specimen): RWB 7232.
Geophis lorancai (8 specimens): MEXICO: Puebla: MZFC-HE 28404; Veracruz: ITSZ 025, ITSZ 071, ITSZ 217,
MZFC-HE 28401—403, MZFC-HE 28405.
Geophis occabus (1 specimen): MEXICO: Guerrero: MZFC-HE 25528.
Geophis omiltemanus (1 specimen): MEXICO: Guerrero: ENS 11496.
Geophis rhodogaster (4 specimens): MEXICO: Chiapas: CIG 00130, SMR 1831, SMR 1847, SMR 1873.
Geophis semidoliatus (2 specimens): MEXICO: Veracruz: CIG 01138, CIG 01375.
Geophis turbidus (8 specimens): MEXICO: Puebla: CNAR 6886-889, CNAR 8233, KU 39642, MZFC-HE 27253-—
254.
Amphib. Reptile Conserv. 310 December 2021 | Volume 15 | Number 2 | e294
Official journal website:
amphibian-reptile-conservation.org
Amphibian & Reptile Conservation
15(2) [General Section]: 311-317 (e295).
The distribution and calls of Vraem’ Treefrog, Dendropsophus
vraemi (Caminer, Mila, Jansen, Fouquet, Venegas,
Chavez, Lougheed, and Ron 2017), with comments on its
conservation status
12.*German Chavez, 7Andy C. Barboza, and *Michelle E. Thompson
‘Instituto Peruano de Herpetologia, Lima, PERU Division de Herpetologia, CORBIDI, Lima, PERU °Keller Science Action Center, Department
of Science and Education, Field Museum of Natural History, Chicago, Illinois 60605, USA
Abstract.—Dendropsophus vraemi is a recently described frog that is only known from the type locality, in La
Mar province, Ayacucho, Peru. Here, we present new data on its geographic distribution, coloration in life, and
habitat, as well as descriptions of the advertisement and aggressive calls of this species. The new localities
extend the known distribution range 151 km northwest and the elevation range down to 250 m asl, which is
nearly 450 m lower than previously known. Our findings are inconsistent with its current IUCN categorization
of Least Concern (LC), and we suggest that this species should be categorized as Data Deficient.
Keywords. Amphibia, Anura, Data Deficient, Peru, South America, vocalization
Citation: Chavez G, Barboza AC, Thompson ME. 2021. The distribution and calls of Vraem’ Treefrog, Dendropsophus vraemi (Caminer, Mila, Jansen,
Fouquet, Venegas, Chavez, Lougheed, and Ron 2017), with comments on its conservation status. Amphibian & Reptile Conservation 15(2) [General
Section]: 311-317 (e295).
Copyright: © 2021 Chavez et al. This is an open access article distributed under the terms of the Creative Commons Attribution License [Attribution
4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction in any
medium, provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced, are
as follows: official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 27 July 2021; Published: 25 December 2021
Introduction
Phylogenetic analyses have given scientists a new approach
for solving taxonomic riddles which had remained
unresolved for years. Nevertheless, a genetic approach
should not be the only basis for assigning new taxonomic
positions, but it can serve as an important tool that helps in
performing a complete and accurate analysis. Traditional
features are still important to support the establishment
of species limits and to identify species in the field and
laboratory. Researchers tend to identify amphibians using
mostly morphological and acoustic characters, and these
characteristics continue to provide strong support for
analyses of proper species diagnosis.
Dendropsophus vraemi is a recently described frog that
has been placed in the Dendropsophus leucophyllatus-
triangulum complex (Caminer et al. 2017) and the D.
leucophyllatus group by Orrico et al. (2020). Thus far,
it is only known from the type locality. This species is
genetically and morphologically distinct from any other
known Dendropsophus. It has a unique combination of
characters consisting of a pale triangular mark on the tip of
the head with its base in the interorbital area and its apex
between the nostrils, two to four marks on the sacrum,
a particular shape of marks on the dorsum (thin on the
sides), a yellowish venter, and orange or pink coloration
on the digits, webbing, axillary membranes, groin and
hidden surfaces of the arms and legs (Caminer et al. 2017).
The advertisement call of this frog is unknown, and here
we use data collected from additional field surveys to
describe the call and add new locality data which extend
the distribution of this poorly-known species.
Materials and Methods
Study area. The fieldwork was performed in two localities:
one in the middle Apurimac basin near the type locality,
and one near a small tributary of the lower Apurimac
basin (Fig. 1). Both are rural areas adjacent to the Andean
foothills of the Apurimac river basin. The habitat on both
sites consisted of temporary ponds, about 100 m from the
river, surrounded by grassy vegetation and bushes about
2 m tall. No trees or plants providing canopy shade were
recorded. Each pond was approximately 400 m? and no
more than 10 cm in depth. There were cacao, coffee, and
palm farms adjacent to the ponds.
Field sampling. We carried out fieldwork during the dry
season of September 2016 in the middle Apurimac basin,
and in May 2019 in the lower basin. We used Visual
Correspondence. *[email protected] (GC); [email protected] (ACB); [email protected] (MET)
Amphib. Reptile Conserv.
December 2021 | Volume 15 | Number 2 | e295
The distribution and calls of Vraem’ Treefrog
—)
oO
oO
N
——
Colombia
14°0'0"S
co
Bolivia
7
Elevation (m)
> 5000
O New localities
A Type locality
Major rivers
50 100
Pe
Fig. 1. Geographic distribution map for Dendropsophus vraemi showing the type locality (green triangle; Caminer et al. 2017) and
new localities in the middle and lower Apurimac basin (yellow circles), extending the range by 151 km to the northwest.
Encounter Surveys (Crump and Scott 1994) to survey
amphibians at night. Photographs taken in the field were
used for descriptions of coloration in life. The specimens
collected from the two localities were fixed in 10%
formalin and then stored in 70% ethanol under the permit
RD-414-2016-SERFOR/DGGSPFFS. We recorded calls
with a Marantz PMD-222 professional recorder coupled
to a Sennheiser MS 907 unidirectional microphone (13
September 2016; air temperature 27 °C). Recordings
and voucher specimens are deposited at Division de
Herpetologia - CORBIDI, Lima, Peru.
Call analysis. Recordings were digitized at a resolution
of 16 bits, with a 44,100 hz sampling rate. To allow for
direct comparisons with other related species, we followed
the call parameters used by Caminer et al. (2017): call
duration(s), number of notes per call, rise time of the
call(s), number of pulses per call, note duration(s), number
of pulses per note, distance between notes, average of the
dominant frequency call (Hz), and frequency bandwidth
(Hz). For the purpose of analyzing the call of D. vraemi,
we defined frequency bandwidth as 90% bandwidth.
We analyzed calls with a Fast Fourier Transformation
window of 1,024 points and the Hann algorithm, all other
parameters used default settings in Raven Pro 1.5 (Cornell
Lab of Ornithology, Ithaca, New York, USA). Oscillogram
and spectrogram figures were produced using the packages
seewave (Sueur et al. 2008), tuneR (Ligges et al. 2018),
and ggplot2 (Wickham 2016) in R version 3.5.1 (R Core
Team, 2018) with a Fast Fourier Transformation window
Amphib. Reptile Conserv.
length of 1,024, and overlap of 90. We followed Toledo
et al. (2015) to classify the advertisement and aggressive
calls, Kohler et al. (2016) and Caminer et al. (2017) to
describe call characteristics, and Kohler (2012) for the
description of the color pattern.
Results
On 13 September 2016, German Chavez (GC) and Andy C.
Barboza (ACB) caught three male individuals (CORBIDI
1789395, Fig. 2), in the vicinity of San Antonio, La Mar
province, Ayacucho, Peru (12°55’46.8”S, 73°32’3.3”W;:
693 m asl), middle basin of Apurimac River (hereafter
referred to as the middle Apurimac basin) and only 5 km
from the type locality. On 4 May 2018, GC caught two more
males (CORBIDI 21857-58, Fig. 2E—H), in Boca Kiatari
Native Community, Satipo province, Junin department,
Peru (11°31°38.9"S, 74°24°40.2”W; 210 m asl), lower
basin of Apurimac river (hereafter referred to as the lower
Apurimac basin). The characteristics of all individuals
match the morphological features described by Caminer et
al. 2017 (see Fig. 2), however we noted some variations in
the measurements and dorsal coloration which are detailed
in Table 1 and also described below. These new records
add two localities and extend the distribution range of D.
vraemi by 151 km to the northwest (Fig. 1).
At both localities, the captured individuals were calling
from the water at night between 1900 and 2000 h (the
water level did not pass over their heads) in ephemeral
flooded areas (approximately 400 m7”), covered by
December 2021 | Volume 15 | Number 2 | e295
Chavez et al.
Fig. 2. Dorsolateral and ventral views of Dendropsophus vraemi in life. A-B: CORBIDI 17894 (SVL = 26.4 mm); C-D: CORBIDI
17895 (SVL = 26.1 mm); E—F: CORBIDI 21857 (SVL = 22.8 mm); G-H: CORBIDI 21858 (SVL = 22.9 mm).
Amphib. Reptile Conserv. 313 December 2021 | Volume 15 | Number 2 | e295
The distribution and calls of Vraem’ Treefrog
Table 1. Descriptive statistics of the morphological
measurements (in mm) of Dendropsophus vraemi from two
new localities in the lower (CORBIDI 21857—58) and middle
(CORBIDI 17893-95) Apurimac River basin. Descriptive
statistics indicate mean + standard deviation and range.
Boca Kiatari,
San Antonio, middle
lower Apurimac basin
Apurimac basin (n = 3)
(n=2)
SVL 26.0 + 0.5 (25.4—26.1) 22.8-22.9
HL 7.3 £ 0.1 (7.2-7.5) 7.2-7.3
HW 7.9+0.1 (7.8-8.1) 7.0-7.3
TL 13.0 = 0.2 (12.7-13.1) 11.6-11.6
FL 11.8 + 0.8 (10.9-12.5) 9,.9-10.2
Femur length 12.4+40.1 (12.2-12.5) 10.5-10.8
Hand length 7.6 + 0.3 (7.3-8.0) 7.2-7.4
HL/SVL 0.2 + 0.0 (0.2-0.2) 0.3-0.3
HL/HW 0.9 + 0.0 (0.9-0.9) 0.9-1.0
HW/SVL 0.3 + 0.0 (0.3-0.3) 0.3-0.3
TL/SVL 0.5 + 0.0 (0.4-0.5) 0.5-0.5
FL/SVL 0.4 + 0.0 (0.40.4) 0.40.4
herbaceous vegetation and small bushes. In both sites, our
Specimens were part of a larger chorus of males (~15—20
males, GC field notes). The distance between males
was approximately 50-80 cm, and the only frog species
recorded in sympatry with D. vraemi were in the genus
Leptodactylus.
We recorded two types of calls, all from one male
in the middle Apurimac basin (CORBIDI 17894): 1)
the advertisement call, in two different variations (Fig.
3 A-B), and 2) the aggressive call (Fig. 3C). The first
variation of the advertisement call consists of two pulsed
notes with a call duration of 0.70 s, 106 pulses per call, a
call rise time of 0.09 s, an average dominant frequency
of the call of 2,258.37 Hz, and a frequency bandwidth of
750.00 Hz, without a secondary note type. The second
variation of the advertisement call has a duration of 1.24
s, consists of three pulsed notes with an average dominant
frequency of call of 2,431.51 Hz, a call rise time of 1.05
s, and frequency bandwidth of 937.50 Hz. The aggressive
call has a duration of 1.53 s, consists of three pulsed notes
with an average dominant frequency of call of 2,269.44
Hz, a call rise time of 0.39 s, and frequency bandwidth of
750.00 Hz, without a secondary note type. For details of
the call variables and comparisons with other species of
the Dendropsophus leucophyllatus-triangulum complex
(sensu Caminer et al. 2017), see Tables 2 and 3.
We also found some phenotypic differences between
the two specimens collected from the lower Apurimac
basin (CORBIDI 21857—-58, Boca Kiatari Native
Community, Junin department), and the three specimens
collected from the middle Apurimac basin (CORBIDI,
17893-95). First, specimens from the lower Apurimac
basin have a smaller SVL than specimens from the middle
Apurimac basin (SVL range lower Apurimac = 22.8—22.9
mm; middle Apurimac = 25.4—26.1 mm; Table 1). Second,
Amphib. Reptile Conserv.
Frequency (kHz)
Frequency (kHz)
8
7
6
<)
4
3
2
1
Or
0.0 02 0.4 06 08 10 12 Ba
Time (s)
‘@)
Frequency (kHz)
O-NWAOOD N OO
0.00.20.406081 0 1 21 ve 64 8
Time (s)
Fig. 3. Spectrograms and oscillograms for Dendropsophus
vraemi. A—B: variations of the advertisement call; C: an
aggressive call. A, B and C are call variations from a single
male individual (CORBIDI 17894) recorded in the middle
Apurimac basin.
December 2021 | Volume 15 | Number 2 | e295
Chavez et al.
the lower Apurimac specimens have a yellow background
color pattern in life, which is an addition to the range of
background colors described by Caminer et al. (2017).
The male CORBIDI 17894 from the middle Apurimac
basin has a creamy yellow dorsal background, but not
properly yellow. Third, the dorsolateral bands in lower
Apurimac basin specimen CORBIDI 21857 are weakly
differentiated from the dorsum background, having mostly
a yellowish background inside the band. Last, the iris in
both lower Apurimac individuals is bronze-yellow and not
gray bronze as in the type series and in our specimens from
the middle Apurimac basin.
Frequency
bandwidth (Hz)
843.75 (750.00—
530.32 + 113.7
(301.4-663.2)
487.67 + 75.06
705.98 + 112.5
(574.2-843.7)
478.34 + 113.54
(281.2-646.0)
(2,101.0-3,070.7)
Average of the dominant
frequency call (Hz)
2,344.94 (2,258.37-
2,748.69 + 162.89
(2,453.9-2,914.1)
2,655.37 + 169.42
(2,416.3-2,876.1)
2,992.39 + 100.80
(2,888.33, 128.6)
2,456.43 + 278.91
Discussion
Distance
notes(s)
0.18 + 0.08
(0.11-0.26)
0.046 + 0.006
(0.03-0.05)
0.042 + 0.004
(0.03—-0.04)
0.051 + 0.007
(0.04—0.06)
The specimens reported here confirm that this species
occurs in the Andean foothills to the west of the Apurimac
River by an extension of at least 151 km northeast of the
type locality. The presence of D. vraemi on the eastern side
of the river remains uncertain. However, we believe that
the lack of records to the east of the river likely reflects
the scarcity of fieldwork performed in those areas instead
of the possible role of the Apurimac as a riverine barrier.
The Apurimac river causes geographic separation in some
birds in its upper basin (Hosner et al. 2015), where canyons
and dry forests create a rough topography. Otherwise,
this phenomenon is uncommon in the lower areas where
tropical rainforest and a flat relief is the dominant habitat
on both sides of the river. Similar ecosystems have already
been reported as semi-permeable barriers in Amazon
lowlands (Moraes et al. 2016). Therefore, we suggest that
further field surveys are necessary to confirm the presence
of D. vraemi on the eastern side of Apurimac River. The
new records also indicate that this species inhabits areas
as low as 250 m asl, nearly 450 m lower than previously
known (Caminer et al. 2017). Furthermore, the ecosystem
is the same as that of the type series: the eastern Andean
foothills.
Compared to the other species in the D. /eucophyllatus-
triangulum complex, the mean duration of the
advertisement calls of D. vraemi is 0.80-0.62 s longer than
the mean duration of the advertisement calls of the other
species. The one aggressive call of D. vraemi analyzed is
1.39-0.94 s longer than the mean duration of aggressive
calls of other species (Table 2). The longer duration is
a consequence of both longer note durations and longer
distances between notes. The average of the dominant
frequency of the advertisement call of D. vraemi tends to
be lower than those of other species described by Caminer
et al. (2017), and only overlaps the lower range of D. arndti
and D. triangulum for this call characteristic. Likewise, the
average of the dominant frequency of the aggressive call
appears to fall within the lower bounds of the range for the
species (Tables 2 and 3).
Our measurements indicate that middle Apurimac
basin specimens fall within the type series SVL range
(25.1-27.6 mm), whereas the specimens from lower
Number of
pulses of the
type II note
3.85 + 0.45
(3.60-4.25)
5.56+ 0.47
3.75 +0.52
Type II note duration
0.027 + 0.007
(0.01-0.004)
0.039 + 0.004
(0.03-0.04)
0.034 + 0.007
(0.023—-0.042)
Number of
pulses of the
type I note
54.60 + 7.64
12.19+0.91
(10.8-13.8)
17.44 + 1.23
(15.6-19.0)
13.5541.18
(12.6-17.0)
15.724 2.24
(13.0-20.2)
Type I note
duration(s)
0.28 + 0.03
(0.23-0.31)
0.2 + 0.02 (0.16—
0.1 £0.01 (0.08-
0.15 + 0.02
(0.12-0.18)
26
S
=)
a
on
S
i)
+H
“4
>)
Number of
pulses per call
136.50 (106—
16.49 + 1.94
17.44 + 1.23
30.39 + 2.75
20.92 + 3.39
Rise time of
the call(s)
0.57 (0.09-
0.08 + 0.04
(0.05—0.15)
0.12 + 0.08
(0.03—0.29)
0.18 + 0.01
(0.18-0.19)
0.13 + 0.03
(0.09-0.17)
Number of
notes per call
(2-3)
2.10+0.16
405+0.33
2.33 + 0.52
Call duration(s)
0.97 (0.70-1.24)
0.17 + 0.02
(0.16—0.22)
0.19+ 0.02
(0.16—0.23)
0.35 + 0.05
(0.27-0.39)
0.26 + 0.04
(0.22-0.36)
=9)
Dendropsophus vraemi
Dendropsophus
leucophyllatus (n
Dendropsophus arndti
Dendropsophus reticulatus
Dendropsophus triangulum
Table 2. Descriptive statistics of the advertisement call of Dendropsophus vraemi (this study) and species in the D. /eucophyllatus-triangulum complex (Caminer et al. 2017). Descriptive
statistics are indicated as mean + | SD and range in parentheses.
Amphib. Reptile Conserv. 315 December 2021 | Volume 15 | Number 2 | e295
The distribution and calls of Vraem’ Treefrog
Apurimac are smaller (see Table 1). Furthermore, the
color pattern variation that we found slightly increases the
range of background colors described for the species (from
brown or gray to yellow). Therefore, we suggest that the
coloration patterns vary geographically. Unfortunately,
females have not been found thus far, and consequently
their coloration remains unknown.
According to Caminer et al. (2017), males of the
type series of D. vraemi were perched on leaves of the
vegetation alongside a stream. However, we spotted
them on the ground in small temporary ponds partially
covered by water. It is important to mention that the
ponds in our surveys lacked trees and only herbs or small
bushes were present, which suggests that this species
can vary its perching places depending on the habitat it
occupies. Our observations suggest that this species can
inhabit disturbed areas that lack canopies. Despite its
tolerance to disturbance, our findings are inconsistent with
the current IUCN Least Concern (LC) categorization.
The small known area of occurrence (only known from
three localities no more than 150 km apart) and lack of
information on abundance leads us to recommend that this
species should be placed into the Data Deficient category
of the IUCN Red List, as previously recommended by
Caminer et al. (2017).
Frequency
bandwidth (Hz)
548.96 + 101.28
(469.4689. 1)
423.26 + 64.73
(335.9-516.8)
735.46 + 120.51
427.4 + 187.34
(281.2-689.1)
Average of
the dominant
frequency call (Hz)
2,269.44
2,615.82 + 196.39
(2,326.6-2,811.9)
2,668.76 + 111.64
(2,485.2—2,830.3)
2,832.05 + 106.24
(2,675.2-2,924 1)
2,411.74 + 349.62
(2,085.0—2,968.3)
Distance between
notes(s)
0.25 (0.24-0.26)
0.036 + 0.004
(0.029-0.040)
0.02 + 0.011
0.005 + 0.004
0.027 + 0.006
55.67 + 8.50
5.01 + 0.36
3.84 + 0.40 (3.13-
5.32 + 0.53
4.66 + 0.35
Number of pulses
Acknowledgments.—We thank SERFOR’s staff for
providing the collection permits. Our work would not
have been possible without the exceptional support
of Consultores Asociados en Naturaleza y Desarrollo
(CANDES) and Programa de Monitoreo Buiologico
COGA who trusted German Chavez to lead the fieldwork.
German Chavez thanks the Cornell Lab of Ornithology
for providing the equipment needed to record the calls
analyzed in this work. German Chavez is also deeply
grateful to Clever LLagas, John Vara-Huillca, Hatzel
Ortiz, Lourdes Duran, and Paola Martinez, who helped
him in the geographical location of the sampling site and
with logistics.
Note duration(s)
0.35 +0.100
(0.26-0.47)
0.033 + 0.004
(0.027—-0.038)
0.035 + 0.006
(0.024—0.042)
0.038 + 0.003
0.036 + 0.005
(0.034—0.041)
22-bP#3.71
19.81 + 1.66
19.96 + 4.14
11.60 + 1.13
nN
oO
Az)
=]
jor
Gey
jo)
tol
oO
ae)
S|
=
Zz
Rise time of the
0.15+0.15 (0.04—
0.07 + 0.02 (0.03—
0.38 + 0.13 (0.24—
0.14+ 0.02 (0.11-
Literature Cited
Caminer MA, Mila B, Jansen M, Fouquet A, Venegas PJ,
Chavez G, Lougheed SC, Ron SR. 2017. Systematics
of the Dendropsophus leucophyllatus species complex
(Anura: Hylidae): cryptic diversity and the description
of two new species. PLoS ONE 12(4): e0171785.
Crump ML, Scott NJ Jr. 1994. Visual encounter surveys.
Pp. 84-94 In: Measuring and Monitoring Biological
Diversity: Standard Methods for Amphibians. Editors,
Heyer RW, Donnelly MA, McDiarmid RW, Hayek LC,
Foster MS. Smithsonian Institution Press, Washington,
DC, USA. 364 p.
Hosner PA, Andersen MJ, Robbins MB, Urbay-Tello A,
Cueto-Aparicio L, Verde-Guerra K, Sanchez-Gonzalez
LA, Navarro-Siguenza AG, Boyd RL, Nufiez J, et al.
2015. Avifaunal surveys of the Upper Apurimac River
Number of notes
3.96 + 0.64 (3-5)
3.03 + 0.08 (3-4)
4.11 +0.72 (3-5)
4.25 +0.23 (4-5)
Call duration(s)
0.25 + 0.05 (0.18—
0.14+0.01 (0.12-
0.16)
0.59 + 0.11 (0.48-
0.24 + 0.03 (0.19—
Dendropsophus
vraemi (n= 1)
Dendropsophus
leucophyllatus (n
5)
Dendropsophus
arndti (n= 7)
Dendropsophus
reticulatus (n = 5)
Dendropsophus
triangulum (n= 5)
Table 3. Descriptive statistics of the aggressive calls of Dendropsophus vraemi (this study) and species in the D. /eucophyllatus-triangulum complex (Caminer et al. 2017). Descriptive statistics
indicate mean + | SD and range in parentheses.
Amphib. Reptile Conserv. 316 December 2021 | Volume 15 | Number 2 | e295
Chavez et al.
Valley, Ayacucho and Cuzco Departments, Peru: new
distributional records and biogeographic, taxonomic,
and conservation implications. The Wilson Journal of
Ornithology 127: 563-581.
Kohler G. 2012. Color Catalogue for Field Biologists.
Herpeton, Offenbach, Germany. 49 p.
Kohler J, Jansen M, Rodriguez A, Kok PJR, Toledo LF,
Emmrich M, Glaw F, Haddad CFB, Rodel MO, Vences
M. 2017. The use of bioacoustics in anuran taxonomy:
theory, terminology, methods, and recommendations
for best practice. Zootaxa 4251: 1-124.
Ligges U, Krey S, Mersmann O, Schnackenberg S. 2018.
tuneR: analysis of music and speech. Available: https://
CRAN.R-project.org/package=tuneR.
Moraes LJCL, Pavan D, Barros MC, Ribas CC. 2016. The
combined influence of riverine barriers and flooding
gradients on biogeographical patterns for amphibians
and squamates in south-eastern Amazonia. Journal of
Biogeography 43: 2,113-2,124.
R Core Team. 2018. R: a language and environment for
statistical computing. R Foundation for Statistical
Computing, Vienna, Austria. Available: https://www.R-
project.org/.
Sueur J, Aubin T, Simonis C. 2008. Seewave: a free
modular tool for sound analysis and_ synthesis.
Bioacoustics 18: 213-226.
Toledo LF, Martins IA, Bruschi DP, Passos MA, Alexandre
C, Haddad CFB. 2015. The anuran calling repertoire in
the light of social context. Acta Ethologica 18: 87-99.
Wickham H. 2016. ggplot2: Elegant Graphics for Data
Analysis. Springer-Verlag, New York, New York, USA.
260 p.
Amphib. Reptile Conserv.
German Chavez is a Peruvian scientist who has been working on the diversity and
conservation of amphibians and reptiles in Peru since 2006. His research interests include
the systematic and biogeography of both the Andean and Amazonian herpetofauna. These
studies have resulted in the publication of 39 scientific articles describing new species of
frogs, lizards, and snakes, and reporting several species inside Peruvian territory for the first
time. Currently, he is an Associated Researcher at the Instituto Peruano de Herpetologia and
Division de Herpetologia-CORBIDI in Lima, Peru.
Andy C. Barboza is a Peruvian scientist who graduated in Biological Sciences from
Universidad Nacional de Trujillo, La Libertad, Peru, in 2012. She currently collaborates
with the Herpetology Collection of the Centro de Ornitologia y Biodiversidad (CORBIDI),
increasing her deep interest in amphibians. For her undergraduate thesis, she worked on
the composition and altitudinal distribution of amphibians from Otishi National Park, in
collaboration with the Missouri Botanical Garden (GMB). Her current research interests
focus on the systematics, diversity, and conservation of Neotropical herpetofauna,
particularly in Peru, as well as the evolutionary responses and behavior of amphibians due
to climate change.
Michelle E. Thompson is a Conservation Ecologist/Herpetologist on the Rapid Inventory
team at the Field Museum of Natural History in Chicago, Illinois, USA. She is interested
in the application of population and community ecology to species conservation and
understanding the patterns of diversity and distributions of tropical amphibians and reptiles.
317 December 2021 | Volume 15 | Number 2 | e295
Official journal website:
amphibian-reptile-conservation.org
Amphibian & Reptile Conservation
15(2) [General Section]: 318-322 (e296).
The highly variable release call of the missing
Northern Darwin’s Frog, Rhinoderma rufum
12.3José M. Serrano, ‘Gabriel Bidart-Enriquez, and '*Mario Penna
'Programa de Fisiologia y Biofisica, Facultad de Medicina, Universidad de Chile, Independencia 1027, 8380453, Santiago, CHILE *ONG Ranita
de Darwin, Santiago, CHILE *Laboratorio de Comunicacion Animal, Vicerrectoria de Investigacion y Postgrado, Universidad Catélica del Maule,
San Miguel 3605, 3480112, Talca, CHILE
Abstract.—The release calls of Rhinoderma rufum (Philippi 1902) are described quantitatively based on
recordings of four males of this species obtained in 1981 from a population in central Chile. This record
corresponds to the last scientific sighting of the species. The release calls of R. rufum consist of sequences
of complex notes containing harmonics and non-linear phenomena, with chaos segments and highly variable
acoustic properties. This characterization expands the acoustic repertoire of this endemic and likely extinct
species, and contributes to differentiating it from the extant congeneric R. darwinii.
Keywords. Anurans, bioacoustics, central Chile, endemic, endangered species, non-linear phenomena, vocalization
Citation: Serrano JM, Bidart-Enriquez G, Penna M. 2021. The highly variable release call of the missing Northern Darwin’s Frog, Rhinoderma rufum.
Amphibian & Reptile Conservation 15(2) [General Section]: 318-322 (e296).
Copyright: © 2021 Serrano et al. This is an open access article distributed under the terms of the Creative Commons Attribution License [Attribution
4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction in any
medium, provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced, are
as follows: official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 6 December 2020; Published: 21 December 2021
Introduction
The release calls of anurans are signals that allow
rejection of unwanted amplexus and may also have an
anti-predator function (Kohler et al. 2017). In addition,
empirical evidence in several anuran species suggests that
release calls play an important role in sexual recognition
(Aronson 1943; Bowcock et al. 2008; Liao and Lu 2009;
Penna and Veloso 1981). The acoustic properties of
release calls have been shown to have a phylogenetic
footprint (di Tada 2001; Forti et al. 2018), and therefore
the characterization of these signals contributes highly
relevant knowledge for endangered species (Marquez et
al. 2018; Stanescu et al. 2019).
Rhinoderma is an anuran genus endemic to the
temperate forests of southern South America in Chile
and Argentina, and a symbolic entity of the current global
amphibian extinction crisis (Azat et al. 2021). Two
species of Darwin’s Frog are currently recognized: the
northern species, Rhinoderma rufum, which is probably
extinct, as the last report of living specimens dates back
to 1981 (IUCN SSC Amphibian Specialist Group 2015),
and the southern species, Rhinoderma darwinii, which 1s
threatened mainly by habitat loss and chytridiomycosis
(IUCN SSC Amphibian Specialist Group 2018). The
recognition of two distinct species in Rhinoderma
remains an unresolved debate due to the disappearance
of the northern species, R. rufum. In this regard, Donoso-
Barros (1970) considered that the phenotypic differences
do not validate the distinctive status of the two species, but
other authors have argued that dissimilarities regarding
the distribution, reproductive behavior, and morphology
differentiate the two species of the Rhinoderma genus
(Cei 1958; Formas et al. 1975; Formas 2013).
Very little is known about the acoustic signals
produced by these two species of Rhinoderma. In 1990,
a description of the advertisement calls of both species
was published (Penna and Veloso 1990). These authors
reported that the calls of R. darwinii had a smaller number
of notes, lower dominant frequency, and shorter duration
of calls and notes relative to those of R. rufum. However,
this description was based in only four and eight
individuals of R. darwinii and R. rufum, respectively.
Audio recordings of these calls are available in Penna
(2005). More recently, Serrano et al. (2020) reported a
comprehensive analysis of geographical variation of the
advertisement calls of R. darwinii.
Unsuccessful efforts implementing traditional visual
and acoustic surveys have been carried out with the
purpose of finding historic populations of the Critically
Endangered Northern Darwin’s Frog, R. rufum (Bourke
et al. 2012; Cuevas 2014; Soto-Azat et al. 2013). The last
record of the species dates back to 1981, as documented
by the capture of four males near the locality of Paredones
in Central Chile (34°38739.6’S 71°54°15.8’°W) by
Nelson Diaz. These individuals were transported to the
Correspondence. *[email protected] (MP), [email protected] (JMS), gabriel. [email protected] (GBE)
Amphib. Reptile Conserv.
December 2021 | Volume 15 | Number 2 | e296
Serrano et al.
Faculty of Medicine of the University of Chile, where
one of us (MP) recorded their release calls at that time.
Morphometric data for these specimens are not available.
In this manuscript, we describe those recordings of the
release calls of R. rufum, about 40 years after they were
obtained.
Materials and Methods
The release calls were prompted by gently finger-
pressing the flanks of the individuals. The soft sounds
produced were recorded using an omnidirectional
microphone (UHER M517) and a magnetic tape recorder
(UHER 4400 Report Stereo IC) under laboratory
conditions, at an air temperature of 20 °C. In December
2018, the tapes of the recordings were digitized in WAV
format with a sampling rate of 44,100 Hz at 24 bits.
As making the acoustic signals of Endangered species
available in curated collections of animal sounds is a
highly recommended resource, following Toledo et al.
(2015), the digitized recordings of the release calls of
R. rufum were deposited in the Fonoteca Zoologica of
the Museo Nacional de Ciencias Naturales (CSIC, FZ
Sound Code: 12943). To eliminate interference caused
by low frequency noise from the original recording, a
digital band-stop filter from 0 to 400 Hz was applied to
the digital recordings. Three temporal variables were
analyzed focusing on the succession of notes typically
composing a release call (Kohler et al. 2017), as follows:
total number of notes, note rate (number of notes / time
from first note onset to last note offset), and note duration.
The following spectral variables were also analyzed: for
notes in which a harmonic structure was evident, the
highest and lowest frequency for the first three harmonic
Frequency (KHz)
Amplitude
0.5
15
1.0
Time (s)
0.0
Frequency (KHz)
Amplitude
segments (Hz) were measured. In addition, in the notes
that lacked harmonics and contained only chaos, the
center frequency (i.e., the one having the largest energy
content) of the spectrum was measured. Finally, chaos
proportion (“% of the duration of chaos segments relative
to total note duration) was calculated for notes in which
this non-linear phenomenon occurred (following Serrano
et al. 2020). The acoustic analysis was made using the
software Raven Pro 1.4 (Cornell Lab of Ornithology,
Bioacoustics Research Program, Ithaca, New York, USA)
making manual selections. Spectral parameters were
obtained with a fast Fourier transform and a Hanning
window of 256 points, the settings used by Kohler et
al. (2017). The means and coefficients of variation
(CV = 100 x SD/mean) were calculated for all notes
recorded from each of the individuals. Oscillograms and
spectrograms were obtained using the package Seewave
in R (Sueur et al. 2018).
Results and Discussion
The release call of R. rufum consists of mid-pitched
squeaks repeated in sustained trains at the beginning of
the manipulation, and the emission rate decays thereafter
to isolated notes, resuming a high rate when the flanks
are pressed again during handling. The notes have a
mixed harmonic and chaotic composition. The harmonic
portions are frequency modulated, having ascending-
descending, ascending, or descending patterns, and the
dominant frequency usually corresponds to the second
harmonic (Fig. 1A). One individual was quite responsive,
producing a total of 131 notes, and the other three were
less active, producing 70, 13, and 17 notes in total (Table
1). Forty-three percent of recorded calls consisted of
1.5
1.0
Time (s)
0.0 0.5
Fig. 1. Spectrograms and oscillograms of multi-note release calls emitted by males of Rhinoderma rufum. Two representative calls
are shown, one having mainly harmonic structure (A, individual | in Table 1) and another having mainly chaotic structure (B,
individual 2 in Table 1). Sample rate: 44.1 kHz, frequency bandwidth: 20 Hz. The oscillograms and spectrograms were obtained
using the package Seewave (Sueur et al. 2018).
Amphib. Reptile Conserv.
319
December 2021 | Volume 15 | Number 2 | e296
Release call of Rhinoderma rufum
Table 1. Means, ranges (in parentheses), and coefficients of variation among individuals (CV, expressed as the percentage) for the
acoustic characteristics in the release calls of Rhinoderma rufum. Center frequency was measured in the chaos components of the
notes. Abbreviations: Hf highest frequency; Lf lowest frequency, of the three first harmonics. CV: coefficient of variation.
: Individuals
Acoustic | VIdU, Niean cy
characteristics 1 2 3 4
Number of notes 131 70 13 17
Number of calls 49 32 8 6
Notes per call in 3.73 3.11 2.67 5.2 34 110.2
multi-note calls (2-13) (2-10) (2-3) (2-5)
Note rate (notes/s) 44 4.35 3.84 4.12 436 32.9
in multi-note calls (1.78-7.30) (2.35-7.81) (2.26-5.09) (2.65—-5.39)
Note duration (s) 0.09 0.068 0.081 0.047 08 52.8
(0.023-0.202) (0.020-0.139) (0.014—0.135) (0.020-0.097)
Hfl (Hz) 798 842 873 768 817 30
(474-1,895) (474-1,292) (560-1,249) (517-1,249)
Lfl (Hz) 611 624 689 668 628 30
(474-1,637) (474-947) (517-1,034) (517-1,120)
Hf2 (Hz) 1,490 1,581 1,600 1,467 1.530 312
(689-3,661) (947-2,412) (1,120-2,110) (947-2,412) Z
Lf2 (Hz) 1,163 13227 1,327 1,299 1.213 347
(646-3,747) (732-1,895) (991-1,938) (991—2,239) ;
HB (Hz) 2,058 2,353 2,498 2135 2710 9
(1,034—3,488) (1,335-3,488) (1,593-3,661) (1,335-3,618)
LB (Hz) 1,601 1,861 1,961 1,923 1.758 176
(991—2,885) (1,120-2,967) (1,464—3,144) (1,464—3,316) °
Center frequency 1,196 1,375 1,142 1,180 1.238 32.2
(Hz) (474—2,067) (517-1,938) (1,120-1,163) (1,120-1,335) °
Chaos (%) 73 4] 30.1 74 68 A7A
(9-100) (14-100) (18-55) (29-100)
single notes. Multiple-note calls had two to 13 notes.
The note rate calculated for multiple-note calls ranged
from 1.78 to 7.81 notes/s. Note durations measured for
all the notes produced by the four individuals ranged
between 0.014 and 0.202 s. Segments with harmonic
components occurred in 54% of the notes, and 97% of the
notes contained non-linear segments identified as chaos
phenomena. For the harmonic segments, the frequencies
of the first, second, and third harmonics ranged between
474—1,895, 646—3,747, and 991—3,661 Hz, respectively,
and the center frequency in notes with non-linear
phenomena ranged from 474 to 3,618 Hz. The proportion
of chaos segments ranged from 9—100% in the notes that
contained these components. All acoustic characteristics
measured were highly variable among individuals, the
temporal characteristic with the lowest CV was note
rate (32.9%), and the number of notes per call had the
highest CV (110.2%) (Table 1). The harmonic spectral
characteristics had CVs ranging from 27.6 to 34.2% and
the non-linear spectral characteristics had CVs of 32.2%
and 47.4%.
The large variation in the number of release calls of
R. rufum and the dynamic character of their acoustic
properties suggest that their occurrence 1s likely
influenced by motivation or stress levels of the animals
(Blumstein and Chi 2012; Moreno-Gomez et al. 2015). In
Amphib. Reptile Conserv.
addition, the high variability of the acoustic properties of
these release calls argues against the potential relevance
of these signals in individual recognition, as occurs for
advertisement calls in other anurans (Feng et al. 2009;
Serrano et al. 2020). In the advertisement call of R.
darwinii, the variation of non-linear components has been
reported to be related with the SVL size of these frogs,
with chaos being inversely related to the emitter’s size
(Serrano et al. 2020). However, relationships of this kind
could not be evaluated in R. rufum due to the low number
of individuals recorded and the lack of morphometric
measurements for these individuals.
Considering the conservation status of the genus
Rhinoderma and the discussion regarding the validity of
the two recognized species, it is relevant to acknowledge
that R. darwinii issues release calls in response to tactile
stimulation but not consistently. For example, continental
populations of this species produce only single-note
release calls when being handled (A. Valenzuela-
Sanchez, Pers. Comm.), but individuals from the island of
Chiloé very rarely produce these kinds of vocalizations.
As such, comparing the release calls produced by R.
darwinii would provide further evidence for behavioral
differences between the Rhinoderma species. The results
of an ongoing study comparing the advertisement calls
of both species show that these signals are rather similar,
December 2021 | Volume 15 | Number 2 | e296
Serrano et al.
not contributing to the assignment of a specific status to
both taxa (G. Bidart-Enriquez et al., In Prep.). This brief
contribution is also meant to prompt renewed efforts to
rediscover the now long-missing local populations of
Darwin’s Frog in central Chile. Knowledge of its release
calls may also contribute to setting up acoustic monitoring
to detect potential populations of this presumably extinct
species.
Acknowledgments.—This study was partially supported
by Stiftung Artenschutz 2018, FONDECYT grant
1201197, and Fundacion Guillermo Puelma. We
appreciate the comments by two anonymous reviewers
and the Editor, who helped to improve the final version
of this manuscript.
Literature Cited
Aronson LR. 1943. The “release” mechanism and sex
recognition in Hyla andersonii. Copeia 1943(4): 246—
249.
Azat C, Valenzuela-Sanchez A, Delgado S, Cunningham
A, Alvarado-Rybak M, Bourke J, Briones R, Cabeza
O, Castro-Carrasco C, Charrier A, et al. 2021. A
flagship for Austral temperate forest conservation: an
action plan for Darwin’s Frogs bringing together key
stakeholders. Oryx 55: 356-363.
Blumstein DT, Chi YY. 2012. Scared and less noisy:
glucocorticoids are associated with alarm call entropy.
Biology Letters 8(2): 189-192.
Bourke J, Busse K, BOhme W. 2012. Searching for a
lost frog (Rhinoderma rufum): identification of the
most promising areas for future surveys and possible
reasons of its enigmatic decline. North-Western
Journal of Zoology 8(1): 99-106.
Bowcock H, Brown GP, Shine R. 2008. Sexual
communication in Cane Toads, Chaunus marinus:
What cues influence the duration of amplexus? Animal
Behaviour 75(4): 1,571-1,579.
Cei J. 1958. Las laminas originales del suplemento a los
batracios chilenos de Philippi: primera impresién y
comentarios. /nvestigaciones Zooldgicas Chilenas 4:
265-268.
Cuevas CC. 2014. Native forest loss impacts on anuran
diversity, with a focus on Rhinoderma rufum (Philippi
1902) (Rhinodermatidae) in Coastal Range, South-
Central Chile. Gesti6n Ambiental 27. 1-18.
di Tada D. 2001. Release vocalizations in neotropical
toads (Bufo): ecological constraints and phylogenetic
implications. Journal of Zoological Systematics and
Evolutionary Research 39(1—2): 13-23.
Donoso-Barros R. 1970. Catalogo herpetologico chileno.
Boletin del Museo Nacional de Historia Natural
(Chile) 31: 49-124.
Feng AS, Riede T, Arch VS, Yu Z, Xu ZM, Yu XJ, Shen
JX. 2009. Diversity of the vocal signals of Concave-
eared Torrent Frogs (Odorrana tormota): evidence for
Amphib. Reptile Conserv.
individual signatures. Ethology 115(11): 1,015—1,028.
Formas JR. 2013. External morphology, chondrocranium,
hyobranchial skeleton, and external and internal
oral features of Rhinoderma rufum (Anura,
Rhinodermatidae). Zootaxa 3641(4): 395—400.
Formas R, Pugin E, Jorquera B. 1975. La identidad del
batracio chileno Heminectes rufus Philippi, 1902.
Physis 34(89): 147-157.
Forti LR, Zornosa-Torres C, Marquez R, Toledo LF. 2018.
Ancestral state, phylogenetic signal, and convergence
among anuran distress calls. Zoologischer Anzeiger
274: 1-5.
IUCN SSC Amphibian Specialist Group. 2015.
Rhinoderma rufum. The IUCN Red List of Threatened
Species 2015: e.T19514A79809567.
IUCN SSC Amphibian Specialist Group. 2018.
Rhinoderma_ darwinii. The IUCN Red List of
Threatened Species 2018: e.T19513A79809372.
Kohler J, Jansen M, Rodriguez A, Kok PJR, Toledo LF,
Emmrich M, Glaw F, Haddad CFB, Rédel MO, Vences
M. 2017. The use of bioacoustics in anuran taxonomy:
theory, terminology, methods, and recommendations
for best practice. Zootaxa 4251(1): 1-124.
Labra A, Silva G, Norambuena F, Velasquez N, Penna
M. 2013. Acoustic features of the Weeping Lizard’s
distress call. Copeia 2013(2): 206-212.
Liao WB, Lu X. 2009. Sex recognition by male Andrew’s
Toad, Bufo andrewsi, in a subtropical montane region.
Behavioural Processes 82(1): 100-103.
Marquez R, Beltran JF, Pita- Vaca I, Samlali MA, S’Khifa
A, Slimani T. 2018. Release calls of Moroccan
Spadefoot Toad, Pelobates varaldii (Anura,
Pelobatidae). Amphibia-Reptilia 39(3): 369-374.
Moreno-Gomez FN, Leon A, Velasquez NA, Penna M,
Delano PH. 2015. Individual and sex distinctiveness
in bark calls of domestic chinchillas elicited in a
distress context. Journal of the Acoustical Society of
America 138(3): 1,614—1,622.
Penna M. 2005. Voces de Anfibios de Chile / Voices of
Chilean Amphibians [compact disc]. Universidad de
Chile, Programa Interdisciplinario de Estudios en
Biodiversidad, Santiago, Chile.
Penna M, Veloso A. 1981. Acoustical signals related to
reproduction in the spinulosus species group of Bufo
(Amphibia, Bufonidae). Canadian Journal of Zoology
59(1): 54-60.
Penna M, Veloso A. 1990. Vocal diversity in frogs of
the South American temperate forest. Journal of
Herpetology 24(1): 23-33.
Serrano JM, Penna M, Soto-Azat C. 2020. Individual
and population variation of linear and non-linear
components of the advertisement call of Darwin’s
Frog (Rhinoderma darwinii). Bioacoustics 29(5):
572-589
Soto-Azat C, Valenzuela-Sanchez A, Collen B, Rowcliffe
JM, Veloso A, Cunningham AA. 2013. The population
decline and extinction of Darwin’s Frogs. PLoS ONE
December 2021 | Volume 15 | Number 2 | e296
Release call of Rhinoderma rufum
8(6): e66957. modular tool for sound analysis and_ synthesis.
Stanescu F, Forti LR, Cogalniceanu D, Marquez R. 2019. Bioacoustics 18(2): 213-226.
Release and distress calls in European spadefoot Toledo LF, Cheryl T, Marquez R. 2015. The value of
toads, genus Pelobates. Bioacoustics 28(3): 224-238. audiovisual archives. Science 347(6221): 484.
Sueur J, Aubin T, Simonis C. 2008. Seewave: a free
José Manuel Serrano is currently a postdoctoral researcher at Universidad Nacional
Autonoma de México (Museo de Zoologia Alfonso L. Herrera, Facultad de Ciencias,
UNAM) and an associate researcher at the NGO Ranita de Darwin (Santiago, Chile). His
interests are related to the acoustic communication, ecology, and conservation of frogs.
Gabriel Bidart-Enriquez earned his Bachelor’s degree as an Environmental Biologist at
the Universidad de Chile (Santiago, Chile) and is co-founder of the citizen-science project
Sappea, a multimedia platform for the recognition and records of Chilean amphibians.
Mario Penna Varela is a Professor in the Programa de Fisiologia y Biofisica, Universidad de
Chile (Santiago, Chile). His area of general interest is acoustic communication, particularly
anuran bioacoustics.
Amphib. Reptile Conserv. 322 December 2021 | Volume 15 | Number 2 | e296
Official journal website:
amphibian-reptile-conservation.org
Amphibian & Reptile Conservation
15(2) [General Section]: 323-334 (e297).
Range expansion of the invasive Tropical House Gecko,
Hemidactylus mabouia (Squamata: Gekkonidae),
in South America
‘*Rudolf von May, 2*Pablo J. Venegas, ?*German Chavez, and ‘Gabriel C. Costa
‘Biology Program, California State University Channel Islands, One University Drive, Camarillo, California 93012, USA ?Instituto Peruano
de Herpetologia, Lima, PERU °?Divisién de Herpetologia-Centro de Ornitologia y Biodiversidad (CORBIDI), Santa Rita N 105 Of 202, Urb.
Huertos de San Antonio, Surco, Lima, PERU *Department of Biology and Environmental Sciences, Auburn University at Montgomery, Montgomery,
Alabama 36117, USA
Abstract.—This report presents new and updated distributional data of the Tropical House Gecko, Hemidactylus
mabouia, in South America, based on 17 specimens collected between 2008 and 2019 at several localities
in Peru. The updated distributional data presented here, based on georeferenced records, suggests that H.
mabouia has experienced a geographic range expansion in northwestern South America. Additionally, we infer
the origin of one of the recently established populations in central Peru by comparing mitochondrial DNA
sequences with sequences from individuals of H. mabouia collected within the native range of the species.
Keywords. Biological invasion, Hemidactylus frenatus, mitochondrial DNA sequences, Peru, Reptilia
Citation: von May R, Venegas PJ, Chavez G, Costa GC. 2021. Range expansion of the invasive Tropical House Gecko, Hemidactylus mabouia
(Squamata: Gekkonidae), in South America. Amphibian & Reptile Conservation 15(2) [General Section]: 323-334 (e297).
Copyright: © 2021 von May et al. This is an open access article distributed under the terms of the Creative Commons Attribution License [Attribution
4.0 International (CC BY 4.0): https://creativecommons.org/licenses/by/4.0/], which permits unrestricted use, distribution, and reproduction in any
medium, provided the original author and source are credited. The official and authorized publication credit sources, which will be duly enforced, are
as follows: official journal title Amphibian & Reptile Conservation; official journal website: amphibian-reptile-conservation.org.
Accepted: 1 August 2021; Published: 25 December 2021
Introduction
The genus Hemidactylus (Squamata: Gekkonidae)
contains several species of widely distributed geckos
that have invaded tropical and subtropical regions in the
Americas over the past century (Carranza and Arnold
2006). Of these, the Tropical House Gecko, Hemidactylus
mabouia, occurs in 12 South American countries
(Argentina, Bolivia, Brazil, Colombia, Ecuador, French
Guiana, Guyana, Paraguay, Peru, Suriname, Uruguay, and
Venezuela), while the Asian House Gecko, Hemidactylus
jrenatus, only occurs in three South American countries
(Colombia, Ecuador, and Venezuela) (Baldo et al.
2008; Rodder et al. 2008; Carvajal-Campos and Torres-
Carvajal 2010; Torres-Carvajal 2015; Scrocchi et al.
2019). Updated distributional data from Ecuador and
Colombia suggest that H. frenatus has experienced a
recent range expansion in northwestern South America
(Torres-Carvajal 2015). Additionally, new reports from
Argentina suggest that H. mabouia has expanded its
distribution into the dry Chaco (a biogeographic region
that is part of the Gran Chaco Sudamericano) in recent
decades (Torres et al. 2018). However, knowledge of
the distribution of H. mabouia in the western portion of
South America remains limited. The establishment of
H. mabouia in new areas may pose a threat to the long-
term survival of native species of geckos. For example,
recent studies in the Caribbean islands of Curacao and
Bonaire indicate that H. mabouia can effectively displace
native gecko populations (Phyllodactylus martini and
Gonatodes antillensis, Hughes et al. 2015).
Here, we present new and updated distributional
data of H. mabouia in western South America, based
on voucher specimens collected at several localities
in Peru. All records were opportunistic and the survey
effort varied across areas. All specimens were collected
in human-made structures located in different settings,
ranging from urban to rural to remote environments.
Additionally, we infer the origin of one of the recently
established populations in central Peru by comparing
mitochondrial DNA sequences with sequences from
individuals of H. mabouia collected within the native
range of the species.
Materials and Methods
Specimens. This report is based on 17 specimens of H.
mabouia collected between 2008 and 2019 at several
Correspondence. *[email protected], ORCID ID: orcid.org/0000-0003-3981-2615
Amphib. Reptile Conserv.
December 2021 | Volume 15 | Number 2 | e297
Hemidactylus mabouia in South America
Table 1. Voucher numbers, measurements, age/sex, locality, and elevation data for 17 specimens of Hemidactylus mabouia
collected between 2008 and 2019 in Peru. SVL = Snout-Vent Length; TL = Tail Length. Latitude and longitude (in decimal
degrees) and additional locality data are provided in Appendix I.
SVL TL
Voucher number (mm) (mm) Age/sex
CORBIDI 1161 31.39 29.98 Juvenile
CORBIDI 1825 41.44 - Juvenile
CORBIDI 3436 62.24 TST Male
CORBIDI 3437 59.18 62.62 Male
CORBIDI 3438 58.78 56.87 Female
CORBIDI 3439 59.91 63.56 Male
CORBIDI 3440 57189 67.77 Female
CORBIDI 6276 67.01 84.31 Male
CORBIDI 9030 54.29 48.66 Male
CORBIDI 9031 55.64 72.11 Male
MUSM 33241 55.41 69.8 Female
CORBIDI 15363 40.31 46.25 Juvenile
CORBIDI 19897 25.27 29.02 Juvenile
CORBIDI 19899 21.82 16.71 Juvenile
CORBIDI 18738 50.29 65.11 Female
CORBIDI 19274 62.13 60.73 Female
CORBIDI 21678 63.01 - Male
localities in Peru (Table 1). To verify the identity of
these specimens, they were compared with specimens of
both H. mabouia and H. frenatus collected within their
native range and deposited in the Museum of Vertebrate
Zoology (MVZ) at the University of California,
Berkeley. Additionally, we photographed an adult female
H. frenatus (MVZ 73664) collected in Bataan Province,
Philippines, and one specimen of H. mabouia collected in
Chanchamayo Province, central Peru (MUSM 33241), to
illustrate differences in the external morphology between
the two species. Images of live individuals in the field are
provided to further illustrate these differences.
Genetic data. The genetic similarity between the
specimen collected in central Peru and specimens
collected in other regions were also examined. This
analysis included comparing the 16S rRNA mitochondrial
fragment of our sample with the sequences from other
species of Hemidactylus (Table 2). To select sequences
for comparison, we conducted a BLAST search for the
16S rRNA fragment and retrieved additional sequences
from GenBank based on recent studies focusing on
Hemidactylus geckos (Rocha et al. 2005; Carranza
and Arnold 2006; Rocha et al. 2010; Rato et al. 2012:
Torres-Carvajal 2015). The DNA from one specimen
of H. mabouia from central Peru (MUSM 33241) was
amplified and a phylogenetic analysis was conducted to
verify its species identity.
To amplify the 16S mitochondrial fragment, the
16SA (= MVZ117; forward) primer (5’-3’ sequence:
CGCCTGTTTATCAAAAACAT) and the 16SB (=
Amphib. Reptile Conserv.
324
Elevation
(m) Locality (all in Peru) Year
160 San Jacinto, Loreto 2008
1,000 Santa Rosa de la Yunga, Cajamarca 2008
844 Bajo Naranjillo, San Martin 2008
844 Bajo Naranjillo, San Martin 2008
844 Bajo Naranjillo, San Martin 2008
844 Bajo Naranjillo, San Martin 2008
844 Bajo Naranjillo, San Martin 2008
140 Jenaro Herrera, Loreto 2008
764 Tingo Maria, Huanuco 2011
764 Tingo Maria, Huanuco 2011
830 Chanchamayo, Junin 2014
123 Surquillo, Lima 2015
183 Puerto Maldonado, Madre de Dios 2016
890 Portillo Alto, Satipo, Junin 2016
704 Chaclacayo, Lima 2018
350 Tambopata, Madre de Dios 2018
1,332 San Antonio, Satipo, Junin 2019
MVZ98; reverse) primer (5’-3’ sequence: CCGGTCTG-
AACTCAGATCACGT) (Palumbi et al. 1991) were
used, with the following thermocycling conditions for
the Polymerase Chain Reaction (PCR): 1 cycle of 96 °C
for 3 min; 35 cycles of 95 °C for 30 s, 55 °C for 45 s,
72 °C for 1.5 min; and 1 cycle of 72 °C for 7 min. The
cycle sequencing reactions were completed by using the
corresponding PCR primers and the BigDye Terminator
3.1 (Applied Biosystems), and sequence data were
obtained by running the purified reaction products in an
ABI 3730 Sequence Analyzer (Applied Biosystems).
The newly obtained sequence was deposited in GenBank
(Table 2). Geneious R6, version 6.1.8 (Biomatters
2013; http://www.genelous.com/) was used to align
the sequences using the Geneious multiple alignment
program for nucleotide (consensus) sequences and to
obtain a Neighbor Joining tree.
A Bayesian approach was applied to infer the
relatedness between our sample and those from other
regions. For this purpose, MrBayes, version 3.2.0
(Ronquist and Huelsenbeck 2003) was used to infer a
molecular phylogeny. The analysis included 45 terminals
and a 474 bp alignment. 7arentola angustimentalis was
used as outgroup following previous analyses focusing
on Hemidactylus (Carranza and Arnold 2006). Before
conducting the phylogenetic analysis, PartitionFinder,
version 1.1.1 (Lanfear et al. 2012) was used to select
the appropriate models of nucleotide evolution, and
the Bayesian Information Criterion (BIC) was used
to determine the best substitution model. The GTR +
I’ model of nucleotide substitution (as suggested by
December 2021 | Volume 15 | Number 2 | e297
von May et al.
Table 2. GenBank accession numbers for taxa sampled in this study. The GenBank accession code of the new sequence is highlighted
in bold font.
Voucher
MVTIC-k27
Masc.33
16S Accession
AY517564
AY517561
HM192642 MA13
HM192643 38722
HM192674 DR6
HM192677 GCl
HM192679 CAS232885
HM192680 CAS235221
OL958452 MUSM-33241
HM192552 SA31
Species
H. frenatus
H. frenatus
H. frenatus
H. frenatus
H. frenatus
H. frenatus
H. frenatus
H. frenatus
Peru: Junin, Chanchamayo
JQ301000 DB1402 Spain: Lanzarote
JQ300878 DB241
H. mabouia
H. mabouia
H. mabouia
H.. mabouia
H. platycephalus
Tarentola angustimentalis
Tarentola boehmei
Morocco: Akka Ighane
PartitionFinder) was used to perform an MCMC Bayesian
analysis that consisted of two simultaneous runs of
8,000,000 generations, and the sampling rate was set to
once every 1,000 generations. Each run had three heated
chains and one “cold” chain, and the burn-in was set to
discard the first 25% samples from the cold chain. At the
end of the run, the average standard deviation of split
frequencies was 0.004405. Following the completion
of the analysis, Tracer 1.6 (Rambaut and Drummond
2003) was used to verify convergence. Subsequently,
FigTree (http://tree.bio.ed.ac.uk/software/figtree/) was
used to visualize the majority-rule consensus tree and
the posterior probability values to assess node support.
Amphib. Reptile Conserv.
Additionally, the R package APE (Paradis et al. 2004)
was used to estimate uncorrected p-distances (1.e., the
proportion of nucleotide sites at which any two sequences
are different).
Mapping. The occurrence of H. mabouia in South
America was mapped using georeferenced data from
previous studies (Kluge 1969; Dirksen and De la Riva
1999: Lehr 2001; Baldo et al. 2008; Rodder et al.
2008; Carvajal-Campos and Torres-Carvajal 2010;
Diele-Viegas et al. 2018; Torres et al. 2018; Caicedo-
Portilla 2019; Scrocchi et al. 2019) and this study.
Additionally, 656 georeferenced records available in
December 2021 | Volume 15 | Number 2 | e297
Hemidactylus mabouia in South America
| F
n th “
F hh ' =
ket | ‘ tad ig
Fig. 1. Dorsal views of head (A), midbody (B), and tail (C) of adult female of Hemidactylus mabouia (MUSM 33241; Field Nbr.
RvM64-14) collected in Chanchamayo, Peru. Dorsal views of head (D), midbody (E), and tail (F) of adult female Hemidactylus
frenatus (MVZ 73664) collected in Bataan Province, Philippines. Photographs by Rudolf von May.
the Global Biodiversity Information Facility (GBIF;
https://www.gbif.org) were included. Only those GBIF
records with voucher specimen data were included
and those that lacked specimen data (e.g., iNaturalist
photo records) or had inaccurate coordinate data (i.e.,
coordinate uncertainty > 3,000 m) were excluded. The
R package maptools (Bivand and Lewin-Koh 2014) was
used to produce a map depicting the known occurrence
points of H. mabouia. A layer depicting the Global
Biomes according to the World Wildlife Fund (WWF)
Amphib. Reptile Conserv.
classification, obtained from the Terrestrial Ecoregions
of the World dataset (WWE 2008), was also incorporated
to determine the primary ecoregions used by this species.
Results
The morphology of all specimens listed in Table 1
closely matches H. mabouia and differs from H. frenatus
(Figs. 1-2). Dorsal conical tubercles are higher in our
specimens as well as H. mabouia from Africa. This
December 2021 | Volume 15 | Number 2 | e297
von May et al.
Fig. 2. Dorsal views of adult male Hemidactylus mabouia (CORBIDI 6276) collected in Loreto (Genaro Herrera, Requena Province),
Peru (A). Dorsal view of juvenile Hemidactylus mabouia (CORBIDI 15363) collected in Lima (Surquillo, Lima Province), Peru
(B). Lateral view of body (C) and head (D), ventral view of head and body (E), and ventral view of right hand (F) of the same
individual (CORBIDI 15363). Photographs by Pablo Venegas (A) and German Chavez (B-F).
character is notoriously different in H. frenatus (lower
dorsal tubercles), which is also evident in Figs. 1-3. The
specimens reported here were collected in seven regions
in Peru (from north to south): Loreto, Cajamarca, San
Martin, Huanuco, Junin, Lima, and Madre de Dios. One
of the specimens collected in Lima (CORBIDI 15363)
was found in a house wall close to a city park in Surquillo
district, a dense urban area, at 123 m elevation. The other
specimen collected in Lima (CORBIDI 18738) was found
Amphib. Reptile Conserv.
in a backyard in Chaclacayo district, an urban area, at an
elevation of 704 m. This specimen was captured on a wall
with a small collection of orchids brought from Tarapoto
and Moyobamba. One of the specimens found in Madre
de Dios (CORBIDI 19274) was captured on a wooden
wall at the Tambopata Research Center, a research
station and ecotourism lodge located in the Tambopata
National Reserve. All other specimens (including the
specimen from Lima) were collected outside of natural
December 2021 | Volume 15 | Number 2 | e297
Hemidactylus mabouia in South America
Villavicencio, Meta, Colombia (C—D). Photographs by L. Lee Grismer (A—B) and Juan D. Vasquez-Restrepo (C—D).
protected areas. The phylogenetic analysis focusing on
the 16S rRNA gene (Fig. 4) indicated that the haplotype
of the specimen collected in Junin region, central Peru,
is identical to the haplotype of specimens of H. mabouia
from Annodon Island, West Africa, and the Republic
of South Africa. Uncorrected p-distances are shown
in Appendix II. Although several terminals in the H.
mabouia clade are labeled as H. mercatorius, we believe
they represent H. mabouia. This apparent discrepancy
appears because we retained the original species
assignment provided in GenBank.
The geographic distribution of H. mabouia in South
America includes 12 countries (Fig. 5). The new records
from Peru are based on field observations and voucher
specimens collected between 2008 and 2019 (Table 1).
Other relatively recent records in Peru (1989-1999) are
from San Martin (KU 212605-212609; https://www.
ebif.org) and Huanuco regions (SMF 80088; Lehr 2001).
Our records from Lima are among the first observations
of H. mabouia west of the Andes, in addition to recent
records from coastal Ecuador (Carvajal-Campos and
Torres-Carvajal 2010).
Discussion
The findings of this study suggest that H. mabouia has
recently expanded its geographic distribution in western
South America. Previous studies had documented
the presence of H. mabouia in western Ecuador and
Amphib. Reptile Conserv.
Colombia (R6dder et al. 2008; Carvajal-Campos and
Torres-Carvajal 2010; Caicedo-Portilla 2019), and
previous records from Peru were obtained in lowland
Amazonian sites located at or below 200 m of elevation
(Kluge 1969; Carrillo and Icochea 1995; Lehr 2001;
Rodder et al. 2008; Cossios 2010). Our locality data
represent a notable extension (> 330 km to the west and >
600 km to the southeast) of the known geographic range
of H. mabouia in Peru. Additionally, our data suggest
that there has been a recent expansion of H. mabouia into
tropical montane forests in Peru. Hemidactylus mabouia
was found at lowland sites close to the Peruvian Andes
in 1989 and 1999 (Fig. 5), and it was first noticed in
montane forest (Chanchamayo, Selva Central) in 2005
(R. von May, Pers. Obs.). Subsequently, specimens were
collected at six montane forest sites in both central and
northern Peru between 2008 and 2019 (Table 1). These
records extend the elevational distribution in Peru by
over 1,100 m. As a result, the elevational distribution of
H. mabouia in Peru ranges from 140 to 1,332 m.
The phylogenetic analysis focusing on the 16S rRNA
gene (Fig. 5, Table 4) indicated that the haplotype of
one population of H. mabouia surveyed in central Peru
is identical to that of populations of H. mabouia from
Sao Tomé and Principe Island and Annodon Island
(Gulf of Guinea, West Africa), as well as populations
from the Republic of South Africa (Rocha et al. 2005;
Rocha et al. 2010). When considering the high similarity
between H. mabouia and H. mercatorius, Rocha et al.
December 2021 | Volume 15 | Number 2 | e297
von May et al.
0.99
Tarentola angustimentalis DB1402
4 H platycephalus Grand Comore AY517571
H platycephalus Mayotte AY517573
H platycephalus Madagascar AY517574
H platycephalus Mozambique AY517572
H platycephalus AY517572
H mabouia South Africa HM192602
H mabouia South Africa HM192601
H mercatorius Madagascar EF210663
H mercatorius Mayotte AY863032
H mercatorius Mayotte AY863031
H mabouia South Africa HM192555
H mercatorius Mayotte AY863033
H mabouia South Africa HM192554
H mabouia South Africa HM192553
H mabouia South Africa HM192552
H mabouia Seychelles JF329705
H mercatorius Madagascar AY517585
H mercatorius Madagascar AY517584
H mabouia South Africa HM192604
H mabouia South Africa HM192603
H mercatorius Mayotte AY863036
H mabouia Seychelles JF329706
H mabouia Tanzania HM192561
H mercatorius Mayotte AY863035
H mabouia Tanzania HM192560
H mabouia Tanzania HM192559
H mabouia Tanzania HM192558
H mabouia Tanzania HM192557
H mabouia South Africa HM192609
H mabouia South Africa HM192608
H mabouia South Africa HM192607
H mabouia South Africa HM192606
H mabouia South Africa HM192605
H mabouia Junin Peru RvM64 14
H mabouia Annobon AY863038
H frenatus Myanmar HM192680
H frenatus Seychelles HM192674
H frenatus Myanmar HM192679
1 H frenatus Seychelles HM192643
H frenatus Seychelles HM192642
H frenatus Mascarenes AY517561
H frenatus India MVTIS k27
H frenatus Grand Comore HM192677
0.99
<+—
0.3
Fig. 4. A consensus Bayesian phylogeny based on 474 bp of aligned mitochondrial sequences (16s rRNA gene). Posterior probability
values are shown on nodes. The arrow indicates the specimen from central Peru (MUSM 33241; Field Nbr. RVM64—14).
(2005) mentioned the possibility of a “species complex”
encompassing taxa currently identified under either of
these two names. Vences et al. (2004) also proposed
that the Malagasy populations of H. mabouia should be
recognized as H. mercatorius. Furthermore, Rocha et al.
(2010) identified multiple cryptic lineages within this
H. mercatorius-mabouia species complex and proposed
that insular populations of H. mabouia off the coasts of
western and eastern Africa (Gulf of Guinea, Comoros,
Madagascar, and Seychelles) should be recognized as H.
mercatorius, while the status of continental populations
required further studies. Accordingly, recent IUCN
conservation status assessments followed Rocha et
al. (2010) and restricted the name H. mercatorius to
island populations within the H. mercatorius-mabouia
clade (Vences and Hawlitschek 2011). As a result, the
continental populations will continue to be recognized as
H. mabouia until the taxonomy of this species complex
Amphib. Reptile Conserv.
329
is resolved. Thus, given that the specimen we collected in
central Peru has mitochondrial sequences that are identical
to H. mabouia from the Republic of South Africa, we
consider that this and all other (morphologically similar)
specimens collected in Peru represent H. mabouia.
The specimens of H. mabouia collected in Lima are
noteworthy because they represent the first records of this
species in the Pacific coastal desert, the driest ecoregion
in Peru (Brack 1986). These records are among the first
observations of H. mabouia west of the Andes, in addition
to records from coastal Ecuador (Carvajal-Campos and
Torres-Carvajal 2010). How this species arrived in Lima
remains unknown, but its arrival on the Peruvian coast
might have occurred as a stowaway through the Pacific
Ocean or via terrestrial or aerial domestic journeys. Lima
is located near Callao, the main maritime port in the
country, and it is also the main hub for bus routes and
both domestic and international flights. Human-mediated
December 2021 | Volume 15 | Number 2 | e297
Hemidactylus mabouia in South America
Pacific
Ocean
@® New Records
@® Previous
V Previous 1989
O Previous 1999
© Previous 2009
-1000 ;
Fig. 5. Known distribution of Hemidactylus mabouia in South America. Black circles represent literature data (most previous
records) and red circles indicate the location of new records in Peru (2008-2019). Other relatively recent records in Peru (1989-
1999) are from the San Martin and Huanuco regions (yellow triangle and square). Recent records from coastal Ecuador are indicated
with yellow diamonds. The color scheme of the map represents the elevation in m asl (see legend on the right).
dispersal in combination with favorable anthropogenic
habitats will facilitate the establishment of this gecko
in Lima and other cities along the west coast of tropical
South America (Colombia, Ecuador, Peru, and northern
Chile).
Our finding of H. mabouia at the Tambopata Research
Center (Madre de Dios region) represents the first record of
this invasive species in a natural protected area in Peru, the
Tambopata National Reserve. As for the other specimens
reported here, the occurrence of this population might be
restricted to human-made buildings, but not forests. Our
survey efforts (~ 7 person-days) did not yield any records
of this species in the lowland rainforest surrounding the
station. In contrast, we were able to observe several
individuals on walls or behind furniture of the Tambopata
Research Center. Boats transporting people and supplies
from Puerto Maldonado, the nearest city (where we also
recorded H. mabouia; Table 1), frequently arrive at this
and other lodges and hotels located in the reserve. Thus,
given that boats are the primary transportation method to
these lodges and considering that this gecko can easily
Amphib. Reptile Conserv.
travel as a stowaway in boats, it 1s likely that H. mabouia
is currently present in many other lowland rainforest
sites with human-made buildings. Yet, the impact of
H. mabouia on the native fauna remains unclear. For
example, the nocturnal gecko Thecadactylus solimoensis
is also present in the region (Doan and Arizabal Arriaga
2002; von May et al. 2009), occasionally uses the same
type of habitats and may compete for resources such as
food, retreat, and nesting sites.
We believe that the new data presented here lend
support to the hypothesis that H. mabouia has recently
expanded its geographic distribution in western South
America. This is because H. mabouia had not previously
been recorded at sites that were subject to intensive
herpetological surveys in previous decades (e.g.,
Tambopata Research Center; Doan and Arizabal Arriaga
2002) but was recorded in the most recent decade (this
study). Likewise, two of the authors (PJV, GC) have
worked in Lima and other coastal areas since the late
1990s, but only recently recorded H. mabouia on the
Peruvian Pacific coast (this study). While some of the
December 2021 | Volume 15 | Number 2 | e297
von May et al.
sites reported here had been visited multiple times by
herpetologists, it 1s possible that H. mabouia is more
common than previously thought. Additional surveys will
provide relative abundance data for this invasive species,
and future studies need to test whether H. mabouia can
displace native gecko populations.
Acknowledgments.—We thank Juan Carlos Chavez-
Arribasplata, Amanda Delgado, Lizet Tejada, Jorge
Reto, Eduardo Almora, Napoleon Monsalve, Luis
Garcia, Jess Ormefio, and Axel Marchelie for help with
data collection. We thank L. Lee Grismer and Juan D.
Vasquez-Restrepo for sharing images of H. frenatus
photographed tn the field. We thank Dennis Rédder and
GBIF for kindly providing some of the georeferenced data
used in this study. Research and collecting permits were
approved by the Direccion General Forestal y de Fauna
Silvestre (DGFFS), Servicio Nacional Forestal y de
Fauna Silvestre, and the Ministry of Agriculture (09 C/C-
2008-INRENA-IANP, 120-2012-AG-DGFFS-DGEFFS,
064-2013-AG-DGFFS-DGEFFS, 292-2014-AG-DGFFS-
DGEFFS, and Contrato de Acceso Marco a Recursos
Genéticos N° 359-2013-MINAGRI-DGFFS-DGEFFS).
We thank Claudia Koch and one anonymous reviewer
for providing constructive comments on the manuscript.
This research was supported with grants from the
National Science Foundation (Postdoctoral Research
Fellowship DBI-1103087) and the National Geographic
Society (Grant # 9191-12) to RVM. GCC was supported
by NSF grant DEB-1754425.
Literature Cited
Baldo D, Bortiero C, Brusquetti F, Garcia JE, Prigioni
C. 2008. Notes on geographic distribution: Reptilia,
Gekkonidae, Hemidactylus mabouia, Tarentola
mauritanica: distribution extension and anthropogenic
dispersal. Check List 4: 434-438.
Bivand R, Lewin-Koh N. 2014. maptools: tools for
reading and handling spatial objects. — R package
ver. 0.8—30. Available: https://cran.r-project.org/
package=maptools [Accessed: 17 January 2021].
Brack A. 1986. Ecologia de un pais Complejo. Pp.
175-319 In: Gran Geografia del Peru. Editors,
Dourojeanni MJ, Mejia Baca J. Naturaleza y Hombre,
Barcelona, Spain.
Caicedo-Portilla JR. 2019. Presencia de Hemidactylus
frenatus y Hemidactylus mabouia (Squamata:
Gekkonidae) en Leticia, Amazonia colombiana. Biota
Colombiana 20(2): 120-127.
Carranza S, Arnold EN. 2006. Systematics, biogeography,
and evolution of Hemidactylus geckos (Reptilia:
Gekkonidae) elucidated using mitochondrial DNA
sequences. Molecular Phylogenetics and Evolution
38: 531-545.
Carrillo N, Icochea J. 1995. Lista taxonomica preliminar
de los reptiles vivientes del Pert. Publicaciones del
Amphib. Reptile Conserv.
Museo de Historia Natural Universidad Nacional de
San Marcos. Serie A Zoologia 49: 1-27.
Carvajal-Campos <A, Torres-Carvajal O. 2010.
Hemidactylus mabouia Moreau De Jonnes, 1818
and H. frenatus Schlegel, 1836 in western Ecuador:
new records reveal range extension. Herpetozoa 23:
90-91.
Cossios ED. 2010. Vertebrados naturalizados en el Peru:
historia y estado del conocimiento. Revista Peruana
de Biologia 17(2): 179-189.
Diele- Viegas LM, Vitt LJ, Sinervo B, Colli GR, Werneck
FP, Miles DB, Magnusson WE, Santos JC, Sette CM,
Caetano GHO, et al. 2018. Thermal physiology of
Amazonian lizards (Reptilia: Squamata). PLoS ONE
13(3): e0192834.
Dirksen L, De la Riva I. 1999. The lizards and
amphisbaenians of Bolivia (Reptilia, Squamata):
checklist, localities, and bibliography. Graellsia 55:
199-215.
Doan TM, Arizabal Arriaga W. 2002. Microgeographic
variation in species composition of the herpetofaunal
communities of Tambopata Region, Peru. Biotropica
34: 101-117.
Hughes DF, Meshaka WE, Van Buurt G. 2015. The
superior colonizing gecko Hemidactylus mabouia
on Curacao: conservation implications for the native
gecko Phyllodactylus martini. Journal of Herpetology
49(1): 60-63.
Kluge AG. 1969. The evolution and geographical origin
of the New World Hemidactylus mabouia-brooki
complex (Gekkonidae, Sauria). Miscellaneous
Publications of the Museum of Zoology, University of
Michigan 138: 1-78.
Lanfear R, Calcott B, Ho SYW, Guindon S. 2012.
PartitionFinder: combined selection of partitioning
schemes and substitution models for phylogenetic
analyses. Molecular Biology and Evolution 29:
1,695—1,701.
Lehr E. 2001. New records for amphibians and reptiles
from Departamentos Pasco and Ucayali, Peru.
Herpetological Review 32(2): 130-132.
Palumbi SR, Martin A, Romano S, McMillan WO, Stice
L, Grabawski G. 1991. The Simple Fool's Guide to
PCR, Version 2.0. Privately published, compiled by
S. Palumbi, University of Hawaii, Honolulu, Hawai,
USA. 45 p.
Paradis E, Claude J, Strimmer K. 2004. APE: analyses
of phylogenetics and evolution in R_ language.
Bioinformatics 20(2): 289-290.
Rambaut A, Drummond, A. 2003. Tracer: a program for
analyzing results from Bayesian MCMC programs
such as BEAST and MrBayes. Available: http://beast.
bio.ed.ac.uk/Tracer [Accessed: 18 September 2016].
Rato C, Carranza S, Harris DJ. 2012. Evolutionary history
of the genus Zarentola (Gekkota: Phyllodactylidae)
from the Mediterranean Basin, estimated using
multilocus sequence data. BMC Evolutionary Biology
December 2021 | Volume 15 | Number 2 | e297
Hemidactylus mabouia in South America
12:14
Rocha S, Carretero MA, Harris DJ. 2005. Diversity and
phylogenetic relationships of Hemidactylus geckos
from the Comoro islands. Molecular Phylogenetics
and Evolution 35(1): 292-299.
Rocha S, Carretero MA, Harris DJ. 2010. On the diversity,
colonization patterns, and status of Hemidactylus
sp. (Reptilia: Gekkonidae) from the Western Indian
Ocean islands. Herpetological Journal 20(2): 83-89.
Rodder D, Solé M, Bohme W. 2008. Predicting the
potential distributions of two alien invasive House
Geckos (Gekkonidae: Hemidactylus _frenatus,
Hemidactylus mabouia). North-Western Journal of
Zoology 4: 236-246.
Ronquist F, Huelsenbeck JP. 2003. MrBayes 3: Bayesian
phylogenetic inference under mixed models.
Bioinformatics 19: 1,572—1,574.
Scrocchi GJ, Stazzonelli JC, Cabrera P. 2019. Nuevas
citas de Squamata (Gekkonidae, Phyllodactylidae y
Dipsadidae) para la provincia de Tucuman, Argentina.
Cuadernos de Herpetologia 33(2): 75-78.
Sound P, Kosuch J, Vences M, Seitz M, Veith M. 2006.
Preliminary molecular relationships of Comoran Day
Geckos (Phelsuma). Pp. 175-179 In: Proceedings
of the 13” Congress of the Societas Europaea
Herpetologica. SEH, Bonn, Germany. 262 p.
emphasis on Peru and Ecuador.
Amphib. Reptile Conserv.
Torres-Carvajal O. 2015. On the origin of South
American populations of the Common House Gecko
(Gekkonidae: Hemidactylus frenatus). NeoBiota 27:
69-79.
Torres PJ, Escalante O, Cardozo D. 2018. First record
of the invasive Hemidactylus mabouia (Moreau de
Jonnes, 1818) (Squamata, Gekkonidae), in the dry
Chaco, Argentina. Check List 14(4): 633-636.
Vences M, Hawlitschek O. 2011. Hemidactylus
mercatorius. The IUCN Red List of Threatened
Species 2011: e.T172976A6951505.
Vences M, Wanke S, Vieites DR, Branch B, Glaw F. 2004.
Natural colonization or introduction? High genetic
divergences and phylogeographic relationships of
House Geckos (Hemidactylus) from Madagascar.
Biological Journal of the Linnaean Society 83: 115-
130.
von May R, Siu-Ting K, Jacobs JM, Medina-Miller
M, Gagliardi G, Rodriguez LO, Donnelly MA.
2009. Species diversity and conservation status of
amphibians in Madre de Dios, Peru. Herpetological
Conservation and Biology 4: 14-29.
World Wildlife Fund. 2008. Terrestrial ecoregions of the
world. World Wildlife Fund (WWF), Washington,
DC, USA. Available: https://www.worldwildlife.org/
biome-categories/terrestrial-ecoregions [Accessed: 25
February 2018].
Rudolf von May is an Assistant Professor in the Biology Program at California State University
Channel Islands, Camarillo, California, USA. His fields of interest include evolutionary ecology,
herpetology, and biodiversity conservation.
Pablo J. Venegas is Curator of the Herpetological Collection of Centro de Ornitologia y
Biodiversidad (CORBIDI) and the Instituto Peruano de Herpetologia, in Lima, Peru. His primary
research interests include the diversity and conservation of the Neotropical herpetofauna, with an
German Chavez is an Associated Researcher at the of Centro de Ornitologia y Biodiversidad
(CORBIDI) and the Instituto Peruano de Herpetologia, in Lima, Peru. His primary research interests
include the taxonomy and systematics of amphibians and reptiles.
Gabriel C. Costa is an Associate Professor in the Department of Biology and Environmental
Sciences at Auburn University at Montgomery, Alabama, USA. His primary research interests
include biogeography, macroecology, herpetology, and conservation biology.
December 2021 | Volume 15 | Number 2 | e297
von May et al.
Appendix I. Locality data, including latitude and longitude (in decimal degrees) and collection dates, of specimens reported in this
study.
-12.59090 -69.19630 Puerto Maldonado 2016
Amphib. Reptile Conserv. 333 December 2021 | Volume 15 | Number 2 | e297
Hemidactylus mabouia in South America
Appendix II. Genetic distances between H. mabouia from Central Peru, H. mabouia from other regions, and related taxa. Uncorrected
p-distances of the mitochondrial 16S rRNA gene.
1 2 3 4 5 6 7 8 2) 10
1 A. frenatus Grand Comore HM192677
2 H. frenatus India MVTIS k27 0.013
3-H. frenatus Mascarenes AY517561 0.013 0.007
4 — H. frenatus Myanmar HM192679 0.026 0.022 0.029
5H. frenatus Myanmar HM192680 0.126 0.128 0.126 0.128
6 _-Z. frenatus Seychelles HM192642 0.013. 0.007 0.004 0.029 0.131
7 — H. frenatus Seychelles HM192643 0.013. 0.007 0.004 0.029 0.131 0.000
8 H. frenatus Seychelles HM192674 0.031 0.027 0.033 0.013 0.142 0.033 0.033
9 H. mabouia Annobon AY 863038 0.203 0.202 0.202 0.205 0.189 0.209 0.209 0.205
10 H. mabouia Junin Peru RVM64 14 0.206 0.206 0.206 0.208 0.192 0212 0.212 0.208 0.000
11. H. mabouia Seychelles JF329705 O2270.. 20,220". 0220" 0226" T2103: “OD 2 en 22 he Gi 2238 ~ FO,012% «0.012
12. H. mabouia Seychelles JF329706 O.213- O212- O212 0219 ‘0209 0219 0219 0215 0:007 0,007
13. H. mabouia South Africa HM192552 0.220 -0.220° 0,220: 0.226 02913 0.227 0.227 0:223 -0:012. 0,012
14. A. mabouia South Africa HM192553 0.220." 0220. 0220. -0.226: 0213 .0227 0227 0:223 ~Q:012 0.012
15H. mabouia South Africa HM192554 0.220. -0.220. 0:220 0,226. 0273. 0227" 0227 0,223 20012) “0012
16 H. mabouia South Africa HM192555 0.218 0218 0218 0224 0.216 0225 0225 0.221 0.017 0.017
17H. mabouia South Africa HM192601 0.221 0221 0221 0.224 0.201 0.228 0.228 0.220 0.074 0.074
18 H. mabouia South Africa HM192602 0.221 0221 0221 0.224 0.201 0.228 0.228 0.220 0.074 0.074
19 H. mabouia South Africa HM192603 0.226. 0.226. 07226. .0:232) .O210. ~0229 0229 0225 0.025. 0,025
20 H. mabouia South Africa HM192604 0.226 0.226 0.226 0.232 0.210 0.229 0.229 0.225 0.025 0.025
21. H. mabouia South Africa HM192605 0.220 0.219 0219 0.226 0.209 0.226 0.226 0.222 0.000 0.000
22 H. mabouia South Africa HM192606 0.220 0219 0219 0.226 0.209 0.226 0.226 0.222 0.000 0.000
23H. mabouia South Africa HM192607 0.220 0.219 0.219 0.226 0.209 0.226 0.226 0.222 0.000 0.000
24 H. mabouia South Africa HM192608 0.220 0.219 0219 0.226 0.209 0.226 0.226 0.222 0.000 0.000
25. H. mabouia South Africa HM192609 0.220 0219 0219 0.226 0.209 0.226 0.226 0.222 0.000 0.000
26 H. mabouia Tanzania HM192557 0.219 -0226°" -0:226 0225." 02208, “0233 0233" 022 ~0:0T0" 0-010
27 ~ H. mabouia Tanzania HM192558 0.219" 0226. 0226. 0.225. 0.223 0.233 0233 0.222 +0:010 ) 0.010
28 H. mabouia Tanzania HM192559 O29 07226, 0.226 —0:225~ 0:223. -0233° 0233 0222 0010" 0-010
29 _H. mabouia Tanzania HM192560 0.219". 02265 02267 0.225. “0223 -0233- 0233 0222. 0.010° 0.010
30. H. mabouia Tanzania HM192561 0.216 0216 0216 0.222 0.216 0.223 0.223 0.219 0.005 0.005
31H. mercatorius Madagascar AY 517584 0.203 0.203 0.203 0.205 0.192 0.209 0.209 0.205 0.006 0.006
32H. mercatorius Madagascar AY517585 0.200 0.200 0.200 0.202 0.192 0.206 0.206 0.202 0.004 0.004
33H. mercatorius Madagascar EF210663 0.215 0214 0214 O217 0.180 0221 0221 0.217 0.022 0.022
34 _H. mercatorius Mayotte AY 863031 0.206 0.202 0.202 0.205 0.192 0.209 0209 0.205 0.011 0.011
35. _H.. mercatorius Mayotte AY 863032 0.203 0.203 0.203 0.205 0.186 0.209 0.209 0.205 0.013 0.013
36 H.. mercatorius Mayotte AY 863033 0.206 0.205 0.205 0.208 0.195 0212 0212 0.208 0.011 0.011
37H. mercatorius Mayotte AY 863035 0.205 0.211 0211 0.207 0.203 0217 0.217 0.207 0.009 0.009
38 H. mercatorius Mayotte AY 863036 0.199 0.199 0199 0.202 0.192 0.205 0.205 0.202 0.006 0.006
39 — -H. platycephalus AY517572 0.161 O161 O161 O158 0174 O161 O161 O.155 0.120 0.120
40H. platycephalus Grand Comore AY517571 0.165 0.162 0.162 O.159 O175 0162 O162 0156 O.118 0.118
41H. platycephalus Madagascar AY 517574 0.164 0161 O161 O161 O176 O162 O162 0159 0127 0.127
42H. platycephalus Mayotte AY517573 0.167 0.164 0164 O.158 O.177 0164 O164 O155 O117 O.117
43 _H.. platycephalus Mozambique AY 517572 0.161 0161 O161 O158 0174 O161 O161 O.155 0.120 0.120
44 Tarentola angustimentalis DB1402 0.222, 0215. 0222- 0208 0.232 0221 .0221 O21) 0214 0214
45 Tarentola boehmei DB241 0.223, 0219. 0223 “0:216 0229 0219 0219 .0216 0210 0210
Amphib. Reptile Conserv. 334 December 2021 | Volume 15 | Number 2 | e297