ON
Xx
MYCOTA
THE INTERNATIONAL JOURNAL OF FUNGAL TAXONOMY & NOMENCLATURE
DECEMBER 2016
OCTOBER-
VOLUME 131(4)
ees Ke
(Aresuny ‘ejzsng sesng ul
a}dag 6) uepy Avjsorel/
RICHARD P. Kore (1925-2016)
http://dx.doi.org/10.5248/131-4 | ISSN (ONLINE) 2154-8889
MYXNAE 131(4): 735-1000 (2016)
ISSN (PRINT) 0093-4666
EDITORIAL ADVISORY BOARD
PETER BUCHANAN (2011-2017), Chair
Auckland, New Zealand
SABINE HUHNDORE (2011-2016), Past Chair
Chicago, Illinois, U.S.A.
BRANDON MATHENY (2013-2018)
Knoxville, Tennessee, U.S.A.
KAREN HANSEN (2014-2019)
Stockholm, Sweden
ISSN 0093-4666 (PRINT)
ISSN 2154-8889 (ONLINE)
MYCOTAXON
THE INTERNATIONAL JOURNAL OF FUNGAL TAXONOMY & NOMENCLATURE
OCTOBER-—DECEMBER 2016
VOLUME 131 (4)
http://dx.doi.org/10.5248/131-4
EDITOR-IN-CHIEF
LORELEI L. NORVELL
[email protected]
Pacific Northwest Mycology Service
6720 NW Skyline Boulevard
Portland, Oregon 97229-1309 USA
NOMENCLATURE EDITOR
SHAUN R. PENNYCOOK
[email protected]
Manaaki Whenua Landcare Research
Auckland, New Zealand
MyYcCoTAxoNn, LTD. © 2016
www.mycotaxon.com &
www.ingentaconnect.com/content/mtax/mt
P.O. BOX 264, ITHACA, NY 14581-0264, USA
Iv ... MYCOTAXON 131(4)
MYCOTAXON
VOLUME ONE HUNDRED THIRTY-ONE (4) — TABLE OF CONTENTS
COVER SECTION
TRV TOW CF Roe Ion tt dd th ced eh sg ele nics and eo eaed chee oe rede oi feel Vii
EP OVP TIC TIAUOLY 6 cece rie PAOD a sg de ac pede tattle gee Gorse bo ate i's astemae vy os ix
SUD ISSIOMPIOCEUUICS 0 Beck, Bin 5 Gass eshte ner AAO SE OR Sa Res IES, x
RESEARCH ARTICLES
Nawawia oviformis sp. nov. from China
JizE PENG, Dou CHANG, YING HUANG & ZE-FEN YU
Pezicula chiangraiensis sp. nov. from Thailand = AnusHa H. EKANAYAKA,
DINUSHANI A. DARANAGAMA, HIRAN A. ARIYAWANSA,
E.B. GARETH JONES, ALI H. BAKHALI & KEVIN D. HYDE
Abieticola koreana gen. et sp. nov., a griseofulvin-producing endophytic
xylariaceous ascomycete from Korea Hyanc-BurM LEE, HyE- YEON Moun,
THI THUONG THUONG NGUYEN, JIN-CHEOL KIM & JEFFREY K. STONE
Entalbostroma erumpens gen. et sp. nov. (Xylariaceae)
from Phormium in New Zealand
P.R. JOHNSTON, J.D. RoGERS, D. PARK & N.A. MARTIN
Podosporiopsis, a new genus of synnematous hyphomycetes
from China JIAN Ma, X1u-Guo ZHANG & RAFAEL FE, CASTANEDA-RU{Z
Distribution of Alternaria species among sections.
3. Sections Infectoriae and Pseudoalternaria
PHILIPP B. GANNIBAL & DANIEL P. LAWRENCE
Zasmidium oleae sp. nov. from China Bao-Ju Lr, XuE-WEN XIE,
YAN-XIA SHI, A-LI CHAI & YING-LAN GUO
Strigula sinoaustralis sp. nov. and three Strigula spp.
new to China SHU-HUuA JIANG, XIN-LI WEI & JIANG-CHUN WEI
Thelenella haradae sp. nov., a saxicolous lichen
from South Korea Joser P HALDA & JAE-SEOUN Hur
Notes on rust fungi in China 2. Two species of Coleosporium
on Compositae JING-XIN Jr, Q1 WANG,
ZHUANG LI, Yu Li & MAKOTO KAKISHIMA
Arthromoniliphora araucariae gen. & sp. nov.
from Brazilian pine SILVANA SANTOS DA SILVA,
Luis FERNANDO PASCHOLATI GUSMAO & RAFAEL F. CASTANEDA-RUIZ
735
739
749
765
773
781
791
795
805
811
821
OCTOBER-—DECEMBER 2016... V
Morphological and phylogenetic clarification of Peziza arvernensis,
P. pseudovesiculosa, P. pseudosylvestris, and P. domiciliana
ANGELA LANTIERI, GIANFRANCO MEDARDI & PABLO ALVARADO = 827
Podosporium bacilliforme sp. nov. and a first record of
Phaeoblastophora peckii from southern China Jin-YE WANG,
Kal ZHANG, CHUN-LING YANG, JI- WEN XIA, YING-RuI Ma,
JIAN-MEI GAo, XIANG-Yu LI, XtU-GUO ZHANG & YU-MEI Car 841
Apiosordaria hamata sp. nov. from lake sediment in China
BING Wu, JIAN-QING TIAN, LIN WANG,
JIAN-Kut Liu, Kevin D. HYDE & JING-ZU SUN 847
Discopycnothyrium palmae gen. & sp. nov. (Asterinaceae)
SINANG HONGSANAN, ALI H. BAHKALI, PUTARAK CHOMNUNTI,
JIAN-Kut Liu, JUN-Bo YANG, & KEVIN D. HypE 859
Two new records of Agaricus from Southwest China
Mao-QIANG HE, JIE CHEN & RuI-LIN ZHAO 871
Entoloma ochreoprunuloides from Italy, with notes on its
geographical distribution and allied species
FRANCESCO DOVANA, ALFREDO VIZZINI,
FABRIZIO BOCCARDO, MARCO MUCCIARELLI & MARCO CLERICUZIO 881
Phaeocollybia pakistanica sp. nov., the first representative
of the genus from Pakistan
JUNAID KHAN, HASSAN SHER & ABDUL NASIR KHALID 889
Mucor indicus isolated from the semiarid region of Brazil:
a first record for South America CarRLos A.F. DE SOUZA,
DioGo X. LIMA, RAFAEL J.V. DE OLIVEIRA,
LucraNa M.S. GURGEL & ANDRE L.C.M. DE A. SANTIAGO 897
Blodgettia saprophytica sp. nov. and Uberispora tropicalis,
new records from southern China CuuN-LING YANG,
Kat ZHANG, JIN- YE WANG, JI-WEN XIA, YING-RuI Ma,
JIAN-MEI Gao, X1u-GuoO ZHANG & ZHUANG Li 907
New record of Beauveria pseudobassiana from Morocco
ABDESSAMAD IMOULAN, YI LI,
WEN-JING WANG, ABDELLATIF EL MEZIANE & YI-JIAN YAO 913
New records of Graphis from Cameroon
with a key to African species of Graphis SANTOSH JOSHI,
D.K. Upret1, ENow ANDREW EGBE &JAE-SEOUN Hur 925
Revision of some Peziza collections in herb. TAAM (Tartu)
GIANFRANCO MEDARDI, ANGELA LANTIERI & GABRIELE CACIALLI 939
vi ... MYCOTAXON 131(4)
BOOK REVIEWS AND NOTICES LORELEI NORVELL 947
THE OUTER SPORES: MUSHROOMS OF HAIDA Gwall
(Kroeger, Kendrick, Ceska & Roberts; 2012)
RARE LICHENS OF OREGON
(Exeter, Glade & Loring; 2016)
LICHENS OF UTTAR PRADESH
(Nayaka & Upreti; 2013)
PLANT PATHOGENIC AND ENDOPHYTIC BOTRYOSPHAERIALES
KNOWN FROM CULTURE
(Phillips, Slippers, Groenewald & Crous, eds.; 2013)
A POLYPHASIC TAXONOMY OF DALDINIA (XYLARIACEAE)
(Stadler, Leessoe, Fournier, Decock,
Schmieschek, Tichy & Persoh; 2014)
HYPOCREALEAN LINEAGES OF INDUSTRIAL AND
PHYTOPATHOLOGICAL IMPORTANCE
(Lombard, Groenewald & Crous, eds.; 2015)
NOMENCLATURAL NOVELTIES AND TYPIFICATIONS
PROPOSED IN VOLUME 131(4) 961
RICHARD P. Korg (1925-1916): A Celebration
LORELEI L. NORVELL (ED.) 963
OCTOBER-DECEMBER 2016...
REVIEWERS — VOLUME ONE HUNDRED THIRTY-ONE (4)
The Editors express their appreciation to the following individuals who have,
prior to acceptance for publication, reviewed one or more of the papers
prepared for this issue.
Najam ul Sehar Afshan
Hiran A. Ariyawansa
Andrew Armitage
Timothy J. Baroni
Uwe Braun
Matias J. Cafaro
Rafael F. Castaftieda-Ruiz
Giovanni Consiglio
Kanad Das
Pradeep K. Divakar
Jacques Fournier
Shouyu Guo
Bo Huang
Ze-Feng Jia
Santosh Joshi
Yu-Ming Ju
Samantha C. Karunarathna
Bryce Kendrick
Paul M. Kirk
De-Wei Li
Cristiano Losi
Robert Liicking
Sajeewa S.N. Maharachchikumbura
Eric H.C. McKenzie
Gabriel Moreno
Lorelei L. Norvell
Shaun R. Pennycook
Emmanuél Sérusiaux
José Ivanildo de Souza
Marc Stadler
Larissa Vasilyeva
Xiu-Guo Zhang
Ying Zhang
Qi Zhao
VII
vill ... MyCOTAXON 131(4)
PUBLICATION DATE FOR VOLUME ONE HUNDRED THIRTY-ONE (3)
MYCOTAXON for JULY-SEPTEMBER 2016 (I-x1I + 491-734)
was issued on October 18, 2016
OCTOBER-DECEMBER 2016... IX
FROM THE EDITOR-IN-CHIEF
RICHARD P. KorrF (1925-2016)—Our man in Ithaca was just too famous! When
assembling materials for MycotTaxon’s special issue (scheduled appropriately as
the final one in 2016), I encountered memorials, awards, over 400 manuscript titles
eponymous names, biographies including a surprisingly complete Wikipedia entry plus
three already published obituaries (not to mention plus Facebook blogs and tweets too
numerous to count)—most accompanied by full color photos capturing our favorite
curmudgeonss inherent greatness. How could his and Grégoire Hennebert’s precious
literary progeny possibly compete?
We can't. Fortunately this is not a competition (which Dick, in his own inimitable
fashion, would have won hands down) but a chance to honor a man with panache and
personality seemingly born to greatness. Thus we present photographs, long and short
vignettes, and quips that we hope will bring smiles in the wake of a mycological giant
who left us too soon.
THE EDITORIAL FINGER WRITES, AND HAVING WRIT - LIVES ON*—After flirting with
using a black cover for this issue dedicated to Dick followed by a vain attempt to find
a metallic gold that was bright instead of dull, we settled on the yellow-orange color
selected last January for 2016’s fourth issue. It was Noni, Dick’s daughter, who realized
that her dad’s celebration issue would display the identical color he selected in 1973 for
the first volume of Mycoraxon. How pleased (and amused) Dick would have been at
the coincidence.
WHAT DO WE DO WITH ‘INVALID’ HIGHER LEVEL TAXA? The MycoTaxon dictum that
all formal taxonomic names be italicized from subspecies to kingdom level sometimes
causes problems. There was a fair amount of editorial hand wringing in December
as to whether to distinguish the formal taxonomic subfamilies Xylarioideae and
Hypoxyloideae from phylogenetic clades by using italics. As the two subfamilies are
nomenclaturally invalid (Dennis proposed them in 1981 without the then-required
Latin diagnoses), we decided to present them in roman font in this issue's Lee & al. (pp.
749-764) and Johnston & al. (pp. 765-771).
METABOLICALLY INACTIVE CULTURES—Although it seems that the INTERNATIONAL
CODE OF NOMENCLATURE FOR ALGAE, FUNGI, AND PLANTS was only just revised, during
July 23-29, 2017, the 19" International Botanical Congress will ratify in China a new
“Shenzhen Code” to replace 2011’s Melbourne Code. As the current code’s Rec. 8B.3
(“When a culture is designated as a type, the status of the culture should be indicated,
including the phrase ‘permanently preserved in a metabolically inactive state’ or an
equivalent”) is expected to become a requirement, MycoTAXxoN now expects authors
who designate cultures as types of new taxa to cite their inactive metabolic status in
their type paragraphs.
*Adapted from Edward Fitzgerald’s translation of the Rubdaiyat of Omar Khayyam:
“The Moving Finger writes; and, having writ, / Moves on: nor all thy Piety nor Wit/
Shall lure it back to cancel half a Line,/ Nor all thy Tears wash out a Word of it?”
x ... MYCOTAXON 131(4)
SPEEDY PUBLICATION, ACCURACY, AND AUTHORS—Of late, we have received far too
many carelessly prepared submissions. Although we all too aware of the current delays
our authors experience between accession and final nomenclatural approval, we
nonetheless stress once again that all text and illustrations submitted to MycoTAXON
Must be error-free. Manuscripts with unacceptable formatting, incoherent text, and
spelling and grammatical errors will be returned to authors, with the returned revisions
placed at the end of the editorial review queue—needlessly delaying final publication.
Incredibly, three final submissions (12% of the total) intended for MycoTaxon
131(4) contained wrong illustrations, which authors did not think to check until AFTER
they received their PDF files. Such major errors should have been detected well before
final manuscript preparation; at the very least the corrected illustrations should have
been sent to the Editor-in-Chief prior to PDF conversion. Art files are not included in
the errata; rather than publish scientifically erroneous papers, a very unhappy editor
decided to replace the files at deadline and to access correction fees. Be warned!
MYCOTAXON 131(4) presents 24 papers by 103 authors (representing 17 countries) and
revised by 34 expert reviewers.
Within its pages are five new genera (Abieticola from South Korea, Arthromoniliphora
from Brazil, Discopycnothyrium from Thailand, Entalbostroma from New Zealand, and
Podosporiopsis from China) and 16 species new to science representing Abieticola and
Thelenella from South Korea; Alternaria from the U.S.A., Apiosordaria, Blodgettia,
Nawawia, Podosporiopsis, Podosporium, Strigula, and Zasmidium from China;
Arthromoniliphora from Brazil; Discopycnothyrium and Pezicula from Thailand;
Entalbostroma from New Zealand, and Phaeocollybia from Pakistan.
In addition to range extensions and/or new hosts for previously named taxa, we offer
a paper dedicated to the “jubilee ofa flourishing 200-year old girl, Alternaria, that assigns
34 spp. to Alternaria sect. Infectoriae and 3 spp. to A. sect. Pseudoalternaria based on
morphological criteria. Two other papers work to clarify Peziza—one comparing four
troublesome species using both morphological and phylogenetic criteria and another
refining the determinations of 40 collections stored in the Mycological Herbarium of
Tartu (Estonia). Keys are provided for species of Apiosordaria worldwide, Mucor from
Brazil’s Caatinga biome, and Graphis from the African Palaeotropics.
Warm regards,
Lorelei L. Norvell (Editor-in-Chief)
16 January 2017
OCTOBER-DECEMBER 2016... XI
FOUR STEPS TO SUCCESSFUL MYCOTAXON PUBLICATION IN 2017
Prospective MycoTaxon authors should download instructions PDE, review and
submission forms, and other helpful templates by clicking the ‘file download page’ link
on our INSTRUCTIONS TO AUTHORS page before preparing their manuscript. Below is a
summary of our ‘4-step’ publication process.
1—PEER REVIEW: Email formatted text and illustration files with a2017 MycoTaxon
Reviewer Comments Form to 2-3 experts for peer review. Authors should (i) ask
peer reviewers to return revisions and comment forms to BOTH authors and Editor-
in-Chief <[email protected]> and (ii) follow reviewer suggestions before
sending revised files to the Nomenclature Editor for nomenclatural review.
2—NOMENCLATURAL REVIEW: Email all corrected, ERROR-FREE text and
illustration files to the Nomenclature Editor <[email protected]> for
accession and pre-submission review. Place ‘Mycotaxon’ + first author surname
on the subject line; list all peer reviewer names+Email addresses in the message.
The Nomenclature Editor will assign accession numbers and return annotated files
with a list of final corrections to the authors and Editor-in-Chief.
3—FINAL SUBMISSION: Consult experts, thoroughly revise and proof-read
manuscripts to prepare error-free text and image files ready for immediate
publication. LABEL the EMAIL message and EVERY FILE with the accession
number before attaching the (i) 2017 Mycoraxon submission form; (ii) text
files for main text, tables, and legends; (iii) final art files to the Editor-in-Chief
<[email protected]> with the (iv) nomenclatural identification verification
for each new name. The Editor-in-Chief usually Emails all coauthors and expert
reviewers within two weeks of final submission, but please wait at least 14 days
before sending a follow-up query (without attachments).
4—FINAL EDITORIAL REVIEW & PRESS PREPARATION: The Editor-in-Chief, who
rejects or returns for revision files not ready for publication, conducts a final
grammatical and scientific review of tentatvely approved manuscripts and returns
text files to all expert reviewers and coauthors with the final Mycotaxon editorial
review for final author approval. After sending PDF proof, bibliographic citation,
and nomenclatural entries to all coauthors for final inspection, the Editor-in-Chief
will correct ONLY processing or editorial errors prior to publication but will list
corrections of author errors in the ERRATA of a subsequent volume for no charge.
Authors are expected to arrange payment of page charges and optional open access
fees with the Business Manager <[email protected]> at this time.
MyYcoTAXxON LTD— www.mycotaxon.com
The Mycotaxon Webmaster <[email protected]> posts general and
subscription information, important announcements, and author forms and templates
on the official MycoTaxon site. The server also hosts the regional mycobiota webpage
for free download of distributional annotated species lists.
MYCOTAXON ONLINE— www.ingentaconnect.com/content/mtax/mt
Mycotaxon publishes four quarterly issues per year. Both open access and
subscription articles are offered.
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 © 2016. Mycotaxon, Ltd.
October-December 2016—Volume 131, pp. 735-738
http://dx.doi.org/10.5248/131.735
Nawawia oviformis sp. nov. from China
JizE PENG’, Dou CHANG, YING HUANG & ZE-FEN YU*
Laboratory for Conservation and Utilization of Bio-resources, Key Laboratory
for Microbial Resources of the Ministry of Education, Yunnan University,
Kunming, Yunnan, 650091, P. R. China
*CORRESPONDENCE TO: [email protected]
ABSTRACT—Nawawia oviformis, a new species collected from decaying leaves in China, is
described and illustrated. It differs from previously described Nawawia species in having
oviform conidia with 5 setulae, one of which is on the conidial apex.
Keyworps—freshwater fungi, hyphomycetes, taxonomy
Introduction
Nawawia was established by Marvanova (1980) based on Clavatospora
filiformis Nawawi (Nawawi 1973); it is characterized by septate, macronematous
conidiophores, terminal phialidic conidiogenous cells, and turbinate-
tetrahedral to obpyramidal unicellular hyaline conidia with a filiform
appendage at each blunt corner. Six Nawawia species have been described, four
from Malaysia (Crous et al. 2009, Goh et al. 2014, Kuthubutheen et al. 1992,
Nawawi 1973), one from South Africa (Hyde et al. 1996), and one from the
Russian Far East (Mel'nik & Hyde 2006).
In our survey of fungi from decaying leaves collected in a stream in China,
we isolated a species of Nawawia, which differed from the six described species
by its conidial shape.
Materials & methods
Submerged dicotyledonous leaves were collected from a stream in Damuling
Mountain of Gaosun County, Sichuan Province, China. Samples were preserved in zip-
‘These authors contributed these work equally
736 ... Peng, Chang & al.
PLATE 1. Nawawia oviformis (holotype, YMF 1.04361). A, B. Conidia viewed from side;
C. Conidium viewed from above; D. Conidia with conidiophore; E. Conidiophore; F. Conidiogenous
cells. Scale bars: A-C, F = 10 um; D, E = 50 um.
Nawawia oviformis sp. nov. (China) ... 737
locked plastic bags, marked, and later transported to the laboratory. By cutting several
2-4 x 2-4 cm fragments in the laboratory, the rotten leaves were spread on the surface
of CMA medium (20 g cornmeal, 18 g agar, 40 mg streptomycin, 30 mg ampicillin,
1000 ml distilled water) and incubated for about 10 days. Single conidia were isolated
using sterilized needles under a BX51 microscope, and cultivated on CMA in Petri
plates; morphological observations were made after incubation at 28°C for one week.
A metabolically inactive frozen pure culture was deposited in the Herbarium of the
Laboratory for Conservation and Utilization of Bio-resources, Yunnan University,
Kunming, Yunnan, PR. China (YMF; formerly Key Laboratory of Industrial
Microbiology and Fermentation Technology of Yunnan).
Taxonomy
Nawawia oviformis J. Peng & Z.F. Yu, sp. nov. PLATE 1
MycoBaAnk MB815592
Differs from other Nawawia spp. by its oviform conidia.
Type: PR China, Sichuan Province, Gaosun County, Damuling Mountain, 28°92’N
103°88’E, elev. 513 m, on submerged leaves of an unidentified dicotyledonous plant
in a stream, July 2015, Z.F. Yu (Holotype, metabolically inactive frozen culture YMF
1.04361).
EryMo_oey: Latin, oviformis referring to the egg-shaped conidia.
CoLonigs on CMA, reaching about 30 mm diameter after 10 days at 25°C.
Mycelium scanty superficial, mostly immersed composed of branched, septate,
hyaline hyphae. CoNIDIOPHORES arise from a small stromatic cushion,
cylindrical, single, unbranched, erect, robust, thick-walled, smooth, dark
brown, becoming paler towards the apex, 10-13-septate, 246-323 x 4-9 um.
CONIDIOGENOUS CELLS phialidic integrated, terminal, determinate, brown,
21-60 x 3.5-9 um. Conrp1A oviform to somewhat globose, slightly truncate
at the base, unicellular, smooth, hyaline, guttulate, 8-10.5 um diam. 13-20 x
11-15 um, with four equatorial filiform appendages and an apical filiform
appendage, all 3-10 um long.
Discussion
Among the previously described Nawawia species, N. dendroidea,
N. filiformis, N. nitida, and N. sasae-kurilensis have round-tetrahedral or
obpyramidal conidia that are distally 3-lobed and mostly with three apical
setulae, N. quadrisetulata has conidia that are distally 4—-5-lobed and mostly
with four apical setulae, and N. malaysiana has conidia that are distally
4-5-lobed and mostly with one basal and four apical setulae.
Acknowledgements
This work was jointly financed by National Basic Research Program of China
((973’Program: 2013CB127506) and National Natural Science Foundation Program
738 ... Peng, Chang & al.
of PR China (31260007, 31570023). We are very grateful to Prof. X.G. Zhang and
Dr. R.E Castafieda-Ruiz for critically reviewing the manuscript and providing helpful
suggestions to improve this paper.
Literature cited
Crous PW, Groenewald JZ, Lee SS. 2009. Fungal Planet 41 - Nawawia malaysiana. Persoonia 23:
194-195.
Goh TK, Lau WY, Teo KC. 2014. A new species of Nawawia from Malaysia, with a synopsis of the
genus. Mycotaxon 129: 109-118. http://dx.doi.org/ /10.5248/129.109
Hyde KD, Goh TK, Steinke T. 1996. Nawawia dendroidea, a new synnematous hyphomycete
from submerged Phragmites in South Africa. Mycological Research 100: 810-814.
http://dx.doi.org/10.1016/S0953-7562(96)80026-8
Kuthubutheen AJ, Liew GM, Nawawi A. 1992. Nawawia nitida sp. nov. (hyphomycetes) and
further records of Nawawia filiformis from Malaysia. Canadian Journal of Botany 70: 96-100.
http://dx.doi.org/10.1139/b92-013
Marvanova L. 1980. New or noteworthy aquatic hyphomycetes. Clavatospora, Heliscella,
Nawawia and Heliscina. Transactions of the British Mycological Society 75: 221-231.
http://dx.doi.org/10.1016/S0007-1536(80)80083-0
Mel'nik VA, Hyde KD. 2006. Nawawia sasae-kurilenses [sic] sp. nov. from the Russian Far East.
Mikologiya i Fitopatologiya 40: 411-414.
Nawawi A. 1973. Clavatospora filiformis sp. nov., an aquatic hyphomycete from Malaysia.
Transactions of the British Mycological Society 61: 390-393.
http://dx.doi.org/10.1016/S0007-1536(73)80163-9
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 © 2016. Mycotaxon, Ltd.
October-December 2016—Volume 131, pp. 739-748
http://dx.doi.org/10.5248/131.739
Pezicula chiangraiensis sp. nov. from Thailand
ANUSHA H. EKANAYAKA?»”3, DINUSHANI A. DARANAGAMA®”4,
HirRAN A. ARIYAWANSA®, E. B. GARETH JONES‘,
AI H. BAKHALI® & KEVIN D. HyDE”°*
‘Center of Excellence in Fungal Research, and School of Science, Mae Fah Luang University,
Chiang Rai 57100, Thailand
? Key Laboratory for Plant Diversity and Biogeography of East Asia,
Kunming Institute of Botany, Chinese Academy of Sciences,
Kunming 650201, Yunnan, People’s Republic of China
°World Agro forestry Centre East and Central Asia Office,
132 Lanhei Road, Kunming 650201, Peoples Republic of China
‘State Key Laboratory of Mycology, Institute of Microbiology, Chinese Academy of Sciences,
No. 3 Ist West Beichen Road, Chaoyang District Beijing 100101, China
°Guizhou Key Laboratory of Agricultural Biotechnology, Guizhou Academy of Agricultural Sciences,
Guiyang, 550006, Guizhou, Peoples Republic of China
°Department of Botany and Microbiology, College of Science, King Saud University,
PO. Box: 2455, Riyadh 1145, Saudi Arabia
* CORRESPONDENCE TO: [email protected]
ABSTRACT—A sexual morph of a new species, Pezicula chiangraiensis, was collected on bark
of decaying wood in Chiang Rai Province, Northern Thailand. Morphologically it is closely
related to P. cinnamomea but differs by its ascospores having a gelatinous sheath; in culture it
produces a sporodochium-like asexual morph. Phylogenetic analysis of combined ITS, LSU,
and RPB2 sequence data confirmed that P chiangraiensis is distinct from other Pezicula spp.
The new species is described, illustrated, and compared with similar taxa.
KEY worDs—Cryptosporiopsis, Dermateaceae, discomycetes, phylogeny, taxonomy
Introduction
Pezicula Tul. & C. Tul. (Leotiomycetes, Helotiales, Dermateaceae), a wide-
spread discomycete genus typified by Peziza carpinea Pers., was established
by Tulasne & Tulasne (1865). Verkley (1999) accepted 26 species in Pezicula.
740 ... Ekanayaka & al.
Subsequently, two new species and nine new combinations have been added to
the genus (Johnston et al. 2014, Yuan & Verkley 2015, Zhong et al. 2001).
Pezicula species are characterized mainly by brightly coloured apothecia,
which occur on the bark of woody plants (Ooki et al. 2003). The apothecia
are frequently sessile, erumpent, and occasionally short-stalked with circular
discs (Verkley 1999). The disc, initially concave and surrounded by slightly
elevated margins, later becomes convex in most species (Verkley 1999). Most
Pezicula species have 8-spored, clavate, or cylindric-clavate inoperculate asci.
Ascospores vary in shape from broadly ellipsoid to elongately ellipsoid to
allantoid or fusoid (Ooki et al. 2003, Verkley 1999).
Cryptosporiopsis has been reported as the asexual morph of Pezicula
and 20 of the 26 Pezicula species accepted by Verkley (1999) are known to
have Cryptosporiopsis asexual morphs. Cryptosporiopsis species produce
sporodochial conidiomata, and most produce both macroconidia and
microconidia that form on different conidiophores (Verkley 1999).
Pezicula and Cryptosporiopsis species are generally known as plant
pathogens (Ooki et al. 2003). One Cryptosporiopsis species causes twig rot
of cherry (Koiwa & Yamada 1996), and C. corticola (Edgerton) Nannf., the
asexual morph of Pezicula corticola (C.A. Jorg.) Nannf., is reported to cause
bull’s-eye rot of Japanese pear. Pezicula cinnamomea (DC.) Sacc. causes stem
canker of apple and pear (Nitta et al. 2002). Pezicula species are also endophytes
(Kowalski & Kehr 1996). They play an important role in natural pruning that
helps to produce a clean bole by decaying and shedding of dead branches
(Kowalski & Kehr 1996). Species in this genus predominantly colonize woody
twigs, although some occur on herbaceous plants (Gené et al. 1990, Kowalski
& Bartnik 1995, Kowalski et al. 1998, Sankaran et al. 1995, Zhong et al. 2001).
Most Pezicula species have been recorded from temperate and boreal forests
of the northern hemisphere (Verkley 1999), with only a few species described
from the southern hemisphere (Sankaran et al. 1995, Zhuang & Korf 1988).
Here we provide detailed morphological descriptions of sexual and
asexual morphs of a new species, Pezicula chiangraiensis, and morphological
comparisons with other closely related taxa. We also provide a multi-gene
phylogenetic tree for Pezicula to infer the phylogenetic relationships of
P. chiangraiensis with other Pezicula spp.
Materials & methods
A collection of Pezicula was made in Chiang Rai Province, Northern Thailand, in
January 2015. Macroscopic and microscopic characters of the specimen were recorded.
A Motic SMZ-168 stereomicroscope was used to observe the structure of the apothecia.
Sections of apothecia were made by hand with a razor blade and mounted in water
Pezicula chiangraiensis sp. nov. (Thailand) ... 741
and preserved in lacto-glycerol. A Nikon ECLIPSE 80i compound microscope was
used to observe microscopic characters. Indian ink was added to detect the presence
of mucilaginous sheaths. The amyloidity of asci was tested using Meltzer’s reagent.
Photomicrography was carried out with a Canon 450D digital camera fitted to the
microscope. Measurements of apothecia, paraphyses, asci, and ascospores were made
from material mounted in water. Measurements were made with the Taro soft (R) Image
Frame Work v. 0.9.7 program and images used for figures were processed with Adobe
Photoshop CS6 software (Adobe Systems).
TABLE 1 Loramyces and Pezicula species used in the phylogenetic analysis.
New sequences are in bold.
GENBANK ACCESSION NO.
SPECIES CULTURE NO.
ITS SU. RPB2
L. macrosporus AFTOL-ID 913 JN033383 DQ470957 DQ470907
P. acericola CBS 239.97 KF376154 KR858884 KF376214
CBS 245.97 KF376153 KR858889 KF376213
P. aurantiaca CBS 201.46 KF376150 KR858893 KF376210
P. californiae CBS 124805 KR859104 KR858895 KR859332
CBS 124819 GU973504 GU973597 -
P. carpinea CBS 324.97 KF376156 KR858896 KF376160
CBS 921.96 KF376155 KR858898 KF376159
P. chiangraiensis MFLUCC 15-0170 KU310621 KU310622 KU310623
P. cinnamomea CBS 239.96 KF376102 KR858915 KF376165
CBS 625.96 KF376104 KR858943 KF376164
CBS 240.96 KF376105 KR858916 KF376163
CBS 626.96 KF376103 KR858944 KF376162
P. corni CBS 285.39 AF141182 - -
P. corticola CBS 259.31 AF141179 KR858956 -
CBS 260.31 KR859165 KR858957 -
P. corylina CBS 249.97 KF376106 KR858960 KF376161
P. diversispora CBS 185.50 KR859170 KR858962 -
CBS 282.47 KR859171 KR858963 -
P. eucrita CBS 656.96 KF376144 KR858977 KF376208
CBS 257.97 KR859177 KR858969 -
P. frangulae CBS 778.96 KF376151 KR859001 KF376212
CBS 100244 KF376152 KR858996 KF376211
P livida CBS 262.31 AF141180 = -
P. melanigena CBS 898.97 KR859211 KR859003 =
P. neosporulosa CBS 724.95 KR859231 KR859023 -
CBS 660.95 KR859228 KR859020 -
CBS 101.96 KR859223 KR859015 -
P. ocellata CBS 949.97 KF376149 KR859025 KF376215
P. pruinosa CBS 292.39 AF141188 KR859026 -
P. rubi CBS 253.97 KF376100 KR859042 KF376204
CBS 593.96 KF376101 KR859045 KF376203
P. sporulosa CBS 224.96 AF141172 KR859053 KF376201
CBS 225.96 KF376107 KR859054 KF376202
P. subcarnea CBS 203.46 AF141171 KR859059 -
742 ... Ekanayaka & al.
Observation of cultures and asexual morph
A pure culture was obtained from single spore isolation as described by Chomnunti
et al. (2014). Germinating spores were transferred to malt extract agar (MEA) and
incubated at 25 °C for one week. Cultural characteristics, such as mycelium colour,
shape and texture, were determined. After one week, hyphal tips were cut and
transferred to new media. The cultures were incubated at 25 °C under light for one
week and growth rate was measured. After one week, cultures on MEA were checked for
asexual structures. Conidiophores, conidiogenous cells and conidia were observed and
measured by phase contrast microscopy under 400x and 1000x optical magnifications.
The type specimen was deposited in the Mae Fah Luang University Herbarium, Chiang
Rai, Thailand (MFLU) and an ex-type culture in Mae Fah Luang University Culture
Collection (MFLUCC). A Faces of Fungi number was obtained as described in Jayasiri
et al. (2015).
DNA isolation, PCR, and sequencing
The fungal isolate was grown on potato dextrose agar (PDA) for 7-21 days at 25 °C.
Total genomic DNA was extracted as described by Thambugala et al. (2015). Polymerase
chain reactions (PCR) were carried out using three partial gene regions: ITS4 and ITS5
(White et al. 1990) for the internal transcribed spacer (ITS); LROR and LRS (Vilgalys &
Hester 1990) for the nuclear ribosomal large subunit (LSU); and fRPB2-5F and fRPB2-
7cR (Liu et al. 1999) for RNA polymerase IT (RPB2). The PCR mixtures (25 uL) contained
ddH,O (9.5 wL), PCR Master Mix (TIANGEN Co., China) (12.5 uL; 2x), DNA template
(1 wL), each primer (1 wL; 10 uM). Amplification conditions for all regions comprised
an initial denaturation step at 94 °C for 5 min and final extension step at 72 °C for 10
minutes. ITS amplification comprised 34 cycles of denaturation at 94 °C for 30 seconds,
annealing at 55 °C for 30 seconds and elongation at 72 °C for 1 minute. LSU and RPB2
amplification comprised 37 cycles of denaturation at 94 °C for 1 minute, annealing at 54
°C for 50 seconds, and elongation at 72 °C for 1 minute. The PCR products were viewed
on 1% agarose electrophoresis gels stained with ethidium bromide. The PCR products
were purified and sequenced at Invitrogen Biotechnology Co., Shanghai, China.
Sequence alignment and phylogenetic analysis
Newly generated sequences were subjected to a standard BLAST search of GenBank
for rough identification. Eighty-nine sequences belonging to three gene regions (ITS,
LSU, RPB2) from representative Pezicula species and the outgroup taxon Loramyces
macrosporus Ingold & B. Chapm. were downloaded from GenBank (TaBLE 1); these
sequences were published by Abeln et al. (2000), Chen et al. (2016), Spatafora et al.
(2006), and Verkley (1999). The newly generated sequences were deposited in GenBank
(TABLE 1). The consensus sequences for each gene were aligned using MAFFT v.
6.864b (http://mafft.cbrc.jp/alignment/server/index.html). The single alignment
was improved manually where necessary using BioEdit (Hall 2004). The single
gene alignments were concatenated into a combined dataset. Maximum likelihood
phylogenetic analyses were performed in CIPRES web portal (Miller et al. 2009) using
RAXxML-HPC Black Box (8.2.4) tool (Stamatakis 2006). The combined gene analysis
was carried out using default conditions. The best scoring tree was selected with a final
likelihood value of —7794.684804. The resultant tree was viewed with FigTree v.1.4.0
Pezicula chiangraiensis sp. nov. (Thailand) ... 743
(http://tree.bio.ed.ac.uk/software/figtree/). Maximum Likelihood bootstrap values 260%
are given near the nodes (Fie. 1).
Molecular phylogeny
A backbone tree for the genera Pezicula, Cryptosporiopsis, and Neofabraea
was generated using ITS sequence data (data not shown). Two basic clades,
the Pezicula-Cryptosporiopsis clade and the Neofabraea clade, were identified
in the backbone tree, and Pezicula chiangraiensis grouped with other Pezicula
species within the Pezicula—Cryptosporiopsis clade. A single gene tree for the
genus Pezicula was generated from ITS sequence data (data not shown). As
the single gene tree shows several taxonomic disagreements, a combined ITS,
LSU and RPB2 dataset comprising 34 strains of Pezicula species with Loramyces
macrosporus (CBS 235.53) as outgroup was generated to determine the exact
species placement of our strain (Fic. 1). The resulting tree supports our new
isolate in a distinct sister clade to Pezicula cinnamomea with strong bootstrap
support (93%).
Pezicula sporttosa CBS 225 96
Pezicufa sporulosa CBS 224 96
37
66 #9 Pezicula tivida CBS 262 31
re) I Pezieuta neosporulasa CBS 724 95
92K! Pezicute neosporutosa CBS 66095
Pezicula neosporulosa CBS 101 96
Pezicula cinnamomea CBS 626 96
Pezicula cinnamomea CBS 625 96
a Pezicula cinnamomea CBS 240 96
# Pexicula cinnamomea CRS 239 96
Pezicula chiangraiensis NIFLUCC 15-0470
95 _¢ Pezicuta rubi CBS 253 97
100 Pezicula rubi CBS $93 96
Pezicula corticola CBS 25¢
871 | Pezicuia eucrita CBS 257 97
(001 Pezicula eucrita CBS 656 96
100, Pezieule diversispora CBS 185 50
Pezicuta diversispora CBS 282 47
Pezicula aurantiaca CBS 201 46
Pezicula subcarnea CBS 203 46
Pezicula melanigena CBS 898 97
100) Pezicula acericola CBS 245 97
7 Pezicuta acericoke CBS 239 97
Pesicula pruinasa CBS 292 39
Peziciuta corni CBS 285 39
9O8
Pezicula ovellata CBS 949.97
fie Pezicula corticola CBS 260 31
1004 Pezicula frangulae CIS 100244
Pesicuta frangulae CBS 778 96
100, Pezicula californiae CBS 124819
Pezicula catiforniae CBS 124805
Pezicula corytina CBS 249 97
98 | Pezicula carpinea CBS 324.97
Pezicula carpinea CBS 921 96
Loramyces macresperus AFTOL ID 913
Fic. 1. The best scoring RAxML maximum likelihood phylogenetic tree based on a combined ITS,
LSU, and RPB2 sequence dataset. Strain/culture numbers are given following the taxon names.
The newly generated sequences are in bold. Bootstrap support values for maximum likelihood
>60% are given near the nodes. The tree is rooted with Loramyces macrosporus (CBS 235.53).
744 ... Ekanayaka & al.
Taxonomy
Pezicula chiangraiensis Ekanayaka & K.D. Hyde, sp. nov. PLATES 1, 2
INDEX FUNGORUM IF551789
Differs from other Pezicula species by possessing ascospores with a gelatinous sheath.
Type: Thailand, Chiang Rai Province, Kun Korn waterfall, 21 January 2015, A.H.
Ekanayaka (Holotype, MFLU 15-3566; ex-type culture, MFLUCC 15-0170; GenBank
KU310621, KU310622, KU310623).
EryMo_ocy: With reference to the province where the holotype was collected.
FACESOFFUNGI: FoF 01667
SEXUAL MORPH: SAPROBIC on dead stems. APOTHECIA 800-870 x 230-280 um
(x = 826 x 253 um, n = 10), arising singly or in small groups, sessile, slightly
erumpent from the substrate, subsphaerical, urceolate, bright yellow when
fresh, brownish yellow when dried. Disc convex. RECEPTACLE yellow to light
brown when fresh. ECTAL EXCIPULUM variably thick, composed of large thin-
walled yellow cells in a textura angularis. MEDULLARY EXCIPULUM thin, not
clearly distinguishable, composed of vertically arranged rows of yellow cells
in a textura prismatica. HyMENIUM hyaline. PaRAPHYSES 1.8-2.1 um diam.
(x = 2.0 um, n = 20), numerous, filiform, obtuse, septate, branched, slightly
enlarged at the apex. Asci 90-120 x 15-25 um (x = 108 x 19 um, n = 30),
8-spored, unitunicate, cylindric-clavate, short pedicellate, arising from croziers
with conical and non-amyloid apices. Ascospores 18-22 x 8-10 um (x = 20 x
9 um, n = 40), partially biseriate, lower spores uniseriate, hyaline to grey,
fusoid, gelatinous sheath present; immature spores non-septate and filled with
guttules; mature spores 3-septate, aguttulate, and smooth-walled.
ASEXUAL MORPH: CONIDIOMATA sporodochium-like, produced in 7-day-old
cultures, gregarious, dark brown. CONIDIOPHORES 11-12 x 5-6 (x = 11.5 x
5.8 um, n = 20), branched near the base, septate, smooth-walled, composed
various size cells. CONIDIOGENOUS CELLS holoblastic, cylindrical, smooth,
hyaline. Conrp1a 23-29 x 11-12 um (x = 25.2 x 11.2 um, n = 20), cylindrical,
straight, smooth with rounded apex and slightly truncate base, multi-guttulate
or filled with granular cytoplasm, hyaline and aseptate when immature, pale
brown and 1-3-transversely septate at maturity.
CULTURE CHARACTERISTICS: Ascospores germinating on MEA within 24 h.
Colonies on MEA plates at 25-27 °C reaching 2 cm diameter within 1 week,
circular, flat or effuse, with diffuse edge, medium honey-brown, grey aerial
mycelium surrounded by pink mycelia, mycelium composed of 2-3 um wide,
septate, branched, smooth, hyaline hyphae, reverse dark brown to black.
Notes—Pezicula cinnamomea is morphologically similar to P chiangraiensis
in having apothecia, paraphyses, asci, and ascospores of a similar size and
Pezicula chiangraiensis sp. nov. (Thailand) ... 745
PiaTE 1. Pezicula chiangraiensis (holotype, MFLU 15-3566), sexual morph: a. Substrate;
b. Ascomata on wood; c. Ascoma; d. Cross section of ascoma; e. Vertical section of ascomal margin;
f. Septate paraphyses; g-j. Short pedicellate asci; k. Germinated ascospore; |. Apex of mature ascus;
m. Ascospore with gelatinous sheath; n—q. Fusoid ascospores. Scale bars: b = 500 um; c, e = 100 um;
d = 300 um; f, k = 50 um; g-j = 40 um; |, m = 20 um; n-q = 10 um.
shape, but differs by its pale luteous to cinnamon or red-brown apothecia, its
transversely and longitudinally septate spores without gelatinous sheaths, its
faster growth rate, and absence of diffusing pigment in culture (Ooki et al. 2003,
746 ... Ekanayaka & al.
PLATE 2. Pezicula chiangraiensis (MFLUCC 15-0170), asexual morph in culture: a. 7-day-old MEA
colony from above; b. 7-day-old MEA colony from below; c. Conidiomata; d. Conidioma; e. Septate
and branched hyphae; f. Fragment of small sporodochium-like conidioma; g, h. Different stages of
conidiogenesis; i-l. Conidia at different stages. Scale bars: e = 50 um; f, j-1 = 20 um; g, h = 30 um;
i=10um.
Verkley 1999). Pezicula aesculea Kirschst. differs from P chiangraiensis
by its larger apothecia, asci, and ascospores; P. amoena Tul. & C. Tul. by its
dark brown, thick-walled ascospores; P. heterochroma Verkley, P. frangulae
(Pers.) Fuckel, P rubi (Lib.) Niessl, P puberula (EJ. Durand) Verkley,
P. crataegicola (E.J. Durand) J.W. Groves, P. myrtillina (P. Karst.) P. Karst., and
P. grovesii Wehm. by their short, stout stalked apothecia; P linda Korf and
Pezicula chiangraiensis sp. nov. (Thailand) ... 747
P. sepium (Desm.) Dennis by their asci with an amyloid ring; P tasmanica
W.Y. Zhuang & Korf by its positive reaction with Meltzer reagent after
pretreating with KOH; P hamamelidis J.W. Groves & Seaver by its broader
apothecial base that is entirely hidden under the bark of its host substrate; and
P. melastomatis Rehm by its smaller asci and ascospores (Verkley 1999). The
asexual morphs of most Pezicula species produce both macro and microconidia
(Verkley 1999), but microconidia were not observed in P. chiangraiensis.
Acknowledgments
This work was supported by the International Research Group Program (IRG-14-27),
Deanship of Scientific Research, King Saud University, Saudi Arabia. Anusha H.
Ekanayaka is grateful to Dr. Peter R. Johnston for valuable suggestions, to Dr. Eric
McKenzie and Dr. Qi Zhao for presubmission reviews, and to Mr. W. Ekanayaka
(deceased), Mrs. C. Ekanayaka, and Mr. A. Surasinghe for their valuable support and
encouragement.
Literature cited
Abeln ECA, de Pagter MA, Verkley GJM. 2000. Phylogeny of Pezicula, Dermea and Neofabraea
inferred from partial sequences of the nuclear ribosomal RNA gene cluster. Mycologia 92(4):
685-693. http://dx.doi.org/10.2307/3761426
Chen C, Verkley GJM, Sun G, Groenewald JZ, Crous PW. 2016. Redefining common endophytes
and plant pathogens in Neofabraea, Pezicula and related genera. Fungal Biol. 120(11):
1291-1322. http://dx.doi.org/10.1016/j.funbio.2015.09.013
Chomnunti P, Hongsanan S, Aguirre-Hudson B, Tian Q, Persoh D, Dhami MK, Alias AS,
Xu J, Liu X, Stadler M, Hyde KD. 2014. The sooty moulds. Fungal Divers. 66(1): 1-36.
http://dx.doi.org/10.1007/s13225-014-0278-5
Gené J, Guarro J, Figueras MJ. 1990. A new species of Cryptosporiopsis causing bud rot of Corylus
avellana. Mycol. Res. 94: 309-312. http://dx.doi.org/10.1016/S0953-7562(09)80355-9
Hall T. 2004. BioEdit. Ibis Therapeutics, Carlsbad, CA, 92008, USA.
http://www.mbio.ncsu.edu/BioEdit/bioedit.html.
Jayasiri SC, Hyde KD, Ariyawansa HA, Bhat J, Buyck B, Cai L, Dai YC, Abd-Elsalam KA, Ertz D,
Hidayat I, Jeewon R, Jones EBG, Bahkali AH, Karunarathna SC, Liu JK, Luangsa-ard JJ,
Lumbsch HT, Maharachchikumbura SSN, McKenzie EHC, Moncalvo, JM, Ghobad-Nejhad
M, Nilsson H, Pang KA, Pereira OL, Phillips AJL, Raspé O, Rollins AW, Romero AI, Etayo J,
Selcuk FE, Stephenson SL, Suetrong S, Taylor JE, Tsui CKM, Vizzini A, Abdel-Wahab MA,
Wen TC, Boonmee S, Dai DQ, Daranagama DA, Dissanayake AJ, Ekanayaka AH, Fryar SC,
Hongsanan S, Jayawardena RS, Li WJ, Perera RH, Phookamsak R, de Silva NI, Thambugala KM,
Tian Q, Wijayawardene NN, Zhao RL, Zhao Q, Kang JC, Promputtha I. 2015. The Faces of
Fungi database: fungal names linked with morphology, phylogeny and human impacts. Fungal
Divers. 74: 3-18. http://dx.doi.org/10.1007/s13225-015-0351-8
Johnston PR, Seifert KA, Stone JK, Rossman AY, Marvanova L. 2014. Recommendations on
generic names competing for use in Leotiomycetes (Ascomycota). IMA Fungus 5(1): 91-120.
http://dx.doi.org/10.5598/imafungus.2014.05.01.11
Koiwa T, Yamada T. 1996. Fungi associated with the damaged twigs of cherry trees, and their
pathogenicity (in Japanese). Trans. Jap. For. Soc. 107: 275-276.
Kowalski T, Bartnik C. 1995. Cryptosporiopsis radicicola sp. nov. from roots of Quercus robur.
Mycol. Res. 99: 663-666. http://dx.doi.org/10.1016/S0953-7562(09)80524-8
748 ... Ekanayaka & al.
Kowalski T, Kehr RD. 1996. Fungal endophyte of living branch bases in several European tree
species. 67-86, in: SC Redlin, LM Carris (eds). Endophytic fungi in grasses and woody plants.
APS Press, St. Paul.
Kowalski T, Halmschlager E, Schrader K. 1998. Cryptosporiopsis melanigena sp. nov., a root-
inhabiting fungus of Quercus robur and Q. petraea. Mycol. Res. 102: 347-354.
http://dx.doi.org/10.1017/S0953756297004991
Liu YJ, Wheelen S, Hall BD. 1999. Phylogenetic relationships among ascomycetes: evidence from
an RNA polymerase II subunit. Mol. Biol. Evol. 16: 1799-1808.
http://dx.doi.org/10.1093/oxfordjournals.molbev.a026092
Miller MA, Holder MT, Vos R, Midford PE, Liebowitz T, Chan L, Hoover P, Warnow T. 2009.
The CIPRES Portals. http://www.phylo.org/sub_sections/portal. Accessed: December 2015.
Nitta H, Sato T, Kobayashi T, Kurihisa H, Nishikawa Y, Miyoshi M. 2002. Bull’s-eye rot of Japanese
pear caused by Cryptosporiopsis corticola (Edgerton) Nannfeldt (abstract in Japanese). Jap. J.
Phytopathol. 68: 190.
Ooki Y, Fujita T, Harada Y. 2003 Pezicula cinnamomea from cherry tree: pathogenicity tests and
photomorphogenesis in culture. Mycoscience 44: 319-326.
http://dx.doi.org/10.1007/s10267-003-0122-3
Sankaran KV, Sutton BC, Balasundaran M. 1995. Cryptosporiopsis eucalypti sp. nov., causing leaf
rot of eucalypts in Australia, India and U.S.A. Mycol. Res. 99: 827-830.
http://dx.doi.org/10.1016/S0953-7562(09)80735-1
Spatafora JW, Sung GH, Johnson D, Hesse C, O’Rourke B, Serdani M, Spotts R, Lutzoni F,
Hofstetter V, Miadlikowska J, Reeb V, Gueidan C, Fraker E, Lumbsch T, Lucking R, Schmitt I,
Hosaka K, Aptroot A, Roux C, Miller AN, Geiser DM, Hafellner J, Hestmark G, Arnold AE,
Budel B, Rauhut A, Hewitt D, Untereiner WA, Cole MS, Scheidegger C, Schultz M, Sipman
H, Schoch CL. 2006. A five-gene phylogeny of Pezizomycotina. Mycologia 98(6): 1018-1028.
http://dx.doi.org/10.3852/mycologia.98.6.1018
Stamatakis A. 2006. RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with
thousands of taxa and mixed models. Bioinformatics 22: 2688-2690.
http://dx.doi.org/10.1093/bioinformatics/btl446.
Thambugala KM, Hyde KD, Tanaka K, Tian Q, Wanasinghe DN, Ariyawansa HA, Jayasiri SC,
Boonmee S, Camporesi E, Hashimoto A, Hirayama K, Schumacher RK, Promputtha I, Liu ZY.
2015. Towards a natural classification and backbone tree for Lophiostomataceae, Floricolaceae,
and Amorosiaceae fam. nov. Fungal Divers. 74: 199-266.
http://dx.doi.org/10.1007/s13225-015-0348-3
Tulasne LR, Tulasne C. 1865. Selecta fungorum carpologia, vol. 3. Paris.
Verkley GJM. 1999. A monograph of the genus Pezicula and its anamorphs. Stud. Mycol. 44. 180 p.
Vilgalys R, Hester M. 1990. Rapid genetic identification and mapping of enzymatically amplified
ribosomal DNA from several Cryptococcus species. J. Bacteriol. 172: 4238-4246.
White TJ, Bruns T, Lee S, Taylor JW. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in: MA Innis MA et al. (eds). PCR protocols: a guide to
methods and applications. New York Academic Press.
http://dx.doi.org/10.1016/B978-0-12-372180-8.50042-1
Yuan ZL, Verkley GJM. 2015. Pezicula neosporulosa sp. nov. (Helotiales, Ascomycota), an endophytic
fungus associated with Abies spp. in China and Europe. Mycoscience 56(2):205-213.
http://dx.doi.org/10.1016/j.myc.2014.06.004
Zhong Z, Wang Z, Pfister DH. 2001. Pezicula magnispora, a new species on an herbaceous plant.
Mycotaxon 78: 161-165.
Zhuang WY, Korf RP. 1988. A new species of Pezicula on leaves of Phyllocladus aspleniifolius in
Tasmania. Mycotaxon 31: 225-228.
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 © 2016. Mycotaxon, Ltd.
October-December 2016—Volume 131, pp. 749-764
http://dx.doi.org/10.5248/131.749
Abieticola koreana gen. et sp. nov., a griseofulvin-producing
endophytic xylariaceous ascomycete from Korea
HYANG BurRM LEE?*, HYE YEON Mun?”, THI THUONG THUONG NGUYEN’,
JIN-CHEOL KIM? & JEFFREY K. STONE?
‘College of Agriculture & Life Sciences, Chonnam National University,
Gwangju 61186, Republic of Korea
*Fungal Resources Research Division, Nakdonggang National Institute of Biological Resources,
Sangju 37242, Republic of Korea
°Department of Botany & Plant Pathology, Cordley Hall 2082, Oregon State University,
Corvallis, OR 97331-2902, USA
*CORRESPONDENCE TO: [email protected]
ABSTRACT—A new genus and species. Abieticola koreana, is described. This xylariaceous
fungus was isolated from the inner bark of a Manchurian fir (Abies holophylla) in Korea.
Phylogenetic analyses based on the sequences of four gene regions—ITS1-5.8S-ITS2, 28S,
6-tubulin, and rpb2—were used to confirm this new genus and species.
Key worDs—Ascomycota, anamorph, multigene, Xylarioideae, Xylariaceae
Introduction
The Xylariaceae is a large family of ascomycetes comprising approximately
85 genera and at least 1,340 species that are distributed worldwide and exhibit
exceptional diversity in the tropics (Whalley 1996, Velmurugan et al. 2013,
Stadler et al. 2014). It has been estimated that the Xylariaceae contains 10,000
undescribed species (Stadler 2011, Richardson et al. 2014). Recent phylogenetic
studies (Tang et al. 2009, Daranagama et al. 2015) using combined ITS, LSU,
rpb2, and $-tubulin sequences, suggested that Xylariaceae has two major
lineages, Xylarioideae and Hypoxyloideae.
To date, 11 genera of Xylariaceae have been shown to occur as endophytes
of various plants (Pazoutova et al. 2013), including firs, palms, orchids,
bromeliads, aroids, ferns, and rainforest trees (Dreyfuss & Petrini 1984, Bayman
750 ... Lee & al.
et al. 1998; San Martin et al. 2001; Park et al. 2005). Recently, endophytes have
been predominantly investigated because of their ability to produce either new
or interesting secondary metabolites and for their potential use in bioenergy
applications (Bayman et al. 1997, Isaka et al. 2000, Boonphong et al. 2001,
Wiyakrutta et al. 2004, Park et al. 2005, Liu et al. 2007).
During screening for organisms that produce antifungal agents, an
endophytic fungus designated as FO010, was isolated from the inner bark of
Abies holophylla (Manchurian fir), a tree that is widespread in Korea (Park
et al. 2005). Initially, the isolate was provisionally identified as an unknown
species of Xylaria and was shown to produce two antifungal metabolites,
dechlorogriseofulvin and griseofulvin (Park et al. 2005). However, further
investigation suggested that FO010 differs from species classified in Xylaria
based on both morphological details of the anamorph and on molecular
phylogenetic analyses.
The objectives of this study were to image the ultrastructure of the conidial
state of FO010 by scanning electron microscopy (SEM), for comparison of its
mode of conidiogenesis with that of other Xylariaceae, and to investigate its
phylogenetic relationship to other xylariaceous fungi based on a multigene
analysis, including the nuclear ribosomal ITS1-5.8S-ITS2 and 28S subunit,
rpb2, and 6-tubulin gene sequences. As a result of this study, a new genus
Abieticola and species A. koreana are proposed here to accommodate this novel
xylariaceous fungus.
Materials & methods
Fungal isolation
Samples of Abies holophylla bark were collected from a garden in Daejeon, Korea,
placed in zip-lock bags, stored in a refrigerator, and then used for the isolation of
endophytic fungi within 72 h after sampling. Samples were cleaned under running
tap water and then air-dried. The samples were surface sterilised by immersion in
70% ethanol for 1 min and a 3.5% sodium hypochlorite solution for 5 min. Next, the
surface-sterilized samples were washed in sterile water three times to remove the surface
sterilization agents (Wiyakrutta et al. 2004). The samples were then cut into small pieces
and placed on cornmeal malt extract agar (17.0 g of cornmeal, 20.0 g of malt extract,
2.0 g of yeast extract, and 20 g agar in 1.0 L of distilled water) supplemented with
chloramphenicol (50 mg/mL) (Sigma, St. Louis, MO, USA), and then incubated at 25°C
for up to 3 weeks. Individual fungal strains were transferred to potato dextrose agar
(PDA, Bacto Potato Dextrose Dehydrated, Becton Dickinson, USA) and incubated at
25°C for at least 2 weeks. After checking for purity, each fungal culture was transferred
to a fresh agar plate. Stock cultures of test species were grown on MEA at 25°C and used
as inocula. The basal medium consisted of 2% malt extract agar (MEA, Difco) at pH 5.5.
The water activity (a,) of the basal MEA medium was 0.999, which was modified to 0.95,
0.98, and 0.995 by addition of KCl and glucose. The a, of media was measured using
Abieticola koreana gen. & sp. nov. (Korea) ... 751
a Novasina ICII (Novasina AG, Zurich, Switzerland). The growth of the fungus was
determined by transferring mycelial plugs (5 mm diameter) from the growing margin
of stock cultures in Petri dishes (90 x 15 mm). After inoculation, plates with the same a,
were sealed in polyethylene bags and incubated at 20, 25, and 30°C in darkness for up
to 10 days. Mycelial growth was recorded periodically by measuring the diameter of the
colony in two directions at right angles to each other.
Ten strains, FO010-1 to FO010-10, were derived from isolate FO010. Dried MEA
cultures were conserved in Chonnam National University Fungal Collection, Gwangju,
Korea (CNUFC), and live cultures were conserved in CNUFC and in the Korean
Collection for Type Cultures, Daejeon, Korea (KCTC).
Ultrastructure of isolate FO010
The micromorphological features of strain FO010-1 were investigated by light
microscopy (LM) with a Nikon Labophot 2 Microscope (Nikon, Tokyo, Japan) with
differential interference contrast optics. For scanning electron microscopy (SEM),
samples were fixed in 2.5% paraformaldehyde-glutaraldehyde in 0.1 M phosphate buffer
(pH 7.2) for 2 h, post-fixed with 1% OsO, in the same buffer for 1 h, dehydrated in
graded ethanol, substituted by isoamyl acetate and then critical-point dried in CO,,.
Finally, the sample was sputter-coated with gold (SC502; Polaron, West Sussex, UK)
and observed with a SEM515 scanning electron microscope (Phillips, Eindhoven, the
Netherlands) and an S-3500N low vacuum scanning microscope (Hitachi Science
Systems Ltd., Tokyo, Japan).
DNA extraction and PCR amplification
Strains FO010-1 and FO010-2 were grown on PDA, covered with cellophane at 25°C
for 4-5 days. Genomic DNA was extracted using the HiGene™ Genomic DNA Prep
Kit for fungi (Biofact Co., Daejeon, Korea). The target regions, ribosomal ITS1-5.8S-
ITS2, 28S subunit, B-tubulin, and rpb2 (RNA polymerase II subunit 2) were amplified
by PCR (TABLE 1) in 20 uL reaction mixtures containing 2 uL of genomic DNA, 1.5 uL
of each primer (5 pM), 14 uL of demineralised sterile water, and 1 uL of PCR premix
TABLE 1. Primers and annealing conditions used in the molecular analysis.
ANNEALING TEMP.
Locus PRIMER SEQUENCE (5’-3’) (°C) REFERENCE
te LR5F GCTATCCTGAGGGAAAC
55 (30 sec) Vilgalys &
LROR ACCCGCTGAACTTAAGC Hester 1990
B-tubulin BL
a GGTAACCAAATCGGTGCTGCTTTC 59 (Limin) Sang et al.
2010
Bt2b ACCCTCAGTGTAGTGACCCTTGGC
FESSDNS ITS1 T TAGGTGAACCT
SORES LGC ECETCCeS 55 (30 sec) White et al.
ITS4 TCCTCCGCTTATTGATATGC 1990
rpb2 RPB2-5F_Eur GAYGAYCGKGAYCAYTTC 50-72 (1 min), Hibbett 2006;
ramping 0.3°C Houbraken et
RPB2-7CR_Eur = CCCATRGCYTGYTTRCCCAT per sec al. 2011
752... Lee & al.
(Bioneer, Daejeon, Korea) using the following fungal-specific primer sets: ITS1 and
ITS4 for ITS1-5.8S-ITS2, LROR and LRSF for 28S (White et al. 1990), Bt2a and Bt2b for
6-tubulin (Sang et al. 2010), and RpB2-5F-Eur and rpB2-7cr-Eur for RpB2 (Hibbett 2006,
Houbraken et al. 2011).
DNA sequencing and phylogenetic analyses
Amplified PCR products of strains FO010-1 and F0010-2 were electrophoresed on
a 0.75% agarose gel. The amplicons were purified with the AccuPrep PCR Purification
Kit (Bioneer). The purified PCR products were sequenced using an ABI 3700 automated
DNA sequencer (Applied Biosystems Inc., USA). The four gene sequences generated
were initially aligned with other sequences from GenBank using Clustal X v. 2.0 (Larkin
et al. 2007) with a gap opening penalty of 10.0 and a gap extension penalty of 0.05.
BioEdit v. 7.2.5 (Hall 1999) was used to manually exclude ambiguous and uninformative
variable sites. The alignment was manually refined using MEGA v. 6.0 (Tamura et al.
2013). The ITS, 28S, B-tubulin, and rpb2 gene sequences of F0010-1 and F0010-2 were
deposited in GenBank (see TABLE 2).
TABLE 2. Sequences used in the phylogenetic multigene analysis.
GENBANK ACCESSION NO.
TAXON SAMPLE
ITS LSU rpb2 6-tubulin
Abieticola EML-F0010-1 JN977612 JQ014618 KP792128 KP792126
koreana (T)
A. koreana EML-F0010-2 KP835547 KP835546 KP792129 KP792127
Annulohypoxylon CBS123834 DQ631935 DQ840061 DQ631960 DQ840095
moriforme
var. microdiscum
A. stygium MFLUCC 12-0826 —_KJ940870 KJ940869 KJ940868 KJ940867
Anthostomella brabeji CBS 110128 EU552098 EU552098 ~ _
A. proteae CBS 110127 EU552101 EU552101 — x:
Astrocystis MFLUCC 14-0174. KP297404 KP340545 KP340532 KP406615
concavispora
A. mirabilis HAST 94070803 GU322448 — GQ844835 GQ495941
A. sublimbata HAST 89032207 GU322447 — GQ844834 GQ495940
Collodiscula japonica CBS 124266 JF440974 — — JF440974
Daldinia concentrica CBS 113277 AY616683 ~ KC977274 —
D. decipiens CBS 122879 JX658441 — - AY951694
D. loculata BCRC 34117 EF026145 — AY951698 —
Discoxylaria JDR 169 GU322433 _ GQ844819 GQ487710
myrmecophila
Entoleuca mammata JDR 100 GU300072 _ GQ844782 GQ470230
Euepixylon JDR 261 GU292821 _ GQ844774 GQ470224
sphaeriostomum
Hypoxylon fendleri MFLUCC 12-0816 = KM017563 KMO017565 KMO017566 KM017564
Abieticola koreana gen. & sp. nov. (Korea) ... 753
H. fragiforme MUCL 51264 KM186294 KM186295 KM186296 KM186293
H. lenormandii MFLUCC 13-0120 KM039135 KM039136 KM039137 KMO039138
H. monticulosum MFLUCC 12-0818 | KM052716 KM052717 KM052719 KM052718
Kretzschmaria HAST 89062903 GU300079 — GQ844792 GQ478214
guyanensis
Lunatiannulus MFLUCC 14-0014 KP297398 KP340540 KP340526 KP406609
irregularis
Nemania diffusa FR AT-113 DQ658238 DQ840073 DG631947 DQ840088,
N. serpens FR AT-114 DQ631942 DQ840075 DQ631948 DQ840086
Podosordaria WSP 176 GU324762 _ GQ853039 GQ844840
mexicana
P muli WSP 167 GU324761 — GQ853038 GQ844839
Poronia pileiformis WSP 88113001 GU324760 _ GQ853037 GQ502720
Rhopalostroma lekae MFLUCC 13-0123 KJ472428 KJ472427 KJ472429 —
Rosellinia HAST 89112602 EF026118 — GQ844778 EF025604
lamprostoma
R. merrillii HAST 89112601 GU300071 — GQ844781 GQ470229
R. necatrix HAST 89062904 EF026117 — GQ844779 EF025603
R. sancta-cruciana HAST 89062903 GU292824 — GQ844777 GQ470227
Rostrohypoxylon CBS 119137 DQ631943 DQ840069 DQ631954 DQ840097
terebratum
Ruwenzoria MUCL 51394 GU053568 — — —
pseudoannulata
Stilbohypoxylon YMJ 89091608 EF026120 -- GQ853021 EF025606
quisquiliarum
Thamnomyces MUCL 51396 FN428828 — — —
camerunensis
Xylaria adscendens JDR 865 GU322432 — GQ844818 GQ487709
X. bambusicola WSP 205 EF026123 — GQ844802 AY951762
X. hypoxylon CBS 122620 AM993141 KM186301 KM186302 KM186300
CBS Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands, BCRC Bioresource Collection and
Research Centre, Taiwan, HAST Herbarium, Research Centre for Biodiversity, Academia Sinica, Taipei,
JDR Herbarium of Jack D. Rogers, MFLCC Mae Fah Luang University Culture Collection, Chiang Rai,
Thailand, MUCL Mycotheque de l'Université Catholique de Louvain, Germany, YMJ Herbarium of
Yu Ming Ju, WSP Washington State University, USA, EML Environmental Microbiology Laboratory
Fungarium, Chonnam National University, Gwangju, South Korea; T ex-holotype strain.
Maximum-likelihood (ML) (Felsenstein 1985) algorithms were applied using the
general time reversible (GTR) model under assumption of the gamma distribution
to accommodate substitution rates at the remaining sites and the starting tree was
obtained via neighbor-joining with nearest neighbors. For the Maximum Parsimony
analysis (MP), heuristic search method of tree bisection-reconnection (TBR) branch
swapping was used. A neighbor-joining (NJ) analysis was calculated from the Kimura
two-parameter model (Kimura 1980) with uniform rates as rate among sites (Saitou
& Nei 1987). Bootstrap analyses were performed with 1000 resampled datasets using
MEGA 6.05 (Tamura et al. 2013).
795A ... Lee & al.
Stilbohypoxylon quisquiliarum YMJ 89091608
Kretzschmaria guyanensis HAST 89062903
Xylaria adscendens JDR 865
Xylaria bambusicola WSP 205
Xylaria hypoxylon CBS122620
Nemania diffusa FRAT-113
Nemania serpens FR AT-114
Astrocystis mirabilis HAST 94070803
Astrocystis sublimbata HAST 89032207
Astrocystis concavispora MFLUCC 14-0174
Discoxylaria myrmecophila JDR 169
Colfodiscula japonica CBS 124266
Lunatiannulus irregularis MFLUCC 14-0014
Rosellinia sancta-cruciana HAST89062903
Rosellinia necatrix HAST 89062904
a Rosellinia lamprostoma HAST 89112602
Euepixyion sphaeriostomum JDR 261
[ Entoleuca mammata JDR 100
99 Rosellinia merrillii HAST 89112601
Podosordaria muli WSP 167
Podosordaria mexicana WSP 176
Poronia pileiformis WSP 88113001
Abieticola koreana EML-F0010-1
Abieticola koreana EML-F0010-2
aevooeuel|Ax seapioe|AX
98
Anthosiomella brabeji CBS 110128
Anthostomella proteae CBS 110127
Daldinia loculata BCRC 34117
Daldinia decipiens CBS 122879
Daldinia concentrica CBS 113277
Ruwenzoria pseudoannulata MUCL 51394
Thamnomyces camerunensis MUCL 51396
Rhopalostroma lekae MFLUCC 13-0123
Annulohypoxylon moriforme var. microdiscum CBS123834
90
Rostrohypoxylon terebratum CBS 119137
Annulohypoxylon stygium MFLUCC 12-0826
Hypoxyion fendleri MFLUCC 12-0816
Hypoxylon lenormandii MFLUCC 13-0120
Hypoxylon monticulosum MFLUCC 12-0818
Hypoxylon fragiforme MUCL51264
seaoeelAX seopiojAxodAY
Fic. 1. Phylogenetic position of Abieticola koreana EML-F0010-1 and EML-F0010-2 and
relationships among Xylariaceae based on multigene analysis (ITS, 28S, rpb2, and $-tubulin).
Hypoxylon fragiforme was used as outgroup. The scale bar represents one substitution per 100
nucleotides. The trees were constructed based on Maximum Likelihood (ML). Phylogenetic
classification by Daranagama et al. (2015).
Results
Phylogenetic analysis
FO010-1 and F0010-2 clustered within a clade including Podosordaria and
Poronia species, but formed a separate monophyletic group in maximum-
Abieticola koreana gen. & sp. nov. (Korea) ... 755
likelihood (ML) trees. BLASTn search revealed that the ITS sequence of
FO010-1 strain (JN977612) was 96.5% identical with Pod. mexicana WSP
176 (GU324762; 409 of 424 bp), 97.2% identical with Pod. muli WSP 167
(GU324761; 412 of 424 bp), and 96.5% identical with Por. pileiformis WSP
88113001 (GU324760; 409 of 424 bp). However, the sequences of F0010-1
were <95% similar to those of several isolates known to be species of Xylaria
(FJ612908; EU716506; AY315407; EU716509). In addition, the BLASTn search
results for the 28S rDNA sequence of strain F0010-1 (JQ014618) was 98.1%
homologous with Xylariaceae sp. 1175 (FJ425703; 527 of 537 bp), 97.8%
homologous with Xylaria sp. DIS99a (DQ327620; 715 of 731 bp), and 97.6%
homologous with Xylaria sp. DIS255j (DQ327627; 721 of 739 bp).
To further elucidate the phylogenetic status of isolate FO010, sequence data
for additional genes, rpb2, and 6-tubulin were analysed. The BLAST results for
the rpb2 and £-tubulin gene sequences indicated that the fungus is somewhat
closely related to genera such as Podosordaria and Poronia, but showing identity
values of only 76.6-81.0% with Pod. mexicana WSP 176, 83.0-83.9% with Pod.
muli WSP 167, and 73.2-82.2% with Por. pileiformis WSP 88113001. Based on
the sequence data and the structure of the conidial anamorph, isolate FO010
appeared to constitute a new genus and species, forming a distinct lineage
within the Xylarioideae clade, sister to the Podosordaria/Poronia lineage
(Fret).
Taxonomy
Abieticola Hyang B. Lee, gen. nov.
MycoBank MB 811702
Differs from Poronia by its slightly curved conidia, and its shorter conidiogenous cells.
TYPE SPECIES: Abieticola koreana Hyang B. Lee
ErymMo.oey: Abieticola, meaning “Abies-inhabiting’, referring to the host genus.
A coremioid, synnematous conidial anamorph produced on artificial
media is characterized by small clubs with white heads consisting of coiled
conidiogenous hyphae and synnemata that resemble those of Poronia species
but differ in bearing slightly curved conidia from shorter conidiogenous cells,
some of which bear three conidia.
Abieticola koreana Hyang B. Lee, sp. nov. FIGS 2, 3
MycoBAnk MB 811703
Differs from Poronia spp. by its slightly curved conidia, and its shorter conidiogenous
cells that sometimes bear 3 conidia.
Type: Republic of Korea, Daejeon, Yuseong-gu, endophytic in inner bark of Abies
holophylla Maxim. (Pinaceae), August 2006 (CNUFC EML-F0010-1 [preserved as
756 ... Lee & al.
metabolically inactive frozen culture]; ex-type cultures, KCTC 10629BP, CNUFC
EML-F0010-1; GenBank JN977612, JQ014618, KP792128, KP792126).
EryMo.oey: koreana, referring to the country of isolation, Korea.
STROMATA frequently developed on PDA medium, resembling small clubs with
white heads, <20.5 mm tall and with blackish brown exudates oozing out along
the lower stalk. Substrate mycelia forming in abundance, but aerial mycelia
poorly produced. SyNNEMATA generally erect but curving in age, 8.0-20.5
(av. 13.15 + 1.4) x 0.9-1.4mm, with knotted hyphae of variable thickness (mostly
1-1.8 um), pigmented brown to yellow in age; functioning as conidiophores.
ConlipiA | or 2 (sometimes 3) in number, produced laterally on mycelia and
detaching with distinct scars, 2.5-4.0 x 1.0-1.5 (av. 3.0 x 1.5) um on PDA,
Fic. 2 (above). Abieticola koreana (F0010-1): macromorphological culture characteristics.
A, B: PDA containing 5% wild dog dung culture at 27°C for 1 month (A) and 2 months (B - plate
refrigerated for 2 days and then moved to RT to induce fruiting); C, D: PDA culture at 18°C for 1
month (C) and 50 days (D); E: MEA culture with abundant mycelia and aerial club-like synnemata
with long whitish heads and yellowish bases; F: culture on 5% dung medium at 27°C for 50 days;
G: culture on PDA containing 5% dung at 27°C for 50 days; H: culture on MEA medium at 27°C
for 1 month; I and J: culture on PDA containing 5% dung at 27°C for 50 days; K: old fruit bodies
producing whitish powdery conidia and hairy mycelia (yellow arrow) in age on PDA, L: culture
on PDA containing 5% dung at 27°C for 2 months (plate refrigerated for 2 days and then moved
to RT to induce fruiting).
Fic. 3 (right). Abieticola koreana (F0010-1): micromorphological culture characteristics. A: fruit
bodies of the vase-shaped structure on PDA; B: magnified picture of the round head shown in A;
C: slender, long, tangled thread-like mycelia with conidia, D: magnified picture of numerous conidia
Abieticola koreana gen. & sp. nov. (Korea) ... 757
on mycelia shown in C, E: magnified pictures of anamorphic conidia in different forms including
elliptical, or oblong to banana-like (solid arrow) shown in C and D, F: conidia and normal mycelia
with small knots (solid arrow) and flat mycelia (dotted arrow), G: conidia (solid arrow) and scar
(dotted arrow) formed on mycelia, H: conidiation in cluster (solid arrow) on mycelia.
758 ... Lee & al.
hyaline, bases brown to yellow, tips white to grey; morphologically variable,
Poronia-like, ellipsoid or fusoid to ovoid, often slightly curved. No teleomorph
found on artificial media. COLONIES on PDA 25 mm diam. after two weeks at
25°C, yellow to brown in age.
ADDITIONAL STRAINS: REPUBLIC OF KOREA, DAEJEON, Yuseong-gu, endophytic in
inner bark of Abies holophylla, August 2006 (CNUFC EML-F0010-2 to F0010-10).
DISTRIBUTION: Known only from the type locality in South Korea.
Growth
Colonies attained an average diameter of 25 mm on MEA medium after
two weeks incubation at 25°C (the optimum temperature for growth). The
medium became pigmented yellow to brown with age. Mycelial growth rates
were determined under different water activity conditions (0.90-0.999 a, ;
Fia. 4. Growth of strain F0010-1 was maximal at 0.999 a /25°C, with a similar
growth rate at 0.98 a , but with almost no mycelial growth at 0.90 a, regardless
of temperature. At 0.95 a, the strain showed moderate growth on medium
amended with glucose, but no growth on medium amended with KCI solution.
The strain showed almost no mycelial growth at lowered water availability level
(0.90 a) regardless of temperature.
35
30
25
20
15
10
Mycelial growth (diameter, mm)
0.999 0.995 0.98 0.95
Water activity (a,,)
Fic. 4. Abieticola koreana (F0010-1): effect of water activity (a,) on mycelial growth on PDA.
The water activity levels were adjusted using two different solutes, KCl (left) and glucose (right).
Abieticola koreana gen. & sp. nov. (Korea) ... 759
Discussion
Several attempts were made to induce a teleomorph of Abieticola koreana
on a variety of artificial media (including dung in some media because some
xylariaceous fungi are coprophilous), but our attempts were unsuccessful.
The conidiomata that formed in culture on artificial media were tested for
germination in solution, but no spores germinated within 3 days.
Anamorphs of Xylariaceae differ in their modes of conidiogenesis and the
complexity of the conidiophores, and these characters have previously been
employed to define different form-genera (Hsieh et al. 2005). No teleomorphic
structures were observed here on various artificial media including dung-
containing media.
Although many related genera produce anamorphs on developing
stromata, few detailed ultrastructural studies of these anamorphs have
been published. The anamorphs of genera such as Calceomyces, Daldinia,
Hypoxylon, Rhopalostroma, Thamnomyces, and Thuemenella (“Hypoxyloideae’)
have Nodulisporium-like anamorphs (Stadler et al. 2013); and Xylocoremium
flabelliforme has been reported as the anamorph of Xylaria cubensis (Rogers
1984, Hsieh et al. 2005). The ultrastructure of the stromata and conidia and
mode of conidiogenesis in A. koreana could be used to distinguish it from
similar xylariaceous anamorphs. The mode of conidiogenesis on the surface of
the synnemata of A. koreana was examined by SEM and found similar to other
Xylariaceae (including those in Podosordaria, Poronia, and Xylaria), but the
morphology of the synnemata, conidiomata, and conidia differed from those
of the related genera.
Conidia formed by A. koreana resembled those of Pod. leporina, but differed
slightly in that they were produced by geniculate conidiogenous cells; the
elongated tips of the synnemata resembled those of Por. ingii in being slightly
shorter but differed in the ellipsoid and subglobose conidia (Koehn & Cole
1975, Ribes & Negrin 2011). According to Rogers et al. (1998), Podosordaria
has Geniculosporium-like anamorphs, while Poronia has Lindquistia-like
anamorphs. Podosordaria, with a typically stalked stroma with a subglobose
head, differs from Poronia, with a flattened disc (Krug & Cain 1974).
Koehn & Cole (1975) compared the ultrastructure of Pod. leporina and
Por. oedipus suggesting that Pod. leporina should be returned to Poronia. The
morphology and molecular phylogenetic position of A. koreana also differed
from these two genera.
Podosordaria and Poronia are closely related genera containing species
that have been considered close relatives of Xylaria but differ by their capitate
stromata and coprophilous nature (Deepna & Manimohan 2012). Neighbor-
joining (NJ) and maximum parsimony (MP) analyses of four DNA loci (ITS,
760 ... Lee & al.
28S, B-tubulin, rpb2) performed in this study produced tree patterns almost
identical to ML (not shown). Three ITS-based phylogenetic analyses of Xylaria
and related genera proved to be practical for taxonomic determination of
intra-specific relationships in highly morphologically variable fungi like the
Xylariaceae (Spatafora & Blackwell 1993). Nevertheless, studies based on the ITS
marker encountered major issues when attempting to determine phylogenetic
relationships with other Xylaria species because of its highly variable nature
(Hsieh et al. 2010). In addition, the number of Xylaria-related sequences in
GenBank is limited.
Nevertheless, it is very important to note the phylogenetic status and
relatedness of Abieticola among xylariaceous fungi because until now no
intermediate group related to Poronia and Podosordaria has been reported.
Results revealed that Abieticola is a clade within the intermediate group on
phylogenetic trees such as ML, NJ, and MP.
Most Xylaria species (‘Xylarioideae’) and some segregates like Sarcocylon
have elongate stromata; interestingly, Daldinia asphalatum (‘Hypoxyloideae’)
also produce elongate stromata. The sporulating structures and attachment
patterns of A. koreana resembled those of Poronia spp. (Lindquistia-like) and
Xylaria spp. (Geniculosporium-like), but differed from them in having broader
conidiogenous cells and slightly curved conidia.
The presence or absence of specific chemicals can, in many cases, be
linked with taxonomic position, which may prove invaluable in determining
associations between species, species groups, and genera (Whalley & Edwards
1995). The placement of the FO010-1 and F0010-2 strains in the Xylarioideae
clade constructed by Daranagama et al. (2015) suggests that other members of
the clade should be investigated for ability to produce griseofulvin.
Endophytic fungi are organisms that live inside plant tissue for at least part
of their life cycle without causing any disease symptoms (Petrini 1991, Schulz
& Boyle 2005). It is interesting that Xylaria species isolated from eastern white
pine (Pinus strobus) needles and lowbush blueberry (Vaccinium angustifolium)
stems has been reported to produce griseofulvin (Richardson et al. 2014). Liu
et al. (2007) reported that an endophytic Xylaria sp. isolated from Ginkgo biloba
had broad antimicrobial activity. Quang & Bach (2008) also reported that
ergosta-4,6,8(14),22-tetraen-3-one produced bya Xylaria species from Vietnam
can inhibit nitric oxide production. Several metabolites, including linoleic
acid, linoleic acid methyl ester, and 4-hydroxyscytalone, were isolated from a
methanolic extract of another Xylaria species (Jang et al. 2009). A xylariaceous
coprophilous fungus, Pod. tulasnei, was shown to produce tulasnein,
a new metabolite with strong antimicrobial activity and weak cytotoxic and
phytotoxic activities (Ridderbusch et al. 2004). Poronia punctata has been
Abieticola koreana gen. & sp. nov. (Korea) ... 761
shown to produce a range of biologically active sesquiterpenes (Poyser et al.
1985, Anderson et al. 1988). Stadler et al. (2014) noted that fungal secondary
metabolite profiles can have taxonomic value beyond the species rank and
even coincide with phylogenetic data. Kuhnert et al. (2014) indicated that the
biosynthetic pathways of diverse compounds derived from fungi have evolved
independently during the evolution of fungi. More studies on the molecular
phylogeny and ultrastructure of diverse groups belonging to the Xylarioideae
clade, which are related to the new genus and species, are needed.
Acknowledgements
This work was supported by the project on the survey and discovery of Korean
indigenous species of the National Institute of Biological Resources (NIBR) under the
Ministry of Environment, Republic of Korea. Authors are grateful to Prof. Marc Stadler
(Helmholtz-Zentrum fiir Infektionsforschung GmbH, Germany), Dr. Yu-Ming Ju
(Institute of Plant and Microbial Biology, Taiwan), and Dr. Paul M. Kirk (Royal Botanic
Gardens Kew, U. K.) for the kind reviews and comments.
Literature cited
Anderson JR, Edwards RL, Poyser JP, Whalley AJS. 1988. Metabolites of the higher fungi. Part 23.
The punctaporonins. Novel bi-, tri-, and tetra-cyclic sesquiterpenes related to caryophyllene,
from the fungus Poronia punctata (Linnaeus : Fries) Fries. J. Chem. Soc. Perkin Trans. I,
823-831.
Bayman P, Lebron LL, Tremblay RL, Lodge DJ. 1997. Variation in endophytic fungi from roots and
leaves of Lepanthes (Orchidaceae). New Phyt. 135: 143-149.
http://dx.doi.org/10.1046/j.1469-8137.1997.00618.x
Bayman P, Angulo-Sandoval P, Baez-Ortiz Z, Lodge DJ. 1998. Distribution and dispersal of Xylaria
endophytes in two tree species in Puerto Rico. Mycol. Res. 102: 944-948.
http://dx.doi.org/10.1017/s095375629700590x
Boonphong S, Kittakoop P, Isaka M, Pittayakhajonwut D, Tanticharoen M, Thebtaranonth Y. 2001.
Multiplolides A and B, new antifungal 10-membered lactones from Xylaria multiplex. J. Nat.
Prod. 64: 965-967. http://dx.doi.org/10.1021/np000291p
Callan BE, Rogers JD. 1990. Teleomorph-anamorph connections and correlations in some Xylaria
species. Mycotaxon 36: 343-369.
Daranagama DA, Camporesi E, Tian A, Liu X, Chamyuang S, Stadler M, Hyde KD. 2015.
Anthostomella is polyphyletic comprising several genera in Xylariaceae. Fungal Divers.
73: 203-238. http://dx.doi.org/10.1007/s13225-015-0329-6
Deepna LKP, Manimohan P. 2012. Two remarkable xylariaceous ascomycetes associated with
elephant dung. Mycosphere 3(2): 111-129. http://dx.doi.org/10.5943/mycosphere/3/2/10
Dreyfuss M, Petrini O. 1984. Further investigation on the occurrence and distribution of endophytic
fungi in tropical plants. Bot. Helv. 94: 33-40.
Felsenstein J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution
39: 783-791. http://dx.doi.org/10.2307/2408678
Grove JF, MacMillan J, Mulholland TPC, Rodgers MAT. 1952. Griseofulvin. Part IV. Structure.
J. Chem. Soc. 3977-3987. http://dx.doi.org/10.1039/JR9520003977
Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program
for Windows 95/98/NTT. Nucleic Acids Sym. Ser. 41: 95-98.
762... Lee & al.
Hibbett DS. 2006. A phylogenetic overview of the Agaricomycotina. Mycologia 98: 917-925.
http://dx.doi.org/10.3852/mycologia.98.6.917
Houbraken J, Frisvad JC, Samson RA. 2011. Taxonomy of Penicillium section Citrina. Stud. Mycol.
70: 53-138. http://dx.doi.org/10.3114/sim.2011.70.02
Hsieh H-M, Ju Y-M, Rogers JD. 2005. Molecular phylogeny of Hypoxylon and closely related
genera. Mycologia 97: 844-865. http://dx.doi.org/10.3852/mycologia.97.4.844
Hsieh H-M, Lin C-R, Fang M-J, Rogers JD, Fournier J, Lechat C, Ju Y-M. 2010. Phylogenetic status
of Xylaria subgenus Pseudoxylaria among taxa of the subfamily Xylarioideae (Xylariaceae)
and phylogeny of the taxa involved in the subfamily. Mol. Phylogenet. Evol. 54: 957-969.
http://dx.doi.org/10.1016/j.ympev.2009.12.015
Isaka M, Jaturapat A, Kladwang W, Punya J, Lertwerawat Y, Tanticharoen M, Thebtaranonth Y.
2000. Antiplasmodial compounds from the wood-decayed fungus Xylaria sp. BCC1067. Planta
Med. 66: 473-475. http://dx.doi.org/10.1055/s-2000-8588
Jang Y-W, Lee I-K, Kim Y-S, Seok S-J, Yu S-H, Yun B-S. 2009. Chemical constituents of the fruiting
body of Xylaria polymorpha. Mycobiology 37: 207-210.
http://dx.doi.org/10.4489/MYCO.2009.37.3.207
Kimura M. 1980. A simple method for estimating evolutionary rates of base substitutions
through comparative studies of nucleotide sequences. J. Mol. Evol. 16:111-120.
http://dx.doi.org/10.1007/BF01731581
Koehn RD, Cole GT. 1975. An ultrastructural comparison of Podosordaria leporina and Poronia
oedipus (Ascomycetes). Can. J. Bot. 53(20): 2251-2259. http://dx.doi.org/10.1139/b75-249
Kuhnert E, Heitkamper S, Fournier J, Surup FE, Stadler M. 2014. Hypoxyvermelhotins
A-C, new pigments from Hypoxylon lechatii sp. nov. Fungal Biol. 118: 242-252.
http://dx.doi.org/10.1016/j.funbio.2013.12.003
Krug JC, Cain RE 1974. A preliminary treatment of the genus Podosordaria. Can. J. Bot. 52:
589-605.
Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F,
Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG. 2007. Clustal W and
Clustal X version 2.0. Bioinformatics 23: 2947-2948.
http://dx.doi.org/10.1093/bioinformatics/btm404
Liu X, Dong M, Chen X, Jiang M, Lv X, Zhou J. 2007. Antimicrobial activity of an endophytic Xylaria
sp.Y X-28 and identification of its antimicrobial compound 7-amino-4 methylcoumarin. App.
Microbiol. Biotechnol. 78: 241-247. http://dx.doi.org/10.1007/s00253-007-1305-1
Park J, Choi GJ, Lee HB, Kim KM, Jung HS, Lee S, Jang KS, Kwang Y, Kim J. 2005. Griseofulvin
from Xylaria sp. strain FO010, an endophytic fungus of Abies holophylla and its antifungal
activity against plant pathogenic fungi. J. Microbiol. Biotechnol. 15: 112-117.
Pazoutova S, Follert S, Bitzer J, Keck M, Surup F, Sritka P, Holu&a J, Stadler M. 2013. A
new endophytic insect-associated Daldinia species, recognised from a comparison of
secondary metabolite profiles and molecular phylogeny. Fungal Divers. 60:107-123.
http://dx.doi.org/10.1007/s13225-013-0238-5
Petrini O. 1991. Fungal endophytes of tree leaves. In: Andrews JH, Hirano SS, editors. Microbial
ecology of leaves. New York: Springer-Verlag. 179-197.
http://dx.doi.org/10.1007/978-1-4612-3168-4_9
Poyser JP, Edwards RL, Anderson JR, Hursthouse MB, Walker NPC, Sheldrick GM, Whalley AJS.
1985. Punctatins A, D, E and F (antibiotics M95464, M167906, M171950, and M189122),
isomeric allylic alcohols from the fungus Poronia punctata: X-ray crystal structures of D and of
E acetonide. J. Antibiot. 39: 167-169. http://dx.doi.org/10.7164/antibiotics.39.167
Abieticola koreana gen. & sp. nov. (Korea) ... 763
Quang DN, Bach DD. 2008. Ergosta-4,6,8(14),22-tetraen-3-one from Vietnamese Xylaria
sp. possessing inhibitory activity of nitric oxide production. Nat. Prod. Res. 22: 901-906.
http://dx.doi.org/10.1080/14786410701642706
Ribes MA, Negrin R. 2011. Poronia injii (J.D. Rogers & Leessge) J.D Rogers, Y.-M. Ju & F. San
Martin rediscovered in Canary Islands (Spain). Ascomycete Org. 3(1): 3-8.
Richardson SN, Walker AK, Nsiama TK, Mcfarlane J, Sumarah MW, Ibrahim A, Miller JD. 2014.
Griseofulvin-producing Xylaria endophytes of Pinus strobus and Vaccinium angustifolium:
evidence for a conifer-understory species endophyte ecology. Fungal Ecol. 11: 107-113. http://
dx.doi.org/10.1016/j.funeco.2014.05.004
Ridderbusch DC, Weber RWS, Anke T, Sterner O. 2004. Tulasnein and podospirone from the
coprophilous xylariaceous fungus Podosordaria tulasnei. Z. Naturforsch. C 59: 379-383. http://
dx.doi.org/10.1515/znc-2004-5-616
Rogers JD. 1984. Xylaria cubensis and its anamorph Xylocoremium flabelliforme, Xylaria allantoidea
and Xylaria poitei in continental United States. Mycologia 76: 912-923.
http://dx.doi.org/10.2307/3793147.
Rogers JD, Ju Y-M, San Martin FE. 1998. Podosordaria: a redefinition based on cultural studies of the
type species, P mexicana, and two new species. Mycotaxon 67: 61-72.
Saitou N, Nei M. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic
trees. Mol. Biol. Evol. 4: 406-25.
Sang H, Choi Y, Yu SH. 2010. Phylogenetic analysis, morphology and pathogenicity of Penicillium
spp. Associated with blue mold of apple in Korea. J. Agric. Sci. 37: 341-350.
San Martin F, Lavin P, Rogers JD. 2001. Some species of Xylaria (Hymenoascomycetes, Xylariaceae)
associated with oaks in Mexico. Mycotaxon 79: 337-360.
Schulz B, Boyle C. 2005. The endophytic continuum. Mycol. Res. 109: 661-686.
http://dx.doi.org/10.1017/s095375620500273x
Spatafora JW, Blackwell M. 1993. Molecular systematics of unitunicate perithecial ascomycetes: the
Clavicipitales-Hypocreales connection. Mycologia 85: 912-922.
http://dx.doi.org/10.2307/3760674
Stadler M. 2011. Importance of secondary metabolites in the Xylariaceae as parameters for
assessment of their taxonomy, phylogeny, and functional biodiversity. Curr. Res. Environ. Appl.
Mycol. J. 1: 75-133. http://dx.doi.org/10.5943/cream/1/2/1
Stadler M, Kuhnert E, PerSoh D, Fournier J. 2013. The Xylariaceae as model example for a unified
nomenclature following the “One Fungus-One Name” (1F1N) concept. Mycology 4: 5-21.
http://dx.doi.org/10.1080/21501203.2013.782478
Stadler M, Leessge T, Fournier J, Decock C, Schmieschek B, Tichy HV, PerSoh D. 2014. A polyphasic
taxonomy of Daldinia (Xylariaceae). Stud. Mycol. 77. 143 p. http://dx.doi.org/10.3114/sim0016
Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. 2013. MEGA6: Molecular Evolutionary
Genetics Analysis version 6.0. Mol. Biol. Evol. 30: 2725-2729.
http://dx.doi.org/10.1093/molbev/mst197
Tang AMC, Jeewon R, Hyde KD. 2009. A re-evaluation of the evolutionary relationships within
the Xylariaceae based on ribosomal and protein-coding gene sequences. Fungal Divers. 34:
127-155:
Velmurugan N, Lee HM, Han SS, Sol L, Lee YS. 2013. Xylariaceae diversity in Thailand and
Philippines, based on rDNA sequencing. Ann. For. Res. 56(1): 31-42.
Vilgalys R, Hester M. 1990. Rapid genetic identification and mapping of enzymatically amplified
ribosomal DNA from several Cryptococcus species. J. Bacteriol. 172(8): 4238-4246.
http://dx.doi.org/10.1128/jb.172.8.4238-4246.1990
764 ... Lee & al.
Whalley AJS. 1996. The xylariaceous way of life. Mycol. Res. 100: 897-922.
http://dx.doi.org/10.1016/S0953-7562(96)80042-6
Whalley AJS, Edwards RL. 1995. Secondary metabolites and systematic arrangement within the
Xylariaceae. Can. J. Bot. 73: 802-810. http://dx.doi.org/10.1139/b95-325
White TJ, Bruns T, Lee S, Taylor JW. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics, 315-322, in: MA Innis et al. (eds). PCR protocols: a guide to
methods and applications. Academic Press, San Diego, CA.
http://dx.doi.org/10.1016/B978-0-12-372180-8.50042-1
Wiyakrutta S, Sriubolmas N, Panphut W, Thongon N, Danwisetkanjana K, Ruangrungsi N,
Meevootisom V. 2004. Endophytic fungi with anti-microbial, anti-cancer and anti-malarial
activities isolated from Thai medicinal plants. World. J. Microbiol. Biotechnol. 20: 265-272.
http://dx.doi.org/10.1023/B:WIBI.0000023832.27679.a8
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 © 2016. Mycotaxon, Ltd.
October-December 2016—Volume 131, pp. 765-771
http://dx.doi.org/10.5248/131.765
Entalbostroma erumpens gen. et sp. nov. (Xylariaceae)
from Phormium in New Zealand
P.R. JOHNSTON’, J.D. ROGERS’, D. PARK! & N.A. MARTIN?
"Landcare Research, Private Bag 92170, Auckland 1142, New Zealand
2 Department of Plant Pathology, Washington State University,
Pullman, WA 99164-6430, USA
" CORRESPONDENCE TO: [email protected]
ABSTRACT—A xylariaceous fungus on the dead leaves of Phormium tenax and P. cookianum
is described as a new genus and species, Entalbostroma erumpens. Phylogenetically
E. erumpens is close to Xylaria amphithele. The sexual state resembles Kretzschmariella in
general morphology, but the two genera are phylogenetically distant. The asexual state can
be used to distinguish the genera morphologically, Entalbostroma having an anamorph with
typical xylariaceous conidia, while Kretzschmariella has Mirandina-like conidia, unknown in
any other xylariaceous taxon.
Key worps— phylogeny, Xylariales, Xylarioideae
Introduction
The generic taxonomy of the Xylariaceae remains uncertain. Phylogenetic
studies have shown that few of the long recognised, morphologically based
genera form well resolved, monophyletic clades, most being polyphyletic,
paraphyletic, or with poorly resolved relationships in DNA based phylogenetic
studies (Hsieh et al. 2010, Pazoutova et al. 2010, U’Ren et al. 2016) As discussed
by U’Ren et al. (2016), resolution of phylogenetically robust genera within the
Xylariaceae requires not only additional genes but also more complete taxon
sampling.
In this paper we fill a gap in the taxon sampling of these fungi by
describing a morphologically unusual xylariaceous fungus from leaves of
the monocotyledonous Phormium spp. (Asparagales, Hemerocallidaceae)
as a new genus and species. Morphologically the sexual state is similar to
766 ... Johnston & al.
Kretzschmariella Ju & Rogers 1994); however newly obtained DNA sequences
for Kretzschmariella culmorum show the two taxa to be phylogenetically distant.
Materials & methods
Specimens were collected during general surveys of fungi associated with the native
plants of New Zealand.
Ascospore masses were removed aseptically from perithecia in the holotype specimen
PDD 107494 and spotted onto SMEA medium (Kenerley & Rogers 1976). Germinated
ascospores were transferred to 2% oatmeal agar (OA, Difco), Leonian’s medium (Booth
1971), and half strength potato dextrose agar (PDA, Difco). Asci and ascospores from
dried specimens and conidia from pure cultures were examined in water or 5% KOH
with Melzer’s reagent.
For DNA sequencing, mycelium was harvested from the cultures, dried, then ground
in 400 uL lysis buffer (Qiagen, USA) with a plastic pestle followed by incubation for
2 hr at 55°C Then 220 uL lysed solution was loaded into the QIAxtractor Robot (Qiagen,
USA) and DNA extraction performed with a Qiagen DX reagent pack and tissue
extraction protocol. DNA sequences for ITS, B-tubulin, and RPB2 were generated using
the amplification primers from Hsieh et al. (2010). In addition, DNA was extracted from
the hymenium of a fruit body from PDD 107494, prior to the specimen being dried for
storage, and an ITS sequence generated.
The DNA sequences were concatenated and a phylogenetic analysis performed
using our newly generated sequences together with selected taxa from U’Ren et al.
(2016) and previously unpublished sequences from a culture grown from a collection
of Kretzschmariella culmorum (Guadeloupe, on culm of bamboo, coll. J. Vivant,
1 Nov 1992, sent by H.W. Ravenel (#2505) to WSP; culture stored at The Institute
of Plant and Microbial Biology, Academia Sinica). An initial analysis showed that
Entalbostroma erumpens was within the Xylaria ‘HY clade of U’Ren et al. (2016). The
taxa selected were those that represented the diversity across that clade, together with
representative taxa from the other clades recognised within the Xylarioideae by U’Ren
et al. Poronia pileiformis and Podosordaria mexicana were used as the outgroup. The
sequences were aligned using MAFFT as implemented in Geneious R9 (Kearse et al.
2012). A Bayesian phylogenetic tree was generated using MrBayes 3.2 (Ronquist et al.
2012) with gaps treated as missing data, applying the GITR+I+G model for all three
genes, the same model selected for all genes using the Akaike information criterion
method in MrModeltest 2.3 (Nylander 2004). The data set was run with four chains for
10 million generations, trees sampled every 1000 generations with a burn-in of 25%.
Bayesian posterior probabilities were obtained from 50% majority rule consensus trees.
Taxonomy
Entalbostroma J.D. Rogers & PR. Johnst., gen. nov.
MycoBAnk MB817225
Differs from Kretzschmariella in having typical xylariaceous conidia.
Type: Entalbostroma erumpens J.D. Rogers & P.R. Johnst.
EtyMo.oey: For the white entostroma.
Entalbostroma erumpens gen. et sp. nov. (New Zealand) ... 767
FiGurE 1 Entalbostroma erumpens (A-C, holotype, PDD 107494; D, E, I-K, PDD 107550;
F-H, ICMP 21152). A, B, fruiting bodies erumpent from leaf, variable in shape. C, fruiting body
in section showing white internal tissue and continuous narrow black outer layer. D, erumpent,
partly exposed fruiting body showing barely differentiated ostioles. E, fruiting body from D with
upper part removed to show internal structure; F, detail of surface of culture on PDA, darkened
structures, and powdery layer of conidia in places. G, conidia from PDA culture. H, conidiogenous
cells from PDA culture. I, ascus apex in KOH and Melzer’s reagent. J, ascospores with gelatinous
sheath and small apical gelatinous cap. K, ascospores with spore-length germ slit. Scale bars:
A-F = 1mm; G-K = 10 um.
Stromata pulvinate to applanopulvinate, orbicular to elliptical to irregular,
solitary to gregarious, erumpent becoming superficial; surface blackish,
interior perithecium-bearing tissue white. Perithecia more or less spherical;
768 ... Johnston & al.
ostioles ill defined. Ascus apical ring inverted hat-shaped, bluing in Melzer’s
iodine reagent. Ascospores dark brown, with germ slit on flattened side,
a hyaline gelatinous sheath. Paraphysate.
In culture, conidiophores forming a palisade-like layer of short, cylindric
cells with conidia produced holoblastically on several scars near apex. Conidia
hyaline, smooth, ellipsoid with narrowed flattened bases.
Entalbostroma erumpens J.D. Rogers & P.R. Johnst., sp. nov. FIG. 1
MycoBank MB817226
Differs from Xylaria amphithele by its initially immersed, then erumpent, non-stipitate
ascomata, its non-erumpent perithecia, and its ascospores being surrounded by a
gelatinous sheath.
Type: New Zealand: Auckland: North Piha, Laird Thomson Track, on dead leaf
Phormium tenax J.R. Forst. & G. Forst., 28 Aug 2015, coll. N.A. Martin (Holotype,
PDD 107494; isotype, WSP 72775; ex type culture, ICMP 21152; GenBank KX258204,
KX258205, KX258206).
EryMo_oey: For the erumpent nature of the ascomata from leaf tissue.
Stromata pulvinate to applanopulvinate, orbicular to elliptical to irregular,
solitary to gregarious, erumpent becoming superficial, 2-10 mm long x 1-3
mm broad x 1-2 mm thick; surface blackish, interior perithecium-bearing
tissue white. Perithecia more or less spherical, 0.2-0.4 mm diam. Ostioles ill
defined. Asci short-stipitate, 120-146 x 8 um total length. Ascus apical ring
inverted hat-shaped, bluing in Melzer’s iodine reagent, ca. 4.5 um high, 2.7 um
broad. Ascospores dark brown, ellipsoid-inequilateral, 16-19 x 8-8.8 um, with
long germ slit on flattened side, with a hyaline gelatinous sheath that is often
broader on the flattened side, and often with a small gelatinous cap at one end.
Paraphysate.
Cultures from multiple ascospores on OA under 12 hr fluorescent light and
12 hr dark white to pinkish, covering 9 cm diam plate in 2-3 wk. Surface at
first plane, appressed and smooth after 4-6 wk showing small areas of raised
pimples. Pimples becoming enlarged and blackened, hollow. Conidiophores
forming a palisade-like layer of short, cylindric cells with conidia produced
holoblastically on several scars near apex. Conidia hyaline, smooth, ellipsoid
with narrowed flattened bases indicating point of attachment to conidiogenous
cell, (3-)4—5(-7) x 2-2.5 um.
FIGURE 2. Bayesian phylogenetic tree based on concatenated ITS, B-tubulin, and RPB2 sequences,
Bayesian posterior probabilities >0.95 on edges. Taxa selected from U’Ren et al. (2016) are labelled
with voucher numbers; Podosordaria mexicana and Poronia pileiformis were selected as outgroup.
Clade designations follow U’Ren et al. (2016). Entalbostroma erumpens sequences are deposited
in GenBank as KX258204, KX258205, and KX258206; those from Kretzschmariella culmorum as
KX430043, KX430045, and KX430046.
Entalbostroma erumpens gen. et sp. nov. (New Zealand) ... 769
Kretzschmaria deusta CBS 826.72
Kretzschmaria neocaledonica HAST 94031003
1 Kretzschmaria clavus JDR 114
Kretzschmaria pavimentosa JDR 109
Kretzschmaria sandvicensis JDR 113
{ Kretzschmaria guyanensis HAST 89062903
Kretzschmaria megalospora JDR 229
Xylaria cranioides HAST 226
Xylaria sp. ARIZ FL1777
Xylaria tuberoides HAST 475
Xylaria microceras HAST 414
0.97 Xylaria muscula HAST 520
Penzigia cantareirensis HAST 526
Xylaria alboareolata HAST 453 HY Clade
Xylaria coccophora HAST 786
Xylaria oligotoma HAST 784
Xylaria venustula HAST 88113002
0.99
ae Xylaria sp. genotype 262 isolate FLO224
Xylaria sp. genotype 425 isolate FL1042
1 Entalbostroma erumpens ICMP 21152
nae i Xylaria sp. 6 HMH 2010f
Xylaria amphithele HAST 529
1 Xylaria sicula f. major HAST 90071613
Xylaria arbuscula HAST 89041211
Xylaria venosula HAST 94080508
Xylaria striata HAST 304
0.98 Xylaria bambusicola WSP 205
Xylaria meliacearum JDR 148
Xylaria intraflava HAST 725
Xylaria ochraceostroma HAST 401 TE Clade
Xylaria cirrata HAST 664
Xylaria brunneovinosa HAST 720
0.99 Xylaria schweinitzii HAST 92092023
Xylaria telfairif HAST 90081901
Xylaria plebeja HAST 91122401
Xylaria allantoidea HAST 94042903
1 Xylaria berteri JDR 256
Xylaria castorea PDD 47417
Xylaria feejeensis JDR 180
1 Xylaria frustulosa HAST 92092010 PO Clade
1 Astrocystis mirabilis HAST 94070803
Kreizschmariella culmorum Candoussau 5281
Xylaria badia HAST 95070101
Stilbohypoxylon elaeicola JDR 173
Xylaria culleniae JDR 189
Xylaria curta HAST 92092022
Discoxylaria myrmecophila JDR 169
0.97 Xylaria palmicola PDD 47440
Nemania serpens HAST 235 NR Clade
0.99 Rosellinia necatrix HAST 89062904
Podosordaria mexicana WSP 176
Poronia pileiformis WSP 88113001
770 ... Johnston & al.
ADDITIONAL SPECIMENS EXAMINED: NEW ZEALAND: NorTHLAND: Poor Knights
Islands, on dead leaves of Phormium tenax, 3 Sep 1984, coll. R.E. Beever (PDD 46231).
AUCKLAND: Piha South, Lookout Track, on dead leaves of Phormium tenax, 28 Aug
2015, coll. N.A. Martin (PDD 107553);. Muriwai, Quarry Track, on dead leaves of
Phormium tenax, 21 July 2015, coll. N.A. Martin (PDD 107552); Muriwai, Maori Bay
Track, on dead leaves of Phormium tenax, 21 Aug 2015, coll. N.A. Martin (PDD 107550);
Waitakere Ranges, Nihotupu Dam, on dead leaves of Phormium tenax, 4 Nov 1960,
coll. J.M. Dingley (PDD 42824). Mrp CANTERBURY: Bealey Valley, on dead leaves of
Phormium cookianum Le Jol. (as P. colensoi Hook. f.), 11 Mar 1983, coll. E. Horak (PDD
93072). STEWART IsLAND: Doughboy Bay, on dead leaves of Phormium sp., 29 Apr 2002,
coll. PR. Johnston, S. Whitton, R. Leschen (PDD 107551).
Phylogeny
The ITS sequences from the fruit body from the PDD 107494 fungarium
specimen and from cultures derived from that specimen (ICMP 21152) were
identical. The DNA sequences from ICMP 21152 have been deposited in
GenBank as KX258204, KX258205, and KX258206.
Entalbostroma erumpens formed a strongly supported sister relationship
with Xylaria amphithele and Xylaria sp. 6 sensu Hsieh et al. (2010) within
the ‘HY’ clade of U’Ren et al. (2016) (Fic 2). Morphologically it is divergent
from X. amphithele (San Martin Gonzalez & Rogers 1989), but it shares a leaf-
inhabiting ecology with both this species and Xylaria sp. 6 (Hsieh et al. 2010).
Kretzschmariella is phylogenetically distant, positioned within the ‘PO’ clade
of U’Ren et al. (2016).
Discussion
The morphology of the sexual state of Entalbostroma recalls Kretzschmariella,
both genera having erumpent ascomata with a thin black crust and white soft
entostromatic tissue surrounding the perithecia. The two genera differ in their
anamorph, our new fungus having a reduced Geniculosporium-like anamorph
in culture (typical of species of Xylaria and Kretzschmaria), rather than the
Mirandina-like conidial state of Kretzschmariella (Ju & Rogers 1994). This
reinforces earlier studies showing that the morphology of the anamorph may be
phylogenetically informative among these fungi. Inclusion of morphologically
divergent taxa such as Entalbostroma will be necessary for future phylogenetic
resolution of generic level clades within the Xylariaceae, and for recognition of
the characters that can be used to recognise those clades morphologically.
Entalbostroma erumpens is geographically widespread on dead, partly
decomposed leaves of Phormium spp. in New Zealand, and appears to be quite
common on its host.
Entalbostroma erumpens gen. et sp. nov. (New Zealand) ... 771
Acknowledgments
Yu-Ming Ju (IPMB, Academia Sinica) is thanked for providing unpublished
sequences for Kretzschmariella culmorum. Jacques Fournier and Yu-Ming Ju are
thanked for reviewing the manuscript and suggesting improvements. This research was
supported through the Landcare Research Systematics Portfolio with funding from the
Science and Innovation Group of the New Zealand Ministry of Business, Innovation
and Employment, and by Dept. of Plant Pathology, Washington State University.
Literature cited
Booth C. 1971. Fungal culture media. 49-94, in: C Booth (ed.). Methods in microbiology, Volume
4, Academic Press, London and New York.
Hsieh H-M, Lin C-R, Fang M-J, Rogers JD, Fournier J, Ju Y-M. 2010. Phylogenetic status of Xylaria
subgenus Pseudoxylaria among taxa of the subfamily Xylarioideae (Xylariaceae) and phylogeny
of the taxa involved in the subfamily. Molecular Phylogenetics and Evolution 54: 957-969.
http://dx.doi.org/10.1016/j.ympev.2009.12.015
Ju Y-M, Rogers JD. 1994. Kretzschmariella culmorum (Cooke) comb. nov. and notes on some other
monocot-inhabiting xylariaceous fungi. Mycotaxon 51: 241-256.
Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S$, Buxton S, Cooper A,
Markowitz S, Duran C, Thierer T, Ashton B, Mentjies P, Drummond A. 2012. Geneious Basic:
an integrated and extendable desktop software platform for the organization and analysis of
sequence data. Bioinformatics 28: 1647-1649. http://dx.doi.org/10.1093/bioinformatics/bts199
Kenerley C.M, Rogers JD. 1976. On Hypoxylon serpens in culture. Mycology 68: 688-691.
http://dx.doi.org/10.2307/3758993
Nylander JAA 2004. MrModeltest v2. Program distributed by the author. Evolutionary Biology
Centre, Uppsala University.
Pazoutova S, Sritka P, Holuga J, Chudi¢kova M, Kolafik M. 2010. The phylogenetic position of
Obolarina dryophila (Xylariales). Mycological Progress 9: 501-507.
http://dx.doi.org/10.1007/s11557-010-0658-5
Ronquist F, Teslenko M, van der Mark P, Ayres D, Darling A, Héhna S, Larget B, Liu L, Suchard
MA, Huelsenbeck JP. 2012. MrBayes 3.2: efficient Bayesian phylogenetic inference and model
choice across a large model space. Systematic Biology 61: 539-542.
http://dx.doi.org/10.1093/sysbio/sys029
San Martin Gonzalez F, Rogers JD. 1989. A preliminary account of Xylaria of Mexico. Mycotaxon
34: 283-373.
U’Ren JM, Miadlikowska J, Zimmerman NB, Lutzoni F, Arnold AE, Stajich JE. 2016. Contributions
of North American endophytes to the phylogeny, ecology, and taxonomy of Xylariaceae
(Sordariomycetes, Ascomycota). Molecular Phylogenetics and Evolution 98: 210-232.
http://dx.doi.org/10.1016/j.ympev.2016.02.010
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 © 2016. Mycotaxon, Ltd.
October-December 2016— Volume 131, pp. 773-780
http://dx.doi.org/10.5248/131.773
Podosporiopsis, anew genus of synnematous hyphomycetes
from China
JIAN Ma’, X1u-Guo ZHANG? & RAFAEL F. CASTANEDA-RUiz?
‘College of Agronomy, Jiangxi Agricultural University, Nanchang, 330045, China
"Department of Plant Pathology, Shandong Agricultural University, Taian, 271018, China
3 Instituto de Investigaciones Fundamentales en Agricultura Tropical Alejandro de Humboldt’
(INIFAT), Académico Titular de la “Academia de Ciencias de Cuba”,
Calle 1 Esq. 2, Santiago de Las Vegas, C. Habana, Cuba, C.P. 17200
*CORRESPONDENCE TO: [email protected]
ABSTRACT—Podosporiopsis gen. nov. is proposed. It is characterized by distinct unbranched
conidiophores forming distinct synnematal conidiomata with emergent monotretic,
integrated, terminal, determinate or percurrently extending conidiogenous cells that produce
solitary, obclavate, distoseptate conidia. Podosporiopsis sinensis sp. nov. (the type species) and
P. obclavata sp. nov., both collected on dead branches of unidentified plants in China, are
described and illustrated. A key to Podosporiopsis and similar genera is provided.
KEY worps—anamorphic fungi, asexual morph, taxonomy
Introduction
Lushan Mountain is a world heritage site in Jiangxi Province, China, south
of the Yangtze River and northwest of Poyang Lake. It covers 302 km’ and
is protected by an outlying buffer zone of 500 km’. However, its mycobiota,
especially of saprobic microfungi, are poorly known. During our continuing
mycological surveys (2012-15) in this region, two novel synnematous
hyphomycetes were encountered on dead branches. Close examination showed
significant differences from previously described hyphomycetes, and a new
genus, Podosporiopsis, is erected for them.
Materials & methods
At the end of rainy season, samples of dead branches were collected from
humid or riparian environments, and processed as described by Ma et al.
774 ... Ma, Zhang & Castafieda-Ruiz
(2012). Conidia and conidiophores were measured and photographed using
a Nikon Eclipse E200 with 100x (oil immersion) objectives and SmartV550Dc
digital camera. Adobe Photoshop 7.0 was used to process images into plates,
with backgrounds replaced for esthetic reasons. The specimens studied
are deposited in the Plant Pathology Herbarium, Jiangxi Agricultural
University, Nanchang, China (HJAUP), and the Mycological Herbarium,
Institute of Microbiology, Chinese Academy of Sciences, Beijing, China
(HMAS; http://hmas.im.ac.cn).
Taxonomy
Podosporiopsis Jian Ma, X.G. Zhang & R.F. Castafieda, gen. nov.
INDEX FUNGORUM IF 551862
Differs from Podosporium by its distoseptate conidia.
TYPE SPECIES: Podosporiopsis sinensis Jian Ma et al.
EryMoLoey: refers to its similarity to Podosporium.
CONIDIOMATA synnematous, solitary, erect, cylindrical, indeterminate,
dematiaceous. CONIDIOPHORES synnematous, unbranched, _ septate,
dematiaceous. CONIDIOGENOUS CELLS diverging from the synnematal axis,
monotretic, integrated, terminal, determinate or with percurrent extensions.
Conidial secession schizolytic. Conip1a solitary, dry, acrogenous, distoseptate.
Podosporiopsis sinensis Jian Ma, X.G. Zhang & R.F. Castafieda, sp.nov. —_ Fics 1, 2
INDEX FUNGORUM IF 551863
Differs from Podosporium spp. by its distoseptate conidia.
Type: China, Jiangxi Province: Lushan Mountain, on dead branches of an unidentified
broadleaf tree, 8 November 2014, J. Ma (Holotype, HHAUP M0279-1; isotype, HMAS
245604).
EryMoLoecy: refers to the country in which the fungus was collected.
Cotontgs effuse on the natural substratum, dark brown to black, hairy.
Mycelium partly superficial, partly immersed in the substratum. CONIDIOMATA
synnematous, solitary, erect, cylindrical, dark brown to black, becoming
narrower toward the apex, up to 1000 um high, 100-120 um wide at the often
swollen base, fertile region with more than half the length of the synnemata.
CONIDIOPHORES distinct, synnematous, cylindrical, unbranched, septate,
smooth, brown to dark brown, up to 1000 um long, 6-10 um wide, diverging
laterally and terminally. CoNIDIOGENOUS CELLS monotretic, integrated,
terminal, cylindrical, smooth, brown, determinate, or sometimes with 1-2
cylindrical percurrent extensions, 12-27 x 6-8.5 um. Conidial secession
schizolytic. Conrp1 solitary, dry, acrogenous, smooth, straight or curved,
Podosporiopsis gen. & spp. nov. (China) ... 775
Fic. 1. Podosporiopsis sinensis (holotype, HJAUP M0279-1): A-C. Synnemata with conidiophores
and conidia; D, E. Conidia. Scale bars: A~C = 100 um; D, E = 40 um.
obclavate, 10-14-distoseptate, pale brown to brown, 65-97 um long, 10-15 um
thick at the widest part, tapering to 3-4.5 um at the apex, 5-7 um wide at the
truncate base.
Podosporiopsis obclavata Jian Ma, X.G. Zhang & R.F. Castafieda, sp. nov. Fics 3, 4
INDEX FUNGORUM IF 551864
Differs from Podosporiopsis sinensis by its longer and narrower, 8-20-distoseptate
conidia with the truncate base narrower than the apex.
Type: China, Jiangxi Province: Lushan Mountain, on dead branches of an unidentified
broadleaf tree, 8 November 2014, J. Ma (Holotype, HHAUP M0279-2; isotype, HMAS
245605).
EryMo_oey: obclavata, referring to the obclavate conidia of this fungus.
Cotontgs effuse on the natural substratum, dark brown to black, hairy.
Mycelium partly superficial, partly immersed in the substratum. CONIDIOMATA
synnematous, solitary, erect, cylindrical, dark brown to black, becoming
narrower toward the apex, <1420 um tall, 65-170 um diam. at the often
776 ... Ma, Zhang & Castafieda-Ruiz
A
Fic. 2. Podosporiopsis sinensis (holotype, HJAUP M0279-1): A-C. Conidiophores with terminal,
monotretic conidiogenous cells; D-F. Conidiophores with terminal conidia and 0-1 percurrent
extension. Scale bars = 40 um.
swollen base, fertile region with more than half the length of the synnemata.
CONIDIOPHORES distinct, synnematous, cylindrical, unbranched, septate,
smooth, brown to dark brown, <1400 um long, 5-7.5 um diam., diverging
Podosporiopsis gen. & spp. nov. (China) ... 777
Fic. 3. Podosporiopsis obclavata (holotype, HJAUP M0279-2): A-C. Synnemata with conidiophores
and conidia; D, E. Conidia. Scale bars: A = 100 um; B, C = 80 um; D, E = 40 um.
laterally and terminally. CoNIDIOGENOUS CELLS monotretic, integrated,
terminal, cylindrical, smooth, brown to pale brown, determinate or sometimes
with 1-2 cylindrical percurrent extensions, 20-40 x 5-6.5 um. Conidial
secession schizolytic. Conip1A solitary, dry, acrogenous, smooth, straight or
curved, obclavate, 8-20-distoseptate, pale brown, 95-160 um long, 8-11 um
diam. at the widest part, tapering to 3.5-5.5 um at the apex and 2-4 um at the
truncate base.
Discussion
Podosporiopsis sinensis and P. obclavata are unique in having distinct
unbranched conidiophores forming synnematous conidiomata, and solitary
obclavate distoseptate conidia seceding schizolytically from monotretic,
integrated, terminal, determinate or percurrently extending conidiogenous
cells diverging from the axis of the synnemata. We initially thought of assigning
them to the genus Podosporium Schwein. (Schweinitz 1832), but the conidia in
Podosporium are euseptate rather than distoseptate, and the addition of these
species would have significantly broadened its generic concept. Furthermore,
conidial septation (euseptate vs distoseptate) has often been used as a generic
character to divide otherwise morphologically similar fungi (e.g., Ellisembia
vs Sporidesmium, Linkosia vs Stanjehughesia, Sporidesmiella vs Repetophragma,
778 ... Ma, Zhang & Castafieda-Ruiz
A
Fic. 4. Podosporiopsis obclavata (holotype, HJAUP M0279-2): A. Conidiophore with developing
conidium; B, C. Conidiophores with terminal conidia, conidiogenous cells, and percurrent
extensions; D. Conidiophores with terminal, monotretic conidiogenous cells and percurrent
extensions. Scale bars = 40 um.
Solicorynespora vs Corynespora, and Parablastocatena vs Blastocatena) and
provides a narrow generic concept (Seifert et al. 2011; Zhang et al. 2012).
Such distinctions also help avoid confusion and complexity in a number of
hyphomycete genera and facilitate the morphological division of larger genera
into smaller units (Subramanian 1992; McKenzie 1995; Wu & Zhuang 2005).
For these reasons, we propose the new genus Podosporiopsis to accommodate
P. sinensis and P. obclavata.
Podosporiopsis resembles Dendrographium Massee (Massee 1892),
Exosporium Link (Link 1809), Corynespora Gtssow (Glssow 1906), and
Solicorynespora R.F. Castaheda & W.B. Kendr. (Castafeda-Ruiz & Kendrick
1990) in possessing distinct conidiophores with tretic conidiogenesis.
However, in Dendrographium and Exosporium conidiogenesis is polytretic, in
contrast to the monotretic conidiogenesis of Podosporiopsis. Conidiogenesis
Podosporiopsis gen. & spp. nov. (China) ... 779
in Corynespora and Solicorynespora is the same as in Podosporiopsis, but
Podosporiopsis has synnematous conidiomata not found in Corynespora and
Solicorynespora.
Several other genera including Gangliostilbe Subram. & Vittal (Vittal
1976), Novozymia W.P. Wu (Wu & Zhuang 2005), Neosporidesmium Mercado
& J. Mena (Mercado Sierra & Mena Portales 1988), Raizadenia S.L. Srivast.
(Srivastava 1981), and Annellophragmia Subram. (Subramanian 1963) have
morphological characters similar to those of Podosporiopsis. However,
conidiogenesis is polyblastic sympodial in Annellophragmia, monoblastic with
percurrent extension in Novozymia, and monoblastic but producing euseptate
conidia in Gangliostilbe, all of which differ from the monotretic conidiogenesis
of Podosporiopsis. Conidia in Neosporidesmium and Raizadenia are distoseptate
but conidiogenesis is monoblastic, an obvious difference from Podosporiopsis.
Key to Podosporiopsis and morphologically similar genera
1. Coenidiogenous cells enteroblastic :..4 bce sda 4 ences oon ten sn ee le 2
f. Gonidiogenousscellsiiolablastices nok Sanat Att Aneel Aiea neat As ettt Aeet An: 7
PEC Onidiosenious- cell spol VTHOELE cts & axesube fst fj Paul Cj ececth geese patos pe nce Ge ne Eos 3
2yGonidiogenous cella mGnomehicis AT on wT ok yl Steal Bhatt ek call ahs 4
3. Conidiophores divergent from synnematal capitulum,
conidia with an non-darkened hilum ...................... Dendrographium
3. Conidiophores mononematous or divergent from stipe and synnematal capitulum,
conidia with a conspicuously darkened hilum ................... Exosporium
4 Conidiophores morionemMatous «0.6 5) pe Dae eek Bare seey rere Dae been wr hha ot eto 5
AV GMI CIOPMOTESSyAINERIALOUR: 7 ate eRe Re Sa Re ea Me Rr Me ee 6
DUG ON Iga MSL OSEPLALEs 125 Gaote ena uac te Pine adeaht-oeedeade owes sate aie ase nate ahtne worth Corynespora
PLC OBICIA GUIS CL ALG: Ws or Sia Od sen Oa id en a Hato bh a Hodes la ta besa be ret a sarge a Solicorynespora
GAC Oiicia GISLOSEPLAtes ng hehe hater pte arse oe Bere! rater Podosporiopsis
GAGonidia- CUS plates. Hts Bede Beit 2 hcwiies« Mecwites« Meewiiose Whom bp fens s heontens Podosporium
7. Conidiogenous cells: polyblastic «wi... nee connie tana eeeee came es Annellophragmia
Fe Gonidiosenois.cellsmOno blastic” so. ps .ecbea ce sce bencer a ecben.erwcacbencera Seb qe se Geese e qeac shark 8
8. Conidiophores divergent from stipe and synnematal capitulum ................ 9
8. Conidiophores divergent from synnematal capitulum .....................00. 10
9. Conidiogenous cells with annellidic percurrent proliferation .......... Novozymia
9. Conidiogenous cells determinate or with lageniform, ampulliform,
ordohiform proliteratOney At... 2eten teams tan ean atta is Neosporidesmium
IG s@onidia-cdistoseptate te. m eae eod Cet ok eet ad er tod wees ad whe od ow, Raizadenia
LO “Conidia’ euseptatery div. 2.iy 1h teen Be cing te cme te eet he gis Be tts Gangliostilbe
780 ... Ma, Zhang & Castafieda-Ruiz
Acknowledgments
The authors express gratitude to Dr. W.B. Kendrick and Dr. De-Wei Li for serving
as pre-submission reviewers, to Dr. Shaun Pennycook for nomenclatural review, and to
Dr. Lorelei L. Norvell for editorial review. This project was supported by the National
Natural Science Foundation of China (No. 31360011).
Literature cited
Castaneda-Ruiz RF, Kendrick B. 1990. Conidial fungi from Cuba: II. Univ. Waterloo Biol. Ser. 33:
1-61.
Giissow HT. 1906. Uber eine neue Krankheit an Gurken in England (Corynespora mazei, Giissow
gen. et sp. nov.). Z. Pflanzenkrankh. 16: 10-13.
Link HE 1809. Observationes in ordines plantarum naturales. Dissertatio I. Mag. Ges. Naturf.
Freunde Berlin 3: 3-42.
Ma J, Zhang YD, Ma LG, Castafieda-Ruiz RF, Zhang XG. 2012. Three new species of Sporidesmiella
from southern China. Mycoscience 53: 187-193. http://dx.doi.org/10.1007/s10267-011-0152-1
Massee GE. 1892. Notes on exotic fungi in the Royal Herbarium, Kew. Grevillea 21: 1-6.
McKenzie EHC. 1995. Dematiaceous hyphomycetes on Pandanaceae. 5. Sporidesmium sensu lato.
Mycotaxon 56: 9-29.
Mercado Sierra A, Mena Portales J. 1988. Nuevos o raros hifomicetes de Cuba. VI. Neosporidesmium,
nuevo genero sinematico. Acta Bot. Cub. 59: 1-6.
Schweinitz LD von. 1832. Synopsis fungorum in America boreali media degentium. Trans. Am.
phil. Soc. 4: 141-316.
Seifert K, Morgan-Jones G, Gams W, Kendrick B. 2011. The genera of hyphomycetes. CBS
Biodiversity Series 9. 997 p.
Srivastava SL. 1981. Raizadenia: a new genus of hyphomycetes from India. Indian Phytopath.
34: 334-336.
Subramanian CV. 1963. On Arthrobotryum coonoorense. Proc. Indian Acad. Sci. B 58: 348-350.
Subramanian CV. 1992. A reassessment of Sporidesmium (hyphomycetes) and some related taxa.
Proc. Indian. Natn. Sci. Acad. B 58: 179-190.
Vittal BPR. 1976 [“1975”]. Gangliostilbe indica, a new synnematous hyphomycete from India.
Kavaka 3: 69-71.
Wu WP, Zhuang WY. 2005. Sporidesmium, Endophragmiella and related genera from China. Fungal
Divers. Res. Ser. 15. 351 p.
Zhang YD, Ma J, Ma LG, Zhang XG. 2012. Parablastocatena tetracerae gen. et sp. nov.
and Corynesporella licualae sp. nov. from Hainan, China. Mycoscience 53: 381-385.
http://dx.doi.org/10.1007/s10267-011-0171-y
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 © 2016. Mycotaxon, Ltd.
October-December 2016—Volume 131, pp. 781-790
http://dx.doi.org/10.5248/131.781
Distribution of Alternaria species among sections. 3.
Sections Infectoriae and Pseudoalternaria
PHILIPP B. GANNIBAL™ & DANIEL P. LAWRENCE?
‘Laboratory of Mycology and Phytopathology, All-Russian Institute of Plant Protection,
Shosse Podbelskogo 3, Saint Petersburg, 196608, Russia
? Department of Plant Pathology, University of California,
One Shields Avenue, Davis, CA 95616, USA
* CORRESPONDENCE TO: [email protected]
ABsTRACT—Morphological examination of material conforming to the morphological
description of Alternaria sect. Infectoriae (but not phylogenetically characterized) allowed
the inclusion of nine additional species in this section, which thus encompasses 34 species.
Alternaria sect. Pseudoalternaria consists of two species and one misidentified isolate that
represents a novel taxon, described here as Alternaria parvicaespitosa. Emended descriptions
of A. sect. Infectoriae and A. sect. Pseudoalternaria are presented, and their species are listed.
Key worps—Alternaria infectoria, Alternaria rosae, Lewia
This article is dedicated to the jubilee of the flourishing 200-year-old girl, Alternaria.
Introduction
Alternaria Nees 1816 is a large pleomorphic genus that comprises
approximately 280 distinguishable species (Simmons 2007). A large series of
morphological and phylogenetic studies have attempted to better resolve the
phylogeny of Alternaria and other alternarioid hyphomycetes by utilizing more
than ten different genomic loci (Pryor & Bigelow 2003; Hong et al. 2005; Runa
et al. 2009; Lawrence et al. 2012, 2013, 2014; Woudenberg et al. 2013, 2014;
Armitage et al. 2015). Several well-supported lineages (phylogenetic species-
groups) have been revealed within the alternarioid hyphomycetes and have led
to several taxonomic novelties. The genus Alternaria was recently divided into
eight taxonomic sections by Lawrence et al. (2013) followed by the elevation
782 ... Gannibal & Lawrence
of 19 additional clades by Woudenberg et al. (2013, 2014), Grum-Grzhimaylo
et al. (2016), and Lawrence et al. (2016), thereby bringing the total number of
sections of Alternaria to 27.
All works support the monophyly of two morphologically peculiar
Alternaria groups, two of several groups having members with catenate, small-
spored conidia. Recently these groups were elevated to sectional status, as
A. sect. Infectoriae and A. sect. Pseudoalternaria.
Twenty-five species were indicated as members of sect. Infectoriae by
Lawrence et al. (2013). Woudenberg et al. (2013) added two additional species
to this clade, bringing the total number of recognized species to 27. Lawrence
et al. (2013) also mentioned three species (A. peglionii, A. dianthicola, and
A. photistica) that cannot be included in sect. Infectoriae. The sequenced
strain of A. peglionii (CBS 103.26) was not the type, and this species was
previously listed as incertae sedis (Simmons 2007). The sequenced strain of
A. dianthicola was not designated by E.G. Simmons as a representative strain.
When a representative strain of A. dianthicola was utilized it clustered distantly
to sect. Infectoriae (Woudenberg et al. 2013). Also Lawrence et al. (2013) and
Woudenberg et al. (2013) used the same strain of A. photistica (EGS 35.172), but
it was obtained from different sources. Conclusions by Woudenberg et al. (2013)
based on molecular and morphological data placed A. photistica in sect. Panax
and A. dianthicola in sect. Dianthicola. Ariyawansa et al. (2015) described a new
species, A. murispora, in section Infectoriae based on ascomatal morphology
and DNA analysis; no living culture or conidial state of this species is known.
Ariyawansa et al. (2015) also noted that the type isolate of Xenobotryosphaeria
calamagrostidis (CBS 303.71) clustered in sect. Infectoriae (albeit with low
support) and only the sexual state was produced in culture and clearly
differed from species within Alternaria sect. Infectoriae. The authenticity of
X. calamagrostidis remains unresolved and would benefit from a re-examination
of morphological and molecular characters for this peculiar isolate/taxon.
The number of species recovered by phylogenetic species recognition
approaches can differ from that revealed by morphological analysis. Very likely
a morphological concept favors splitting. For instance, phylogenetic analyses of
three genomic regions from 39 infectoria species-group isolates (Andersen et al.
2009) were unable to provide strong support for species-level designations for
most isolates. No correlations were found among phylogenetic data, metabolite
production, morphological identity, proascoma formation, ability to grow
at 37°C, and host or geographic origin. Gannibal & Yli-Mattila (2007), who
utilized a set of 52 infectoria species-group isolates (including representative
strains of eight morphospecies), were unable to divide the isolates into distinct
groups based on data from molecular fingerprinting.
Alternaria sect. Infectoriae & A. sect. Pseudoalternaria ... 783
The main discriminating morphological features of many Alternaria sect.
Infectoriae species are small conidia (in culture usually no longer than 60 um)
and long secondary conidiophores (Lawrence et al. 2013; Woudenberg et al.
2013). Ten species have a known sexual state (A. alternarina, A. daucicaulis,
A. ethzedia, A. hordeiaustralica, A. hordeicola, A. infectoria, A. intercepta,
A. murispora, A. scrophulariae, and A. viburni). Some strains are capable of
producing proascoma in axenic culture, suggesting that members of this
group, at least in part, are homothallic (Andersen et al. 2009). In general
fungi in this section are common. Usually they exist as saprobes showing no
substrate preference. This group produces reliable chemotaxonomic markers
(Christensen et al. 2005; Andersen et al. 2002, 2009). Some authors have shown
that strains of this group do not produce mycotoxins generally made by other
small-spored Alternaria sections (e.g., sect. Alternaria) (Andersen et al. 2002).
Other studies revealed the ability of some species to produce alternariol and
monomethyl ether (Oviedo et al. 2013), which probably is common for other
Alternaria sections.
Lawrence et al. (2014) assigned two species, sister to A. sect. Infectoriae, to
a new genus, “Pseudoalternaria” nom. inval. This placement became untenable
after all alternarioid hyphomycetes were collected under the single generic
name Alternaria (Woudenberg et al. 2013). The thorough review by Lawrence
et al. (2016) resurrected “Pseudoalternaria” as a new section, Alternaria sect.
Pseudoalternaria, typified by a new species, Alternaria arrhenatheri.
Section Pseudoalternaria currently consists of two described species,
A. arrhenatheri D.P. Lawr. et al. and A. rosae E.G. Simmons & C.F. Hill, and
one misidentified isolate (X1272, isolated from blueberry and identified as
A. rosae by Zhu & Xiao 2015) but which represents a third/new species (based
on molecular and morphological data), described here as A. parvicaespitosa.
Ongoing molecular studies will likely identify additional species and novel
lineages within Alternaria. However, living cultures are not known for several
morphospecies. Additionally some herbaria materials are recalcitrant to DNA
isolation and/or devoid of conidia. Fortunately, the morphological diversity
of Alternaria has been well studied (Simmons 2007). Classical comparative
morphological studies are useful for establishing phylogenetic affiliation. This
work is a continuation of the series started with the manuscripts on sections
Porri and Alternaria (Gannibal 2015, 2016). The aim of the present work is
to detect among phylogenetically unexamined Alternaria species those species
that fit the current morphological circumscription of sections Infectoriae and
Pseudoalternaria and to emend the morphological concept of these sections.
784. ... Gannibal & Lawrence
Materials & methods
The morphology of almost all Alternaria species with legitimate names was
analyzed with regard to conformity with criteria of Alternaria sections Infectoriae and
Pseudoalternaria. The morphological assessment was based on descriptions made by
Simmons (2007) or using original diagnoses and illustrations for species described after
2007. Descriptions of three species included in sect. Infectoriae were found in Roberts
(2008: A. roseogrisea), Roberts et al. (2010: A. cerasidanica), and Ariyawansa et al.
(2015: A. murispora). Strain X1272 was cultured on potato carrot agar (PCA) at 24°C
under light/dark cycle (12/12 h) for 7-10 days to promote sporulation in order to
describe this as a new taxon; the holotype specimen (a metabolically inactive dried PCA
culture) was conserved in the Mycological Herbarium, All-Russian Institute of Plant
Protection, Saint Petersburg, Russia (LEP).
Results & discussion
The evaluation of all available descriptions of Alternaria species allowed
for the inclusion of nine additional species in sect. Infectoriae, two of which
have no known living isolates. The diversity of this section consists of 34
morphologically recognizable species. Recircumscription of the misidentified
isolate, A. rosae strain X1272 (Zhu & Xiao 2015), allowed for the addition of
one species to sect. Pseudoalternaria bringing the total number of species in
this clade to three.
Alternaria parvicaespitosa Gannibal & D.P. Lawr., sp. nov. FIGS 1, 2
MycoBAank MB 816666
Differs from Alternaria rosae by its shorter conidial chains (non-branched parts) and
narrower conidia with fewer transverse septa.
Type: USA, California, Tulare, harvested blueberry fruit from a commercial fruit-
packing center, 6 June 2013, X.Q. Zhu & C.L. Xiao X1272 (Holotype, LEP 014858, a
metabolically inactive dried culture).
EryMo_oey: parvi (Latin), small; caespitosa (Latin), bushy.
Sporulation on PCA occurs primarily in discrete bushy clumps. Conidiophores
arise as series in close proximity to one another from submerged or (more
often) aerial hyphae. Aerial conidiogenous hyphae are hyaline filiform or thick
colored conidiophore-like and may be positioned vertically or horizontally.
Most conidiophores remain relatively short, 35-70 x 3-4 um. They are
simple or sometimes produce two branches. Each branch is multigeniculate
(1-6 genua near conidiogenous loci). The conidiogenous sites produce short
chains of conidia (<3-4 between branching points) which usually have one
or a few branches due to the production of several conidiogenous sites on
an apical secondary conidiophore or (very rarely) due to the formation of a
lateral secondary conidiophore. Aged clumps of conidia developed on a single
conidiophore may comprise <20 conidia.
Alternaria sect. Infectoriae & A. sect. Pseudoalternaria ... 785
50 um
————
Fic. 1. Alternaria parvicaespitosa (ex holotype, LEP 014858): sporulation pattern.
Fic. 2. Alternaria parvicaespitosa (ex holotype, LEP 014858): conidia and conidiophores.
786 ... Gannibal & Lawrence
Both juvenile and mature conidia are ovoid or elliptical. Small portion of
conidia is obclavate. Maximum size range of mature conidia is 10-25 x 7-12 um.
Conidia have 1-3(-4) transverse septa and at most one longiseptum in 1-2 of
the transverse segments. Rarely conidia have no longisepta. Most conidia have
no secondary conidiophores; but any conidium, including 1-celled units and
conidia with relatively large conidial bodies, can produce an apical secondary
conidiophore (a single cell ca 3 x 3 um) or a geniculate extension 5-28 um
long with 2-5 conidiogenous sites. Rarely apical secondary conidiophores are
branched. Lateral secondary conidiophores appear rarely and when present
are short. Conidia and conidiophores are concolorous, medium brown. The
conidium outer wall is smooth or (in the largest conidia) slightly punctulate.
Alternaria species in sections Infectoriae and Pseudoalternaria are listed in
TABLE l.
Herein we present emended and somewhat expanded versions of the
descriptions of Alternaria sect. Infectoriae by Woudenberg et al. (2013) and of
A. sect. Pseudoalternaria by Lawrence et al. (2016). Characters are quantified
when appropriate, and examples are provided of species whose quantified
characters either depart from the section norm or conform to it.
Alternaria sect. Infectoriae Woudenb. & Crous, Stud. Mycol. 75: 194. 2013; emend.
Gannibal & Lawrence
On PCA or weak potato dextrose agar (WPDA) primary conidiophores arise
from the agar surface or from vegetative aerial hyphae. Primary conidiophores
are solitary or aggregated, cylindrically straight or geniculate, simple or
branched, short to long, septate, brown, 20-150 x 3-4 um, with one or several
(2-6) conidiogenous loci (pores) at the apex and throughout its length. Conidial
chains are moderately long to long, simple or (usually) branched. Branching is
produced by the occurrence of several conidiogenous loci on apical secondary
conidiophores or (rarely: in some species completely absent) lateral secondary
conidiophores.
Young conidia are ovoid, broadly ovoid, ellipsoid or subellipsoid, erostrate
or with short to long secondary conidiophore at the apex. Mature conidia
are obclavate, ovoid, ellipsoid or subellipsoid; small or moderate in size; with
(1-)4-7(-10) transverse and no, one or a few longitudinal septa; slightly
constricted near some transverse septa. Size of conidia is 30-60 x 6-15 um
(except conidia with long secondary conidiophores); sometimes a large number
of conidia remain small (12-30 x 5-10 um). Several species (e.g., A. triticina)
can produce relatively larger conidia, <60 x 25 um, not including secondary
Alternaria sect. Infectoriae & A. sect. Pseudoalternaria ... 787
TABLE 1. List of Alternaria spp. assigned to A. sect. Infectoriae and
A. sect. Pseudoalternaria.
Names with bracketed annotations = species with phylogenetic data (in the cited references).
Unannotated names = species with reliable living cultures and herbarium specimens.
Names with asterisk = species for which no known living isolates are available.
Section Infectoriae
A
A
A.
A
Ces ee ees
pe Seis es Ba
peo
eT ee
A
A
A
A
A.
Be CBE BO ee ies De
. alternarina E.G. Simmons (Lawrence et al. 2013, 2014)
. arbusti E.G. Simmons (Lawrence et al. 2013, 2014)
astragali Wangeline & E.G. Simmons
. caespitosa (de Hoog & C. Rubio) Woudenb. & Crous (Woudenberg et al. 2013; Grum-Grzhimaylo et al.
2015)
californica E.G. Simmons & S.T. Koike (Lawrence et al. 2013, 2014)
cerasi Potebnia [*]
cerasidanica R.G. Roberts
daucicaulis E.G. Simmons (Lawrence et al. 2013, 2014)
ethzedia E.G. Simmons (Pryor & Bigelow 2003; Hong et al. 2005; Lawrence et al. 2013; Woudenberg et al.
2013; Grum-Grzhimaylo et al. 2015)
frumenti E.G. Simmons & C.E Hill (Lawrence et al. 2013, 2014)
geophila Dasz.
graminicola E.G. Simmons (Lawrence et al. 2013, 2014)
hordeiaustralica E.G. Simmons & Alcorn (Lawrence et al. 2013, 2014)
hordeicola E.G. Simmons & Kosiak (Lawrence et al. 2013, 2014)
humuli E.G. Simmons (Lawrence et al. 2013, 2014)
incomplexa E.G. Simmons (Lawrence et al. 2013, 2014)
infectoria E.G. Simmons (Pryor & Bigelow 2003; Lawrence et al. 2013; Woudenberg et al. 2013; Grum-
Grzhimaylo et al. 2015)
intercepta E.G. Simmons (Lawrence et al. 2013, 2014)
iridiaustralis E.G. Simmons, Alcorn & C.F. Hill
litorea (Pivkin & Zvereva) E.G. Simmons [*]
merytae E.G. Simmons (Lawrence et al. 2013, 2014)
metachromatica E.G. Simmons (Hong et al. 2005; Lawrence et al. 2013, 2014)
murispora Ariyaw. & K.D. Hyde [*] (Ariyawansa et al. 2015)
novae-zelandiae E.G. Simmons (Lawrence et al. 2013, 2014)
oregonensis E.G. Simmons (Hong et al. 2005; Lawrence et al. 2013; Woudenberg et al. 2013; Grum-
Grzhimaylo et al. 2015)
roseogrisea R.G. Roberts
scrophulariae (Desm.) Rossman & W.C. Allen (Hong et al. 2005; Lawrence et al. 2013; Woudenberg et al.
2013; Grum-Grzhimaylo et al. 2015)
seleniiphila Wangeline & E.G. Simmons
slovaca (Svob.-Pol., L. Chmel & Bojan.) Woudenb. & Crous (Woudenberg et al. 2013; Grum-Grzhimaylo
et al. 2015)
. triticimaculans E.G. Simmons & Perellé (Lawrence et al. 2013, 2014)
. triticina Prasada & Prabhu (Pryor & Bigelow 2003; Lawrence et al. 2013)
. vaccinii E.G. Simmons
. ventricosa R.G. Roberts (Lawrence et al. 2013, 2014)
viburni E.G. Simmons (Lawrence et al. 2013, 2014)
Section Pseudoalternaria
A
A
A
. arrhenatheri D.P. Lawr., Rotondo & Gannibal (Lawrence et al. 2014, 2016)
. rosae E.G. Simmons & C.F. Hill (Lawrence et al. 2013, 2014)
. parvicaespitosa Gannibal & D.P. Lawr. (Zhu & Xiao 2015, as “A. rosae”)
788 ... Gannibal & Lawrence
conidiophores. Some mature conidia remain erostrate or produce secondary
conidiophores. Apical secondary conidiophores are short or long, simple or
branched, usually geniculate with one or (often) a few (<5-7) conidiogenous
loci over its entire length. Approximately 30% of mature conidia produce at
least 4 transverse septa in the conidium body terminating in a chain that is
ovoid or ellipsoid and has no secondary conidiophores, beak or conidiogenous
loci on apical cell. At least 10% of mature conidia produce apical secondary
conidiophores that are longer than conidial body and exceed 30 um (often
reaching 50-100+ um). Long apical conidiophores having only one transverse
septum and no longitudinal septa are sometimes produced by very small
conidia. Some conidia have short solitary lateral secondary conidiophores
with one or two conidiogenous loci. Conidia are pale brown, yellowish to dark
brown; the spore wall is smooth or conspicuously ornamented.
Ascomata on natural substrata are erumpent, almost superficial or submerged
into host cortex, scattered, subglobose to sphaeroid with a short blunt beak,
dark, smooth, thin-walled at maturity. Asci subcylindrical, straight, curved or
muriform, usually 8-spored. Mature ascospores are ellipsoid, 5-7 transverse
septa, forming one or two longitudinal septa through each central or sometimes
through apical transverse segments, conspicuously constricted at median
septum and slightly so at two other transepta, brown.
Colony color on rich media like PDA, PSA, DRYES or Czapek-Dox agar, is
light: white, delicate rose, light gray or pale olivaceous. Colonies usually do not
sporulate in the dark, especially on rich media. Sporulation is usually copious
on PCA or V8 agar medium, intensive light or near UV light (when grown in
glass Petri dishes).
Alternaria sect. Pseudoalternaria D.P. Lawr., Rotondo & Gannibal, Mycol. Progr.
15:3 [11 of 22]. 2016; emend. Gannibal & Lawrence
On PCA or WPDA sporulation aggregated, appearing granular to the
naked eye. Mycelium subhyaline to light brown; hyphae smooth, branched,
septate, 3.8-5 um wide. Primary conidiophores aggregated on agar surface or
developing from arachnoid aerial hyphae, simple or branched, septate, smooth,
medium brown, 8.7-37.5 x 3.7-5 um (M = 18.1 x 4.8 um), simple with single
apical pore. Secondary conidiophores short to long, simple to multi-geniculate
with one to many conidiogenous loci. Conidia 10-32.5 x 4.7-10 um (M = 16.8
x 7.3 um), mostly catenulate, ellipsoid to obclavate, medium brown to golden
brown, 3-4 transverse septa, 1-2 longitudinal septa, smooth, may produce a
secondary conidiophore (false beak).
Alternaria sect. Infectoriae & A. sect. Pseudoalternaria ... 789
Acknowledgments
The authors are grateful to Dr. Hiran Ariyawansa (Guizhou Academy of Agricultural
Sciences, Guizhou University, Guiyang, China) and Dr. Andrew Armitage (Genetics
and Crop Improvement, East Mailing Research, UK) for presubmission review. This
work was supported by Russian Science Foundation (project #14-26-00067).
Literature cited
Andersen B, Kroger E, Roberts RG. 2002. Chemical and morphological segregation of Alternaria
arborescens, A. infectoria and A. tenuissima species-group. Mycol. Res. 106(2): 170-182.
http://dx.doi.org/10.1017/S0953756201005263
Andersen B, Sorensen EL, Nielsen KF, van den Ende BG, de Hoog S. 2009. A polyphasic approach
to the taxonomy of the Alternaria infectoria species-group. Fungal. Genet. Biol. 46: 642-656.
http://dx.doi.org/10.1016/j.fgb.2009.05.005
Ariyawansa HA, Thambugala KM Manamgoda DS, Jayawardena R, Camporesi E, Boonmee S,
Wanasinghe DN, Phookamsak R, Hongsanan S, Singtripop C, Chukeatirote E, Kang J-C, Jones
EBG, Hyde KD. 2015. Towards a natural classification and backbone tree for Pleosporaceae.
Fungal Diversity 71(1): 85-139. http://dx.doi.org/10.1007/s13225-015-0323-z
Armitage AD, Barbara DJ, Harrison RJ, Lane CR, Sreenivasaprasad S, Woodhall JW, Clarcson
JP. 2015. Discrete lineages within Alternaria alternata species group: Identification using
new highly variable loci and support from morphological characters. Fungal Biol. 119(11):
994-1006. http://dx.doi.org/10.1016/j.funbio.2015.06.012
Christensen KB, Van Klink JW, Weavers RT, Larsen TO, Andersen B, Phipps RK. 2005. Novel
chemotaxonomic markers of the Alternaria infectoria species-group. J. Agric. Food Chem.
53(24): 9431-9435. http://dx.doi.org/10.1021/jf0513213
Gannibal PhB. 2015. Distribution of Alternaria species among sections. 1. Section Porri. Mycotaxon
130(1): 207-213. http://dx.doi.org/10.5248/130.207
Gannibal PhB. 2016 [“2015”]. Distribution of Alternaria species among sections. 2. Section
Alternaria. Mycotaxon 130(4): 941-949. http://dx.doi.org/10.5248/130.941
Gannibal PhB, Yli-Mattila T. 2007. Morphological and UP-PCR analyses and design of a PCR assay
for differentiation of Alternaria infectoria species-group. Mikologiya i Fitopatologiya 41(4):
313-922,
Grum-Grzhimaylo AA, Georgieva ML, Bondarenko SA, Debets AJM, Bilanenko EN. 2016. On the
diversity of fungi from soda soils. Fungal Diversity 76(1): 27-74.
http://dx.doi.org/10.1007/s13225-015-0320-2
Hong SG, Cramer RA, Lawrence CB, Pryor BM. 2005. Alt a 1 allergen homologs from Alternaria
and related taxa: analysis of phylogenetic content and secondary structure. Fungal Genet. Biol.
42: 119-129. http://dx.doi.org/10.1016/j.fgb.2004.10.009
Lawrence DP, Park MS, Pryor BM. 2012. Nimbya and Embellisia revisited, with nov.
comb. for Alternaria celosiae and A. perpunctulata. Mycol. Progress 11(3): 799-815.
http://dx.doi.org/10.1007/s11557-011-0793-7
Lawrence DP, Gannibal PhB, Peever TL, Pryor BM. 2013. The sections of Alternaria: formalizing
species-group concepts. Mycologia 105(3): 530-546. http://dx.doi.org/10.3852/12-249
Lawrence DP, Gannibal PhB, Dugan FM, Pryor BM. 2014. Characterization of Alternaria isolates
from the infectoria species-group and a new taxon from Arrhenatherum, Pseudoalternaria
arrhenatheria sp. nov. Mycol. Progress 13(2): 257-276.
http://dx.doi.org/10.1007/s11557-013-0910-x
Lawrence DP, Rotondo F, Gannibal PhB. 2016. Biodiversity and taxonomy of the pleomorphic
genus Alternaria. Mycol. Progress 15(1):3 1-22. http://dx.doi.org/10.1007/s11557-015-1144-x
790 ... Gannibal & Lawrence
Oviedo MS, Sturm ME, Reynoso MM, Chulze SN, Ramirez ML. 2013. Toxigenic profile and
AFLP variability of Alternaria alternata and Alternaria infectoria occurring on wheat. Braz. J.
Microbiol. 44(2): 447-455. http://dx.doi.org/10.1590/S1517-83822013000200017
Pryor BM, Bigelow DM. 2003. Molecular characterization of Embellisia and Nimbya species and
their relationship to Alternaria, Ulocladium and Stemphylium. Mycologia 95: 1141-1154.
https:/doi.org/10.2307/3761916
Roberts RG. 2008. Alternaria roseogrisea, a new species from achenes of Helianthus annuus
(sunflower). Mycotaxon 103: 21-26.
Roberts RG, Reymond ST, Andersen B. 2010. Alternaria cerasidanica sp. nov., isolated in Denmark
from drupes of Prunus avium. Mycotaxon 111: 175-182. https:/doi.org/10.5248/111.175
Runa F, Park MS, Pryor BM. 2009. Ulocladium systematics revisited: phylogeny and taxonomic
status. Mycol. Progress 8: 35-47. http://dx.doi.org/10.1007/s11557-008-0576-y
Simmons EG. 2007. Alternaria: an identification manual. Utrecht: CBS. 775 p.
Woudenberg JHC, Groenewald JZ, Binder M, Crous PW. 2013. Alternaria redefined. Studies in
Mycology 75: 171-212. http://dx.doi.org/10.3114/sim0015
Woudenberg JHC, Truter M, Groenewald JZ, Crous PW. 2014. Large-spored Alternaria pathogens
in section Porri disentangled. Studies in Mycology 79: 1-47.
http://dx.doi.org/10.1016/j.simyco.2014.07.003
Zhu XQ, Xiao CL. 2015. Phylogenetic, morphological, and pathogenic characterization of
Alternaria species associated with fruit rot of blueberry in California. Phytopathology 105:
1555-1567. http://dx.doi.org/10.1094/PHY TO-05-15-0122-R
MYCOTAXON
ISSN (print) 0093-4666 (online) 2154-8889 © 2016. Mycotaxon, Ltd.
October-December 2016— Volume 131, pp. 791-794
http://dx.doi.org/10.5248/131.791
Zasmidium oleae sp. nov. from China
Bao-Ju L1’*, XUE-WEN XIE, YAN-XIA SHI’, A-LI CHAI’ & YING-LAN Guo?*
‘Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences,
Beijing 100081, PR. China.
° Institute of Microbiology, Chinese Academy of Sciences, Beijing 100101, PR. China
* CORRESPONDENCE TO: [email protected]
ABSTRACT—A new species, Zasmidium oleae on Olea tsoongii is described, illustrated and
discussed. The type specimen is deposited in HMAS.
Key worps—cercosporoid fungi, Mycosphaerellaceae, plant pathogen
Introduction
The genus Zasmidium, established by Fries (1849), was considered a
monotypic genus until recently. Based on molecular sequence analyses,
this genus is now used for cercosporoid fungi in the Mycosphaerellaceae
morphologically characterized by verruculose superficial hyphae in vivo
(rarely lacking); smooth to verruculose conidiophores; conspicuous, somewhat
thickened and darkened, planate conidiogenous loci; and solitary or catenate
conidia with thin to somewhat thickened, smooth to verruculose walls and
somewhat thickened and darkened planate hila (Braun et al. 2013). Zasmidium
oleae, a new species on Olea tsoongii collected in Hainan Province, China,
is described, illustrated, and compared with other cercosporoid species on
Oleaceae. The type specimen is deposited in the Herbarium Mycologium,
Chinese Academy of Sciences, Beijing, China (HMAS).
Taxonomy
Zasmidium oleae Y.L. Guo, X.W. Xie & B.J. Li, sp. nov. FIG. 1
FUNGAL NAME FN570159
Differs from Passalora amurensis by its shorter, smooth, 3-4-septate conidia.
*These authors contributed equally to this work
792 ... Li, Xie & al.
Fic. 1. Zasmidium oleae (HMAS 245707, holotype).
a. Conidia; b. Conidiophores; c. Stroma. Bar = 25 um.
Type: China, Hainan Province, Wanning, on living leaves of Olea tsoongii (Merr.) PS.
Green (Oleaceae), 10 April 2011, coll. Guo Ying-lan 380 (Holotype, HMAS 245707).
ErymMo oey: Derived from the host genus Olea.
Leaf spots amphigenous, circular to angular, 2-8 mm diam., often confluent,
red-brown to dark brown with a yellow to pale olivaceous-brown halo on the
upper surface, pale brown with yellow to pale olivaceous-brown halo on the
lower surface. Caespituli mainly hypogenous. Mycelium internal. Stromata
Zasmidium oleae sp. nov. (China) ... 793
substomatal, globose, pale brown to brown, 25-50 um diam. Conidiophores
densely fasciculate, pale olivaceous-brown to olivaceous-brown, uniform
in color, irregular in width, straight to slightly curved, not branched,
geniculate, thin-walled, smooth, conical to conically truncate at the apex,
0-2-septate, mostly aseptate, 6.7-20(-48) x 4-5.3 um. Conidiogenous cells
integrated, terminal or mostly reduced to conidiogenous cells, 6.7-20 um
long. Conidiogenous loci conspicuous, thickened, darkened, 1.3-2.5 um wide.
Conidia formed singly, cylindrical, brown, thick-walled, verruculose, straight
to variously curved, rounded at the apex, rounded to short obconically truncate
at the base, indistinctly 3- to multiseptate, 40-128 x 4.0-5.8 um, hila thickened
and darkened, 1.3-2.5 um wide.
Discussion
Based on the description in Chupp (1954), Cercospora lumbricoides Turconi
& Maffei on Fraxinus sp. (Oleaceae) is very similar to Z. oleae but differs by its
brown, longer conidiophores (30-60 x 4-6 um) and longer conidia (80-200
x 4-6 um). However, the generic affinity of C. lumbricoides is quite unclear
(the type material has not been traced and the species is known only from the
original description) (Turconi & Maffei 1915).
Passalora amurensis (Ziling) H.D. Shin & U. Braun on Syringa amurensis
Rupr. (Oleaceae), also morphologically similar to Z. oleae, differs in having
pale olivaceous, 3-4-septate, shorter, and smooth conidia (35-70 x 4.0-5.5 um;
Shin & Braun 1996).
Although superficial verruculose mycelium, common in most Zasmidium
species, is lacking on Olea tsoongii, assignment of the new species to Zasmidium
is nevertheless justified. Several comparable species with distinctly verruculose
conidia have recently been allocated to Zasmidium based on molecular data
that support their affinities to this genus.
Acknowledgments
This work was supported by the Project for Fundamental Research on Science
and Technology, Ministry of Science and Technology of China (No. 2013FY110400);
CAAS Agricultural Science and Technology Innovation Program and funded by Key
Laboratory of Biology and Genetic Improvement of Horticultural Crops, Ministry of
Agriculture, China. We are grateful to Dr. U. Braun and Prof. S.Y. Guo for reviewing the
manuscript and to Ms. X.F. Zhu for inking the line drawing.
Literature cited
Braun U, Nakashima C, Crous PW. 2013. Cercosporoid fungi (Mycosphaerellaceae) 1.
Species on other fungi, Pteridophyta and Gymnospermae. IMA Fungus 4(2): 265-345.
http://dx.doi.org/10.5598/imafungus.2013.04.02.12
79A< ... Li, Xie & al.
Chupp C. 1954. A monograph of the fungus genus Cercospora. Ithaca, New York.
Fries EM. 1849. Summa vegetabilium Scandinaviae. Sectio posterior. Typographia Academica,
Uppsala.
Shin HD, Braun U. 1996. Notes on Korean Cercosporae and allied genera (II). Mycotaxon 58:
157-166.
Turconi M, Maffei L. 2015. Note micologiche e fitopatologiche. I. Cercospora lumbricoides n. sp.
sul Frassino e Nectria Castilloae n. sp. sulla Castilloa elastica, nel Messico. I. Steganosporium
Kosaroffii n. sp. sul Gelso, in Bulgaria. Atti dell’ Istituto Botanico dell’ Universita di Pavia,
Serie 2, 12: 329-336.
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 © 2016. Mycotaxon, Ltd.
October-December 2016— Volume 131, pp. 795-803
http://dx.doi.org/10.5248/131.795
Strigula sinoaustralis sp. nov.
and three Strigula spp. new to China
SHU-HUA JIANG »?, XIN-LI WEI ! & JIANG-CHUN WEI"?
'State Key Laboratory of Mycology, Institute of Microbiology, Chinese Academy of Sciences,
Beijing 100101, China
? University of Chinese Academy of Sciences, Beijing 100049, China
* CORRESPONDENCE TO: [email protected]
ABSTRACT—A new foliicolous lichen is described from South China. Strigula sinoaustralis is
most similar to S. concreta in ascospore dimensions but differs by its white-punctate thallus
with entire margins and its longer asci. An analysis of its relationships based on molecular
phylogeny is given. Strigula antillarum, S. laureriformis, and S. prasina are reported as new
to China.
KEY WORDS—new species, taxonomy, phylogenetic analysis, lichenized Ascomycota
Introduction
Strigula Fr. (Strigulaceae) is a genus of lichenized fungi containing about 70
species (Hyde et al. 2013). Seventeen Strigula species (twelve foliicolous; five
corticolous or saxicolous) have been recorded from China (Santesson 1952, Wei
& Jiang 1991, Aptroot & Seaward 1999, Aptroot & Sipman 2001, Aptroot 2003,
Aptroot et al. 2003, Licking 2008). During our ongoing studies of lichenized
fungi in China, we found material representing an undescribed Strigula species
and three Strigula species new to China, which are reported here.
Materials & methods
Lichen collections
Most Strigula specimens in this study were collected from Guangxi, Hainan, Yunnan,
and Guangdong provinces and are preserved in the Fungarium of the Institute of
Microbiology, Chinese Academy of Sciences, Beijing, China (HMAS-L); one additional
collection from Xizang is preserved in the Herbarium of Kunming Institute of Botany,
Chinese Academy of Sciences, Kunming, China (KUN).
796 ... Jiang, Wei & Wei
Phenotypic analysis
A Leica M125 dissecting microscope was used for the morphological studies and a
Zeiss Axioscope2 compound microscope with a Zeiss Axio Imager A2 for the anatomical
studies. Sections were studied in tap water and photographed with an AxioCam MRc5
camera. Thin-layer chromatography (TLC) (Culberson & Kristinsson 1970, Culberson
1972, Orange et al. 2001) was used to detect lichen substances.
TABLE 1. Specimens of Strigula spp. and Falciformispora outgroup used in the
phylogenetic analysis
SPECIES VOUCHER SPECIMEN GENBANK No.
S. antillarum HMAS-L 0137209 KX216696*
HMAS-L 0137208 KX216697*
HMAS-L 0137211 KX216702*
S. prasina HMAS-L 0137213 KX216700*
HMAS-L 0137212 KX216701*
S. smaragdula KoLRI016344 KF553663
LFF016344 KF553664
S. sinoaustralis HMAS-L0137203 (T) KX216699*
HMAS-L0137204 KX216698*
E. senegalensis 1P614.60 KP132365
EF. tompkinsii IP559.60 KP132366
* = sequences newly generated for this study by the authors
DNA extraction, amplification, and sequencing
Seven fresh specimens representing three different Strigula species reported from
China were chosen for DNA extraction (TABLE 1). The extraction procedure followed
a modified CTAB method (Rogers & Bendich 1988). The nuclear ribosomal RNA gene
region, including the internal transcribed spacer (ITS), was amplified through PCR
using the primer pair ITS5 and ITS4 (White et al. 1990). Reactions were carried out in
25 ul reaction volume including 1 ul DNA, 1 ul each primer (10 uM), 2 ul dNTP (2.5 mM
each), 2.5 ul amplification buffer (10x, 25 mM MgCl, contained), 0.5 ul Taq polymerase
(rTaq DNA Polymerase, 5 U/ul), 17 ul ddH,O. Cycling parameters were set to an initial
denaturation at 95°C for 5 min, followed by 30 cycles of denaturation at 94°C for 30 s,
annealing at 52°C for 30 s, extension at 72°C for 50 s, and a final extension at 72°C for 10
min. The new sequences generated for this study were deposited in GenBank (TABLE 1).
Phylogenetic analysis
Eleven sequences including seven sequences were newly generated for this study
(TABLE 1) were aligned with the program MAFFT (Katoh 2002); two other accessions of
Strigula smaragdula Fr. were retrieved from GenBank (Jayalal et al. 2013). Due to lack of
ITS sequences of other genera in Strigulales, two species, Falciformispora tompkinsii (El-
Ani) S.A. Ahmed et al. and Falciformispora senegalensis (Segretain et al.) S.A. Ahmed et
al., belonging to Pleosporales (the family most closely related to Strigulales), were chosen
Strigula sinoaustralis sp. nov. (China) ... 797
100 [© Strigula antillarum KX216696
® Siri guila antilarum KX216697
Strigula antillarum KX216702
Strigula smaragdula KF553663
Strigula smaragdula KF553664
2. Strigula prasina KX216700
e Strigula prasina KX216701
®*Swrigula sinoaustralis sp.nov. KX216698
® SHigula sinoaustralis sp.nov. 1-X216699 (T)
Falciformispora tompkinsii KP132366
Falciformispora senegalensis KP132365
0.05
Fic. 1. The Neighbor-Joining tree based on nrDNA ITS sequences. Samples marked with '®’ were
sequenced by the authors; others were downloaded from GenBank. Genetic distance scale = 0.05
changes per site. Numbers above each node represents bootstrap support values >50%.
as outgroup. The alignment was subjected to a Neighbor-Joining analysis involving 1000
replicates with MEGA (Tamura et al. 2011), using the p-distance model.
Results
The best-scoring Neighbor-Joining tree, based on the eleven ITS sequences
(481 bp), is shown in Fic. 1. Within the well-supported (bootstrap = 100%)
monophyletic four-species clade of Strigula, the new species S. sinoaustralis and
the Chinese material of S. antillarum and S. prasina each formed a separate
well-supported branch (bootstraps = 100%).
Taxonomy
Strigula sinoaustralis S.H. Jiang, X.L. Wei & J.C. Wei, sp. nov. PL. 1
FUNGAL NAMES FN570267
Differs from Strigula concreta by its white-punctate thallus with entire margins and its
longer asci.
Type: China. Guangxi Province, Shangsi County, Shiwan mountain forest park, along
the way to Yingkesong and Jiulongsong, 21°54’16”N 107°54’09”E, alt. 271 m, on living
leaves, 26/V/2015, Xin-Li Wei & Jiao-Hong Wang GX20150342 (Holotype, HMAS-L
0137203; GenBank KX216699).
Erymo toey: The epithet sinoaustralis refers to South China.
798 ... Jiang, Wei & Wei
THALLUuS subcuticular, dispersed into rounded patches with entire margins,
without forming distinct lobes, 2-11 mm across and 25-35 um thick; surface
smooth, grayish green, often minutely white-punctate. PHOTOBIONT a
Cephaleuros sp., composed of angular-rounded cells, 8-14 x 4-6 um.
PERITHECIA exposed, almost conical, basal part somewhat broadly
spreading, 0.25-0.4 mm diam. and 100-180 um tall, black. ExcrpuLum
prosoplectenchymatous, 10-18 um thick, brown; INVOLUCRELLUM 22-40 um
thick, carbonaceous, black; PARAPHySES unbranched. Asci cylindrical or
almost thread like, numerous and dense, 72.5-92.5 x 4-5 um. ASCOSPORES
8 per ascus, uniseriate, ellipsoid, 1-septate, usually with 1-2 oil droplets per cell
when fresh, distinctly constricted at the septum and sometimes broken into
parts (fragmented) outside the asci, 8-12 x 2.5-3 um (4-6 um long for each
fragment), 3-4 times as long as broad.
PycnipIA usually rather few, wart-shaped, 0.05-0.15 mm diam.; two types
present: one type 0.1-0.15 mm diam. producing macroconidia that are bacillar,
0-1-septate, 4-6 x 1.8-2.3 um, with a mucilaginous appendage at one or both
ends, 5-10 um long; the second type 0.05-0.1 mm diam., rather few, and often
empty. MICROCONIDIA not seen.
CHEMISTRY. No substances detected by TLC.
ECOLOGY & SUBSTRATE. Found in humid, partly exposed habitats on living
leaves of bamboo.
ADDITIONAL SPECIMENS EXAMINED: CHINA. GUANGDONG PROVINCE, Shixing
County, Chebaling national nature reserve, along the way to Xianrendong Village,
24°44’7”N 114°12’31”E, alt. 486 m, on living leaves, 15/V/2015, X.L. Wei & J.H. Wang
GD2015042-8 (HMAS-L 0137206). GUANGXI PROVINCE, Shangsi County, Shiwan
mountain forest park, along the Shitou River, 21°54’3”N 107°54’26’E, alt. 342 m, on
living leaves, 25/V/2015, X.L. Wei & J.H. Wang GX20150265 (HMAS-L 0137204;
GenBank KX216698), GX20150387 (HMAS-L 0137205).
REMARKS: Two other Strigula species with carbonized perithecia develop
similarly white-punctate thalli: S. lacericola PM. McCarthy, which can be
distinguished by its shallowly lobate thallus margins and very narrow (5-7
times longer than broad) ascospores that do not separate either within or
outside the asci (McCarthy 2009) and S. albomaculata Sérus., which has
longer asci (120-140 x 5-8 um) and larger ascospores (18-22 x 5-6 um) and
macroconidia (8-8.5 x 1.5-2 um) (Aptroot et al. 1997).
Anatomically, the new species is most closely related to S. concreta (Fée)
R. Sant. Both share the same perithecial anatomy and small, uniseriate
ascospores that fragment outside the asci, but they differ in thallus morphology
and ascus dimensions: S. concreta lacks white dots on the thallus and has
lobulate thallus margins and shorter asci (30-70 x 4-6 um; Santesson 1952).
Strigula sinoaustralis sp. nov. (China) ... 799
PLaTE 1. Strigula sinoaustralis. A. Thallus with perithecia (holotype, HMAS-L 0137203);
B. Macroconidia, with appendage at one or both ends (HMAS-L 0137204); C. Ascus, with eight
uniseriate ascospores (holotype, HMAS-L 0137203); D, E. Ascospores, with distinct constriction
at septum and breaking into parts outside the asci (holotype, HMAS-L 0137203). Scale bars:
A = 300 um; B-E = 10 um.
The new species also resembles S. nitidula Mont., which is distinguished by
a very thin (8-15 um) marginally effuse bright metallic green thallus usually
bordered by a narrow black line (Licking 2008).
Strigula microspora Licking can be separated from S. sinoaustralis by its
thallus with a white central part surrounded by crenulate or shortly lobulate
margins, ascospores that do not fragment outside the asci, and larger
macroconidia (8-10 x 2-2.5 um; Liicking 1991, 2008).
Strigula sinoaustralis cannot be confused with any species of the S. smaragdula
group, which is characterized by broader asci and larger biseriate ascospores
(Santesson 1952, Liicking 2008). Besides the morphological differences, the
new species is also supported by the phylogenetic analysis (see p. 797).
800 ... Jiang, Wei & Wei
Strigula antillarum (Fée) Miill. Arg., Bot. Jahrb. Syst. 6: 379 (1885). PL. 2A-E
THALLUS often medium green, 0.5-7.5 mm diam.
PERITHECIA exposed, immersed at the base, not sharply delimited from the
thallus, not easily found in the specimens bearing pycnidia. Asct 55-87.5 x
8-12 um. AscosporEs 8 per ascus, biseriate, fusiform, with acute ends, 17.5-25
x 4-7.5 um.
PycnipiA producing macroconidia aggregated. MAcroconrpi1A bacillar,
1-septate, 12.5-20 x 3-5 um.
CuHEMiIstTRY. No substances detected by TLC.
SPECIMENS EXAMINED: CHINA. GUANGXI PROVINCE, Nanning, Long’an County,
Longhu mountain natural reserve, 22°57’42”N 107°37’40’E, alt. 147 m, on living
leaves, 1/XII/2015, S.H. Jiang GX201511110 (HMAS-L 0137209; GenBank KX216696),
GX201511112 (HMAS-L 0137208; GenBank KX216697), GX201511114 (HMAS-L
0137207). HAINAN PROVINCE, Dongfang city, Nanlang village E’xian Ling, 19°00°18”N
109°04’09’E, alt. 160 m, on living leaves, 13/XII/2014, J.H. Wang & R.D. Liu HN2014376
(HMAS-L 0130571), HN2014354 (HMAS-L 0130622); 19°00’07”N 109°04’20’E, alt.
126 m, J.H. Wang & R.D. Liu HN2014393 (HMAS-L 0130573). YUNNAN PROVINCE,
Xishuangbanna, Mengla County, tropical botanical garden of Chinese Academy of
sciences, East area, 21°55’39”N 101°15’52”E, alt. 560 m, on living leaves, 18/X1/2015, X.L.
Wei & S.H. Jiang XTBG2015051 (HMAS-L 0137211; GenBank KX216702); Lvshilin,
21°54’35’N 101°16’52”E, alt. 626 m, 18/XI/2015, X.L. Wei & S.H. Jiang XTBG2015119
(HMAS-L 0137210).
REMARKS: Strigula antillarum is characterized by its aggregated and confluent
pycnidia in the center of the thallus. This species is anatomically similar to
S. smaragdula, which is distinguished by its thallus-covered perithecia and
dispersed pycnidia (Licking 2008).
Strigula laureriformis Aptroot & Licking, Biblioth. Lichenol. 97: 131 (2008).
PL. 2BG
THALLUS growing on bark, bright green to white green.
PyYCNIDIA immersed-erumpent, wart-shaped, covered by thallus, with
ostiole exposed outside. Conrp1A ellipsoid, 1-septate, hyaline, 7.5-10 x 2.5-4 um,
sometimes with appendage 15-25 um long.
PERITHECIA not seen.
CHEMISTRY. No substances detected by TLC.
SPECIMENS EXAMINED: CHINA. XIZANG PROVINCE, Motuo County, alt. 1000 m, on
living leaves, 1982, Y.G. Su 2532 (KUN 7537).
REMARKS: Strigula laureriformis (very typical of the genus; Aptroot et al. 2008)
does not produce perithecia and is easily recognized by its corticolous habit,
bright white green thallus, and simple 1-septate conidia.
Strigula sinoaustralis sp. nov. (China) ... 801
PLATE 2. Strigula antillarum. A. Thallus with pycnidia (HMAS-L 0137209); B. Ascospores,
fusiform, with acute ends, not breaking into parts outside the asci (HMAS-L 0137211); C, D. Asci,
with eight biseriate ascospores (HMAS-L 0137211); E. Macroconidia (HMAS-L 0137209). Strigula
laureriformis (KUN 7537). FE. Thallus with pycnidia; G. Macroconidia. Strigula prasina (HMAS-L
0137213). H. Hypophyllous thallus; I. Asci, with irregularly arranged ascospores; J. Ascospores,
fusiform-ellipsoid, 1-septate, with slight constriction at septum and not breaking into parts outside
the asci. Scale bars: A = 200 um; B-E = 10 um, F = 800 um, G = 20 um, H = 300 um, I, J = 10 um.
802 ... Jiang, Wei & Wei
Strigula prasina Miil. Arg., Flora 68: 343 (1885). PL. 2H-J
THALLUS hypophyllous, subcuticular, dispersed into patches, pale green.
PERITHECIA basally immersed, hemispherical, black. PARAPHysEs slightly
branched. Asci dense and compact, cylindrical, 52.5-70 x 7.5-10 um.
AscosporEs 8 per ascus, biseriate to irregularly arranged or occasionally
uniseriate, fusiform-ellipsoid, 1-septate, with slight constriction at septum,
12-17 x 4-5 um.
PYCNIDIA not seen.
CHEMISTRY. No substances detected by TLC.
SPECIMENS EXAMINED: CHINA. HAINAN PROVINCE, Ledong County, Jianfengling, on
living leaves, 2009, J.C. Wei 046F1 (HMAS-L 0137213; GenBank KX216700), 046F2
(HMAS-L 0137212; GenBank KX216701).
REMARKS: Strigula prasina is typically a hypophyllous species with a thallus
morphology rather similar to that of S. concreta. However, S. concreta is
typically epiphyllous and has distinctly smaller ascospores, often broken into
parts (Santesson 1952). The other hypophyllous species, S. janeirensis (Mull.
Arg.) Licking, mainly differs in its thinner thallus, larger perithecia, and much
larger ascospores that easily fragment within the asci (Roux & Sérusiaux 1995,
Liicking 2008).
Acknowledgements
This project was supported by Ministry of Science and Technology of China
(2013FY110400, 2014FY120100). Sincere thanks to Dr. Robert Liicking and Prof.
Emmanuél Sérusiaux for reviewing the manuscript and providing references during
our studies. The authors are indebted to Dr. Patrick McCarthy and Prof. L.S. Wang for
lending us specimens. We thank Ms. H. Deng for giving considerable assistance during
the studies in HMAS-L.
Literature cited
Aptroot A. 2003. Pyrenocarpous lichens and related non-lichenized ascomycetes from Taiwan.
Journal of the Hattori Botanical Laboratory 93: 155-173.
Aptroot A, Seaward MRD. 1999. Annotated checklist of Hong Kong lichens. Tropical Bryology
17: 57-101.
Aptroot A, Sipman HJM. 2001. New Hong Kong lichens, ascomycetes and lichenicolous fungi.
Journal of the Hattori Botanical Laboratory 91: 317-343.
Aptroot A, Diederich P, Sérusiaux E, Sipman HJM. 1997. New or interesting lichens and
lichenicolous fungi from Papua New Guinea. Bibliotheca Lichenologica 64: 186-188.
Aptroot A, Ferraro LI, Lai MJ, Sipman HJM, Sparrius LB. 2003. Foliicolous lichens and their
lichenicolous ascomycetes from Yunnan and Taiwan. Mycotaxon 88: 41-47.
Aptroot A, Licking R, Sipman HJM, Umania L, Chaves JL. 2008. Pyrenocarpous lichens with
bitunicate asci. Bibliotheca Lichenologica 97. 162 p.
Strigula sinoaustralis sp. nov. (China) ... 803
Culberson CE. 1972. Improved conditions and new data for the identification of lichen products
by a standardized thin-layer chromatographic method. Journal of Chromatography 72(1):
113-125. http://dx.doi.org/10.1016/0021-9673(72)80013-X
Culberson CF, Kristinsson H. 1970. A standardized method for the identification of lichen products.
Journal of Chromatography 46: 85-93. http://dx.doi.org/10.1016/S0021-9673(00)83967-9
Hyde KD, Jones EBG, Liu JK, Ariyawansa H, Boehm E, Boonmee §, et al. 2013. Families of
Dothideomycetes. Fungal Diversity 63: 1-313. http://dx.doi.org/10.1007/s13225-013-0263-4
Jayalal U, Oh SO, Liicking R, Joshi S, Kim JA, Park JS, Hur JS. 2013. Contributions to the foliicolous
lichens flora of South Korea. Mycobiology 41: 202-209.
http://dx.doi.org/10.5941/MYCO.2013.41.4.202
Katoh K, Misawa K, Kuma K, Miyata T. 2002. MAFFT: a novel method for rapid multiple
sequence alignment based on fast Fourier transform. Nucleic Acids Research 30: 3059-3066.
http://dx.doi.org/10.1093/nar/gkf436
Liicking R. 1991. Neue Arten foliikoler Flechten aus Costa Rica, Zentralamerika. Nova Hedwigia
52: 267-304.
Licking R. 2008. Foliicolous lichenized fungi. Flora Neotropica 103. 866 p.
McCarthy PM. 2009. Strigulaceae. Flora of Australia 57: 570-601.
Orange A, James PW, White FJ. 2001. Microchemical methods for the identification of lichens.
British Lichen Society, London.
Rogers SO, Bendich AJ. 1988. Extraction of DNA from plant tissues. 1-10, in: SB Gelvin & RA
Schilperoort (eds). Plant Molecular Biology Manual A6. Boston: Kluwer Academic Publishers.
Roux C, Sérusiaux E. 1995. Présence d’'appendices mucoides sur les ascospores de Raciborskiella
janeirensis (Mull. Arg.) R. Sant. Bulletin de la Société Linnéenne de Provence 46: 91-94.
Santesson R. 1952. Foliicolous lichens I. A revision of the taxonomy of the obligately foliicolous,
lichenized fungi. Symbolae Botanicae Upsalienses 12(1). 590 p.
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011. Mega5: molecular evolutionary
genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony
methods. Molecular Biology and Evolution 28: 2731-2739.
http://dx.doi.org/10.1093/molbev/msr121
Wei JC, Jiang YM. 1991. Some foliicolous lichens in Xishuangbanna, China. 201-216, in: D
Galloway (ed.). Systematics, Conservation and Ecology of Tropical Lichens, Systematics
Association Special Volume no. 42. Clarendon Press, Oxford.
White TJ, Bruns TD, Lee SB, Taylor JW. 1990. Amplification and direct sequencing of fungal
ribosomal RNA genes for phylogenetics. 315-322, in: MA Innis et al. (eds). PCR protocols: a
guide to methods and applications. Academic Press, New York.
http://dx.doi.org/10.1016/B978-0-12-372180-8.50042-1
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 © 2016. Mycotaxon, Ltd.
October-December 2016— Volume 131, pp. 805-809
http://dx.doi.org/10.5248/131.805
Thelenella haradae sp. nov.,
a saxicolous lichen from South Korea
JOSEF P. HALDA’ & JAE-SEOUN HuR”*
'Muzeum a galerie Orlickych hor, Jiraskova 2, 516 01 Rychnov nad KnéZnou, Czech Republic
*Korean Lichen Research Institute, Sunchon National University, Suncheon, 57922, Korea
“CORRESPONDENCE TO: [email protected]
ABSTRACT—A new species of saxicolous lichen is described, and named as Thelenella
haradae. It occurs on exposed granite rocks of Mt. Daebang, Gyeongnam Prov., southern
maritime Korea, and is similar to T. brasiliensis but differs in having wider ascospores
(25-30 x 13-17 um) and completely immersed ascomata.
Key worps—East Asia, lichenized ascomycetes, biogeography, taxonomy
Introduction
During examination of pyrenocarpus lichens deposited in KoLRI herbarium
(Sunchon Nationbal University), a new species of Thelenella from Korea was
discovered.
The genus Thelenella Nyl. (Thelenellaceae) consists of 35 corticolous,
foliicolous, muscicolous, or saxicolous taxa and is characterized by a crustose
thallus with a chlorococcoid photobiont and immersed ascomata usually
lacking an involucrellum (Mayrhofer 1987, Morse 2016). Most saxicolous
Thelenella species are limited to maritime or oceanic climates and non-
calcareous substrata (with one exception, T! calcicola C.A. Morse; Morse 2016).
Thelenella modesta (Nyl.) Nyl. has recently been reported from Korea (Aptroot
& Moon 2014). We now present a second record for the country, here described
as Thelenella haradae.
Materials & methods
The specimen was collected from southern part of Korea in 2011 and deposited
in the lichen herbarium of the Korean Lichen Research Institute, Suncheon, Korea
806 ... Halda & Hur
(KoLRI). The specimen was examined morphologically and sections were made by
razor blade under an Olympus SZX-7 stereomicroscope. The thin hand-cut sections of
thallus and ascomata were mounted in tap water and examined anatomically using an
Olympus BX50 compound microscope with DIC optics connected to a Canon 5D digital
camera. All measurements were made in water, but sections of ascomata or pycnidia
were mounted in 10% aqueous solution of KOH for observing asci and ascospores in
more detail. Ascospores were measured, and mean length and width values + standard
deviations and mean length/width ratio were calculated. The methodology for colour
spot reaction tests and thin layer chromatography (TLC) followed Orange et al. (2010).
Taxonomy
Thelenella haradae J. Halda, Xin Y. Wang, J.A. Ryu & Hur, sp. nov. PL.1
MycoBank MB819398
Differs from Thelenella brasieliensis by its completely immersed ascomata and wider
ascospores.
Type: South Korea, Gyeongnam Prov., Namhae County, Mt. Daebang, 34°51’00”N
127°59’26’E, alt. 87 m, on vertical face of an exposed granite rock, 29 April 2011,
X.Y. Wang & J.A. Ryu 110271 (Holotype, KoLRI 13485).
EryMoLocy: The new species is named in honor of the well-known Japanese
lichenologist Dr. H. Harada for his numerous contributions to our knowledge of
pyrenocarpous lichens in East Asia.
THALLUS lichenized, epilithic, 2-5 mm diam., 400-600 um thick, gray to gray-
green, smooth, + glossy, verrucose to subsquamulose, thick, with prominent
brown hypothallus. I-, KI-, composed mostly of oblong to spherical hyphae
(ca. 5-8 um diam.) and partly of linear hyphae (especially in the basal parts).
EPINECRAL LAYER well-developed, ca. 20 um thick, hyaline, composed
of horizontally flattened hyphal remnants. CorTICAL LAYER 60-80 um
thick, plectenchymatous, composed of hyphae 1.5-2 um diam., colourless.
PHOTOBIONT LAYER continuous, 40-60 um thick. MEDULLA often present,
white, 40-100 um high. PHoToBIonrT cells of trebouxioid green algae mostly
7-10 um diam., usually in vertically oriented clusters.
ASCOMATA perithecioid (pseudothecial), oval to pyriform, 350-400 um
tall, 300-350 um broad, without involucrellum, completely immersed in
thalline warts; the warts 0.5-1 mm across, usually with several perithecia,
dome-shaped to hemispherical, the same colour as surrounding thallus,
colourless to brown in upper parts around ostiola. OsTIoLuM not visible on
PLaTE 1 (right). Thelenella haradae (holotype, KoLRI 13485). A, thalline warts with ascomata;
B, subsquamulose thallus; C, cross section of thalline wart with ascoma; D, cross section of
thallus with upper epinecral layer, cortical layer, and medulla; E, cross section of ascoma showing
perithecial wall structure, hamathecium, asci with ascospores, and anastomosing paraphysoids
Thelenella haradae sp. nov. (Korea) ... 807
(mounted in water); F, cross section of ascoma with detail of ostiolum; G, H, young and mature
ascospores; I, apical part of non-amyloid ascus with a young ascospore. Scale bars: A = 1000 um;
B = 500 um; C, E, F = 100 um; D = 50 um; G-I = 10 um.
808 ... Halda & Hur
the thallus surface, pale brown in upper part. ExcipuLuM grayish to brownish
in the upper parts, hyaline below, 25-30 um thick in sides, 40-50 um at base;
subhymenium concave above, 20-30 um thick at base. HYMENIUM 300-320 um
high and 250-280 um wide. All hymenial elements I-, KI-. PERrpHyses absent,
PSEUDOPARAPHYSES septate, branched and anastomosing to form a network,
even in thickness (1 um). Ascr clavate, fissitunicate; endotunica universally
thick, lacking prominent ocular chamber, cylindrical, 8-spored, 80-100 x
12-15 um. Ascus apices thickened, non-amyloid, bilabiate (for terminology see
Eriksson 1981).
ASCOSPORES uniseriate, rarely biseriate in the ascus, (22—)25-30(-33) x
(10-)13-17(-17) um [means = 27.2 + 2.5 x 14.5 + 1.8 um (n = 56); 1/w ratio =
1.9], broadly ellipsoidal to oval, colourless at first, dark in maturity, muriform
(with 7 transverse and 2-3 longitudinal septa, 25-35 visible cells), lacking
perispore.
Pycnrp1A not seen in thalline warts and thallus sections.
ECOLOGY & DISTRIBUTION: Thelenella haradae is known only from the type
locality, Mt. Daebang, on an island off the southern coastline of the Korean
Peninsula, where it grows at low elevation on the vertical surface of exposed
rock (granite), together with Xanthoparmelia sp.
ComMENTSs— Thelenella luridella (Nyl.) H. Mayrhofer, known from Japan
(Harada 1999), differs from T: haradae by its colourless ascospores, its black
perithecial ostioles visible on thalline warts, the presence of pycnidia, and the
lack of a hypothallus. Thelenella melanospora Etayo & H. Mayrhofer, described
from Spain (Etayo & Mayrhofer 2003), differs by its smaller (18-22 x 9-12
um) ascospores, its paler coloured hypothallus, and its different substratum
(smooth bark of shrubs or small trees). Thelenella fernandeziana (Zahlbr.) H.
Mayrhofer, described from Juan Fernandez Islands (Mayrhofer 1987), differs by
its ascomata with dark pigmented ostiolum and its longer (30-45 x 15-22 um)
ascospores; and T. brasiliensis (Mull. Arg.) Vain., known from tropical South
and Central America, Africa, and China, differs by its narrower ascospores
(20-32 x 9-13um) and its emergent ascomata with a pale brown ostiolum
(Mayrhofer 1987).
Acknowledgments
This work was supported by Sunchon National University Research Fund in 2016.
Authors are grateful to Dr. Santosh Joshi (CSIR-National Botanical Research Institute,
India) and Prof. Pradeep K. Divakar (Universidad Complutense de Madrid, Spain) for
their valuable comments on the manuscript.
Thelenella haradae sp. nov. (Korea) ... 809
Literature cited
Aptroot A, Moon KH. 2014. 114 new reports of microlichens from Korea, including the description
of five new species, show that the microlichen flora is predominantly Eurasian. Herzogia 27:
347-365. http://dx.doi.org/10.13158/heia.27.2.2014.347
Eriksson O. 1981. The families of bitunicate ascomycetes. Opera Botanica 60: 1-209.
Etayo J, Mayrhofer H. 2003. Thelenella melanospora (Thelenellaceae, lichenized ascomycetes), a new
species from the Mediterranean region. Nova Hedwigia 77: 109-114.
http://dx.doi.org/10.1127/0029-5035/2003/0077-0109
Harada H. 1999. Thelenella luridella (lichenized Ascomycota, Thelenellaceae), newly found in Japan.
Journal of the Natural History Museum and Institute, Chiba 5(2): 91-95.
Mayrhofer H. 1987. Monographie der Flechtengattung Thelenella. Bibliotheca Lichenologica 26.
106 p.
Morse CA. 2016. Two new species of Thelenella and new reports from the Great Plains of central
North America, with a worldwide key to the genus. Opuscula Philolichenum 15: 22-36.
Orange A, James PW, White FJ. 2010. Microchemical methods for the identification of lichens. 2"¢
edition. British Lichen Society. 101 p.
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 © 2016. Mycotaxon, Ltd.
October-December 2016—Volume 131, pp. 811-820
http://dx.doi.org/10.5248/131.811
Notes on rust fungi in China 2.
Two species of Coleosporium on Compositae
JING-XIN Jr?, QI WANG 1, ZHUANG L1?, Yu L1* & MAKOTO KAKISHIMA *3"
' Engineering Research Center of Chinese Ministry of Education for Edible and Medicinal Fungi,
Jilin Agricultural University, Changchun, Jilin 130118 China
College of Plant Pathology, Shandong Agricultural University, Taian 271000 China
> University of Tsukuba, Tsukuba, Ibaraki 305-8572 Japan
* CORRESPONDENCE TO: [email protected]
AssTrRACT—During investigations of rust fungi in northeast China, specimens of
Coleosporium on various Compositae were collected. Based on comparative morphology and
molecular phylogenetic analysis specimens on Hieracium, Parasenecio, and Senecio were
identified as C. neocacaliae, and those on Ligularia, Saussurea, and Synurus as C. saussureae.
Hieracium umbellatum is a new host for C. neocacaliae, and Saussurea odontolepis and
S. pulchella are new hosts for C. saussureae. Coleosporium synuricola is treated as a synonym
of C. saussureae.
Key worps—Pucciniomycetes, rust flora, taxonomy, Uredinales
Introduction
The rust genus Coleosporium is characterized by 1-celled teliospores that
are produced in a 1-layered crust under host epidermal cells (Cummins &
Hiratsuka 2003). The teliospores germinate without dormancy and produce
4-celled internal basidia. About 240 species have been described (data from
MycoBank) and most of the species have a heteroecious life cycle producing
spermogonia and aecia on needles of pines and uredinia and telia on various
angiosperms (Kaneko 1981). In China about 45 species have been reported
(Miura 1928, Ito 1938, Tai 1979, Cao & Li 1999, You et al. 2010), but their
taxonomy and host plants are not well circumscribed and life cycles are still
not investigated.
During investigations of rust fungi in Jilin Province, northeast China, we
collected rust specimens on species of Compositae (Hieracium, Ligularia,
812 ... ji&al.
Parasenecio, Saussurea, Senecio, Synurus). These rust fungi have been referred
to the genus Coleosporium, but species identifications are sometimes confused
because of morphological similarities among species reported on these host
plants. After morphological examinations and phylogenetic analyses, specimens
on Hieracium, Parasenecio, and Senecio were identified as C. neocacaliae and
those on Ligularia, Synurus, and Saussurea were identified as C. saussureae.
Hieracium umbellatum L. was recorded as a new host plant for C. neocacaliae
and Saussurea odontolepis (Herder) Sch.-Bip. ex Herder and S. pulchella
(Fisch.) Fisch. were recorded as new hosts for C. saussureae. ‘The identity of
Coleosporium synuricola Y. Xue & L.P. Shao, described on Synurus deltoides
(Aiton) Nakai, was clarified, and it was shown to be identical to C. saussureae.
Materials & methods
Specimens
Specimens on Compositae were collected mostly in the vicinity of Changbai
Mountain, Jilin Province, China, from 2013 to 2015. Some specimens deposited
in the Herbarium of Mycology, Engineering Research Center of Chinese Ministry
of Education for Edible and Medicinal Fungi, Jilin Agricultural University, China
(HMJAU) were also examined. Their host plants were Hieracium umbellatum, Ligularia
fischeri (Ledeb.) Turcz., Parasenecio hastatus (L.) H. Koyama (= Cacalia hastata L.),
Saussurea odontolepis, S. pulchella, S. umbrosa Kom., Senecio nemorensis L., and Synurus
deltoides. The specimens used for morphological observations and molecular analysis
were deposited in HMJAU.
Morphological observations
Light microscopy (LM) was used to examine morphological characters including
the size and shape of sori and spores. Spores or thin-sections of sori from specimens
were mounted in a drop of lactophenol solution on glass slides for LM. Approximately
20 spores from each specimen were randomly chosen and the length, width, and wall
thickness of spores were measured using Leica LAS X software attached to a Leica
DM2000 microscope (Leica, Germany).
The surface features of spores were examined by scanning electron microscopy
(SEM). For SEM, samples obtained from dry specimens were attached to specimen
holders by double-sided adhesive tape and coated with platinum-palladium using a
Hitachi MC1000 Ion Sputter Coater and examined with a Hitachi SU8010 SEM operated
at 5-7 kV.
DNA extraction and sequencing
The total genomic DNA was extracted from about 200 spores obtained from a
single uredinium or telium. Spores were crushed between two sterilized glass slides
and suspended in 30 ul extraction buffer [10 mM Tris-HCl pH 8.3, 1.5 mM MgCl,
50 mM KCl, 0.01% sodium dodecyl sulfate (SDS), 0.01% Proteinase K], and the
suspensions were incubated at 37°C for 1 hour and 95°C for 10 min, followed by a
4°C soak (Suyama et al. 1996, Virtudazo et al. 2001). From the crude extract, 5-7 ul
Notes on Coleosporium neocacaliae & C. saussureae (China) ... 813
1,00/94 __ ©. S@ussureae [Soussurea odontolepis] HMJAUS8O9:
C. saussureae [Soussurea puichelia] HMJAU8161 | C. saussureae
0.99/68 C. synuri [Synurus deltoides} HMJAU8179
C. neacacatiae [Hieraciumum bellatum] HMJAU8237
1.0099) © neocacatiae [Hieraciumum betlatum] HMJAU8238 7
C. neocacaliae
C. neocacaliae [Senecio nemaresis] HMJAU80S8
0.92/90! ©. cacatiae [Syneilesis patmata] JF273972
C. plectranthi [Peritla frutescens] EFO95711
C. plumeriae [Plumeria sp.] KF879087
0.80/58 C. plumeriae [Pkimeria sp.] GU145555
Uredo sp. [Verbesina sp.] EU851161
C. asterum [TDB1465] AF522165
1.00/97 C. asterum [Solidago virgaurea) AB847107
C. solidaginis [Solidago sp.] DQ354559
C. asterum [Sofidage sp.] HQ317530
C. asterum [TOB1464] AF522164
0.97/61
0.98/71
C. elephantopi [Etephantopus mollis] EU851163
C. phellodendri (Phetlodendron amurense]KP017566
C, senecionis [Senecio sp.) KJ716348
C. phellodendri [Pheitodendron amurense]KP017566
C. senecionis (DB 1719] AY512840
C. campanutae [Campanula sp.] KP017565
C. tussilaginis [Senecio sp.] KT199395
0.98/60 | © tussilaginis [Tussitago farfara] AF426242
C, cacafiae [Adenostyles glabra] AF426243
C. evodiae [Tetradium glabrifotium] KP017567
C. zanthoxyli (Zanthoxylum sp.] KPO17568
C. phellodendri [Zanthoxylum ailanthoides] AB639023
Chrysomyxa arctostaphyli [Picea sp.] EF561640
FiGurE 1. Phylogenetic tree of Coleosporium. Bayesian 0.5 majority-rule consensus tree based on
the 28S RNA gene. Chrysomyxa arctostaphyli was used as outgroup. Values on the branches indicate
maximum likelihood bootstrap values / Bayesian posterior probabilities. Bootstrap values <75%
and Bayesian posterior probabilities <0.75 are not shown on the branches.
samples were used directly for each polymerase chain reaction (PCR). The rDNA-28S
region was amplified using primers NL1 (5’-GCATATCAATAAGCGGAGGAAAAG-3’) and
NL4 (5’-GGTCCGTGTTTCAAGACGG-3’) (O'Donnell 1993). The PCR amplifications were
performed in 50 ul of mixture containing 5 ul of template DNA, 200 un of each primer,
25 ul of Premix Taq™ (TaKaRa Taq™ Version 2.0 plus dye) (TaKaRa, Tokyo, Japan),
and 18 ul of ddH,O. Cycling conditions for amplification consisted of 94°C for 5 min,
followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s and
extension at 72°C for 1 min, and a final extension at 72°C for 10 min. PCR products
were separated on 1% agarose gels containing Nucleic Acid Stain (Beijing Dinggou
Changsheng Biotechnology Co. Ltd.) and purified using the TaKaRa MiniBEST Agarose
Gel DNA Exaction Kit Ver.4.0. Purified PCR products were cloned in pEASY -T1
Cloning Vector (Transgene Biotech, Beijing, China) and then transferred into Trans1-T1
phage, resistant chemically competent cell according to the manufacturer's instructions.
The positive clones were sequenced by Sangon Biotech Co., Shanghai, China. All data
sequenced in this experiment were deposited at GenBank (KX344988- 344993)
Phylogenetic analysis
The sequence data were manually aligned using BioEdit ver. 7.0.9 (Hall 1999).
To make molecular comparison, 23 sequences were retrieved from GenBank based on
host species and genus (FIG. 1). Multiple alignments were performed using MEGA6.
The final dataset contained sequences from 29 specimens with a length of 610 bp, which
included 120 parsimony-informative characters.
814 ... ji &al.
Phylogenetic trees were constructed with a sequence of Chrysomyxa arctostaphyli
Dietel as the outgroup. Topologies were constructed based on maximum likelihood
(ML) analyses using RaxmalGUI1.5b1. Bayesian Markov chain Monte Carlo (MCMC)
analyses were performed using MrBayes ver. 3.1.2 (Huelsenbeck & Ronquist 2001).
In ML and Bayesian analyses, the best-fit substitution models were estimated using
Modeltest ver. 3.7 (Posada & Crandall 1998), and K81uf+I+G was selected as the best
evolutionary model.
Results & discussion
Specimens on Hieracium, Parasenecio, and Senecio
Specimens on H. umbellatum, P. hastatus, and S. nemorensis were
morphologically similar and their uredinial and telial characteristics were
identical to the descriptions of C. neocacaliae (Kaneko 1981, Azbukina 2005).
Molecular phylogenetic analysis of the rDNA 28S regions based on ML and
Bayesian inference placed the specimens on H. umbellatum (HMJAU8237 and
HMJAU8238) and S. nemorensis (HMJAU8098) in the same lineage (Fic. 1).
GenBank data of a rust from Korea recorded as C. cacaliae (DC.) G.H. Otth on
Syneilesis palmata (Thunb.) Maxim. [= Cacalia thunbergii Nakai] (JF273971)
FiGurRE 2. Coleosporium neocacaliae on Hieracium umbellatum. A. Telia on lower leaf surface.
B. A vertical section of a telium. C. Vertical section of uredinium. D. Urediniospores. Scale bars:
A =1cm; B-D = 20 um.
Notes on Coleosporium neocacaliae & C. saussureae (China) ... 815
was also included in this lineage. However, this plant was reported as a host of
C. neocacaliae (Kaneko 1981) and it is phylogenetically distinct from C. cacaliae
from Europe (Fic. 1, AF426243). Based on these specimens a description of
C. neocacaliae is provided.
FiGurRE 3. Coleosporium neocacaliae. A. Urediniospore on Hieracium umbellatum. B. Uredinium
on H. umbellatum. C. Surface of urediniospore on H. umbellatum. D. Urediniospore on Senecio
nemorensis. Scale bars: A, D = 5 um; B = 50 um; C = 2 um.
Coleosporium neocacaliae Saho, Trans. Mycol. Soc. Japan 7: 59, 1966. Figs 2, 3
Uredinia hypophyllous, scattered, orange-yellow, pulverulent, globoid;
urediniospores ellipsoid, broad-ellipsoid, 16.0-34.5 x 13.0-21.5 um (av. 24.5
x 16.5 um), walls uniformly thick 0.3-1.5 um (av. 1.0 um), verrucose with a
smooth reticulum-like spot. Telia hypophyllous, scattered, rounded, orange-
red; one-celled teliospores cylindrical, clavate or oblong-ellipsoid, 44-82
x 16-27 um excluding gelatinous apical layer, four-celled internal basidia
60-107 x 21-34 um, longitudinally or obliquely septate, mature teliospores or
basidia arranged in a single layer, gelatinous apical layer 8-10 um thick, wall
thin, hyaline.
SPECIMENS EXAMINED — CHINA, JILIN PROVINCE:
on Hieracium umbellatum: Changbai Mt., stage II, 29 July 2015 (HMJAU8237; GenBank
KX344992); stage III, 23 September 2015 (HMJAU8238; GenBank KX344993);
816... Ji &al.
on Parasenecio hastatus: Lushuihe, Baishan, stage II, 21 July 2002 (HMJAU8077, 8078,
8079); Changbai Mt., 29 July 2015, (HMJAU8263);
on Senecio nemorensis: Changbai Mt., stage 11, 23 July 2002 (HMJAU8098; GenBank
KX344991).
Coleosporium neocacaliae has been reported only on species of Cacalia and
Senecio from the Russian Far East, China, Korea, and Japan (Tai 1979, Kaneko
1981, Hiratsuka et al. 1992, Azbukina 2005), which makes H. umbellatum a
new host plant for C. neocacaliae. This species differs in telial morphology from
C. cacaliae and C. parvisporum S. Kaneko reported on species of Cacalia and
Senecio (Kaneko 1981). The 4-celled basidia of C. parvisporum are smaller than
those of C. neocacaliae. The 4-celled basidia of C. cacaliae have sterile cells
at their base, but those of C. neocacaliae have no sterile cell. Our molecular
analysis also confirms a phylogenetic difference between C. neocacaliae and C.
cacaliae (Fic. 1).
Specimens on Ligularia, Saussurea, and Synurus
Specimens on Ligularia fischeri, Saussurea odontolepis, S. pulchella, S.
umbrosa, and Synurus deltoides were morphologically similar and uredinial
and/or telial characteristics were identical with the descriptions of C. saussureae
(Kaneko 1981, Azbukina 2005). Our DNA sequence analyses also supported
specimens on Saussurea pulchella (HMJAU8161), S. umbrosa (HMJAU8091)
and Synurus deltoides (HMJAU8179) in the same linage (Fic. 1). Therefore,
these specimens were identified as C. saussureae. Rust on Synurus deltoides
was reported as C. synuricola (Xue & Shao 1995, Azbukina 2005). However,
we observed no morphological difference between specimens on Ligularia
and Saussurea and so consider C. synuricola a synonym of C. saussureae.
This synonymy is also supported by our molecular analysis. Based on these
specimens a description is provided.
Coleosporium saussureae Thiim., Bull. Soc. Imp. Nat. Moscow 55: 212, 1880.
Fics 4, 5
= Coleosporium. synuricola Y. Xue & L.P. Shao, Acta Mycol. Sinica 14: 248, 1995.
Uredinia hypophyllous, scattered, rounded, pulverulent, orange-yellow;
urediniospores ellipsoid, oblong-ellipsoid or subglobose 21.5-32.5 x 13.0-
20.0 um (av. 26.0 x 16.0 um), verrucose, with a smooth reticulum-like spot,
walls uniformly 0.5-2.0 um (av. 1.0 um) thick. Telia hypophyllous, scattered,
rounded, orange-red; one-celled teliospores obovoid to cylindrical, 48.5-88.5 x
18.0-30.0 um (av. 68.5 x 23.5 um) excluding gelatinous apical layer, four-celled
internal basidia 73.5-96.0 x 18.0-27.0 um (av. 81.5 x 22.5 um), longitudinally
or obliquely septate, mature teliospores or basidia arranged in a single layer,
adhering among teliospores, gelatinous apical layer 9.5-32.5 um thick, wall
Notes on Coleosporium neocacaliae & C. saussureae (China) ... 817
Ficure 4. Coleosporium saussureae. A. Telia on lower leaf surface of Synurus deltoides. B. Telia on
lower leaf surface of Saussurea pulchella. C. Basidiospores with smooth surface on Synurus deltoides.
D. Urediniospores on Saussurea umbrosa. E. Teliospores on Saussurea pulchella. F. Teliospores on
Synurus deltoides. Scale bars: A, B = 1 cm; C-F = 20 um.
thin, hyaline; basidiospores ellipsoid, 23.0-29.5 x 15.0-18.5 um (av. 25.5 x 16.5
um), wall thin, hyaline.
SPECIMENS EXAMINED — CHINA, JILIN PROVINCE:
on Ligularia fischeri: Yanbian, stages IJ, II, July 2015 (HMJAU8186);
on Saussurea odontolepis: Changbai Mt., stages II, IIH, 26 August 2014 (HMJAU8088);
27 August 2014 (HMJAU8089);
on S. pulchella: Changbai Mt., stage I], 29 July 2015 (HMJAU8161: GenBank
KX344988); stages II, III, 15 September 2013 (HMJAU8143); stage II, III, 16 September
2013 (HMJAU8163); stage II, III, 24 August 2014 (HMJAU8086); stage II, 24 August
2014 (HMJAU8087, 8090); stage II, 23 September 2015 (HMJAU8266, 8267); Yanbian,
818 ... Ji & al.
FicureE 5. Coleosporium saussureae. A. Urediniospore on Saussurea umbrosa. B. Urediniospore
on S. odontolepis. C. Urediniospore on S. pulchella. D. Uredinium on S. pulchella. Scale bars:
A-C =5 um; D=50 um.
stage II, IH, 30 July 2015 (HMJAU8165); stage I, III, 24 September 2015 (HMJAU8265);
Yanji, stage HI, 15 September 2013 (HMJAU8162, 8163, 8264); stage II, 17 September
2013 (HMJAU8 146);
on S. umbrosa: Changchun, stage II, III, 11 September 2014 (HMJAU8091; GenBank
KX344991);
on Synurus deltoides: Changbai Mt., stage II, 23 September 2015 (HMJAU8179;
GenBank KX344989).
Coleosporium saussureae has been reported on Ligularia and Saussurea
species and is known from the Russian Far East, China, Korea, Taiwan, and
Japan (Kaneko 1981, Hiratsuka et al. 1992, Azbukina 2005). Coleosporium
pedunculatum S. Kaneko was also described on species of Saussurea, but its
teliospores have long sterile cells at their base, whereas C. saussureae has no
sterile cell (Kaneko 1981). No sterile cells were observed in specimens on
Ligularia, Saussurea, and Synurus. Therefore, we identified them as C. saussureae.
Notes on Coleosporium neocacaliae & C. saussureae (China) ... 819
Ito (1938) and Tai (1979) listed Saussurea odontolepis and S. pulchella as host
plants of C. saussureae. Later, Kaneko (1981) segregated C. pedunculatum
from C. saussureae and treated them as host plants of C. pedunculatum, but
specimens on these plants had no sterile cells on the teliospore bases and so
were identified as C. saussureae. Therefore, these two plant species are new
hosts for C. saussureae as revised by Kaneko (1981).
Geographical distribution of C. saussureae differs from that of C. pedunculatum
due to the distributional differences of their aecial host species of Pinus (Kaneko
1981). Coleosporium pedunculatum is found mainly in warm regions, whereas
C. saussureae occurs in alpine and mountainous regions, reflecting distribution
of the aecial hosts. We collected specimens from Changbai Mt., an alpine (cold)
region in China. Therefore, this identification of specimens is also supported
by their distribution.
Coleosporium ligulariae Thiim. and C. zhuangii C.M. Tian & C.J You have
been recorded on species of Ligularia from China (You et al. 2010). These species
were reported to differ slightly in size and urediniospore surface structure from
C. saussureae, but they are morphologically similar to each other. Comparative
morphological studies of these species are needed to clarify their relationships.
Coleosporium synuricola [= Uredo synuri Azbukina] was described based
on a specimen collected on Synurus deltoides in Heilongjiang Province, China,
which is geographically close to Jilin Province (Kaneko 1981, Xue & Shao
1995, Azbukina 2005). This species is morphologically similar to C. saussureae
as reported by Kaneko (1981) and Xue & Shao (1995). We confirmed
morphological and phylogenetic identity between them based on the specimen
on S. deltoides. Therefore, we treat C. synuricola as a synonym of C. saussureae.
Acknowledgments
This work was financed by the National Natural Science Foundation of China
(No. 31470646). We wish to thank Dr. E.H.C. McKenzie (Landcare Research, Auckland,
New Zealand) and Dr. L.N. Vasilyeva (Institute of Biology and Soil Science, Far East
Branch of the Russian Academy of Sciences, Vladivostok, Russia) for critical reading
of the manuscript and suggestions. We express our thanks to Dr. B. Qu, Shenyang
Agricultural University for identification of plant specimens.
Literature cited
Azbukina ZM. 2005. Rust fungi. Cryptogamic plants, fungi and mosses of the Russian Far East:
Fungi, vol. 5. Dal’nauka, Vladivostok. 616 p. (In Russian)
Cao Z, Li Z. 1999. Rust fungi of Qinling Mountains. China Forestry Publishing House, Beijing.
Cummins GB, Hiratsuka Y. 2003. Illustrated genera of rust fungi, 3rd ed. American Phytopathological
Society, St. Paul, Minnesota.
Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program
for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95-98.
820 ... Ji & al.
Hiratsuka N, Sato S, Katsuya K, Kakishima M, Hiratsuka Y, Kaneko S, Ono Y, Sato T, Harada Y,
Hiratsuka T, Nakayama K. 1992. The rust flora of Japan. Tsukuba-shuppankai, Tsukuba.
Huelsenbeck JP, Ronquist F. 2001. MRBAYES: Bayesian inference of phylogenetic trees.
Bioinformatics 17: 754-755. http://dx.doi.org/10.1093/bioinformatics/17.8.754
Ito S. 1938. Mycological flora of Japan, vol. 2, no 2. Yokendo, Tokyo.
Kaneko S. 1981. The species of Coleosporium, the causes of pine needle rusts, in the Japanese
Archipelago. Report of Tottori Mycological Institute 19. 159 p.
Miura M. 1928. Flora of Manchuria and east Mongolia II. Cryptogams, Fungi.
Minamimanshutetsudo, Dalian.
O'Donnell K. 1993. Fusarium and its near relatives. 225-233, in: DR Reynolds, JW Taylor (eds).
The fungal holomorph: mitotic, meiotic and pleomorphic speciation in fungal systematics.
CABI, Wallingford.
Posada D, Crandall KA. 1998. MODELTEST: testing the model of DNA substitution. Bioinformatics
14: 817-818. http://dx.doi.org/10.1093/bioinformatics/14.9.817
Suyama Y, Kawamuro K, Kinoshita I, Yoshimura K, Tsumura Y, Takahara H. 1996. DNA sequence
from a fossil pollen of Abies spp. from Pleistocene peat. Genes & Genetic Systems 71: 145-149.
http://dx.doi.org/10.1266/ggs.71.145
Tai FL. 1979. Sylloge Fungorum Sinicorum. Science Press, Peking.
Virtudazo EV, Nakamura H, Kakishima M. 2001. Phylogenetic analysis of sugarcane rusts based
on sequences of ITS, 5.8 S rDNA and D1/D2 regions of LSU rDNA. Journal of General Plant
Pathology 67: 28-36. http://dx.doi.org/10.1007/PL00012983
Xue Y, Shao L. 1995. A new species of Coleosporium. Acta Mycologica Sinica 14: 248-249.
You CJ, Liang YM, Li J, Tian CM. 2010. A new rust species of Coleosporium on Ligularia fischeri
from China. Mycotaxon 111: 233-239. http://dx.doi.org/10.5248/111.233
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 © 2016. Mycotaxon, Ltd.
October-December 2016— Volume 131, pp. 821-826
http://dx.doi.org/10.5248/131.821
Arthromoniliphora araucariae gen. & sp. nov.
from Brazilian pine
SILVANA SANTOS DA SILVA’, LUIS FERNANDO PASCHOLATI GUSMAO'*
& RAFAEL F. CASTANEDA-RUIZ?
‘Departamento de Ciéncias Biologicas, Universidade Estadual de Feira de Santana,
44031-460, Feira de Santana, BA, Brazil
?Instituto de Investigaciones Fundamentales en Agricultura Tropical ‘Alejandro de Humboldt’
(INIFAT), Académico Titular de la Academia de Ciencias de Cuba,
Calle 1 Esq. 2, Santiago de Las Vegas, C. Habana, Cuba, C.P. 17200
*CORRESPONDENCE TO: [email protected]
ABSTRACT—A new genus and species, Arthromoniliphora araucariae, is described and
illustrated. This fungus is distinguished by differentiated hyaline conidiophores that are
branched above the globose base and robustly cylindrical below, moniliform and subulate
toward the apex. The conidia are thallic-arthric, cylindrical, bacilliform to cuneate, and
hyaline and occur in unbranched chains formed by disarticulation of the moniliform,
subulate conidiophore branches.
Key worps—Araucaria angustifolia, asexual fungi, conidial fungi, taxonomy
Introduction
During a survey of hyphomycetes associated with plant litter in Floresta
Nacional de Sao Francisco de Paula, Rio Grande do Sul State, Brazil, an
interesting fungus was collected. This fungus shows remarkable differences
from all previously described genera (Seifert et al. 2011) and is therefore
described as a new genus and species.
Material & methods
Samples of litter of Araucaria angustifolia (Brazilian pine; Parana pine) were placed
in paper bags. In the laboratory the samples were placed in Petri dish moist chambers
and stored in a 170 L polystyrene box with 200 mL sterile water plus 2 mL glycerol
at 25°C for 30 days (Castafeda-Ruiz 2005). Mounts were prepared in PVL (polyvinyl
822 ... Silva, Gusmao & Castafieda-Ruiz
alcohol, lactic acid, and phenol). Measurements were made at a magnification of x1000.
Micrographs were obtained with an Olympus BX51 microscope equipped with bright
field and Nomarski interference optics. The type specimen is deposited in the Herbarium
of Universidade Estadual de Feira de Santana, Bahia, Brazil (HUEFS).
Taxonomy
Arthromoniliphora S.S. Silva, Gusmao & R.F. Castafieda, gen. nov.
MycoBAank MB 813427
Differs from Arthrographis and Geotrichum by its moniliform, closely fasciculate
conidiophores and its conidia with a highly variable number of septa.
TYPE SPECIES: Arthromoniliphora araucariae S.S. Silva et al.
EryMoLoecy: Greek Arthro-, meaning jointed (referring to thallic disarticulation) +
-monili- Latin, meaning cylindrical but contracted at regular intervals + -phora referring
to the conidiophores.
Conidial fungi. CoLoNres on the natural substratum effuse, white.
CONIDIOPHORES differentiated, single, densely fasciculate, branched,
moniliform, septate, hyaline. CONIDIOGENOUS HYPHAE moniliform, subulate,
holothallic, discrete, determinate. CONIDIAL SECESSION schizolytic. CONIDIA
thallic-arthric, in unbranched chains, unpigmented, unicellular or multiseptate,
cylindrical, doliiform or cuneate, forming by disarticulation of the terminal
moniliform conidiogenous conidiophore branches.
Arthromoniliphora araucariae S.S. Silva, Gusmao & R.F. Castafieda, sp. nov.
MycoBank MB 813428 FIGS 1-3
Differs from all Arthrographis and Geotrichum spp. by its densely fasciculate
conidiophores that are moniliform and cylindrical below and subulate above, and its
cylindrical, unicellular to multiseptate conidia.
Type: Brazil, Rio Grande do Sul State, Sao Francisco de Paula, Floresta Nacional de
Sao Francisco de Paula, 29°25’S 50°23’W, alt. 838 m, on decaying twig of Araucaria
angustifolia (Bertol.) Kuntze (Araucariaceae), 10.1II 2015, S.S. Silva (Holotype: HUEFS
216008).
EryMo_oey: Latin araucariae, meaning growth on an Araucaria species.
CoLonliEs on the natural substratum effuse, hairy, white. Mycelium superficial
and immersed. Hyphae septate, branched, smooth, hyaline, 3-5 um diam,
sometimes forming a rudimentary globulose stroma. CONIDIOPHORES
distinct, single, erect, compact fasciculate, branched just at one level near the
base, moniliform, subulate toward apex of each branch, hyaline, multiseptate,
60-250 x 5-6 um. CONIDIOGENOUS BRANCHES moniliform, subulate,
holothallic, multiseptate, hyaline, discrete, determinate, 38-100 x 2.5-4 um.
CONIDIAL SECESSION schizolytic. Conrp1a thallic-arthric, in unbranched
chains, hyaline, 0-36-septate, cylindrical, doliiform or cuneate, truncate at
Arthromoniliphora araucariae gen. & sp. nov. (Brazil) ... 823
Fic. 1. Arthromoniliphora araucariae (ex holotype, HUEFS 216008). A, B. Conidiophores,
coniiogenous branches, and conidia. C. Rudimentary stroma and basal part of conidiophores.
the ends, sometimes truncate at the base and obtuse at the apex, 3.5-92 x
2.5-4 um forming by disarticulation of the terminal, subuliform, moniliform
conidiogenous branches of the conidiophores
824 ... Silva, Gusmao & Castafieda-Ruiz
10 pom
-
/
rT
-
7
-
-
.
r
7
:
a
ee
an
rrrrrr?yYYT”TvTTSet
1
Fic. 2. Arthromoniliphora araucariae (ex holotype, HUEFS 216008).
Conidial chains and conidia.
CoMMENTS— The genera Arthrographis G. Cochet ex Sigler & J.W. Carmich., Geomyces
Traaen, and Geotrichum Link superficially resemble Arthromoniliphora in their
hyaline thallic-arthric conidia produced by disarticulation of fertile hyphae.
In Arthrographis, however, conidiophores are multi-branched, producing
Arthromoniliphora araucariae gen. & sp. nov. (Brazil) ... 825
Fic. 3. Arthromoniliphora araucariae (ex holotype, HUEFS 216008).
A. Conidiophores, conidiogenous branches, and conidia. B. Conidia.
826 ... Silva, Gusmao & Castafieda-Ruiz
conidia that are globose, cylindrical, Y-shaped or irregular (usually discoid),
rounded or subtruncate at the ends after disarticulation (Sigler & Carmichael
1976, Giraldo et al 2014). Geomyces has branched hyaline conidiophores,
but the conidia have separating cells and the conidial secession is rhexolytic.
Geotrichum is characterized by undifferentiated conidiophores, and after
disarticulation of the fertile hyphae the conidia are unicellular, cylindrical,
Y-shaped to irregular, sometimes forming chains, or slimy or yeast-like (Cole &
Kendrick 1969, Sigler & Carmichael 1976, Hoog et al. 2011, Seifert et al. 2011).
Thedgonia B. Sutton (Sutton, 1973) is somewhat similar to Arthromoniliphora,
but its conidiogenous cells were described as polyblastic and sympodial and
its conidia as blastocatenate, cylindrical, and 0-3-septate by Sutton (1973),
while Seifert et al. (2011) described the conidial ontogeny as thallic-arthric.
The Thedgonia conidiophores are branched and cylindrical but not moniliform
and subulate as in Arthromoniliphora
Acknowledgments
The authors express their sincere gratitude to Dr. De-Wei Li and Prof Xiu-Guo
Zhang for their critical review of the manuscript. The authors thank the National
Council for Scientific and Technological Development (CNPq) (Proc. 142014/2011-7)
and “Programa de Pesquisa em Biodiversidade do Semiarido (PPBio Semiarido -CNPq/
MCTI) for supporting this study. RFCR is grateful to Cuban Ministry of Agriculture
and ‘Programa de Salud Animal y Vegetal’ project P131LH003033 Cuban for facilities.
We acknowledge the assistance provided by Dr. P.M. Kirk and Drs. V. Robert and
G. Stegehuis through the Index Fungorum and MycoBank websites. Dr. Lorelei Norvell’s
editorial and Dr. Shaun Pennycook’s nomenclatural reviews are greatly appreciated.
Literature cited
Castafieda Ruiz RF. 2005. Metodologia en el estudio de los hongos anamorfos. 182-183 in:
Anais do V Congresso Latino Americano de Micologia. Brasilia.
Cole GT, Kendrick WB. 1969. Conidium ontogeny in hyphomycetes. The arthrospores of
Oidiodendron and Geotrichum, and the endoarthospores of Sporendonema. Canadian Journal
of Botany 47: 1773-1780. https://doi.org/10.1139/b69-255
Giraldo A, Gené J, Sutton DA, Madrid H, Cano J, Crous PW, Guarro J, .2014. Phylogenetic
circumscription of Arthrographis (Eremomycetaceae, Dothideomycetes) Persoonia 32: 102-114.
https://doi.org/10.3767/003158514X680207
Hoog GS de, Guarro J, Gené J, Figueras MJ.2011. Atlas of clinical fungi, electronic version 3.1. CBS-
KNAW Fungal Biodiversity Centre, Utrecht, Netherlands
Seifert K, Morgan-Jones G, Gams W, Kendrick B. 2011. The genera of hyphomycetes. CBS
Biodiversity Series 9. 997 p.
Sigler L, Carmichael JW. 1976. Taxonomy of Malbranchea and some other hyphomycetes with
arthroconidia. Mycotaxon 4: 349-388.
Sutton BC. 1973. Some hyphomycetes with holoblastic sympodial conidiogenous cells. Transactions
of the British Mycological Society 61: 417-429.
https://doi.org/10.1016/S0007-1536(73)80112-3
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 © 2016. Mycotaxon, Ltd.
October-December 2016— Volume 131, pp. 827-839
http://dx.doi.org/10.5248/131.827
Morphological and phylogenetic clarification of
Peziza arvernensis, P. pseudovesiculosa,
P. pseudosylvestris, and P. domiciliana
ANGELA LANTIERI? , GIANFRANCO MEDARDI? & PABLO ALVARADO?
'Via Novaluce 38, I-95030 Tremestieri Etneo (Catania), Italy
°Via Giuseppe Mazzini 21, I-25086 Rezzato (Brescia), Italy
4ALVALAB, La Rochela 47, 39012 Santander, Spain
* CORRESPONDENCE TO: [email protected]
ABSTRACT—The concepts of the morphologically similar species Peziza arvernensis,
P. pseudovesiculosa, P. pseudosylvestris, and P. domiciliana are revisited in light of new
morphological and molecular data from freshly collected and herbarium specimens.
Phylogenetic inference based on ITS nrDNA sequences suggests that P arvernensis,
P. pseudovesiculosa, and P. pseudosylvestris are monophyletic and that P. domiciliana represents
an independent taxon.
Key worps—Pezizales, taxonomy
Introduction
The distinction between Peziza arvernensis (subject of previous
phylogenetic studies by Norman & Egger 1999 and Hansen et al. 2001, 2002),
P. pseudovesiculosa |= Aleuria amplissima Boud.], P. pseudosylvestris |= Galactinia
pseudosylvestris], and P. domiciliana is controversial because macro- and
microscopic morphological characters seem insufficient to unambiguously
define these taxa. Moreover, despite our several requests for samples of
P. pseudovesiculosa and P. pseudosylvestris to institutional and private herbaria,
we were able to obtain and examine only a few collections under these names.
Furthermore, P pseudovesiculosa and P. pseudosylvestris are inadequately
described (Gamundi 1975; Donadini 1977, 1978, 1979; Gamundi & Giaiotti
1998; Baiano et al. 2000; Moyne 2008). The two species seem to differ from
828 ... Lantieri, Medardi & Alvarado
P. arvernensis primarily in the thickness of the layers of the excipulum, while
all other characters overlap among the three species. Some authors (Hohmeyer
1986, Baiano et al. 2000) considered them to represent separate species, based
on the thickness of the excipulum layers and a few other macroscopical and
ecological features. The abundant observations reported by Donadini (1977,
1978, 1979, 1981) do not contribute significantly to a better delimitation of
these taxa, because the characters he used are not decisive.
In the present work, we obtained new morphological and molecular data to
clarify the phylogenetic position of these taxa, including: (1) Boudier’s original
material of Aleuria amplissima (PC 0084256, PC 0084257, PC 0084258),
analyzed also by Donadini (1977) when he proposed the replacement name
P pseudovesiculosa; (2) original specimens described as Galactinia
pseudosylvestris by Gamundi (1975); and (3) modern Italian specimens
representing P. domiciliana Cooke.
Materials & methods
Material studied
The study was carried out on both fresh and dried samples (including holotypes)
from the following herbaria—AMB, HMA, K, PC, MCVE, SIENA, TAAM, UPS—as
well as from several private collections. The thirteen herbarium specimens selected for
DNA extraction are listed in TABLE 1.
TABLE 1. Newly sequenced specimens of Aleuria, Galactinia, and Peziza used in
phylogenetic analysis
SPECIES COUNTRY COLLECTOR & HERBARIUM NO. ITS SEQUENCE
A. amplissima France E. Boudier PC 0084257 KC832902
France E. Boudier PC 0084258 KC832903
G. pseudosylvestris Argentina —_‘- I. Gamundi (UPS) F-570657 KC832900
Chile I. Gamundi (UPS) F-570665 KC832899
P. arvernensis Belgium herb. D. Tanchaud DT 26051301 KP125489
Italy herb. F. Padovan FP 84 KC832897
Italy herb. A. Lantieri AL 0406055; K(M) 134792 KC832896
P. domiciliana Italy herb. G. Medardi AL 11030266; MCVE 16472 KC832906
Italy herb. G. Medardi GM 27058844 KC832907
Italy herb. F. Padovan FP 2014 KC832904
P. pseudovesiculosa Italy herb. G. Medardi GM 16100447 KC832901
Italy herb. G. Medardi GM 22099945 KC832898
Italy herb. G. Medardi GM 28100346 KC832905
Clarification of four Peziza species ... 829
SPECIMENS EXAMINED:
Peziza arvernensis: BELGIUM: VALLONIA, Foret de Soignes Brabant Wallon, on the
ground in a deciduous wood, 26.05.2013, leg. & det. D. Tanchaud (DT 26051301;
GenBank KP125489). DENMARK: ZEALAND, Stenholdtsvang, Grib Skov, on sandy
soil, 14.08.1965, leg. P.M. Petersen, det. H. Dissing (TAAM 187941). ENGLAND:
HEREFORDSHIRE, Ross-on-Wye, on sandy soil, 19.06.1977, leg. & det. W.D. Graddon
(K(M) 42798); SuRREY, Sheepleas, West Horsley, on the ground in a deciduous wood
with Fagus, 12.10.1981 (K(M) 50729); West Sussex, Madehurst, on the ground under
deciduous trees, 2.07.1978, leg. D.A. Reid (K(M) 50718). ESTONIA: Tartu Co.,
along the road to Tallinn, on the ground in Fagus litter, 13.05.2007, leg. L. Tedersoo,
det. K. Hansen (TAAM 192338). ITALY: ABRUZZO, Prato di Camposecco, near woody
residue, 10.10.1984 (HMA 3754); Teramo, Intermesoli, Fonte Novello, Pietracamela, on
the ground in a Fagus wood, 20.06.2004 (HMA 6216); BAsILIcaTA, Potenza, Picerno,
Monti li Foi, on the ground in a Fagus wood near fallen wood, 24.10.1998, leg. & det.
G. Medardi (MCVE 14131); CaLasrtia, Reggio Calabria, Molochio, on the ground in
a mixed deciduous wood (mostly Fagus), 11.11.1988, leg. & det. F Padovan (FP 159);
Gambarie, near woody residue in a Fagus wood, 18.10.2003, leg. & det. G. Medardi
(MCVE 16614); near woody residue in a Fagus wood, 6.06.2010, leg. & det. B. Recchia
(BR 7386); CAMPANIA, Salerno, Camalonga, 11.06.2008, leg. G. Ruocco, det. L. Pecoraro
& P. Leonardi (SIENA 6546); EM1L1A-ROMAGNA, Reggio Emilia, Bergogno, Casina, on
the ground in a Fagus wood, 28.04.1991, leg. & det. G. Simonini (MCVE 7282); Lazio,
Terni, Trevi del Lazio, 20.07.1986 (HMA 4128); Roma, Cervara di Roma, 30.07.1986
(HMA 4127, as Peziza repanda); PIEMONTE, Vercelli, Alagna Valsesia, near woody
residue in a mixed deciduous wood, 25.08.1995, leg. & det. P.G. Jamoni (PGJ 931, as
Peziza pseudosylvestris); StcILy, Catania, Maletto, Parco dell’Etna, near woody residue
in a Fagus wood, 2.05.2004, leg. & det. A. Lantieri (AL); Messina, Cesard, Parco dei
Nebrodi, on the ground in a mixed deciduous wood, 4.06.2005, leg. & det. A. Lantieri
(K(M) 134792, AL 0406055; GenBank KC832896); TRENTINO-ALTO ADIGE, Belluno,
Monte Palmina, Canale d’Agordo, on the ground, 24.08.1996, leg. & det. E. Bizio
(MCVE 10690); Tuscany, Pisa, Calambrone, on sandy soil near Cistus, Juniperus and
Ammophila in marine environment, 26.04.1996, leg. & det. G. Medardi (MCVE 11261);
VENETO, Belluno, Campon, Bosco del Cansiglio, on the ground near Fagus, 25.07.1988,
leg. & det. F Padovan (FP 84; GenBank KC832897); Padola, on the ground, 21.08.2012,
leg. & det. A. Testoni (GM 21081216); Tambre, Pian Osteria, Loc. Canaie, under
deciduous, 7.07.2001, leg. G. Robich, det. E. Campo (MCVE 15980); Vicenza, Recoaro,
Malga Chempele, under deciduous, 5.06.2004, leg. & det. G. Medardi (MCVE 16797).
SCOTLAND: HIGHLAND, Inner Hebrides, Isle of Skye, Armadale Castle, on sandy soil,
24.05.1982, leg. & det. R.W.G. Dennis (K(M) 50726); on sandy soil, 27.09.1983, leg. &
det. R.W.G. Dennis (K(M) 50731); on sandy soil, 15.05.1984, leg. & det. R.W.G. Dennis
(K(M) 50730); PERTH AND Kinross, Birks of Aberfeldy, under deciduous, 2.08.2010,
leg. J. & D. Bailey, det. B.M. Spooner (K(M) 166578). SWEDEN: NARKE, Lanna, on the
ground, 12.07.1981, leg. & det. L. Sodeberg (UPS F-640159).
Peziza domiciliana: ITALY: ABRUZzzoO, Aquila, Chiarino, near woody residue of Fagus,
24.05.2000 (HMA 12); Provvidenza, 2.10.2000 (HMA 519); CALABRIA, Reggio Calabria,
Gambarie, near woody residue of Fagus, 7.11.1988, leg. & det. A. Para (AMB 000236,
as Peziza micropus); on the ground under Fagus, 9.12.2000, leg. & det. G. Medardi
(MCVE 15807); LomBarRpIA, Brescia, Ceto, on sandy soil under mixed deciduous
trees, 27.05.1988, leg. & det. G. Medardi (GM 27058844; GenBank KC832907);
VENETO, Belluno, near woody residue of Fagus, 15.04.1993, leg. & det. EF Padovan (FP
2014; GenBank KC832904), Padova, Monselice, on the ground under deciduous trees,
830 ... Lantieri, Medardi & Alvarado
5.03.1997, leg. & det. G. Medardi (MCVE 12412); SiciLy, Siracusa, R.N.O. Vendicari,
on sandy soil in a mixed wood, 11.03.2002, leg. & det. G. Medardi (MCVE 16472, AL
11030266; GenBank KC832906).
Peziza pseudovesiculosa: ITALY: EMILIA-ROMAGNA, Reggio Emilia, Marola, on
the ground under Fagus, 23.05.1997, leg. G. Baiano, det. D. Garofoli (MCVE 12816);
LOMBARDIA, Brescia, Manerba del Garda, 22.09.1999, leg. & det. G. Medardi (GM
22099945; GenBank KC832898); Calvagese, on the ground under Castanea, 4.11.2000,
leg. & det. G. Medardi (MCVE 15497); on the ground in a mixed deciduous wood
(mostly Carpinus and Alnus), also near burnt residue, 28.10.2003, leg. & det. G. Medardi
(GM 28100346; GenBank KC832905); Puegnago del Garda, under mixed deciduous
trees,16.10.2004, leg. & det. G. Medardi (GM 16100447; GenBank KC832901);
PIEMONTE, Alessandria, Vignole Borbera, fraz. Variano Superiore, under deciduous
trees, 22.04.2009, leg. & det. M. Carbone (MCVE 24022); Tuscany, Siena, Riserva di
Cornocchia, 26.05.2010, leg. H. Danielli, L. Pecoraro & E. Salerni, det. L. Pecoraro & E.
Salerni (SIENA 6547); VENETO, Belluno, Falcade, Caviola, near Fagus, 15.08.1984, leg.
& det. E. Bizio (EB 15088407).
Aleuria amplissima: FRANCE: Parts, fle-de-France, Val d’Oise, Bois de Beauchamp et
Forét P’'Isle-Adam, on sandy soil in the forest, s.d., leg. & det. E. Boudier (PC 0084256,
holotype); on sandy soil in the forest, 04.1889, leg. & det. E. Boudier (PC 0084258;
GenBank KC832903); on sandy soil in the forest, 04.1902, leg. & det. E. Boudier (PC
0084257; GenBank KC832902).
Galactinia pseudosylvestris: ARGENTINA: TIERRA DEL FuEGO, Ushuaia, on the
ground in a deforested area, 21.01.1940, leg. & det. I. Gamundi (UPS F-570656
[containing 6 collections]; UPS F-570657 [containing 4 collections]; GenBank
KC832900). CHILE: TIERRA DEL FUEGO, Magallanes y Antarctica Chilena, Rio Rubens,
on the ground in a Nothofagus pumilio forest, 11.01.1941, leg. & det. I. Gamundi (UPS
F-570666 [containing 10 collections]); Canal Whiteside, Puerto Yartou, on the ground
in a Nothofagus pumilio forest, 12.02.1941, leg. & det. I. Gamundi (UPS F-570665
[containing 4 collections]; GenBank KC832899).
Morphological studies
Measurements and descriptions of microscopic characters were made using material
mounted in water, rehydrated when necessary with 5% KOH. Melzer’s reagent and
Cotton blue in lactic acid were also used. An Optika BK 1301 microscope with 40x or
100x (immersion oil) objectives was used to study and photograph the morphological
features. Spore dimensions were calculated by measuring 50 mature spores.
DNA isolation, PCR, and sequencing techniques
Total DNA was extracted from dried specimens (TABLE 1) following a CTAB-based
procedure. 600 pl of 2X CTAB-buffer was added to a small piece of ascoma and blended
with the aid of a micropestle. It was then incubated at 65°C for 15 min; a volume of
chloroform: isoamylalcohol (24:1) was added; and the mixture was gently shaken to
emulsify both phases and centrifuged at 13,000 g.
One volume of isopropanol was added to the recovered supernatant, and the mixture
was centrifuged again at 13,000 g for 15 min. The resulting pellet was washed in 70%
ethanol, centrifuged for 2 min, dried, and finally eluted in 200 ul ddH,O.
PCR amplifications each comprised a 45 ul working volume to which 1-2 ul of
template DNA was added. Primer pairs ITS1F-ITS4, ITS1F-ITS2, or ITS3-ITS4 White
Clarification of four Peziza species ... 831
et al. (1990), and Gardes & Bruns (1993) were used to amplify nrDNA the ITS1 and IT2
(or ITS1+2) regions. Amplification protocols were: 95°C initiation for 5 min; 35 cycles
at 95°C for 45 s, 54°C for 30 s, and 72°C for 45 s; and a final step at 72°C for 10 min.
PCR products were checked in 1% agarose gel prior to purification and sequencing with
primers ITS1F or ITS4.
Chromatograms were visually checked in MEGA5 (Tamura et al. 2011) to detect
ambiguous nucleotides and sequencing problems. Consensus sequences were placed in
GenBank (TABLE 1). Newly generated sequences and their closest relatives in public
databases were incorporated into the alignment produced by Hansen et al. (2002)
stored in TreeBase (M1221), and only slight manual modifications were needed to
accommodate insertions. Final analyses included 902 positions, of which 316 were
parsimony-informative. A maximum parsimony (MP) search was performed in
PAUP*4.0b10 (Swofford 2001) using standard conditions (2000 bootstrap replications,
TBR swapping algorithm, 50 sequence additions per replicate, MULTREES not in
effect). 50% majority-rule consensus tree bootstrap values were annotated in the best-
scoring phylogram evaluated after a maximum-likelihood score analysis of all trees
recovered. Finally, a Bayesian analysis was performed in MrBayes 3.1 (Ronquist &
Huelsenbeck 2003), where the best-scoring model in MrModeltest 2.3 (Nylander 2004)
was simulated. Six chains were employed with temperature set to 0.2, sampling every
100th generation until convergence parameters were met after 2,150,000 generations.
Results & discussion
The analyses were congruent with each other in the suggested topology (Fic.
1) and similar to the phylogenetic relationships already reported for this group
(Hansen et al. 2002, Medardi et al. 2012).
Our results imply P pseudovesiculosa [= A. amplissima Boud.] and
P. pseudosylvestris as closely related to P arvernensis within a monophyletic
clade, sister to those formed by P. varia (Hedw.) Alb. & Schwein. and by
P. fimeti (Fuckel) E.C. Hansen and related taxa. Within this monophyletic
clade, the ambiguity of the taxonomic relationships among the different
lineages could be subject to conflicting interpretations. We choose to consider
them all as synonyms of P arvernensis (the oldest available name) because of
their insufficient genetic differences, the absence of diagnostic morphological
features, and the similarly high intraspecific variability seen in the sister species
P. varia. This synonymy can be summarised as:
Peziza arvernensis Roze & Boud., Bull. Soc. Bot. Fr. 26 (Suppl.): LX XVI. 1879.
= Peziza pseudosylvestris (Gamundi) Alessio, Micol. Ital. 4(2): 21. 1975.
= Galactinia pseudosylvestris Gamundi, Fl. Cript. Tierra del Fuego 10(3): 37. 1975.
= Peziza pseudovesiculosa Donadini, Bull. Soc. Linn. Provence 30: 60. 1977.
= Aleuria amplissima Boud., Hist. Class. Discom. Eur.: 44. 1907, nom. illeg.
(non A. amplissima (Fr.) Pat. 1904).
= Peziza amplissima Sacc. & Traverso, Syll. Fung. 20: 309. 1911, nom. illeg.
(non P. amplissima Fr. 1849).
= Galactinia amplissima Svréek, Ceska Mykol. 16: 110. 1962.
832 ... Lantieri, Medardi & Alvarado
AF491629 Peziza ampelina
1.00/100; AF491627 Peziza subcitrina
AF491628 Peziza subcitrina
KC832899 Galactinia pseudosylvestris
KC832900 Galactinia pseudosylvestris
' KC832901 Peziza pseudovesiculosa
4.00/74 ‘ KC832902 Aleuria amplissima
KC832903 Aleuria amplissima
AF491580 Peziza arvernensis
AF491579 Peziza arvernensis
JQ654489 Peziza fimeti
ALV3919 Peziza arvernensis
KC832898 Peziza pseudovesiculosa
0.98/87
0.98/78
| | KC832897 Peziza arvernensis
KC832896 Peziza arvernensis
| | JF908538 Peziza varia
1.00/98
JF908569 Peziza arvernensis
AF491581 Peziza arvernensis
AF491583 Peziza arvernensis
AF491582 Peziza arvernensis
AF491584 Peziza arvernensis
AF491585 Peziza arvernensis
AF491577 Peziza arvemensis
-00/97 ' AF491578 Peziza arvermensis
1.00/83 AF491587 Peziza sp. (C)
AF491586 Peziza sp. (C)
JF908560 Peziza varia
AF491554 Peziza varia
AF491553 Peziza varia
1.00/99} AF491550 Peziza varia
AF491552 Peziza varia
AF491551 Peziza varia
AF491544 Peziza varia
AF491545 Peziza varia
AF491549 Peziza varia
1.00/100} AF491546 Peziza varia
AF491548 Peziza varia
AF491547 Peziza varia
AF491555 Peziza varia
AF491556 Peziza varia
Lf AF491557 Peziza varia
00/100 * AF491558 Peziza varia
AF491559 Peziza varia
AF491565 Peziza varia
AF491561 Peziza varia
AF491562 Peziza varia
AF491568 Peziza varia
1.00/93) } AF491567 Peziza varia
1100/73 AF491569 Peziza varia
AF491570 Peziza varia
AF491563 Peziza varia
|| AF491564 Peziza varia
AF491566 Peziza varia
AF491560 Peziza varia
~ KC832904 Peziza cf. domiciliana
AF491573 Peziza echinispora
1.00/100} AF491574 Peziza echinispora
KC832905 Peziza pseudovesiculosa
AF491575 Peziza echinispora
AF491571 Peziza sp.
1.00/100' AF491572 Peziza sp.
=
-00/100
Clarification of four Peziza species ... 833
AF491610 Peziza alcis
AF491611 Peziza alcis
AF491612 Peziza alcis
AF491613 Peziza sp. (F)
AF491608 Peziza sp. (E)
1.00/100 ' AF491607 Peziza sp. (E)
AF491588 Peziza ampliata
AF491589 Peziza ampliata
AF491590 Peziza ampliata
AF491592 Peziza ampliata
~ AF491591 Peziza ampliata
AF491614 Peziza domiciliana
AF491593 Peziza fimeti
AF491594 Peziza fimeti
AF491595 Peziza fimeti
AF491596 Peziza fimeti
AF491597 Peziza fimeti
AF491604 Peziza fimeti
0.99/100 1.00 ia AF491605 Peziza fimeti
* AF491606 Peziza fimeti
7 AF491602 Peziza sp. (H)
AF491603 Peziza sp. (I)
| AF491598 Peziza fimeti
AF491600 Peziza fimeti
AF491601 Peziza fimeti
AF491599 Peziza fimeti
~ AF491609 Peziza sp. (B)
AF491617 Peziza sp. (A)
son
1.00/100 1.00/100
AF491615 Peziza sp. (A)
AF491616 Peziza sp. (A)
AF491618 Peziza sp. (G)
L_{ AF491620 Peziza nivalis
1.00/100 - AF491619 Peziza nivalis
KC832906 Peziza domiciliana
oon KC832907 Peziza domiciliana
0.99/100 | JF908561 Peziza domiciliana
——~ AF491621 Peziza ammophila
1.00/100 —- AF491622 Peziza ammophila
| AF491623 Peziza vesiculosa
AF491624 Peziza vesiculosa
1.00/100 | AF491625 Peziza vesiculosa
AF491626 Peziza vesiculosa
1.00/100
ro
0.1
Fic. 1. Consensus ITS phylogram of Peziza s. str. obtained in MrBayes 3.1. Bayesian posterior
probabilities and maximum parsimony bootstrap proportions are presented for nodes significantly
supported by at least one of these analyses. Our new sequences are set in bold font.
TABLES 2-5 summarise morphological data for P arvernensis, P. pseudo-
vesiculosa, P. pseudosylvestris, and P. domiciliana, and make comparisons
between data from the literature and from our study.
834 ... Lantieri, Medardi & Alvarado
TABLE 2. Peziza arvernensis: comparison of cited and new morphological data
CHARACTER ROZE & BOUDIER (1879) CURRENT STUDY
APOTHECIUM — Regularly cup-shaped to Often rather deep cup-shaped, tending to open in
undulate, fragile, rather thick, age, fragile, rather thick, sessile
subsessile
HyMENIUM Ochraceous-ferruginous with + Pale brown, brown-beige, sometimes pale tobacco,
olivaceous tints at times with reddish-violaceous or fawn tints
RECEPTACLE Ochraceous-ferruginous with Concolorous with the hymenium or greyish
olivaceous tints, slightly ochraceous-fawn with rust tints, tending to lighten
furfuraceous. Base with white when dried. Smooth to slightly furfuraceous
tomentum
ASCOSPORES 16-18 x 8-9 um, finely warted 16-19(-20) x 9-10(-11) tm, finely warted
ASCUS (not reported) 270-280 x 15-16 um
PARAPHYSES Clavate above, septate, slightly Clavate, 6-8 ttm above; subcylindrical,
coloured, with several oil 3-4 um below; septate
droplets
EXCIPULUM (not reported) SH: text. globulosa-angularis, cells 13-24 um diam.
ME: 3-layered (Upper & Lower layers: text.
globulosa, cells 35-90 um diam;
Intermediate: text. intricata, hyphae 5-10 um diam
EE: text. intricata, hyphae 5-10 um diam,
mixed with globose cells 15-20 um diam
HABITAT Ground, also between mosseson —_ Ground, also sandy soil; marine to mountain
one thatch environment, under deciduous trees (Fagus,
Quercus), at times also near burnt residue or on
woody remnants
SH = Subhymenium; ME = Medullary excipulum; EE = Ectal excipulum
The microscopical analyses of Aleuria amplissima revealed spores measuring
14—16(-18) x 8-9 um, finely warted, with multiple small internal guttules
and asci measuring 270-300 x 14-16 um. We observed an ectal excipulum
composed of septate hyphae 9-12 um in diam. arranged in a textura intricata,
more or less perpendicular to the hymenium and parallel to one another,
instead of the textura globulosa-angularis reported by Donadini (1977, 1978,
1979) and Baiano et al. (2000). These characters are remarkably similar to those
observed in several P. arvernensis collections: our observations of more or less
finely warted spores of 16-19(-20) x 9-10(-11) um and asci 270-280 x 15-
16 um) agreed with those by Korf (1985). We also noticed a similar excipular
structure and spore measurements in original material of A. amplissima (PC
0084256, PC 0084257, PC 0084258) and in G. pseudosylvestris.
Since the type material of G. pseudosylvestris in LPS was not available for
study, other specimens collected and identified by Gamundi were analyzed
Clarification of four Peziza species ... 835
TABLE 3. Peziza pseudovesiculosa: comparison of cited and new morphological data
CHARACTER DoNADINI (1977) CURRENT STUDY
depenenncrane Cup-shaped, rarely opened, fragile, Cup-shaped, tending to open in age,
thick, sessile or nearly so fragile, + thick, sessile or nearly so
+ Pal nb ,
HyMENIUM Ochraceous to ochraceous-brown a brown Ate
with some reddish tints
Paler than the hymenium, + Concolorous with the hymenium,
RECEPTACLE
furfuraceous furfuraceous
ASCOSPORES 15-18 x 8-10 um, finely warted 16-19 x 9-10(-11) wm, finely warted
ASscus 240-270 x 14-16 um 270-280 x 15-16 um
Cylindrical, 3-4 um below; Subcylindrical, 3-4 tum below;
PARAPHYSES
clavate, 5-10 um above; septate clavate, 6-8 tum above; septate
EXCIPULUM SH: text. globulosa-angularis, SH: text. globulosa-angularis,
cells 7-15 x 15-20 um cells 10-25 pm diam.
ME: 3-layered (Upper: text. globulosa- ME: 3-layered (Upper: text. globulosa,
angularis, cells 15-90(-130) um diam.; cells 30-80 tum diam;
Intermediate: text. intricata & porrecta, Intermediate: text. intricata,
hyphae 6-12 um diam; Lower: text. hyphae 5-10 um diam;
globulosa, cells 30-80 um diam.) Lower: as first layer)
EE: text. globulosa, cells 15-25 um diam. _ EE: text. intricata, hyphae 5-10 um diam,
with protruding hyphae 7-17 um diam. mixed with globose cells 12-17 um diam.
HABITAT Humus, woody remnants, burn residue Humus, woody remnants, burn residue
SH = Subhymenium; ME = Medullary excipulum; EE = Ectal excipulum
(UPS-F570656, UPS-F570665, UPS-F570666, UPS-F570657). These samples
showed spores measuring (15—)16—19(—19.5) x 8.5-11 um, with punctiform
warts ca. 0.5 x 0.5 um and asci <280-320 x 12-14 um. Gamundi (1975)
argued that G. pseudosylvestris could be distinguished from P arvernensis by
its thicker excipulum, especially the upper and lower layers of the medullar
excipulum. Development of more or less wide cells in the excipulum and of
moniliform or thread-like paraphyses seems, however, to be correlated with a
more or less high level of humidity, as stated by Kullman (1995) and Hansen
et al. (2002). Nonetheless, we observed an average thickness ca. 1500-1600
um in all rehydrated samples, in line with the measurements observed in
“typical” P arvernensis. We conclude that this species does not represent an
independent lineage at the species level, but should be considered a synonym
of P. arvernensis.
Most authors mentioned that P arvernensis sensu stricto is typically
associated with Fagus sylvatica L. (fruiting on soil, on litter, or near woody
836 ... Lantieri, Medardi & Alvarado
TABLE 4. Peziza pseudosylvestris: comparison of cited and new morphological data
CHARACTER GAMUNDI 1975; DONADINI 1978 CURRENT STUDY
APOTHECIUM Cup-shaped, then more opened, _
subsessile to stalked
HyYMENIUM Pale ochraceous, pale hazel, 7
ochraceous to olivaceous
RECEPTACLE Concolorous to paler than the hymenium, iF
furfuraceous
ASCOSPORES 14.1-18.2 (-19.2) x 7.2-9.6 um, (15-)16-19 (-19.5) x 8.5-11 um,
finely warted finely warted
Ascus 240-355 x 9.6-14.4 um 280-320 x 12-14 um
PARAPHYSES Thread-shaped, 2.4-4.3 tum large, septate, Subcylindrical, 3-4 um below;
containing ochraceous granules clavate, 6-7 um above; septate
EXCIPULUM SH: text. globulosa, SH: text. globulosa-angularis,
cells 8.4-15.6 um diam. cells <20 um diam.
ME: 3-layered (Upper: text. globulosa, cells ME: 3-layered (Upper: text. globulosa-
50-120 pm diam; Intermediate: text. angularis, cells up to 80 um diam;
intricata, hyphae 4.8-9.6 tum diam; Lower: Intermediate: text. intricata, hyphae
text. globulosa, cells 30-96 um diam.) 8-10 um large; Lower: as first layer)
EE: text. intricata, hyphae 6-9.6 um diam EE: text. intricata, hyphae <5 um diam,
mixed with globose cells 15-20 um diam.
HABITAT Ground, near woody residuals of Nothofagus —
SH = Subhymenium; ME = Medullary excipulum; EE = Ectal excipulum
remnants), but our observations show the habitat of P. arvernensis (both sensu
stricto and sensu lato) to be quite variable: in addition to Nothofagus, some
specimens have been collected under Castanea (MCVE 15497), Carpinus,
Alnus, and other mixed deciduous trees in a floodplain environment (GM
28100346); Quercus ilex L. (AL 0406055); typical Mediterranean vegetation
near Cistus, Juniperus, and Ammophila in a marine retro-dunal environment
(MCVE 11261); and on ground with burn residues (MCVE 15497).
Peziza arvernensis sensu lato may also be confused with P. domiciliana,
which has very similar features: a light umber-brown hymenial surface, paler
(whitish-ochraceous to sub-concolorous) outer surface, spores measuring 15—17
(—20) x 7—9(—10) um that are both smooth and finely warted even in the same
apothecium when ejected from the asci, a similar flesh architecture, and a
substrate of soil, loam, or decaying wood. Sequences of two P. domiciliana
collections (GM 27058844, AL 11030266) seem to match a sequence of another
P. domiciliana stored in GenBank (JF908561; Garbellotto et al., unpubl.) that
represents a lineage distinct from P arvernensis (Fic. 1), thus supporting
Clarification of four Peziza species ...
TABLE 5. Peziza domiciliana: comparison of cited and new morphological data
837
CHARACTER COOKE 1877 CURRENT STUDY
APOTHECIUM Quite regularly cup-shaped, Cup-shaped, tending to open in age, fragile,
then cochleate and contorted, rather thick, sessile or nearly so
fragile
HyMENIUM Hues ranging from white to Amber-brown, honey coloured
amethystine violet;
sometimes rose-tinged
RECEPTACLE Concolorous Paler than the hymenium,
whitish-ochraceous
ASCOSPORES 11-13 x 6-7 um, 15-17(-20) x 7-9(-10) pm,
ornamentation not described smooth to finely warted
ASCUS Not reported 270-300 x 13-15 um
PARAPHYSES Not reported Subcylindrical 2--3 tum below,
clavate 5--6 tum above, septate
EXCIPULUM Not reported SH: text. globulosa-angularis,
cells <10-15 um diam.
ME: 3-layers:
Upper & lower: text. globulosa, cells <50 um diam;
Intermediate: text. intricata, hyphae 5-10 um diam
EE: text. intricata, hyphae <5-10 um diam
HABITAT In a garden Sandy or clay soil, loam, sawdust or other woody
residue: also in cellars or caves
SH = Subhymenium; ME = Medullary excipulum; EE = Ectal excipulum
recognition of P domiciliana as an independent species in accordance with
Hansen et al. (2002). However, it should be noted that the sample of P. domiciliana
sequenced by Hansen et al. (2002; AF491614) seems different from JF908561
and those sequenced in the present work and more closely related to the lineage
formed by Peziza ampliata Pers., P. fimeti, and Peziza alcis Harmaja.
Hansen et al. (2002) noted that both P domiciliana and P. arvernensis could
be confused with P. varia. However, the spores in P varia were observed by
Medardi et al. (2012) as slightly smaller (14-16(-17.5) x 9-11(—12) um), and
the ornamentation in P varia, very difficult to observe with a conventional light
microscope in either surface or outline view, is readily visible in P domiciliana and
P. arvernensis. Nevertheless, one of our collections determined morphologically
as P. domiciliana (FP 2014) fell instead in the clade of P. varia.
Acknowledgments
We wish to thank Prof. D.H. Pfister (Massachusetts, USA), who checked the English of
the text; Prof. Pfister, Prof. Gabriel Moreno (Spain), and Dott. C. Losi (Italy) for critically
838 ... Lantieri, Medardi & Alvarado
reviewing the manuscript; the curators of the institutional Herbaria AMB, HMA, K, PC,
MCVE, SIENA, TAAM, and UPS for arranging loans of material; and E. Bizio, P.G. Jamoni,
FE Padovan, B. Recchia, and A. Testoni for putting their collections at our disposal. We
want to express a particular gratitude to Dr. B. Buyck (PC) and Dr. S. Ryman (UPS) for
granting permission to carry out molecular analysis on their samples.
Literature cited
Baiano G, Garofoli D, Filippa M. 2000. Ascomiceti interessanti del nord Italia. Fungi Non Delineati
12, 74 p.
Cooke MC. 1877. Crop of Peziza. Gardeners’ Chronicle, n.s. 7(182): 793-794.
Donadini JC. 1977. Le genre Peziza L. per Saint-Amans (I). Bulletin de la Société Linnéenne de
Provence 30: 37-100.
Donadini JC. 1978. Le genre Peziza L. per Saint-Amans (II). Les Pezizes de Haute-Provence et de
Dauphiné-Savoie. Bulletin de la Société Linnéenne de Provence 31: 9-36.
Donadini JC. 1979. Le genre Peziza Linné per Saint- Amans (1ére partie). Documents Mycologiques
9(36): 1-42.
Donadini JC. 1981. Le genre Peziza dans le sud-est de la France, avec clé du genre pour la France.
Université de Provence, Marseille. 199 p.
Gamundi IJ. 1975. Fungi, Ascomycetes, Pezizales. Flora criptogamica de Tierra del Fuego 10(3).
181 p.
Gamundi JJ, Giaiotti AL. 1998. Note on andean-patagonian Discomycetes III. New species, new
combinations and new records. Agarica 15(24-25): 11-20.
Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity for Basidiomycetes application
to the identification of mycorrhizae and rusts. Molecular Ecology 2: 113-118. http://dx.doi.
org/10.1111/j.1365-294X.1993.tb00005.x
Hansen K, Lessge T, Pfister DH. 2001. Phylogenetics of the Pezizaceae, with an emphasis on
Peziza. Mycologia 93: 958-990. http://dx.doi.org/10.2307/3761760
Hansen K, Lessoe T, Pfister DH. 2002. Phylogenetic diversity in the core group of Peziza
inferred from ITS sequences and morphology. Mycological Research 106(8): 879-902.
http://dx.doi.org/10.1017/S0953756202006287
Hohmeyer H. 1986. Ein Schlussel zu den europaischen Arten der Gattung Peziza L. Zeitschrift fiir
Mykologie 52(1): 161-188. [French translation: Renaud 1988].
Korf RP. 1986. A compendium of acceptable names for species illustrated in volumes 2 and 3
of Boudier’s Icones Mycologicae [with French translation by J-D Pellet]. 209-252, in: J van
Brummelen et al. (eds). Icones Mycologicae par Emile Boudier. Tome V Liste préliminaire &
Explication des planches [reprint edition]. Lausanne: Editions Piantanida.
Kullman B. 1995. Peziza varia - a moisture loving guest in our homes. Estonian Nature 8: 215-217.
Medardi G, Lantieri A, Pfister DH, LoBuglio K, Cacialli G. 2012. Clarification of
Peziza fimeti with notes on P. varia collections on dung. Mycotaxon 121: 465-476.
http://dx.doi.org/10.5248/121.465
Moyne G. 2008. Pezizomycetes (Discomycétes operculés) recoltes au cours de nos prospections
dans le departement du Doubs (France). Bulletin de la Société d'Histoire Naturelle du Doubs
Mel ISaekS2,
Norman JE, Egger KN. 1999. Molecular phylogenetic analysis of Peziza and related genera.
Mycologia 91: 820-829. http://dx.doi.org/10.2307/3761535
Nylander JAA. 2004. MrModeltest 2. Uppsala, Sweden: Evolutionary Biology Centre, Uppsala
University, Uppsala.
Clarification of four Peziza species ... 839
Ronquist F, Huelsenbeck JP. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed
models. Bioinformatics 19: 1572-1574. http://dx.doi.org/10.1093/bioinformatics/btg180
Roze MM, Boudier E. 1879. Contribution a [étude mycologique de Auvergne. Bull. Soc. Bot. Fr.
26: LXXIV-LXXIX.
Swofford DL. 2001. PAUP*4.0b10: phylogenetic analysis using parsimony (and other methods).
Sinauer Associates, Sunderland, Massachusetts.
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011. MEGAS: molecular
evolutionary genetics analysis using maximum likelihood, evolutionary distance,
and maximum parsimony methods. Molecular Biology & Evolution 28: 2731-2739.
http://dx.doi.org/10.1093/molbev/msr121
White TJ, Bruns T, Lee S, Taylor JW. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in: MA Innis et al. (eds). PCR protocols: a guide to
methods and applications. Academic Press Inc., New York.
http://dx.doi.org/10.1016/B978-0-12-372180-8.50042-1.
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 © 2016. Mycotaxon, Ltd.
October-December 2016— Volume 131, pp. 841-846
http://dx.doi.org/10.5248/131.841
Podosporium bacilliforme sp. nov. and
a first record of Phaeoblastophora peckii
from southern China
JIn- YE WANG’, Kat ZHANG’, CHUN-LING YANG}, JI- WEN X1A3, YING-RuI Ma3,
JIAN-MEI GAO, XIANG-YU LB, X1U-GUO ZHANG} & YU-MEI CAI”
‘College of Animal Science and Veterinary Medicine, Shandong Agricultural University,
Sino-German Cooperation Research Centre for Zoonosis of Animal Origin Shandong Province,
Taian, Shandong, China
?Department of Landscaping, Shandong Yingcai University, Jinan 250104, China
*Department of Plant Pathology, Shandong Agricultural University, Taian, 271018, China
*CORRESPONDENCE TO: [email protected], [email protected]
ABSTRACT—Podosporium bacilliforme is described and illustrated from specimens collected
on dead branches in Guangxi Province. The fungus is characterized by black synnematal
conidiomata and monotretic clavate conidiogenous cells producing solitary elongate-
bacilliform phragmoconidia. Phaeoblastophora peckii is recorded for the first time in China.
Key worps—conidial fungi, taxonomy
Introduction
Decaying wood in the tropical and subtropical forests of southern China
supports a high level of fungal diversity, and several wood-inhabiting
macrofungi and microfungi have been recently discovered there (Gao et al.
2015; Ma et al. 2011, 2014, 2015, 2016; Ren et al. 2012; Xia et al. 201 4a, b, c;
Zhang et al. 2008, 2011). During our ongoing surveys of saprobic fungi
associated with woody debris in Guangxi and Hainan provinces, two interesting
hyphomycetes were collected on dead branches. From morphological
and developmental characteristics, we determined that one of these is an
undescribed synnematous species of Podosporium, while the other represents a
first record of Phaeoblastophora peckii for China.
842 ... Wang & al.
Material & methods
Samples were processed, examined and photographed following the methods
described in Xia et al. (2014b). Adobe Photoshop 7.0 was used to process the photographs
into compound images, with backgrounds modified for esthetic reasons. In view of our
failure to obtain cultures of this species, no molecular data are presented here. The
specimens are deposited in the Herbarium of Department of Plant Pathology, Shandong
Agricultural University, Taian, China (HSAUP) and the Mycological Herbarium,
Institute of Microbiology, Chinese Academy of Sciences, Beijing, China (HMAS).
Podosporium bacilliforme J.Y. Wang, Yu M. Cai & X.G. Zhang, sp. nov. FIG. 1
MycoBank MB 819468
Differs from all other Podosporium spp. by its larger bacilliform or elongated bacillifom
conidia with many more eusepta.
Type: China, Guangxi Province: Tianyang county, Baiyao village, on dead branches of
unidentified bamboo, 15 Nov. 2015, J.Y. Wang (Holotype, HSAUP H10119; isotype,
HMAS 245637).
EryMo_oey: From the Latin bacilliforme, referring to the conidial shape.
Co.toniEs on the natural substratum effuse, brown. Mycelium mostly immersed,
composed of septate, pale brown, flexuous branched hyphae. SYNNEMATA erect,
cylindrical, black, solitary or in groups of 2-3, scattered, 470-720 um long,
14-45 um wide, up to 70 um wide at the apical swollen region, expanded at the
base. CONIDIOPHORES erect, arranged in synnemata, brown, smooth, septate,
sometimes branched at the apex. CONIDIOGENOUS CELLS monotretic, clavate or
cylindrical, integrated and discrete, terminal, determinate, pale brown, 5-8 x
3.5-4.9 um. Conip1a solitary, dry, smooth, bacilliform or elongate-bacilliform,
base truncate, apex rounded, brown to dark brown, 77-310 x 4.5-6.0 um,
9-43-euseptate, slightly constricted at the septa.
COMMENTS—Podosporium was erected by Schweinitz (1832) and typified
by P. rigidum Schwein. The genus is characterized by subulate or cylindrical,
darkly pigmented synnemata with monotretic, percurrent conidiogenous cells
scattered along their length (Ellis 1971). More than 60 Podosporium species
have been described (Index Fungorum 2016).
Podosporium bacilliforme bears some resemblance to P elongatum J.L.
Chen & Tzean, P. etheldoidgeae Crous et al., and P. nilgirense (Subram.) M.B.
Ellis in conidial shape. However, the conidia of P elongatum (62-188 x
6-10 um, 8-21-septate; Chen & Tzean 1993), P. etheldoidgeae (32-85 x 6-9 um,
4-12-septate; Crous et al. 1995) and P. nilgirense (32-50 x 7-9 um, 4-6-septate;
Fic. 1. Podosporium bacilliforme (holotype, HSAUP H10119): A, B. Synnematous conidiomata,
conidiogenous cells, and conidia. C, D. Conidia. E. Conidiogenous cells with conidia.
E Conidiogenous cells.
843
Podosporium bacilliforme sp. nov. (China) ...
844 ... Wang & al.
Ellis 1976) are much smaller and have many fewer septa than those in
P. bacilliforme. Moreover, the terminal conidiogenous cells in P. bacilliforme
clearly separate it from P etheldoidgeae, which is not acropleurogenous.
@9 00
Sse
x
g
=.
=)
Va)
20um
Fic. 2. Phaeoblastophora peckii (HSAUP H7519): A. Conidiophores, conidiogenous cells, and
conidia. B. Conidia. C. Conidiogenous cells and conidia.
Phaeoblastophora peckii (Sacc. & P. Syd.) Partr. & Morgan-Jones,
Mycotaxon 83: 342 (2002)
Cotonigs effuse, dark brown to black. MyceLium partly superficial,
immersed, composed of branched, septate, brown to dark brown, smooth,
FIG. 2
Podosporium bacilliforme sp. nov. (China) ... 845
3-7 um wide hyphae. ConrpiopHores single, distinct, arising as lateral
branches, ascending, erect, straight or slightly flexuous, unbranched, cylindrical,
inflated toward the extreme apex, brown to dark brown, slightly darker
in the distal part, smooth, <280 um long, 4.5-8 um wide. CONIDIOGENOUS
CELLS monoblastic or mostly polyblastic, integrated, terminal or intercalary,
cylindrical, broadly clavate to capitate. Conip1A acropleurogenous, simple or
branched acropetal chains, dry, unicellular, smooth, sub-globose to ellipsoidal,
dark brown, generally paler when young, usually narrowly truncate at one or
both ends, unthickened at the ends, sub-globose 5-7 um diam, ellipsoidal,
7-13 X 5.5-7 um.
SPECIMEN EXAMINED: CHINA, HAINAN PROVINCE: Diaoluoshan, on dead branches of
unidentified tree, 10 May 2014, X.Y. Li (HSAUP H7519).
ComMENtTS—Phaeoblastophora peckii was originally described from America.
Our specimen fits well with the description of the type material (Partridge &
Morgan-Jones 2002), although the conidiophores of the Chinese specimen are
slightly longer (280 um vs 200 um). Therefore, we believe they are the same
species.
Acknowledgments
The authors express gratitude to Dr. Bryce Kendrick and Dr. Rafael F. Castafeda-
Ruiz for serving as pre-submission reviewers and for their valuable comments and
suggestions. This project was supported by the National Natural Science Foundation
of China (Nos. 31093440, 31230001, 31200013) and the Ministry of Science and
Technology of the People’s Republic of China (Nos. 2006FY 120100).
Literature cited
Chen JL, Tzean SS. 1993. Podosporium elongatum a new synnematous hyphomycete from Taiwan.
Mycological Research 97: 637-640. http://dx.doi.org/10.1016/S0953-7562(09)81190-8
Crous PW, Wingfield MJ, Kendrick WB. 1995. Foliicolous dematiaceous hyphomycetes from
Syzygium cordatum. Canadian Journal of Botany 73(2): 224-234.
http://dx.doi.org/10.1139/b95-025
Ellis MB. 1971. Dematiaceous hyphomycetes. Commonwealth Mycological Institute, Kew Surrey.
Ellis MB. 1976. More dematiaceous hyphomycetes. Commonwealth Mycological Institute, Kew
Surrey.
Gao JM, Xia JW, Ma YR, Li Z, Zhang XG. 2015. Blastophragma chonggingense sp. nov. and a
new record of Bahusutrabeeja angularis from southern China. Mycotaxon 130(3): 821-825.
http://dx.doi.org/10.5248/130.821
Index Fungorum. 2016. http://www.indexfungorum.org/names/Names.asp [Accessed: 15 Dec.
2016].
Ma J, Zhang YD, Ma LG, Ren SC, Zhang XG. 2011 [“2010”]. Taxonomic studies of Ellisembia from
Hainan, China. Mycotaxon 114: 417-421. http://dx.doi.org/10.5248/114.417
Ma J, Xia JW, Zhang XG, Castafieda-Ruiz RF. 2014. Arachnophora dinghuensis and Websteromyces
inaequale sp. nov., and two new records of anamorphic fungi from dead branches of broad-
leaved trees in China. Mycoscience 55: 329-335. http://dx.doi.org/10.1016/j.myc.2013.11.007
846 ... Wang & al.
Ma YR, Xia JW, Gao JM, Li XY, Castaneda Ruiz RF, Zhang XG, Li Z. 2015. Atrokylindriopsis, a new
genus of hyphomycetes from Hainan, China, with relationship to Chaetothyriales. Mycological
Progress 14: 77 [5 p.]. http://dx.doi.org/10.1007/s11557-015-1071-x
Ma YR, Xia JW, Gao JM, Li Z, Zhang XG. 2016. Anacacumisporium, a new genus based on
morphology and molecular analyses from Hainan, China. Cryptogamie, Mycologie 37(1):
45-59. http://dx.doi.org/10.7872/crym/v37.iss1.2016.45
Partridge EC, Morgan-Jones G. 2002. Notes on hyphomycetes LXX XVIII: New genera in which
to classify Alysidium resinae and Pycnostysanus azaleae, with a consideration of Sorocybe.
Mycotaxon 83: 335-352.
Ren SC, Ma J, Ma LG, Zhang YD, Zhang XG. 2012. Sativumoides and Cladosporiopsis,
two new genera of hyphomycetes from China. Mycological Research 11: 443-448.
http://dx.doi.org/10.1007/s11557-011-0759-9
Schweinitz LD von. 1832. Synopsis fungorum in America boreali media degentium. Transactions
of the American Philosophical Society 4(2): 141-316.
Xia JW, Ma LG, Ma J, Zhang XG. 2014a [“2013”]. Two new species of Spadicoides from southern
China. Mycotaxon 126: 55-60. http://dx.doi.org/10.5248/126.55
Xia JW, Ma LG, Castafieda-Ruiz RF, Zhang XG. 2014b. Minimelanolocus bicolorata sp. nov.,
Paradendryphiopsis elegans sp. nov. and Corynesporella bannaense sp. nov. from southern
China. Mycoscience 55: 299-307. http://dx.doi.org/10.1016/j.myc.2013.11.003
Xia JW, Ma LG, Castafeda-Ruiz RF, Zhang XG. 2014c. A new species of Sporidesmiopsis and three
new records of other dematiaceous hyphomycetes from southern China. Nova Hedwigia
98(1-2): 103-111. http://dx.doi.org/10.1127/0029-5035/2013/0145
Zhang K, Ma J, Zhang XG. 2008. Two new species of Corynespora from Hainan, China. Mycotaxon
104: 159-163.
Zhang YD, Ma J, Ma LG, Zhang XG. 2011 [“2010”]. A new species of Podosporium and a new
record from southern China. Mycotaxon 114: 401-405. http://dx.doi.org/10.5248/114.401
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 © 2016. Mycotaxon, Ltd.
October-December 2016—Volume 131, pp. 847-857
http://dx.doi.org/10.5248/131.847
Apiosordaria hamata sp. nov. from lake sediment in China
BING Wt’, JIAN-QING TIAN’, LIN WANG’,
Jran-Kui Liu’, Kevin D. HYDE”? & JING-ZuU SUN’?
‘State Key Laboratory of Mycology, Institute of Microbiology, Chinese Academy of Sciences,
No. 3 Park 1, Beichen West Road, Chaoyang District, Beijing 100101, China
? Centre of Excellence in Fungal Research, Chiang Rai 57100, Thailand
° School of Science, Mae Fah Luang University, Chiang Rai 57100, Thailand
* CORRESPONDENCE TO: [email protected];
ABSTRACT—A new species, Apiosordaria hamata, is described and illustrated from sediment
collected from Donghu Lake, Wuhan, Hubei Province, China. Apiosordaria hamata is
characterized by its cleistothecial ascomata with agglutinated hairs, a thin peridium, clavate
asci, and two-celled, biseriate, ovoid ascospores. However, it differs from other Apiosordaria
species in having hooked spines on the upper cell of the ascospores and lacking germ pores.
Combined ITS and LSU sequence analyses using maximum likelihood and Bayesian analysis
nest A. hamata in the Apiosordaria clade. Both morphological and molecular analyses support
this fungus as a new species of Apiosordaria. A key to Apiosordaria species is provided.
Key worps—phylogenetic analyses, soil fungi, Lasiosphaeriaceae, Sordariales, taxonomy
Introduction
Arx & Gams (1967) introduced the genus Apiosordaria Arx & W. Gams
(Lasiosphaeriaceae, Sordariales) based on the type species Pleurage verruculosa
C.N. Jensen [= A. verruculosa]. Krug et al. (1983) synonymised Echinopodospora
and Lacunospora under Apiosordaria based on morphological similarities. In
Apiosordaria ascospores are usually two-celled, composed of a dark upper cell
and a lower hyaline cell; the upper cell is ellipsoidal to subglobose, with walls
ornamented with numerous broad or narrow pits; the lower cell is triangular to
cylindrical and possessing a minute hyaline terminal appendage (Arx & Gams
1967). In addition, the presence of spines, warts, or pits on the upper ascospore
cell is used as a principal character that differentiates this genus from related
848 ... Wu &al.
genera in the Lasiosphaeriaceae that also produce two-celled ascospores (e.g.,
Cercophora, Podospora, Triangularia, Zopfiella; Garcia et al. 2003).
Apiosordaria currently comprises 23 species with a worldwide distribution
in garden soils (Stchigel et al. 2000), field soils (Jensen 1912), grassland soils
(Warcup 1951a), and forest soils (Warcup 1951b). The genus is also found in
dung (Krug et al. 1983) and decaying wood (Badura & Badurowa 1964). Some
species have also been found associated with plant material (Rostrup et al.
1916) and the insect Plecia nearctica (Kish et al. 1974).
During a study of the fungal diversity of wetlands in China, an interesting
Apiosordaria species was isolated. Morphological characteristics distinguishing
this taxon from all other species in the genus (Krug et al. 1983, Guarro & Cano
1988, Stchigel et al. 2000) are here supported by phylogenetic analyses. In this
paper, the new species is introduced, described, and illustrated, and compared
with the most similar species.
Materials & methods
Collection, isolation, and morphological examination
Soil samples were collected from Donghu Lake (30°33’N 114°23’E) in the
northeastern outskirts of Wuchang, Wuhan City, Hubei, China. Donghu Lake, situated
on the alluvial plain in the middle basin of the Changjiang (Yangtze) River, has a total
surface area of 32 km? and lies 21.4 m (20.8-21.7 m) above sea level. The lake is usually
3-4 m deep with a maximum of 4.5 m, and the flat muddy lake bottom is sparsely covered
with hydrophytes. The area is dominated by a damp subtropical monsoon climate, with
a temperature range of 12.9-21.5 °C and annual precipitation of ca. 1040 mm. Sediment
samples were collected along the bank of the lake at depths of 0-40 cm. The samples
were sealed in plastic bags, placed in a 4 °C car refrigerator, and transported to the
laboratory for processing.
A 10 g sediment subsample was homogenized, serially diluted in sterile distilled
water, shaken, and 200 ul plated onto % strength potato dextrose agar (PDA) containing
100 mg! streptomycin and 100 mg!’ chloromycetin. The plates were kept at 25 °C for 1
week, after which fungi with different colony morphologies were selected and grown on
new PDA plates with antibiotics, on oatmeal agar (OA), potato carrot agar (PCA, potato
20 g, carrot 20 g, agar 20 g) and malt extract agar (MEA). Isolates were identified based
on morphological characteristics after 10 days incubation at 25 °C.
Microscopic characteristics of the new species of Apiosordaria were observed with
a Nikon Ellipse 80i light microscope equipped with differential interference contrast
(DIC) optics and a FEI] Quanta 200 scanning electron microscope (SEM). Ex-type and
isotype cultures are deposited in the China General Microbiological Culture Collection
Center (CGMCC), Beijing, China.
DNA sequencing & phylogenetic analysis
After 10 days growth on PDA, ca. 0.2 g of mycelium was collected with a sterile
scalpel and placed into a 1.5 ml centrifuge tube. Genomic DNA was extracted with
Apiosordaria hamata sp. nov. (China) ... 849
TABLE 1. Sources and sequences used in the phylogenetic analysis.
TAXON
Apiosordaria backusii [=
Triangularia backusii]
A. hamata
A. hamata
A. longicaudata
A. nigeriensis
A. tetraspora
A. verruculosa
A. verruculosa
var. maritima
Apodus deciduus
A. oryzae
Bombardia bombarda
Bombardioidea anartia
Cercophora areolata
C. sparsa
C. sulphurella
Cladorrhinum sp.
Immersiella caudata
I. immersa
Jugulospora rotula
Lasiosphaeria glabrata
L. lanuginosa
L. ovina
L. rugulosa
Podospora cupiformis
P. curvicolla
P. intestinacea
Schizothecium aloides
S. fimbriatum
S. glutinans
Strattonia carbonaria
Triangularia mangenotii
T. tanzaniensis
Xylaria hypoxylon
Zopfiella tabulata
Zygopleurage zygospora
COLLECTION NO.*
CBS 106.77
CGMCC 3.15230
CGMCC 3.15231
CBS390.84
FMR 6363
CBS 363.84
F-152365
CBS 550.66
CBS 506.70
CBS 376.74
AFTOL 967
HHB99-1
UAMH7495
JF00229
SMH2531
MJ-2014
SMH3298
SMH2589
ATCC38359
TL4529
SMH3277
CBS 958.72
SMH4438
CBS 246.71
IFO 8548
CBS 113106
CBS 879.72
CBS 144.54
CBS 134.83
ATCC 34567
ATCC 38847
TRTC51981
AFTOL-ID 51
CBS 230.78
SMH4219
ORIGIN
Sandy soil, Japan
Wetland soil, China
Wetland soil, China
Soil, Japan
Garden soil, Nigeria
Soil, Thailand
Ethanol-pasteurized soil,
Spain
Ethanol-pasteurized soil,
Spain
Moose dung
Branch, Panama
Decaying wood, Germany
Kobus defassa dung
Rabbit dung
Horse dung
Soil, Netherlands
Horse dung
Arctostaphylos uva-ursi,
Switzerland
Burned soil, Japan
Soil, Japan
Downed rotting wood
Porcupine dung, Canada
Dung of cow, USA
GENBANK ACCESSION NO.
ITS
GQ922520
KP878306
KP878307
AJ458184
AY681199
AY681200
AY587911
AY587913
KJ572182
AY587914
AY587920
AY587925
AY587932
AY999125
AY999122
AY999121
AY999120
AY999115
AY999116
DQ491487
AY999132
LSU
KP878304
KP878305
FR692340
FR692341
AY346258
FR692345
AY681165
AY681166
DQ470970
AY346264
AY587936
AY587937
AY587938
AY436407
AY436408
AY346287
AY436410
AY587943
AY587946
AY587952
AY999102
AY999099
AY999104
AY999097
AY999092
AY999093
AY346302
AY346303
AY780081
AY544648
AY999105
AY346306
* ATCC, American Type Culture Collection, USA; AFTOL, Assembling the Fungal Tree of Life, USA; CBS,
Centraalbureau voor Schimmelcultures, Netherlands; CGMCC, China General Microbiological
Culture Collection Center, China; HHB, Field Museum of Natural History, Chicago, Illinois;
IFO, Institute for Fermentation, Osaka; SMH, Sabine M. Huhndorf; TL, Thomas Leessoe; UAMH,
University of Alberta Microfungus Collection and Herbarium.
850 ... Wu &al.
a simple and rapid ‘thermolysis’ method (Zhang et al. 2010). Partial 28S rDNA and
complete ITS+5.8S rDNA were amplified using fungal specific primers LROR/LR7
(Vilgalys & Hester 1990) and ITS5/ITS4 (White et al. 1990), respectively.
All PCR amplifications were carried out using a Biometra T-professional
thermocycler. The reaction mixture included 5 ul of 10x Takara Bio PCR buffer, 2 ul of
25 mM MgCl, (1 uM final concentration), 4 ul of 2.5 mM deoxynucleotide triphosphate
mix (final concentration, 250 uM each; Takara Bio, Japan), 2 ul of 10 uM primers each
(final concentration, 0.25 uM; Sangon Biotech, China), 1 ul Sigma deionized formamide,
and 0.4 ul Taq polymerase. The amplification was carried out as follows: 95 °C for 3
min; followed by 35 cycles at 95 °C for 1 min, 54 °C for 45 s, and 72 °C for 90 s; and
a final extension for 10 min at 72 °C. After the PCR products were separated in 1%
(w/v) agarose gels, they were stained with 0.4% GoldView nucleic acid gel stain (SBS
Genetech) and viewed and photographed on a Gel imaging system (Bio-Rad).
The internal transcribed spacer (ITS) region and large-subunit rRNA (LSU) gene
data sets were constructed with sequences of Apiosordaria hamata (isolates CGMCC
3.15230, CGMCC 3.15231) and reference sequences from related taxa retrieved from
GenBank (TaBLE 1). All sequences were aligned with ClustalX v1.83 (Thompson et
al. 1997), and the alignment was manually adjusted to allow maximum alignment and
minimize gaps. Maximum likelihood (ML) and Bayesian analysis were used to estimate
phylogenetic relationships of A. hamata with its related taxa, with Xylaria hypoxylon (L.)
Grev. as the outgroup taxon.
Maximum Likelihood analysis was conducted in RaxmlGUI v1.3 (Silvestro &
Michalak 2012) with the GTRGAMMAI model, 1000 bootstrap replicates. While
Bayesian analysis was performed in a likelihood framework as implemented by MrBayes
v3.0b4 software package to reconstruct phylogenetic trees (Huelsenbeck & Ronquist
2001), the best-fit evolutionary model was determined by MrModeltest v2.3 (Posada &
Crandall 1998, Nylander 2004) through comparing different nested DNA substitution
models in a hierarchical hypothesis-testing framework. The best-fit model determined
by MrModeltest was the “GTR+1+G’, lsetnst = 6, rates = invgamma; prset statefreqpr =
dirichlet (1, 1, 1, 1) for Bayesian analyses. Multiple Bayesian searches using Metropolis-
coupled Markov chain Monte Carlo sampling were conducted using one cold and three
heated Markov chains in the analysis. Bayesian analysis was run for 645,000 generations,
with trees sampled every 100 generations. The first 1290 trees, representing the burn-in
phase, were discarded. To estimate posterior probabilities (PP) of recovered branches
(Larget & Simon 1999) 50% majority rule consensus trees were created from the
remaining trees using PAUP.
Results
Molecular phylogeny
Nucleotide sequence blasts of the NCBI-nrDNA database showed that the
new fungus, Apiosordaria hamata, exhibited 98% LSU sequence similarity with
Cercophora sp. isolate SMH3200 (AY780055) (query cover = 99%, identities
= 1274/1295, gaps = 2/1295), 97% similarity with Arnium arizonense isolate
18211-c (S) (KF557668) (query cover = 100%, identities = 1252/1297, gaps
Apiosordaria hamata sp. nov. (China) ... 851
1.00/100);- Lasiosphaeria lanuginosa SMH3277
Lasiosphaeria ovina CBS958.72
Lasiosphaeria rugulosa SMH4438
1.00/78 Lasiosphaeria glabrata TL4529
Cercophora sparsa JF00229
Cercophora areolata UAMH7495
Zoptiella tabufata CBS230.78
1.00/*| Triangularia mangenotii ATCC 38847
Apodus oryzae CBS376.74
0.98/87 Cercophora sulphurella SMH2531
Bombardioidea anartia HHB99-1
4.00/100 Bombardia bombarda AFTOL967
1.00/100, Apiosordaria hamata CGMCC 3.15230"
“160 Apiosordaria hamata CGMCGC 3.15231
Cladorrhinum sp. MJ-2014
Apiosordaria verruculosa F-152365
Apiosordaria nigeriensis FMR 6363
*#/98, Apiosordaria longicaudata CBS390.84
Apiosordaria tetraspora CBS363.84
Apiosordaria verruculosa var. maritima CBS550.66
Apiosordaria backusii CBS106.77
1.00/97 Apodus deciduus CBS506.70
0.96/90 Podospora intestinacea CBS113106
1.00/100 Zygopleurage zygospora SMH4219
Podospora curvicolla |FO 8548
*/93 Podospora cupiformis CBS246.71
Triangularia tanzaniensis TRTC51981
*/64 Schizothecium fimbriatum CBS144.54
1.00/100 Schizothecium aloides CBS897.72
Schizothecium giutinans CBS134.83
0.9541 00 rp Jugulospora rotula ATCC38359
Strattonia carbonaria ATCC34567
Immersiella caudata SMH3298
1.00/95 © Immersiella immersa SMH2589
Xylaria hypoxylon AFTOL-ID51
1.00/*
“167
0.99/86
“(57
1.00/95
0.03
Fic. 1. Maximum likelihood (ML) tree from PAUP analysis and Bayesian tree by MrBayes based on
LSU and ITS sequences of Apiosordaria and GenBank data from related species. Bayesian posterior
probabilities >0.95 and ML bootstrap support values > 50% are shown on the upper branches.
= 3/1297), and 97% similarity with Arnium arizonense isolate 724 (UPS)
(KF557669) (query cover = 99%, identities = 1250/1295, gaps = 3/1295) in
family Lasiosphaeriaceae. ITS sequence results indicated a 92% similarity
with Cladorrhinum sp. MJ-2014 (KJ572182) (Lasiosphaeriaceae) (query cover
= 100%, identities = 498/544, gaps = 10/544). We therefore included related
reference sequences in Lasiosphaeriaceae in our phylogenetic analyses.
The LSU and ITS combined gene datasets were analyzed using maximum
likelihood (ML) and Bayesian analysis (Fic. 1). The phylogenetic trees derived
from ML and Bayesian analysis gave similar results; the Apiosordaria hamata
852 ... Wu &al.
strains (CGMCC 3.15230 and CGMCC 3.15231) formed a well-supported
clade with A. backusii (L.H. Huang) Guarro [= Triangularia backusii] (CBS
106.77), A. longicaudata (Furuya & Udagawa) J.C. Krug et al. (CBS390.84),
A. nigeriensis Stchigel & Guarro (FMR 6363), A. tetraspora J.C. Krug et al.
(CBS 363.84), A. verruculosa (C.N. Jensen) Arx & W. Gams (F-152365),
A. verruculosa var. maritima (Apinis & Chesters) Arx & W. Gams (CBS 550.66),
and Cladorrhinum sp. (MJ-2014) within Lasiosphaeriaceae (Bayesian posterior
probability = 1; ML bootstrap value = 95%). However, the two A. hamata strains
formed a separate clade with high support (Bayesian posterior probability = 1;
ML bootstrap value = 100%).
Taxonomy
Apiosordaria hamata B. Wu, K.D. Hyde, Jing Z. Sun & Xing Z. Liu, sp.nov. Fra. 2
MycoBAnk MB 812280
Differs from related Apiosordaria species by lacking germ pores in the ascospores and by
having hooked spines on the upper cell of the ascospores.
Type: China, Hubei, Wuhan, Donghu Lake, isolated from sediment, July 2009, B. Wu
(Holotype, HMAS 246231; ex-type cultures, CGMCC 3.15230, C@MCC 3.15231).
EryMo.ocy: hamata refers to the hooked spines on the upper cell of the ascospores.
FACES OF FUNGI NUMBER: FoF 00663
ASCOMATA superficial, scattered, cleistothecial, dark brown, globose,
overall 475-490 x 480-525 um. PERIDIUM 4-6-layered, up to 4-5 um wide,
translucent, brownish orange to brown, comprising cells arranged in a textura
angularis. PARAPHYSES hyaline, filiform, septate, unbranched, 1.8-2.2 um wide.
Asci 8-spored, clavate, broadly rounded at the apex, 420-450 x 90-100 um,
pedicel without conspicuous apical structures, evanescent, 90-150 um long.
Ascosporss biseriate, clavate, hyaline, 1-celled when young and becoming
two-celled with the formation of a transverse septum, warted wall, 26-31 x
22-26 um; upper cell obovoid, truncate at the base and with a slightly acuminate
apex, brown, thick-walled, uniformly ornamented with numerous 2-3 um
diam (x = 2.4 um, n = 30) hooked spines, lacking a germ pore; lower cell sub-
hyaline, conical and smooth, 4-7 x 12-15 um (x = 5.2 x 13.1 um, n = 30) long.
ASEXUAL MORPH: Undetermined.
Fic. 2. Apiosordaria hamata (holotype, HMAS 246231). A. colony on PCA; B, ascomata;
C. immature ascoma; D, E. mature ascomata; F. immature ascus; G-I. mature asci in cotton blue;
J. ascospores; K. ascospore with warted coat; L. ascospore with smooth coat; M, O. ascospores
with hooked spines (SEM); N. ascoma (SEM). Scale bars: B = 1 mm; C, D = 100 um; E = 50 um;
F-I, K, L = 10 um; J = 20 um.
Apiosordaria hamata sp. nov. (China) ... 853
-
WD Mag _ HV_ Det Spot. —————20.0um
12:01:55 PM 20.1 mm 2736x 15.0 kVETD 3.0
WD 2) WD Mag! HV | Det Spot 10.0um:
11:59:34 AN) 20.0 mm 345x 15.0 kVETD 3.0 -40:08 AM 20.0 mm 3068x 15.0 kKVETD 3.0
854 ... Wu &al.
Discussion
Apiosordaria hamata can be recognized by its spiny ascospores in the clavate
asci and is supported in the phylogeny. Its ascospores are similar in size to
A. nigeriensis (24-32 x 20-23 um), A. jamaicensis (B.M. Robison) Krug et al.
(24-30 x 17-23 um), A. sacchari (B.M. Robison) Krug et al. (33-40 x 25-31
um), and A. spinosa (Cailleux) Krug et al. (25-32 x 18-21 um), all of which
also have spinulose to spiny ascospores (Krug et al. 1983). However, A. hamata
is distinct in having hooked spines on the upper cell of the ascospores and
in lacking germ pores, which Meléndez-Howell (1970) observed in her SEM
studies of previously described Apiosordaria species.
Phylogenetic analysis supported the two isolates of A. hamata in a subclade
with A. nigeriensis, A. verruculosa, and Cladorrhinum sp. (asexual morph of
Apiosordaria) with >50% bootstrap ML value but separated from the other
Apiosordaria species. Although A. hamata is morphologically similar to
A. nigeriensis, they are separated on the ITS and LSU phylogenetic tree
(Frc. 1), which clusters A. hamata in a monophyletic group with seven species
of Apiosordaria. Here, morphology coupled with molecular analysis support
this fungus as a new species in Apiosordaria (Lasiosphaeriaceae).
Key to species of Apiosordaria
if, “ACT Pas OTRO RCLAV ALC Ae yi ah Steal bk ead Pace tered chert edeeal Fae e Beste Mite Ape 2
Mi Ascr Bspored, clavate Or cyl rical solo NOP 2 et or spat his Sigg hye Sieger Sih uer ER gr sis 5
2. Ascomata globose, upper ascospore cell verrucose, 18-22 x 14-17 um;
lower ascospore cell 4-6 X 5-6 UM 0... eee eee eee eee A. effusa
2, Ascomata pyr wornysOstiolates. Wat an. was wn wane «a vedo ee wee ore Rose 3
3. Upper ascospore cell spinulose or warty, 16-21 x 13-15 um;
lower ascospore cell 6-10 x 9-19 Um «1.0... eee eee eee ee A. verruculosa
SWIPE asc OSPOES Cell Cle, tn MF Ben. c, hreeconneh het nacg ens aeea ist pon asses gee Anessa 4
4, Lower ascospore cell 10-14 X 7.5-9 UM 11... .. ee eee eee eee eee A. longicaudata
4, Lower ascospore cell 4—7.5(-10) x 6-8(-11) um... eee eee eee A. tetraspora
5. Ascospore wall with broad pits;
ornamentation appearing as spines or irregular warts .................0000. 6
5. Ascospore wall with narrow pits; ornamentation appearing as pits ............. 18
6. Upper ascospore cell polygonal, five-angled in side view,
ornamented with longitudinal ribs, 10-12 x 8-9 um ............ A. striatispora
6. Upperascospore-cell-more or-less ellipsoidal 5 ech) eead pod ooetak: wertade ehoaes 7
PEAS COUIALOS 1G ARG: Atlee ea Mel oa See ary Ae tS galt Me tt Me tyne cele Me oe Re ese 8
7. Ascoma smooth or with another type of vestiture, non-ostiolate;
ascospores overall typically larger than 14uum................ 0... eee ee eee 11
Apiosordaria hamata sp. nov. (China) ... 855
8. Ascoma lacking agglutinated hairs;
upper ascospore cell 10-12.5 x 6-8 um with flat-topped spines;
lower cell 4-6 um long; asexual morph absent ................ A. yaeyamensis
§.ASEOMA: SVE AS SIL ALCON ALG’ 5. Pax soa: fax, cate ap ae BEC fe ene PG vas PA need Be oe a faces pe E
9. Upper ascospore cell 15-19 x 10-12.5 um; lower cell 5-6.5 um long;
asexual MOLPI GHEY SOSPOLIE sx Bente tes Bacdhine Badel an Sioues op ads ong ee A. microcarpa
> Upper-ascospore-celDlarger ony otc eh hcg cos By enn eran te Hin eihey eine x Berne eA ns 10
10. Ascoma pyriform; upper ascospore cell pitted, 27-34 x 18-23 um ..... A. backusii
10. Upper ascospore cell uniformly ornamented with numerous rounded warts,
23-28(-30) x 18-22(-23) um; lower ascospore cell 1-5(-6) um long;
used Ter pM Abseny . eye Seis. hore ke eg ete hte Seen yee tse ee A. hispanica
11. Ascospores with a granulose to wart-like ornamentation;
lower ascospore cell 4-5 um long; asexual morph absent ........ A. tuberculata
11. Ascospores with spine-like ornamentation or flat-topped ridges;
lower ascospore:cell longer ...5 don <xa% ge u eh ee hres elas 4 eee Metage o 12
12. Asci cylindrical and curved; upper ascospore cell 16-20(-22) x 12-15 um,
lower cell frequently transversely septate, 12-20 um long;
asexual morphs Cladorrhinum and Chrysosporium ............ A. vermicularis
12. Asci clavate; upper ascospore cell larger; lower cell non-septate............... 13
13. Ascospore ornamentation 2-5.5 um long,
upper cell (24—)25-32 x 18-21(-22) um, lower cell 4-8 um long;
sexual morph Chrysosporium (when present) ............--0--e eee A. spinosa
13. Ascospore ornamentation shorter (<3 tum); lower cell longer ................. 14
14. Upper ascospore cell 33-40 x 25-31 um; lower cell 14-20 um long;
ASEM AOL PM ADSSME yg octet tr ate, in ae Ue aae wee ean een seeaen ate A. sacchari
14. Upper and lower ascospore cells shorter ............ 0. eee e eee e eee e ence 15
15 Ascospore ornamentation irregular flat-topped ridges forming an incomplete
reticulum, upper cell 28.5-33 x 17-19.5 um; lower cell ca. 8-10 um long;
asexual MOP CHPVSOSPOTEAIA® fo .5) she utans. 3 os alten eae teh eockecs, earktle ens A. terrestris
LS wesCOSPOre: OLN AMIE talon Spin ert ees sy a8 Sa ol Note oh! Bote ol! Mate oh eb Aiea ats 16
16. Upper ascospore cell without germ pore, 26-31 x 22-26 um, uniformly
ornamented with hooked spines of 2-3 um diam; lower cell
sub-hyaline, conical, smooth, 12-15 um long; asexual morph absent A. hamata
1G: Wppedscospore cellowitlhyCerm Ores sre Fo aga tw deat seat h ao S peg t oraiphgd prt hald ors 17
17. Upper ascospore cell 24-32 x 20-23 um, with a dark area surrounding
the germ pore and ornamented with spines <7 um long;
bower ceule7—WOstirin Ln Se ia porte Sree eck oe sa red ata taper eral atl i A. nigeriensis
17. Upper ascospore cell 24-30 x 17-23(-26) um, ornamented with
spines <3 um long; lower cell ca. 11-18 um long;
asexual morph Chrysosporium (when present) .............+--- A. jamaicensis
856 ... Wu &al.
18. Ascoma glabrous; ascospores overall (16-)18-21(-23) x 10-12 um, with rugose
flanges; lower ascospore cell 2.5-5 um long; asexual morph absent ... A. rugosa
[8Ascoma with agelutinated: Has... mt rl mel ok eal ek el ae ok coat ot, coals fet 19
19. Upper ascospore cell regularly pitted, 20-25 x 12-15 um, lacking flanges;
lower ascospore cell 4—5 um long; asexual morph Cladorrhinum ..... A. vestita
19" Upper-aseospore cellicovered: withismallwarts<. x... Stal oo Seas .-o Seles cep Leeds ot Pace 20
20. Upper ascospore cell 27-34 x 18-23 um, walls ornamented with shallow pits;
lower ascospore cell 11-17 x 10-12 um long ................ A. tenuilacunata
20 ,Upperascospore cellismaller var. cosets iis ant. slec ates hel anes Aet o's Mae ane ane AS one 21
21. Asexual morph Chrysosporium-like;
upper ascospore cell 20-24 x 15-18 um... eee eee A. otanii
DAL ASE RUAN OEP a DSCINE 4.5 spf in race coke EME nt hk to, asset ccatateeinet NE eer hee nat oft 22
22. Upper ascospore cell 25-27(-29) x (22—)23-27 um, uniformly ornamented
with small warts; lower cell (1-) 4-6 um long, slightly warted ....... A. globosa
22. Upper ascospore cell 19-24 x 8-10 um, ornamented with small warts;
lower cell 3:5-4.5-* 3=4 um. bg eh hea ae cates oa eee tee ee bees A. antarctica
Acknowledgments
This research was jointed supported by the Natural Science Foundation of China
(No. 31600024 and 41101238). The authors thank Professors Xue-Wei Wang (Institute
of Microbiology, Chinese Academy of Sciences) and Yu-Cheng Dai (Beijing Forestry
University, China) for their kind suggestions and valuable comments in identification;
they are also grateful to Dr. Sajeewa S.N. Maharachchikumbura (Guizhou Academy of
Agricultural Sciences) and Dr. Eric H.C. McKenzie (Landcare Research, New Zealand)
for presubmission reviews.
Literature cited
Arx JA von, Gams W. 1967. Uber Pleurage verruculosa und die zugehérige Cladorrhinum-
Konidienform. Nova Hedwigia 13: 199-208.
Badura L, Badurowa M. 1964. Some observations on the mycoflora in the litter and soil of
the beech forest in Lubsza region. Acta Societatis Botanicorum Poloniae 33: 507-525.
https://doi.org/10.5586/asbp.1964.037
Garcia D, Stchigel AM, Guarro J. 2003 Soil ascomycetes from Spain. XIII. Two new species of
Apiosordaria. Mycologia 95: 134-140. https://doi.org/10.2307/3761972
Guarro J, Cano, J. 1988. The genus Triangularia. Transactions of the British Mycological Society 91:
587-591. https://dx.doi.org/10.1016/S0007-1536(88)80031-7
Huelsenbeck JP, Ronquist F. 2001. MRBAYES: Bayesian inference of phylogenetic trees.
Bioinformatics 17: 754-755. https://dx.doi.org/10.1093/bioinformatics/17.8.754
Jensen CN. 1912. Fungous flora of the soil. Bulletin of the Cornell University Agricultural
Experimental Station 315: 415-501. http://dx.doi.org/10.1097/00010694-193102000-00005
Kish LP, Allen GE, Kimbrough JW, Kuitert LC. 1974. A survey of fungi associated with the lovebug,
Plecia nearctica, in Florida. Florida Entomologist 57: 281-284. https://doi.org/10.2307/3493260
Krug JC, Udagawa S, Jeng RS. 1983. The genus Apiosordaria. Mycotaxon 17: 533-549.
Apiosordaria hamata sp. nov. (China) ... 857
Larget B, Simon DL. 1999. Markov chain Monte Carlo algorithms for the Bayesian analysis of
phylogenetic trees. Molecular Biology and Evolution 16: 750-759.
https://doi.org/10.1093/oxfordjournals.molbev.a026160
Meléndez-Howell LM. 1970. Analyse, par decapage, du pore germinatif des spores Apiosordaria
verruculosa (Jensen) v. Arx et Gams. Annales des Sciences Naturelles 11: 153-168.
Nylander J. 2004. MrModeltest 2.2. Evolutionary Biology Centre. Uppsala University. Program
distributed by the author.
Posada D, Crandall K. 1998. Modeltest: testing the model of DNA substitution. Bioinformatics 49:
817-818. https://doi.org/10.1093/bioinformatics/14.9.817
Rostrup O, Ferdinandsen CCF, Buchwald NEF. 1916. Bidrag til Danmarks svampeflora I. Dansk
Botanisk Arkiv 2: 1-56.
Silvestro D, Ingo M. 2012. raxmlGUI: a graphical front-end for RAxML. Organisms Diversity &
Evolution 12: 335-337. https://doi.org/10.1007/s13127-011-0056-0
Stchigel AM, Cano J, Guarro J, Gugnani HC. 2000. A new Apiosordaria from Nigeria, with a key to
the soil-borne species. Mycologia 92: 1206-1209. http://dx.doi.org/10.2307/3761487
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. 1997. The CLUSTAL_X windows
interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.
Nucleic Acids Research 25: 4876-4882. https://doi.org/10.1093/nar/25.24.4876
Vilgalys R, Hester M. 1990. Rapid genetic identification and mapping of enzymatically amplified
ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172: 4238-4246.
https://doi.org/10.1128/jb.172.8.4238-4246.1990
Warcup J. 1951a. The ecology of soil fungi. Transactions of the British Mycological Society 34:
376-399. https://doi.org/10.1016/S0007-1536(51)80065-2
Warcup J. 1951b. Effect of partial sterilization by steam or formalin on the fungus flora of
an old forest nursery soil. Transactions of the British Mycological Society 34: 517-519.
https://doi.org/10.1016/S0007-1536(51)80036-6
White T, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in: MA Innis et al. (eds). PCR protocols: a guide to
methods and applications. San Diego, Academic Press.
https://doi.org/10.1016/B978-0-12-372180-8.50042-1
Zhang YJ, Zhang S, Liu XZ, Wen HA, Wang M. 2010. A simple method of genomic DNA extraction
suitable for analysis of bulk fungal strains. Letters in Applied Microbiology 51: 114-118.
https://doi.org/10.1111/j.1472-765X.2010.02867.x
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 © 2016. Mycotaxon, Ltd.
October-December 2016—Volume 131, pp. 859-869
http://dx.doi.org/10.5248/131.859
Discopycnothyrium palmae gen. & sp. nov. (Asterinaceae)
SINANG HONGSANAN?”, ALI H. BAHKALI?, PUTARAK CHOMNUNTI ””,
J1AN-Kut Liu*’, JUN-BoO YANG* & KEVIN D. HyDE*”?
"Institute of Excellence in Fungal Research, Mae Fah Luang University,
Chiang Rai, 57100, Thailand
? School of Science, Mae Fah Luang University, Chiang Rai, 57100, Thailand
° Department of Botany and Microbiology, College of Sciences, King Saud University,
Riyadh, KSA
* Germplasm Bank of Wild Species in Southwest China, Kunming Institute of Botany,
Chinese Academy of Science, Kunming 650201, Yunnan, China
* CORRESPONDENCE TO: [email protected]
ABSTRACT—A new genus and species, Discopycnothyrium palmae, is described from palms
(Arecaceae) in Narathiwat Province, southern Thailand, and is known only from its asexual
morph. The genus is characterized by circular pycnothyria with darkened cells around the
central ostiole, variably long hyphae at the margin, and pycnothyriospores that are 1-septate
with the septum between a larger brown upper cell and hyaline lower cell. LSU gene sequence
analysis clustered D. palmae in the Asterinaceae clade and supported (59% ML and 0.88 PP
support) the taxon as phylogenetically distinct from other Asterinaceae. Morphological and
phylogenetic differences confirm the new genus, here introduced and illustrated.
Key worps—Asterinales, foliar epiphytes, taxonomy
Introduction
The family Asterinaceae was introduced by Hansford (1946), with the
generic type Asterina Lév. (Miller & von Arx 1962, Luttrell 1973, Eriksson
1981, Hosagoudar 2004, Kirk et al. 2008, Hofmann 2010, Hyde et al. 2013,
Hongsanan et al. 2014). The family comprises biotrophs found on living plant
leaves and is distributed worldwide (Kirk et al. 2001, Barr & Huhndorf 2001,
Taylor et al, Hofmann et al. 2010, Hyde et al. 2013, Hongsanan et al. 2014).
While most previous studies focused on the morphology, Hofmann (2010)
provided the first molecular data of Asterinaceae that supported its phylogenetic
860 ... Hongsanan & al.
placement in Dothideomycetes and which were included in the phylogenetic tree
representing Asterinales sensu stricto (Hyde et al. 2013, 2016, Wijayawardene
et al. 2014). The order comprises a single family Asterinaceae, which contains
17 genera that are differentiated using both morphological and phylogenetic
characters (Hongsanan et al. 2014). The asexual morph in the family can be
either coelomycetous (Asterostomella) or hyphomycetous (Asterina), although
classification of the asexual morphs needs further clarification (Hyde et al. 2013,
Hongsanan et al. 2014). Redescription of the asexual morphs of Asterinaceae
(Hofmann 2010, Hosagoudar 2010) and key to genera by Hosagoudar (2010)
were based mainly on morphology and host association
In this study, we introduce a new genus Discopycnothyrium and its type
species D. palmae based on phylogeny, morphology, and host association.
Discopycnothyrium is an asexual morph genus that somewhat resembles
Asterostomula and Prillieuxina in its circular pycnothyria with radially
arranged cells. However, Asterostomula and Prillieuxina differ in having
pycnothyria with star-like or irregular openings and brown pycnothyriospores,
while pycnothyria in Discopycnothyrium have a central ostiole and 1-septate
pycnothyriospores comprising brown upper cells and hyaline lower cells. The
placement of Discopycnothyrium in Asterinaceae is also supported by rDNA
sequence analysis.
Materials & methods
An Asterinaceae-like specimen was collected from Narathiwat Province in the
southern part of Thailand. Morphological characters were observed under Nikon 80i
stereo and compound microscopes. Measurements were determined using Tarosoft (R)
Image Frame Work (v. 0.9.7). We attempted to isolate the specimen by using a single
spore technique (Chomnunti et al. 2011, 2014), but the spores did not grow in culture.
The fresh specimen was therefore dried in silica gel, and DNA was extracted directly
from pycnothyria. Type material was conserved in the Herbarium, Center of Excellence
in Fungal Research, Mae Fah Luang University, Chiang Rai, Thailand (MFLU), and the
Herbarium, Kunming Institute of Botany, Chinese Academy of Sciences, Kunming,
China (KUN).
Genomic DNA was extracted from dried pycnothyria using the E.Z.N.A° Forensic
Genomic DNA Extraction Kit (OMEGA Bio-tek Norcross GA 2013). Individual
pycnothyria were placed into 1.5 ml sterilized tubes and kept in -20 °C overnight, after
which DNA was extracted following the manufacturer's instructions.
Universal primers LR5 and LROR were successfully used to amplify the 28S rDNA
(LSU) region. The PCR thermal cycle program was: an initial cycle at 94°C for 3
min; 40 cycles of denaturation (94°C for 30 s), annealing (54°C for 40 s), elongation
(72°C for 1 min); final extension (72°C for 10 min). After visualization on 1% agarose
electrophoresis gels stained with ethidium bromide, the PCR products were sent to
Discopycnothyrium palmae gen. & sp. nov. (Thailand) ... 861
TABLE 1. Taxa used in the phylogenetic analysis: specimen codes and
GenBank accession numbers (LSU)
SPECIES
Apiosporina collinsii
Asterina cestricola
Asterina fuchsiae
Asterina phenacis
Asterina siphocampyli
Asterina sp.
Asterina weinmanniae
Asterina zanthoxyli
Discopycnothyrium palmae
Asterotexis cucurbitacearum
Chaetothyriothecium elegans
Coleroa robertiani
Fusicladium africanum
Fusicladium pini
Gibbera conferta
Gloniopsis praelonga
Gloniopsis subrugosa
Hysterium angustatum
Hysterobrevium smilacis
Lembosia albersii
Lichenothelia convexa
Microthyrium microscopicum
Natipusilla limonensis
Natipusilla naponensis
Oedohysterium insidens
Oedohysterium sinense
Protoventuria barriae
Psiloglonium araucanum
Psiloglonium clavisporum
Psiloglonium simulans
Rhytidhysteron rufulum
Sympoventuria capensis
Tyrannosorus pinicola
Venturia inaequalis
Veronaeopsis simplex
Zeloasperisporium siamense
VOUCHER/CULTURE
CBS 118973
TH 591
TH 590
TH589
ppMP 1324
MFLU13-0619
TH 592
TH 561
MFU13-0485
PMA M-0141224
CPC 21375
CBS 458.64
CPC 12828
CBS 463.82
CBS 191.53
CBS 112415
CBS:123346
CBS 236,34
CBS 114601
MFLU13-0377
L1608
CBS 115976
L_AF286_1A
PE3_2b
L_AF217_1A
CBS:238.34
CBS:123345
CBS 300.93
CBS:112412
CBS:123338
CBS:206.34
AFTOL-ID 2109
CPC 12840
CBS 120136
AFTOL-ID 1235
CBS 815.69
CBS 588.66
IFRDCC 2194
"LSU: 28s rDNA (Newly generated sequence in bold)
GENBANK NO.
GU301798
GU586215
GU586216
GU586217
HQ701140
KM386978
GU586218
GU586219
KM386979
HQ610510
KF268420
JQ036231
EU035423
EU035436
GU301814
FJ161173
FJ161210
FJ161180
FJ161174
KM386982
KC015085
GU301846
HM196370
JX474862
HM196371
FJ161142
FJ161209
JQ036232
FJ161172
FJ161197
FJ161178
FJ469672
DQ885904
KF156104
DQ470974
GU301878
EU041877
JQ036228
862 ... Hongsanan & al.
Majorbio Co., Ltd. (China) for purification and sequencing. The sequence generated for
Discopycnothyrium palmae was deposited in GenBank (KM386979).
Other LSU sequence data in this study were obtained from GenBank to compile the
dataset (TABLE 1), which represents Asterinaceae, Hysteriaceae Chevall., Microthyriaceae
Sacc., Mytilinidiaceae Kirschst., Natipusillaceae Raja et al., Sympoventuriaceae Y. Zhang
ter et al., and Venturiaceae E. Mill. & Arx ex M.E. Barr following the publications
by Schoch et al. (2009), Hyde et al. (2013), Boonmee et al. (2014), Hongsanan et al.
(2014), and Wijayawardene et al. (2014). Lichenothelia convexa Henssen was selected as
outgroup. Alignments were performed automatically using BioEdit v 7.1.9 and Clustal
X 2.0.11 (Thompson et al. 1997) and improved manually when necessary (Hall 2004).
Maximum likelihood analysis was performed in RAxML with raxmlGUIVv.0.9b2
(Silvestro & Michalak 2012); the search strategy was set to rapid bootstrapping and
carried out using GTRGAMMAI model of nucleotide substitution for a small dataset
to account for rate heterogeneity. The nucleotide substitution model was selected with
MrModel test 2.2 (Nylander 2008); the number of replicates was automatically inferred
using the stopping criterion (Pattengale et al. 2009). The evolution model was performed
with MrModeltest 2.2 (Nylander 2008). Posterior probabilities (PP) (Rannala & Yang
1996, Zhaxybayeva & Gogarten 2002) were determined by Markov Chain Monte
Carlo sampling (MCMC) in MrBayes (v. 3.0b4; Huelsenbeck & Ronquist 2001). Six
simultaneous Markov chains ran for 1,000,000 generations, with trees sampled every
100th generation. 10,000 trees were obtained; the first 2000 trees, representing the burn-
in phase were discarded, and the remaining 8000 trees were used to calculate posterior
probabilities; the default convergence criterion was set at 0.001 (Cai et al. 2006, 2008).
Phylogenetic trees were viewed in TreeView (v. 1.6.6; Page 2001). Maximum likelihood
bootstrap values higher than 50% are given as the first set of numbers above the nodes
(Fic. 2). Bayesian posterior probabilities (BYPP) equal or higher than 0.9 are given as
the second set of numbers above the nodes (Fic. 2).
Taxonomy
Discopycnothyrium Hongsanan & K.D. Hyde, gen. nov.
INDEX FUNGORUM IF551024
Differs from other genera in Asterinaceae by its pycnothyria with darker cells surrounding
a rounded central ostiole, and 1-septate pycnothyriospores with a hyaline lower cell.
TYPE SPECIES: Discopycnothyrium palmae Hongsanan & K.D. Hyde
EryMoLoecy: from Latin disco meaning “circular” or “plate-like”, and pycnothyrium
referring to the technical term for the type of fructification.
FACES OF FuNGI FoFoo0569
Foliar epiphytes. SUPERFICIAL MYCELIUM aseptate, pale brown to brown.
SEXUAL MORPH: undetermined. ASEXUAL MORPH: PYCNOTHYRIUM superficial
on the host surface, circular, walls comprising radially arranged cells, dark
brown, with central ostiole surrounded by dark cells. PERIpIuM poorly
Discopycnothyrium palmae gen. & sp. nov. (Thailand) ... 863
Fic 1. Discopycnothyrium palmae (MFLU 13-0485, holotype). A, B. Pycnothyria on surface of
host. C. Pycnothyrium when viewed in squash mounts. D. Pycnothyriospore arrangement in
pycnothyrium. E. Vertical section through pycnothyrium. F. Upper wall of pycnothyrium when
viewed in squash mounts. G. Darkened cells around ostiole. H. Aseptate hyphae without appressoria.
I, J. Conidiogenous cells giving rise to pycnothyriospores. K, M-O. Mature pycnothyriospore.
L. Immature pycnothyriospore. Bars: C-E = 100 um; K = 20 um; D, F-J, L-O = 10 um.
developed at the base. CONIDIOGENOUS CELLS holoblastic, cylindrical, hyaline.
PYCNOTHYRIOSPORES ovoid or broadly clavate, widest and rounded near the
apex and tapering towards lower end, 1-septate near the tapering base, upper
cell pale brown to brown, lower cell hyaline.
Discopycnothyrium palmae Hongsanan & K.D. Hyde, sp. nov. FIG. 1
INDEX FUNGORUM IF551023
Differs from other species in Asterinaceae by its darker brown cells surrounding a
rounded central ostiole, and its 1-septate pycnothyriospores with a hyaline lower cell.
864 ... Hongsanan & al.
Type: Thailand, Narathiwat Province, on the branches of palm (Arecaceae), September
2013, K.D. Hyde (holotype MFLU 13-0485; isotype KUN; GenBank KM386979).
Erymo ocy: Referring to the host palm on which the fungus was found.
FACES OF FuNGI FoFo0570
Foliar epiphytes on surface of palm leaves (Arecaceae). SUPERFICIAL MYCELIUM
1-2 um diam (x = 2 um, n = 10), aseptate, pale brown to brown, dark brown at
the margin, lacking appressoria and setae.
SEXUAL MORPH: Undetermined.
ASEXUAL MORPH: PYCNOTHYRIUM 162-195 um diam (x = 187 um, n = 10),
superficial on host surface, easily removed, mostly solitary, circular, hyphae of
different lengths at the margin, wall comprising radial cells, dark brown, with
central ostiole, and with darker cells around the central ostiole. PERIDIUM poorly
developed at the base. PPEUDOPARAPHYSES not observed. CONIDIOPHORES not
observed. CONIDIOGENOUS CELLS 6-8 x 2-3 um (x = 8 x 3 um, n=5), holoblastic
in cavity of pycnothyria, cylindrical, hyaline, smooth. PYCNOTHYRIOSPORES
18-22 x 12-15 um (x = 20 x 13 um, n = 10), ovoid or broadly clavate, widest
and rounded near the apex and tapering towards the lower end, 1-septate near
the tapering base, not constricted at the septum, upper cell with 2 layers when
immature, outer layer disappearing at maturity, pale brown in upper cell when
immature and dark brown at maturity with smooth-walls, lower cell always
hyaline, smooth-walled or sometimes rough.
Notes: Discopycnothyrium palmae is most similar to Asterostomula loranthi
Theiss. by having a superficial mycelium without appressoria and setae and
pycnothyrium walls composed of radial cells, but A. loranthi differs in the stellate
dehiscence of the pycnothyrium centers and its unicellular pycnothyriospores
(Hosagoudar 2010).
The new species also somewhat resembles the asexual morph of Prillieuxina,
which also has circular pycnothyria and dark pycnothyriospores with a single
septum, and a similar host association (Hofmann 2010), with P calami (Syd.
& P. Syd.) R.W. Ryan and P. saginata (Syd. & P. Syd.) R.W. Ryan also described
from arecaceous hosts. Prillieuxina differs from Discopycnothyrium by its
circular pycnothyria with X- or Y-shaped fissures at maturity and its 1-septate
pycnothyriospores with a brown (not hyaline) lower cell (Hongsanan et al.
2014).
Allothyrium marcgraviae Syd. also has circular pycnothyria but differs from
D. palmae by the star-like fissures of its pycnothyrial opening and its multi-
septate ascospores (Hongsanan et al. 2014). The LSU sequence analyses cluster
D. palmae in the clade of Asterinaceae but in its own lineage, with 59% ML and
0.88 PP support (Fic. 2), confirming it as a new genus.
Discopycnothyrium palmae gen. & sp. nov. (Thailand) ... 865
65091 terobrevium smilacis C&S 114601
530.96 tenum angustatum C&S 236.34
77,097, Psilogionium clavisporum C&8S.1233338
‘Psiloglonium areucanum C&8S.112412
; Psiloglonium simulans C8S:206.34 Hysteriaceae
FAG 71.0 loniopsis subrugosa C8S-12346
ess loniopsis praelonga CBS 112415
70 $6] 10001 Osdohystenum sinense C8S12345
Oedohystenum insidens C8S.236.34
Phytidhysteron rufulum AFTOLAD 2109
Asterotexis cucurbitacearum PMA M-0141224
Asterina fuchsiae TH $90
Asterina weinmanniae TH $82
Astenna sp. MFLU13-0619
6301
‘Asterina zanthoxyli TH $61 5 5
a i raxyl Asterinales sensu stricto
sai Asterina cesvicola TH $91
oe Asterina siphocampyli ppMP 1324
7 “- Asterina phenacis TH $9
Discopycnothyrium palmae MFU13-04S
Lembosia albersii MFLU13-0377
6191 $30.1 Chaetothyriothecium elegans CPC 21375
Microthyrium microscopicum C&S 115976
Zeloasperisporium siamense IFROCC 2194
1000.1 ,Natipusilla limonensis t_A=206_1A
1000.1 Natipusilla limonensis PE3_2 Hatipusillaceae
Natipusilla naponensis L_AF217_1A
Microthyriaceae
63! Tyrannosors pinicola AFTOLAD 1235
S40.93 Gibbere conferta CBS 191.53
$101 Ventuna inaequalis C&S 815.69 F
dogs | [— Calera robertiani Cas 45864 Venturiaceae
Apiosponna collinsii CBS 118873
590.91 “ Protoventunia bamiae CBS 30093
61 4000.1 )Sympoventuna capensis CPC 12640
1920 Sympoventuns capensis CBS 120136
sr! Fusicladium africanum CPC 12628
ane Fusicladium pini C&S 463.62
Veronaeopsis simplex C&S $33.66
Lichenothelia convexa Li60s
Sympoventuriaceze
me
Fic 2. RAxML maximum likelihood phylogenetic tree based on sequence analysis of LSU dataset.
The first set of numbers above the nodes are RAxML values >50%; the second set are Bayesian
posterior probabilities 20.9. Strain numbers are indicated after species names. The new species
introduced is in red bold, other types are in black bold.
Molecular phylogeny
LSU sequence data from six families (Hysteriaceae, Microthyriaceae,
Mytilinidiaceae, Natipusillaceae, Sympoventuriaceae, Venturiaceae) were
included in the phylogenetic analysis (Fic. 2). The Asterinaceae clade includes
six strains of Asterina: A. cestricola (R.W. Ryan) Hosag. & T.K. Abraham,
A. fuchsiae Syd., A. phenacis Syd., A. siphocampyli Syd., A. weinmanniae Syd.,
and A. zanthoxyli W. Yamam. The new taxon, Discopycnothyrium palmae,
forms a moderately supported (59% ML, 0.88 PP) clade sister to the other
Asterina species, supporting D. palmae as clearly separate from other species
in Asterinaceae. Moreover, Lembosia albersii Henn. (MFLU13-0377) forms a
well-supported clade basal to the other genera in Asterinaceae with high (99%
ML, 1.0 PP) bootstrap support.
The Microthyriaceae clade comprises two strains: Chaetothyriothecium
elegans Hongsanan & K.D. Hyde and Microthyrium microscopicum Desm.,
866 ... Hongsanan & al.
also with high (99% ML, 1.0 PP) bootstrap support. The Natipusillaceae clade
includes three strains of freshwater fungi: Natipusilla limonensis A. Ferrer
et al. (two strains) and N. naponensis A. Ferrer et al. with 100% ML and
1.0 PP support; although they are phylogenetically related to Zeloasperisporium
siamense Hongsanan et al., there is no morphological similarity between
Natipusilla and Zeloasperisporium, so these should be regarded as tentatively
placed lineages.
The Venturiaceae clade ) with high bootstrap support of 91% ML, 1.0 PP)
includes six representative strains—Apiosporina collinsii(Schwein.) Hohn.,
Coleroa robertiani (Fr.) E. Mull., Gibbera conferta (Fr.) Petr., Protoventuria
barriae Carris & A.P. Poole, Tyrannosorus pinicola (Petrini & PJ. Fisher)
Unter. & Malloch, and Venturia inaequalis (Cooke) G. Winter.The clade of
Venturiaceae—and is closely (66% ML support) related to the Sympoventuriaceae
clade with five strains: Sympoventuria capensis Crous & Seifert (two strains),
Fusicladium africanum Crous, F. pini Crous & de Hoog, and Veronaeopsis
simplex(Papendorf) Arzanlou & Crous.
Discussion
Discopycnothyrium (type species D. palmae) is introduced as a new genus
in the family Asterinaceae (characterised by a superficial pycnothyrium
comprising radiating cells) that differs from other genera in having circular
pycnothyria with variably long marginal hyphae, darkened cells around a
central ostiole, and pycnothyriospores that are widest near the apex, taper
towards lower end, and have one septum near the tapering base that separates
the larger pale brown to brown upper cell from the smaller hyaline basal cell.
There are limited sequence data for taxa in Asterinaceae because members of
this family are mostly obligate parasites/biotrophs, and pure cultures are difficult
to obtain; therefore direct DNA extraction and sequencing must be obtained
from specimen. However, sequence data from Asterina species do support the
Asterinaceae within Dothideomycetes (Hofmann 2010, Wu et al. 2011, Hyde
et al. 2013, Boonmee et al. 2014, Hongsanan et al. 2014, Wijayawardene et
al. 2014). Although phylogenetic LSU analyses of Discopycnothyrium cluster
D. palmae within the Asterinaceae clade, it is distinctly separate from other
genera in that clade. Bootstrap values are not high because of low number of
populations representing this group, and further study is needed to clarify the
divergence of the species. Based on
Nonetheless, both morphology and phylogeny supports the new taxon
as a species in a new genus within Asterinaceae, which we introduce here as
Discopycnothyrium.
Discopycnothyrium palmae gen. & sp. nov. (Thailand) ... 867
Acknowledgments
The authors extend their sincere appreciations to the Deanship of Scientific Research
at King Saud University for its funding this Prolific Research group (PRG-1436-9). We
thank the reviewers Hiran Ariyawansa (Guizhou Academy of Agricultural Sciences,
Guizhou University) and Ying Zhang (Institute of Microbiology, Beijing Forestry
University) for improving this manuscript.
Literature cited
Barr ME, Huhndorf SM. 2001. Loculoascomycetes. 283-305, in: DJ McLaughlin et al.
(eds). The Mycota: Systematics and Evolution, Part A, vol. VII. Springer, Berlin.
http://dx.doi.org/10.1007/978-3-662-10376-0_13
Boonmee S, Rossman AY, Liu JK, Li WJ, Dai DQ, Bhat JD, Jones EBG, McKenzie EHC, Xu JC, Hyde
KD. 2014. Tubeufiales, ord. nov., integrating sexual and asexual generic names. Fungal Divers.
68: 239-298. http://dx.doi.org/10.1007/s13225-014-0304-7
Cai L, Jeewon R, Hyde KD. 2006. Phylogenetic investigations of Sordariaceae
based on multiple gene sequences and morphology. Mycol. Res. 110: 137-150.
http://dx.doi.org/10.1016/j.mycres.2005.09.014
Cai L, Guo XY, Hyde KD. 2008. Morphological and molecular characterisation of a new
anamorphic genus Cheirosporium from freshwater in China. Persoonia 20: 53-58.
http://dx.doi.org/10.3767/003158508X3 14732
Chomnunti P, Schoch CL, Aguirre-Hudson B, KoKo TW, Hongsanan S, Jones EBG, Kodsueb
R, Chukeatirote E, Bahkali AH, Hyde KD. 2011. Capnodiaceae. Fungal Divers. 51: 103-134.
http://dx.doi.org/10.1007/s13225-011-0145-6
Chomnunti P, Hongsanan S, Aguirre-Hudson B, Tian Q, Persoh D, Dhami MK, Alias AS,
Xu J, Liu X, Stadler M, Hyde KD. 2014. The sooty moulds. Fungal Divers. 66: 1-36.
http://dx.doi.org/10.1007/s13225-014-0278-5
Eriksson O. 1981. The families of bitunicate ascomycetes. Nord. J. Bot. 1(6): 800-800.
http://dx.doi.org/10.1111/j.1756-1051.1981.tb01167.x
Hall TA. 2004. BioEdit. Ibis Therapeutics, Carlsbad, CA, 92008, USA
[http://www.mbio.ncsu.edu/BioEdit/bioedit.html (18 March 2005) ]
Hansford CG. 1946. The foliicolous ascomycetes, their parasites and associated fungi. Mycol.
Papers 15: 1-240.
Hofmann TA. 2010. Plant parasitic Asterinaceae and Microthyriaceae from the Neotropics
(Panama). PhD thesis. The faculty of biological sciences at the J.W. Goethe- University Frankfurt
am Main, Germany. 408 p.
Hongsanan S, Li YM, Liu JK, Hofmann T, Piepenbring M, Bhat JD, Boonmee S, Doilom M,
Singtripop C, Tian Q, Mapook A, Zeng XY, Bahkali AH, Xu JC, Wu XH, Yang JB, Hyde KD.
2014. Revision of genera in Asterinales. Fungal Divers. 68: 1-68.
http://dx.doi.org/10.1007/s13225-014-0307-4
Hosagoudar VB. 2010. Anamorphs of Asterinales. J. Theor. Biol. 6(3 and 4): 199-211.
Hosagoudar VB, Biju CK, Abraham TK. 2004. Studies on foliicolous fungi. J. Econ. Taxon. Bot.
28: 175-182.
Huelsenbeck JP, Ronquist F. 2001. MRBAYES: Bayesian inference of phylogenetic trees.
Bioinformatics 17(8): 754-755. http://dx.doi.org/10.1093/bioinformatics/17.8.754
Hyde KD, Jones EBG, Liu JK, Ariyawansa H, Boehm E, Boonmee S, Braun U, Chomnunti P, Crous
PW, Dai DQ, Diederich P, Dissanayake A, Doilom M, Doveri F, Hongsanan S, Jayawardena R,
Lawrey JD, Li YM, Liu YX, Licking R, Monkai J, Muggia L, Nelsen MP, Pang KL, Phookamsak
868 ... Hongsanan & al.
R, Senanayake I, Shearer CA, Suetrong S, Tanaka K, Thambugala KM, Wijayawardene NN,
Wikee S, Wu HX, Zhang Y, Aguirre-Hudson B, Alias SA, Aptroot A, Bahkali AH, Bezerra JL,
Bhat DJ, Camporesi E, Chukeatirote E, Gueidan C, Hawksworth DL, Hirayama K, Hoog SD,
Kang JC, Knudsen K, Li WJ, Li XH, Liu ZY, Mapook A, McKenzie EHC, Miller AN, Mortimer
PE, Phillips AJL, Raja HA, Scheuer C, Schumm F, Taylor JE, Tian Q, Tibpromma S, Wanasinghe
DN, Wang Y, Xu JC, Yan JY, Yacharoen S, Zhang M. 2013. Families of Dothideomycetes. Fungal
Divers. 63: 1-313. http://dx.doi.org/10.1007/s13225-013-0263-4
Hyde KD, Hongsanan §, Jeewon R, Bhat DJ, McKenzie EHC, Jones EBG, Phookamsak R, Ariyawansa
HA, Boonmee S, Zhao Q, Abdel-Aziz FA, Abdel-Wahab MA, Banmai S, Chomnunti P, Cui BK,
Daranagama DA, Das K, Dayarathne MC, de Silva NL, Dissanayake AJ, Doilom M, Ekanayaka
AH, Gibertoni TB, Gées-Neto A, Huang SK, Jayasiri SC, Jayawardena RS, Konta S, Lee HB, Li
WJ, Lin CG, Liu JK, Lu YZ, Luo ZL, Manawasinghe IS, Manimohan P, Mapook A, Niskanen
T, Norphanphoun C, Papizadeh M, Perera RH, Phukhamsakda C, Richter C, de Santiago
ALCMA, Drechsler-Santos ER, Senanayake IC, Tanaka K, Tennakoon TMDS, Thambugala
KM, Tian Q, Tibpromma S, Thongbai B, Vizzini A, Wanasinghe DN, Wijayawardene NN, Wu
H, Yang J, Zeng XY, Zhang H, Zhang JF, Bulgakov TS, Camporesi E, Bahkali AH, Amoozegar
AM, Araujo-Neta LS, Ammirati JE, Baghela A, Bhatt RP, Bojantchev S, Buyck B, da Silva GA,
de Lima CLF, de Oliveira RJV, de Souza CAF, Dai YC, Dima B, Duong TTT, Ercole E, Mafalda-
Freire F, Ghosh A, Hashimoto A, Kamolhan S, Kang JC, Karunarathna SC, Kirk PM, Kytévuori
I, Lantieri A, Liimatainen K, Liu ZY, Liu XZ, Licking R, Medardi G, Mortimer PE, Nguyen
TTT, Promputtha I, Raj KNA, Reck MA, Lumyong S, Shahzadeh-Fazeli SA, Stadler M, Soudi
MR, Su HY, Takahashi T, Tangthirasunun N, Uniyal P, Wang Y, Wen TC, Xu JC, Zhang ZK,
Zhao YC, Zhou JZ, Zhu L. 2016. Fungal diversity notes 367-491: taxonomic and phylogenetic
contributions to fungal taxa. Fungal Divers. 81: 1-270.
Kirk PM, Cannon PF, David JC, Stalpers JA. 2001. Ainsworth & Bisby’s dictionary of the fungi, 9th
edn. CABI, Wallingford.
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Ainsworth & Bisby’s dictionary of the fungi,
10th edn. CABI, Wallingford.
Luttrell ES. 1973. Loculoascomycetes. 135-219, in: GC Ainsworth et al. (eds). The fungi: an advanced
treatise. Academic Press.
Miller E, von Arx JA. 1962. Die Gattungen der didymosporen Pyrenomycten. Beitr. Kryptogamenfl.
Schweiz 11(2). 992 p.
Nylander JAA, Wilgenbusch JC, Warren DL, Swofford DL. 2008. AWTY (are we there yet?): a system
for graphical exploration of MCMC convergence in Bayesian phylogenetics. Bioinformatics 24:
581-583. http://dx.doi.org/10.1093/bioinformatics/btm388
Omega Bio-tek. 2013. E. Z. N. A. Forensic DNA Kit. www.omegabiotek.com
Page RDM. 2001. TreeView: Tree drawing software for Apple Macintosh and Windows. Available
at http://taxonomy.zoology.gla.ac.uk/rod/treeview.html.
Pattengale ND, Alipour M, Bininda-Emonds ORP, Moret BME, Stamatakis A. 2009. How many
bootstrap replicates are necessary?. LNCS 5541: 184-200.
http://dx.doi.org/10.1089/cmb.2009.0179
Rannala B, Yang Z. 1996. Probability distribution of molecular evolutionary trees: a new method of
phylogenetic inference. J. Mol. Evol. 43: 304-311. http://dx.doi.org/10.1007/BF02338839
Schoch CL, Crous PW, Groenewald JZ, Boehm EWA, Burgess TI, de Gruyter J, de Hoog GS, Dixon
LJ, Grube M, Gueidan C, Harada Y, Hatakeyama S, Hirayama K, Hosoya T, Huhndorf SM,
Hyde KD, Jones EBG, Kohlmeyer J, Kruys A, Li YM, Liicking R, Lumbsch HT, Marvanova L,
Mbatchou JS, McVay AH, Miller AN, Mugambi GK, Muggia L, Nelsen MP, Nelson P, Owensby
CA, Phillips AJL, Phongpaichit S, Pointing SB, Pujade-Renaud V, Raja HA, Rivas Plata E,
Discopycnothyrium palmae gen. & sp. nov. (Thailand) ... 869
Robbertse B, Ruibal C, Sakayaroj J, Sano T, Selbmann L, Shearer CA, Shirouzu T, Slippers
B, Suetrong S, Tanaka K, Volkmann-Kohlmeyer B, Wingfield MJ, Wood AR, Woudenberg
JHC, Yonezawa H, Zhang Y, Spatafora JW. 2009. A class-wide phylogenetic assessment of
Dothideomycetes. Stud. Mycol. 64: 1-15. http://dx.doi.org/10.3114/sim.2009.64.01
Silvestro D, Michalak I. 2012. RaxmlGUI: a graphical front-end for RAxML. Org. Divers. Evol. 12:
335-337. http://dx.doi.org/10.1007/s13127-011-0056-0
Taylor A, ST Hardy GE, Wood P, Burgess T, 2005. Identification and pathogenicity of Botryosphaeria
species associated with grapevine decline in Western Australia. Australas. Plant Pathol. 34:
187-195. http://dx.doi.org/10.1071/AP05018
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. 1997. The CLUSTAL X windows
interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.
Nucleic Acids Res. 25: 4876-4882. http://dx.doi.org/10.1093/nar/25.24.4876
Wijayawardene NN, Crous PW, Kirk PM, Hawksworth DL, Boonmee S, Braun U, Dai
DQ, D’souza MJ, Diederich P, Dissanayake A, Doilom M, Hongsanan S, Jones EBG,
Groenewald JZ, Jayawardena R, Lawrey JD, Liu JK, Licking R, Madrid H, Manamgoda
DS, Muggia L, Nelsen MP, Phookamsak R, Suetrong S, Tanaka K, Thambugala KM, Wikee
S, Zhang Y, Aptroot A, Ariyawansa HA, Bahkali AH, Bhat DJ, Gueidan C, Chomnunti
P, De Hoog GS, Knudsen K, McKenzie EHC, Miller AN, Phillips AJL, Piatek M, Raja HA,
Shivas RS, Slippers B, Taylor JE, Tian Q. Wang Y, Woudenberg JHC, Cai L, Jaklitsch WM,
Hyde KD. 2014. Naming and outline of Dothideomycetes—2014. Fungal Divers. 69: 1-55.
http://dx.doi.org/10.1007/s13225-014-0309-2
Wu HX, Schoch CL, Boonmee S, Bahkali AH, Chomnunti P, Hyde KD. 2011. A reappraisal of
Microthyriaceae. Fungal Divers. 51(1): 189-248. http://dx.doi.org/10.1007/s13225-011-0143-8
Zhaxybayeva O, Gogarten JP. 2002. Bootstrap, Bayesian probability and maximum likelihood
mapping: exploring new tools for comparative genome analyses. BMC Genomics 3: 4.
http://dx.doi.org/10.1186/1471-2164-3-4
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 © 2016. Mycotaxon, Ltd.
October-December 2016— Volume 131, pp. 871-880
http://dx.doi.org/10.5248/131.871
Two new records of Agaricus from Southwest China
Mao-QIANG HE?”, JIE CHEN?* & RuI-LIN ZHAO'™*
'State Key Laboratory of Mycology, Institute of Microbiology,
Chinese Academy of Sciences, Beijing 100101, China
*Department of Entomology and Plant Pathology, Faculty of Agriculture,
Chiang Mai University, Chiang Mai 50200, Thailand
°Center of Excellence in Fungal Research & *School of Science,
Mae Fah Luang University, Chiang Rai 57100, Thailand
°College of Life Sciences, University of Chinese Academy of Sciences,
Huairou District, Beijing 100408, China
* CORRESPONDENCE TO: [email protected]
ABSTRACT—Two specimens of A. brunneosquamulosus (from China and Thailand) and four
specimens of A. duplocingulatus (from China) were identified and studied by morphological
and ITS sequence analyses. They are presented here with descriptions, line drawings, and
color photographs as new records for China. Our additional molecular sampling of A.
duplocingulatus has revealed intraspecific variability within this species.
KEY WORDS—Agaricaceae, rDNA, taxonomy
Introduction
Agaricus L. is a well-known genus containing species with a high nutritional
and medicinal value, such as the famous cultivated mushrooms A. bisporus
(J.E. Lange) Imbach and A. subrufescens Peck. Zhao et al. (2011) recognized
386 species in this cosmopolitan genus, a number that has subsequently risen
to over 400 with the discovery of numerous novel taxa from Asia, Australia,
and Europe (Chen et al. 2012, Gui et al. 2015, Lebel 2013, Lebel & Syme 2012,
Li et al. 2014, Parra 2013, Zhao et al. 2012). Eight sections were traditionally
recognized in the genus, long classified based on temperate species (Challen et
al. 2003; Kerrigan et al. 2005; Kerrigan et al. 2008; Parra 2008, 2013). However,
following a phylogenetic study of samples from both temperate and tropical
872 ... He, Chen & Zhao
regions by Zhao et al. (2011), eleven new lineages comprising tropical or
subtropical taxa were revealed.
One new clade determined by Zhao et al. (2011) has been phylogenetically
reconstructed and identified as corresponding with Agaricus sect. Brunneopicti
Heinem. (Chen et al. 2015). The section has been delimited to accommodate
species that combine the following morphological characters: punctiform
squamulose remnants of the universal veil or brownish larger squamules on
pileus surface; a double or complex annulus with cortinate fibrils on the under
side; context when bruised discoloring faint to strong yellow, orange, rufescent,
brownish rufescent, or red; odor of bitter almond, phenol, or solvent; a positive
KOH reaction, and a negative or (rarely) weakly positive Schaffer’s reaction
(Chen et al. 2015). The section, which has a strictly palaeotropical distribution,
contains 16 species.
Southwestern China is known as home to glacial refugia and plays an
important role in postglacial biological recolonization. In order to reveal the
species spreading patterns and biodiversity of Agaricus, since 2010 we have
conducted a series of investigations in this area during the July-August rainy
season. As one result, two representatives of A. sect. Brunneopicti—Agaricus
brunneosquamulosus and A. duplocingulatus—are newly recorded from China.
Materials & methods
Morphological study
Specimens were collected in Yunnan Province, China, during the rainy season.
Photographs were taken immediately in the field. Each specimen was wrapped in
aluminum foil or kept separate in a plastic collection box. Macroscopic characters were
recorded and chemical tests were performed immediately after the specimens reached
the laboratory according to Largent (1986). The specimens were dried completely at
70°C in a food drier, sealed in plastic bags, and deposited in the herbarium of Southwest
Forestry University, Kunming, China (SWFC), with duplicates in Herbarium,
Mycologicum Academiae Sinicae, Beijing, China (HMAS). An additional specimen
from Thailand (deposited in HMAS) was included in the study.
Following the methodology described by Largent (1986), microscopical features
(basidiospores, basidia, cystidia, pileipellis, annulus hyphae) of each dried specimen
were examined. At least 20 measurements were made to calculate the dimensions
presented as follows: X = the means + SDs of length x width, Q = basidiospore length :
width ratio, and Q. = the mean + SD of Q values.
DNA extraction, PCR, and sequencing
DNA was extracted from the dried fruiting bodies using the E.Z.N.A. Forensic
DNA Extraction Kit (D3591-01, Omega Bio-Tek). The internal transcribed spacer (ITS)
regions were amplified with the primers ITS4 and ITS5 following the protocol of White
et al. (1990). DNA sequencing was performed in commercial biotechnology company.
Agaricus species new for China... 873
TABLE 1. Agaricus specimens included in the phylogenetic analyses.
SPECIES
A. sp. 1
A, sp. 2
A. sp. 3
A
. bingensis
A. niveogranulatus
A. chiangmaiensis
A. brunneopunctatus
A. toluenolens
sp. 4
sordidocarpus
subsaharianus
sp. 5
Si hat ge
megacysidiatus
A. sp. 6
A. brunneosquamulosus
A. cf. inoxydabilis
A. duplocingulatus
SAMPLE
C3182
LD2011027
ZRLwxh3115
ADK1992
C3155
LD2011025
LD2011023
LD2011024
PYP009
NTS113
ADK2564
CA911
CA926
NTT117
LD201237
ADK4732
CA800
LD2012168
LD2012179
NTS115
NTS116
NTO19
NTT118
LD201238
ZRL3005
ZRL4017
LD2012105
ZRL133
ZRL2013266
LAPAFI1
ZRL3064
CA903
LD2012177
LD201218
LD201233
LD201274
LD201275
ZRL3031
ZRL3041
NTT34
ZRL2013328
ZRL2012267
ZRL2012120
ZRL2013348
ORIGIN
Togo
Thailand
China
Bénin
Togo
Thailand
Thailand
Thailand
Thailand
Thailand
Bénin
Thailand
Thailand
Thailand
Thailand
Burkina-Faso
Thailand
Thailand
Thailand
Thailand
Thailand
Thailand
Thailand
Thailand
Thailand
Thailand
Thailand
Thailand
China
Togo
Thailand
Thailand
Thailand
Thailand
Thailand
Thailand
Thailand
Thailand
Thailand
Thailand
China
China
China
China
ITS SEQUENCE
KJ540955
KJ540955
KR812336
KJ540954
KJ540950
KJ540957
KJ540958
KJ540959
KJ540960
JF514513
JF514518
KJ540947
KJ540948
JF514534
KJ540946
JF440300
JE727826
KF305947
KF305946
KC971098
JF514532
JE727844
KJ540970
KJ540969
KR869107
JF691549
KJ540968
KR812337
KR812340
JF727841
KR869108
KJ540962
KJ540961
KJ540967
KJ540965
KJ540963
KJ540964
JF691550
KR869109
JF514536
KR812341
KR812339
KR812338
KR812342
874 ... He, Chen & Zhao
Phylogenetic analyses
Our original sequences plus those retrieved from GenBank (TaBLE.1) were first
aligned using ClustalX 2.0 (Thompson et al. 1997) and then manually adjusted in
BioEdit v.7.0.4 (Hall 2007). Bayesian analysis was performed with MrBayes 3.1.2
(Ronquist & Huelsenbeck 2003). One million generations using a GIR+I+G model
nucleotide substitution detected by MrModeltest 2.2 (Nylander 2004) were run for
six Markov chains and sampled every 100th generation resulting in 10,000 trees.
Maximum Parsimony analysis was performed using PAUP*4.0b10 (Swofford 2004).
One thousand heuristic searches were conducted with random sequence addition,
tree bisection-reconnection (TBR) branch swapping, and gaps treated as missing data.
Parsimony bootstrap values were obtained from 1000 bootstrap replicates, with starting
trees obtained via stepwise addition, random sequence addition, and max-trees set to
1,000,000.
1.0/100 7m ©3182 Agaricus sp. |
1/99 LD2011027 Agaricus sp. 2
ZRLwxh3115 Agaricus sp. 3
1.0/99 - ADK1992 A. bingensis
C3115 A. bingensis
10/77 o.q¢af” LD2011025 A. niveogranulatus
1 ooo PoP D201 1023 A. niveogramulatus
- LD2011024 A. niveogramiatus
0.9/8] CA954 PY P009 A. niveogranuatis
1.0/94 NTS113 A. chiangmaiensis T
-/59 ADK2564 A. bpuleopeeaees
1.0/100 -CA9I1 A. foluenolens T
CA926 A. toluenolens
NTT117 Agaricus sp. 4
1.0/92 LD201237 A. sordidocarpus
ADK4732 A. subsaharianus T
CA800 Agaricus sp. 5
LD2012168 4. megacystidiatus
10/100 LD2012179 A. megacystidiatus
- NTS11S A. megacystidiatus
NTS 116 4. megacystidiatus
NTO19 Agaricus sp. 6
NTT1L18 A. brunneosquamulosus
LD201238 A. brameosquamulosus
10/79 ZRL3005 A. breemeosquamulosus
-/59 Pl ZRL4017 A. briemeasquanndosus
1.0/96 1 LD2012105 4. dbrunneosquamulosus T
15) a ZRL133 A. brunneosquamilosus
ZRL2013266 A. brinneosquamulosus
LAPAFI A. cf. inoxydabilis
ZRL3064 A. duplocingulatus
1.0/100 CA903 A. duplocingulatus
LD2012177 4. duplocingulatus
LD201218 A. duplocingudlatus
1.09/99 LD201233 A. duplocingulatus
LD201274 A. duplocingulatus
LD201275 A. duplocingulatus
ZRL3031 A. duplocingudatus
ZRL3041 A. duplocingulatus
NTT34 A. duplocingulatus
ZRL2013328 A. duplocingulatus
~/881 7RL2012267 A. Glace lates
ZRL2012120 A. duplocingulatus
ZRL2013348 A. duplocingulatus
1.0/100
CA637 A. campestris
0.2
Figure 1. Phylogeny of Agaricus sect. Brunneopicti generated from MrBayes analysis of ITS
sequences rooted with A. campestris. New sequences are set in bold font. Bayesian posterior
probability (PP) values >0.9, and parsimony bootstrap support (BS) values >50% are given at the
nodes.
Agaricus species new for China... 875
Results
Phylogenetics analyses
The dataset comprised 45 sequences representing 17 species with A. campestris
as outgroup (Zhao et al. 2011). The final alignment comprised a total of 663
characters, of which 517 were constant, 39 parsimony-uninformative, and
107 parsimony-informative. The phylogenetic trees generated by MP and
Bayesian methods exhibited very similar topologies, with the Bayesian tree
shown in Fic.1. Collections ZRL2013266 (from China) and ZRL133 (from
Thailand) clustered in the A. brunneosquamulosus clade with strong support
(1/96); and Chinese collections ZRL2013328, ZRL2012267, ZRL2012120, and
ZRL2013348 grouped with NTT34 (from Thailand; Zhao et al. 2011) in the
A. duplocingulatus clade with strong support (1/99).
Taxonomy
FIGURE 2. Agaricus brunneosquamulosus (ZRL2013266):
a. Pileipellis; b. Basidiospores; c. Basidia; d. Cheilocystidia.
Agaricus brunneosquamulosus L.J. Chen, R.L. Zhao, K D. Hyde & Callac,
Phytotaxa 192(3): 154 (2015). Fics 2, 4A,B
Macroscopical characters: PILEUs 26 mm in diam, parabolic, convex, margin
decurved; surface dry, with appressed triangular fibrillose squamules, light
brown to brown against white background; LAMELLAE free, crowded, pink to
brown, 3 mm broad, with 3 series of lamellulae. StrPE 60 x 8-16 mm (at base),
thickening towards the base, with long rhizomorphs; surface white, covered
by fine fibrils; context narrow, hollow. ANNuLUus double (two adhering layers):
upper layer a membranous remnant of the partial veil, rigid, pendant, white,
876 ... He, Chen & Zhao
<21 mm diam, 3 mm thick; bottom layer a fibrillose-membranous remnant of
the universal veil, fragile; white above and with brown fibrils below. CONTEXT
3 mm thick, white; discoloration indistinct when touched, none when cut.
Odor not noted.
Macrochemical reactions: KOH—slightly yellow. Schaffer’s reaction—
negative.
Microscopical characters: BASIDIOSPORES 4.1-5.6 x 2.8-3.7 um, [X = 4.8 +
0.4 x 3.3 + 0.3 um, Q = 1.21-1.65, Q_ = 1.47 + 0.13, n = 20], ellipsoid, smooth,
brown, thick-walled. Bastp1a 4-spored, 18.5-30.6 x 5.9-8.7 um, narrowly
clavate to clavate, hyaline, smooth. CHErLocystip1a 14.6-27.6 x 10.9-25.3 um,
pyriform, clavate to broadly clavate, basally septate or catenulate with 2-3
ellipsoid to subspherical cells in chain, hyaline, smooth. PLEUROCYSTIDIA
absent. PILEIPELLIS a cutis, hyphae 4.3-11.5 um diam, cylindrical, light brown,
smooth, sometimes slightly constricted at the septa.
Hasir: Solitary in forest.
SPECIMENS EXAMINED: CHINA, YUNNAN PRovINcE, Teng Chong County, Laifeng
Mountain, 18 July 2013, Zhou Junliang, ZRL2013266 (HMAS, SWFC; GenBank
KR812340). THAILAND, CHIANG Mal! PROVINCE, Mae Taeng District, Ban Pha Deng
Village, Mushroom Research Centre, 15 May 2008, Zhao Ruilin, ZRL133 (HMAS;
GenBank KR812337).
¢ _10um d Sum
FIGURE 3. Agaricus duplocingulatus (ZRL2013328):
a. Basidiospore; b. Basidia; c. Pileipellis; d. Cheilocystidia.
Agaricus duplocingulatus Heinem., Bull. Jard. Bot. Natl. Belg. 50: 32 (1980). Fras 3,
4C-H.
Macroscopical characters: PiLEus 27-87 mm diam, convex, margin
decurved when young, becoming straight when mature; surface dry, covered
Agaricus species new for China... 877
ww
5mm & 10mm ‘
f
10mm 4a K 10mm 20mm
“Wy
Figure 4. A. brunneosquamulosus (a, b: ZRL2013266). Habit.
A. duplocingulatus (c, d: ZRL2012120; e, f: ZRL2012267; g, h: ZRL2013328). Habit.
with reddish brown appressed fibrillose squamules on a white background;
squamules congregated on the disc and concentrically arranged elsewhere;
fibrillose or mud-cracked [areolate?]; surface becoming dull red when wet.
LAMELLAE free, crowded, lamellulae in 5 tiers, 1-6 mm broad, pink when
young, brown when mature. STIPE 30-43 x 4-9 mm, cylindrical with enlarged
(4-23 mm diam) base, with rhizomorphs, hollow; surface silky; white, turning
reddish brown when bruised or cut. ANNULUs double, two separate layers: upper
layer wider (47 mm diam), persistent, membranous, white, smooth above and
fibrillose to floccose below; lower layer, narrower (12 mm diam), bracelet-like,
fugacious, movable, white and floccose above, smooth with a brown margin
below. CONTEXT 4 mm broad, firm; discoloration variable: distinctly yellow
when touched and red when cut or no discoloration when touched or cut. Odor
almond-like.
Macrochemical reactions: KOH reaction yellow. Schaffer’s reaction negative.
Microscopical characters: BASIDIOSPORES 4.5-6.5 x 3.6-4.5 um [X =
5.7 + 0.3 x 4.0 + 0.2 um, Q = 1.30-1.7, Q. = 1.40 + 0.10, n = 20], ellipsoid,
smooth, brown, thick-walled. Basip1a 4-spored, 14.5-19.3 x 4.9-7.5 um,
878 ... He, Chen & Zhao
clavate, hyaline, smooth. CHEILOCysTIDIA 14.2-27.3 x 8.1-19.6 um, globular
to pyriform, hyaline, smooth. PLEUROCysTIpDIA absent. PILEIPELLIS a cutis,
hyphae 2.3-7.0 um diam, cylindrical, light brown, smooth, slightly constricted
at the septa.
Hasir: Solitary in forest.
SPECIMENS EXAMINED: CHINA, YUNNAN PROVINCE, Ying Jiang County, Tong Biguan
National Natural Reserve, 19 July 2013, Yu Qinghua, ZRL2013328 (HMAS, SWFC;
GenBank KR812341); 20 July 2013, Yu Qinghua, ZRL2013348 (HMAS, SWFC; GenBank
KR812342); Cang Yuan county, Nan Gunhe National Natural Reserve, 7 July 2012, Zhao
Ruilin, ZRL2012120 (HMAS, SWFC; GenBank KR812338); An Kang Village, 11 July
2012, Philippe Callac, ZRL2012267 (HMAS, SWFC; GenBank KR812339).
Discussion
Agaricus brunneosquamulosus, originally described from Thailand,
is characterized by small sporocarps, tiny ferruginous brown appressed
triangular squamules on the pileus surface, and a complex annulus with
woolly scales and cortinate fibrils on its lower surface (Chen et al. 2015). The
Chinese material generally agrees with original description, except for the
uncertain annulus morphology of annulus and occasional presence of short
catenulate cheilocystidia. These annular and cheilocystidial differences may be
due to the immaturity of the Chinese collection. The ITS sequence alignment
does indeed show a five nucleotide difference between the Thai and Chinese
collections; however, all the differences are transition mutations (T/C or A/G),
polymorphisms commonly observed in intraspecific variation (Zhang et al.
2009, Yadav 2014). In the absence of significant morphological differences
between the Thai and Chinese material, we for the time recognize the Chinese
material as A. brunneosquamulosus. Collection of more young to mature
materials in near future will undoubtedly refine our determination.
Agaricus duplocingulatus, first described from Singapore and recently
reported from Thailand, is characterized by brown ferruginous appressed
squamules on the pileus surface, a double annulus with the lower one movable,
an ochraceous to reddish discoloration when cut or bruised, and catenulate
cheilocystidia (Heinemann 1980, Chen et al. 2015). The four Chinese
collections, which generally match the species circumscription, are more
variable in sporocarp size (pileus 27-87 mm diam). Comparison of the ITS
sequences reveals nucleotides that differ at four polymorphic positions in
more than 16 positions, also by Chen et al. (2015). This degree of intraspecific
variability is rarely observed in Agaricus, and multi-gene analysis may be
helpful in determining whether A. duplocingulatus represents a complex of
species. Presently, we adopt the identification by Chen et al. (2015).
Agaricus species new for China... 879
Acknowledgements
This work was supported by grants from the National Natural Science Foundation
of China to RLZ (Project IDs 31470152 and 31360014) and the Opening Foundation
of State Key Laboratory of Mycology, Microbiology of Institute, Chinese Academy of
Sciences. The authors wish to thank Kanad Das (Cryptogamic Unit, Botanical Survey of
India, Howrah) and Samantha C. Karunarathna (World Agroforestry Centre (ICRAF),
Kunming Institute of Botany, China) for presubmission review.
Literature cited
Challen MP, Kerrigan RW, Callac P. 2003. A phylogenetic reconstruction and emendation of
Agaricus section Duploannulatae. Mycologia 95(1): 61-73. http://dx.doi.org/10.2307/3761962
Chen J, Zhao RL, Karunarathna SC, Callac P, Raspé O, Bahkali AH, Hyde KD. 2012. Agaricus
megalosporus: a new species in section Minores. Cryptogamie, Mycologie 33: 145-155.
http://dx.doi.org/10.7872/crym.v33.iss2.2012.145
Chen J, Zhao RL, Parra LA, Guelly AK, De Kesel A, Rapior S$, Hyde KD, Chukeatirote E, Callac P.
2015. Agaricus section Brunneopicti: a phylogenetic reconstruction with descriptions of four
new taxa. Phytotaxa 192(3): 145-168. http://dx.doi.org/10.11646/phytotaxa.192.3.2
Gui Y, Zhu GS, Callac P, Hyde KD, Parra LA, Chen J, Yang TJ, Huang WB, Gong GL, Liu ZY. 2015.
Agaricus section Arvenses: three new species in highland subtropical Southwest China. Fungal
Biology 119: 79-94. http://dx.doi.org/10.1016/j.funbio.2014.10.005
Hall T. 2007. BioEdit v7. Available from: http://www.mbio.ncsu.edu/BioEdit/BioEdit.html
Heinemann P. 1980. Les genres Agaricus et Micropsalliota en Malaisie et en Indonésie. Bulletin du
Jardin Botanique National de Belgique 50: 3-68. http://dx.doi.org/10.2307/3667774
Kerrigan RW, Callac P, Guinberteau J, Challen MP, Parra LA. 2005. Agaricus section Xanthodermatei:
a phylogenetic reconstruction with commentary on taxa. Mycologia 97: 1292-1315.
http://dx.doi.org/10.3852/mycologia.97.6.1292
Kerrigan RW, Callac P, Parra LA. 2008. New and rare taxa in Agaricus section Bivelares
(Duploannulati). Mycologia 100: 876-892. http://dx.doi.org/10.3852/08-019
Largent DL. 1986. How to identify mushrooms to genus, vols 1-5. Mad River Press, CA USA.
Lebel T. 2013. Two new species of sequestrate Agaricus (section Minores) from Australia.
Mycological Progress 12: 699-707. http://dx.doi.org/10.1007/s11557-012-0879-x
Lebel T, Syme A. 2012. Sequestrate species of Agaricus and Macrolepiota from Australia: new
species and combinations and their position in a calibrated phylogeny. Mycologia 104:
496-520. http://dx.doi.org/10.3852/11-092
Li SE, Xi YL, Qi CX, Liang QQ, Wei SL, Li GJ, Zhao D, Li SJ, Wen HA. 2014. Agaricus taeniatus sp.
nov., anew member of Agaricus sect. Bivelares from northwest China. Mycotaxon 129: 187-196
-http://dx.doi.org/10.5248/129.187
Nylander JAA. 2004. MrModeltest 2.2 Program distributed by the author. Uppsala University,
Evolutionary Biology Centre.
Parra LA. 2008. Fungi Europaei, Volume 1, Agaricus L.: Allopsalliota, Nauta & Bas, Candusso
Edizioni.
Parra LA. 2013. Fungi Europaei, Volume 1A, Agaricus L.: Allopsalliota, Nauta & Bas, Candusso
Edizioni.
Ronquist F, Huelsenbeck JP. 2003. MrBayes3: Bayesian phylogenetic inference under mixed
models. Bioinformatics 19: 1572-1574.
Swofford DL. 2004. PAUP*: phylogenetic analysis using Parsimony, Version 4.0b10. Sinauer,
Sunderland.
880 ... He, Chen & Zhao
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG.1997. The ClustalX windows
interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.
Nucleic Acids Research 25: 4875-4882. http://dx.doi.org/10.1093/nar/25.24.4876
White TJ, Bruns T, Lee S, Taylor JW.1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in: MA Innis MA et al. (eds). PCR protocols: a guide to
methods and applications. Academic, New York.
http://dx.doi.org/10.1016/B978-0-12-372180-8.50042-1
Yadav MC. 2014. DNA markers reveal genome-wide variations in the strains of button mushroom
(Agaricus bisporus). Proceedings of the 8th International Conference on Mushroom Biology
and Mushroom Products (ICMBMP§8).
Zhang YJ, Xu LL, Zhang S, Liu XZ, An ZQ, Wang M, Guo YL. 2009. Genetic diversity
of Ophiocordyceps sinensis, a medicinal fungus endemic to the Tibetan Plateau:
implications for its evolution and conservation. BMC Evolutionary Biology 9: 290.
http://dx.doi.org/10.1186/1471-2148-9-290
Zhao RL, Karunarathna S, Raspé O, Parra LA, Guinberteau J, Moinard M, De Kesel A, Barroso R,
Courtecuisse R, Hyde KD, Guelly AK, Desjardin DE, Callac P. 2011. Major clades in tropical
Agaricus. Fungal Diversity 51: 279-296. http://dx.doi.org/10.1007/s13225-011-0136-7
Zhao RL, Hyde KD, Desjardin DE, Raspé O, Soytong K, Guinberteau J, Karunarathna SC,
Callac P. 2012. Agaricus flocculosipes sp. nov., a new potentially cultivatable species from the
palaeotropics. Mycoscience 53(4): 300-311. http://dx.doi.org/10.1007/s10267-011-0169-5
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 © 2016. Mycotaxon, Ltd.
October-December 2016— Volume 131, pp. 881-887
http://dx.doi.org/10.5248/131.881
Entoloma ochreoprunuloides from Italy, with notes
on its geographical distribution and allied species
FRANCESCO DOVANA!, ALFREDO VIZZINI' , FABRIZIO BOCCARDO?,
MARCO MUCCIARELLI: & MARCO CLERICUZIO?
‘Department of Life Sciences and Systems Biology, University of Torino,
Viale P.A. Mattioli 25, 10125 Torino, Italy
’Via Filippo Bettini 14/11, I-16162 Genova, Italy
° Dipartimento di Scienze dell Ambiente e della Vita (DISIT), Universita del Piemonte Orientale, Via
T: Michel 11, 15121 Alessandria, Italy
* CORRESPONDENCE TO: alfredo. [email protected]
ABSTRACT—An Italian collection of E. ochreoprunuloides |= E. prunuloides var. obscurum] is
described. The specimen was identified by means of morphology, and by the analysis of its
nrITS sequence. The European distribution of the species is also discussed. The sequence from
a single Italian specimen of E. luteobasis suggests that E. luteobasis and E. ochreoprunuloides
may be conspecific.
Key worps—Basidiomycota, Agaricomycetes, tricholomatoid clade, taxonomy
Introduction
Entoloma (Fr. ex Rabenh.) P. Kumm. is a large genus of Agaricomycetes, with
worldwide distribution; more than 1500 taxa have been described (Morgado et
al. 2013). Until a few years ago, the systematics of Entoloma was based only on
morphological data (Noordeloos 1981, 1992, 2004), but recent studies based
on DNA sequences have started to appear in the literature (e.g., Co-David
et al. 2009; Baroni et al. 2011; Kokkonen 2015). The consequence of these
investigations is that the infrageneric subdivision is continuously evolving,
but this process is just at the beginning. For example, Noordeloos (1981, 1992,
2004) treats Entoloma as a single genus subdivided into several subgenera, while
Largent (1994) recognizes Entoloma sensu stricto and many segregate genera,
882 ... Dovana & al.
most corresponding to the subgenera used by Noordeloos. Recently Baroni et
al. (2011) proposed Entocybe T.J. Baroni et al. as a new genus that includes a few
select species from Entoloma subg. Entoloma and a few other anomalous species
previously placed in Rhodocybe sect. Rhodophana (Kihner) Singer. These taxa
produce bumpy spores reminiscent of those found in Rhodocybe and abundant
clamp connections that are not typical of Rhodocybe. Entocybe was erected for
a distinct clade in Entoloma subg. Entoloma based on both morphological and
molecular data.
At the species level, even some well-known species appear far more complex
when investigated at the molecular level. For example, Morgado et al. (2013)
focused on the subgenus Entoloma using a multigene approach (mtSSU, nrLSU,
rpb2, nrITS) to find that E. bloxamii (Berk. & Broome) Sacc., E. prunuloides
(Fr.) Quél., and E. sinuatum (Bull.) P. Kumm. each represent species complexes
containing different taxa when considered from a worldwide perspective.
Kokkonen (2015), who examined nrITS, nrLSU and rpb2 sequences of several
Entoloma taxa mainly in E. sect. Rhodopolia (Fr.) Noordel. (actually elevated at
subgeneric level), also proposed several novel taxa and combinations.
The present contribution concerns the E. prunuloides complex in E. sect.
Entoloma, a section characterised by small, somewhat isodiametric and
obscurely angular spores and pileipellis hyphae arranged as a simple cutis or
ixocutis. From a phylogenetic point of view, the species of this section form a
clade that appears basal to the bulk of the species in the Entoloma sensu lato
clade. Morgado et al. (2013) demonstrated that at least three different species
have been covered under the name “E. prunuloides”—(1) E. pseudoprunuloides
Morgado & Noordel., for a Canadian collection; (2) typical E. prunuloides,
probably with an exclusively European distribution; and (3) E. ochreoprunuloides
[= E. prunuloides var. obscurum], from France, Germany, and United Kingdom.
We here describe the finding of an Italian collection of E. ochreoprunuloides,
whose nrITS sequence was examined and confirmed as conspecific with the
holotype collection.
Materials & methods
Morphology
Fresh basidiomata were photographed in the field using a Nikon D80 digital camera.
Microscopic features were examined using a Nikon Eclipse E200 light microscope and
observations were made on mounts in Congo red, followed by 5% NH, solution.
DNA extraction, PCR amplification, and sequencing
DNA was extracted from two herbarium specimens (E. ochreoprunuloides TO 3327;
E. luteobasis WU 17842) with NaOH (Osmundson et al. 2013); 2 mg of dry sample
were homogenized in 250 ul of soda at 0.5M with a pestle. After 5 minutes to allow for
Entoloma ochreoprunuloides in Italy ... 883
sedimentation, 5 ul of the extract were removed and diluted in 195 ul of 100mM Tris-
HC] at pH 8.0, and 1 ul of the dilution was used as template DNA. The nrITS region was
amplified with primers ITS1F (Gardes & Bruns 1993) and ITS4 (White et al. 1990). PCR
was performed in 25 ul reaction volumes following Gardes & Bruns (1993).
PCR products were purified and sequenced by IGA Technology Services (Udine,
Italy).
Results
The ITS sequence of our Italian collection (TO 3327; GenBank KU984720)
shared 99% (582/583) of nucleotides with the German holotype of
E. ochreoprunuloides (L [E. Arnolds 01-142]; GenBank KC710092) and 100%
homology with two independent sequences from an Italian collection labelled
as E. luteobasis (WU 17842; GenBank KU984721 [this paper], LN850613
[Kokkonen 2015]).
Taxonomy
Entoloma ochreoprunuloides Morgado & Noordel., Persoonia 31: 171. 2013.
Figs 1A, C-F
= Entoloma prunuloides var. obscurum Arnolds & Noordel., Fungi Europaei
vol. 5a: 838. 2005 [non Entoloma obscurum Hesler 1967].
SELECTED ICONOGRAPHY: Noordeloos (2004; Pl. 1b, p. 1166), Morgado et al. (2013; Fig.
g 1-2, p. 168)
Description of the Tuscan collection (TO 3327)
Priteus 4-6.5 cm broad, convex, or even conico-convex when young, then
more applanate but with a consistently broad (sometimes acute) central umbo;
surface fibrillose (even strongly so), greasy; colour sepia brown to ochre, darker
in the center, lighter and more brown-yellow at the periphery; hygrophanous;
margin irregular, fimbriate, strongly involute, striate. LAMELLAE emarginate to
almost adnate, crowded, at first whitish or light grey, then pink. StrpE 5-9 x
0.5-1.4 cm, cylindrical, base ending in a distinctly tapered tip; longitudinally
fibrillose, concolourous with the pileus, whitish towards base. CONTEXT rather
thin in the pileus, thicker near the umbo, whitish; sMELL intensely mealy
(farinaceous), TASTE mealy.
SpoRES 6.0-7.6 x 5.4-7.1 um, av. 6.8 x 6.4 wm, Q = 1.0-1.17(-1.26), Q, = 1.08,
somewhat isodiametric, 4-5(-6)-angled, angles blunt under the light
microscope. Basip1A 27-40 x 7-11 um, 4-spored, clavate. HYMENOPHORAL
TRAMA made up of cylindrical to fusoid, parallel hyphae, 35-60 x 4-8 um.
PILEIPELLIS three-layered, with the outermost layer (suprapellis) an ixocutis
of very narrow (1.5-2.5 um diam) hyphae dispersed in a gelatinous matrix,
the middle layer (mediopellis) a cutis of parallel cylindrical hyphae (4-6 um
884 ... Dovana & al.
diam), and the bottom layer (subpellis) of broad, inflated hyphae measuring
25-50 x 15-25 um. Pigments pale, intracellular, diffuse. STIPITIPELLIS a cutis
of narrow (3-5 um diam) cylindrical hyphae. CAuLOcysTIDIA absent. CLAMP-
CONNECTIONS frequent in all tissues.
HasitaT densely gregarious to sub-cespitose in a broad-leaved wood
composed mainly of Quercus cerris L. (Turkey oak; Fagaceae) and Carpinus
betulus L. (hornbeam; Betulaceae).
MATERIAL STUDIED: Entoloma_ ochreoprunuloides: ITALY, Tuscany, Grosseto,
Scansano, Monte Auto, under Quercus cerris and Carpinus betulus, 6.11.2013, legit M.
Clericuzio (TO 3327; GenBank KU984720).
ADDITIONAL MATERIAL STUDIED: Entoloma luteobasis: ITALY, APULIA, Foggia, Vieste,
Val del Tesaro, under Q. cerris, 16.11.1997, legit A. Hausknecht & F. Reinwald (WU
17842; GenBank KU984721)
Discussion
The Italian collection of E. ochreoprunuloides was made by one of us (MC)
in Tuscany (Italy) in a mixed hardwood forest. The micro-morphologic
data revealed small, rather rounded isodiametric spores averaging ca. 7 um;
pileipellis hyphae arranged in an ixocutis; abundant clamp-connections; and
broad inflated hyphae in the subpellis and hymenophoral trama. All these
data supported it as a species of Entoloma sect. Entoloma (sensu Noordeloos
1981, 1992, 2004). From a macro-morphological point of view, the basidiomes
recalled the E. prunuloides group but differed from those of a typical
E. prunuloides not only in pileus colour—sepia ochraceous rather than whitish—
but also for their slender aspect (quite unlike the stout and fleshy basidiomes of
E. prunuloides; Noordeloos 1992, 2004). This collection was therefore assigned
to E. prunuloides var. obscurum, a variety described in 2004 and later raised to
species rank and renamed as E. ochreoprunuloides (Morgado et al. 2013).
The morphologically closest species to E. ochreoprunuloides is E. luteobasis
Ebert & E. Ludw. (described from Germany and Italy), which differs mainly
by its slightly to distinctly yellow or ochraceous stipe base (Ebert et al. 1992,
Noordeloos & Hausknecht 1998, Noordeloos 2004). Because the holotype of E.
luteobasis is missing from the Leiden herbarium (L; Nicolien Sol, pers. comm.),
we turned to an Italian collection of E. luteobasis (WU 17842) described in
Noordeloos & Hausknecht (1998) and Noordeloos (2004). Our ITS sequence
analyses revealed that this collection is conspecific with E. ochreoprunuloides.
This suggests that E. luteobasis (proposed in 1992) might be considered an
earlier name for E. ochreoprunuloides (published in 2013). However, additional
collections and sequences of both taxa and further phylogenetic analyses will
be required to test this potential synonymy.
Entoloma ochreoprunuloides in Italy ... 885
Fig. 1. Entoloma ochreoprunuloides (TO 3327). A. Habit. B. Map of E ochreoprunuloides
distribution. C. Pileipellis. D. Spores: E. Basidia. E. Spores (in water). Scale bars: A = 1 cm;
C-F = 10 um.
From a morphological point of view, delimiting species in the E. prunuloides-
bloxamii group is no easy task. Morgado et al. (2013) published a box plot
of spore dimensions for all the species of the group that showed
E. ochreoprunuloides spores as among the smallest in the whole section.
However, our Tuscan collection falls within the limits of spore size and shape
for the species (5.9-7.1 x 5.7-7.2 um, Q = 1.0-1.16, Q., = 1.04; Morgado et
al. 2013). Our data also agree well with the WU 17842 (E. luteobasis) figure
and spore dimensions in Noordeloos & Hausknecht (1998; 6.6-7.6 x 6.2-7.5
um, av. 7.0 x 6.6 um, Q. = 1.05). Spore dimensions can be used to distinguish
E. ochreoprunuloides from E. prunuloides (with a spore average ca. 1 um larger;
Morgado et al. 2013). Typically, E. prunuloides tends to be more robust and
to have pale (whitish to light ochraceous) tinges on the pileus (Noordeloos
1992, 2004), but it should be stressed that pileus colours are rather variable
and should be used only in connection with other characters. In contrast,
our collection showed sepia brown ochraceous colours, which are probably
the most typical for the species; Noordeloos & Hausknecht (1998) reported
a brown (from chocolate brown through orange brown) pileus with a greyish
886 ... Dovana & al.
margin. Morgado et al. (2013) also described a new form (E. ochreoprunuloides
f. hyacinthinum) with violet or pink tinges on both pileus and stipe. DNA
sequences from two collections of this form, however, show an almost complete
identity with the typical form (Morgado et al. 2013).
With its dark pileus colors and small spores, the Canadian species
E. pseudoprunuloides is morphologically closer to E. ochreoprunuloides than to
E. prunuloides. However, the phylogenetic analysis by Morgado et al. (2013)
placed it as sister to E. prunuloides.
Our report widens the distribution of E. ochreoprunuloides to include Italy,
in addition to Germany (NordRhein-Westfalen, Ibbenbturen, holotype), UK,
and France (Corsica). A map with all of the localities is presented in Fic. 1B.
Acknowledgments
The authors are grateful to Anton Hausknecht (Maissau, Austria) for giving us a
collection of Entoloma luteobasis and to Nicolien Sol (Naturalis Biodiversity Center,
Leiden, The Netherlands) for providing information on the holotype collection of
E. luteobasis. Thanks are due also to Gabriel Moreno (Univ. Alcala de Henares, Madrid,
Spain) and Tim Baroni (State University of New York - College at Cortland, New York)
for reviewing the manuscript and providing useful suggestions.
Literature cited
Baroni TJ, Hofstetter V, Largent D, Vilgalys R. 2011. Entocybe is proposed as a new genus in the
Entolomataceae (Agaricomycetes, Basidiomycota) based on morphological and molecular
evidence. North American Fungi 6(12): 1-19. http://dx.doi.org/10.2509/naf2011.006.012
Co-David D, Langeveld D, Noordeloos ME. 2009. Molecular phylogeny and spore evolution of
Entolomataceae. Persoonia 23: 147-176. http://dx.doi.org/10.3767/003158509x480944
Ebert H, Ludwig E, Rodig TH 1992. Neue oder seltene Arten aus der Gattung Entoloma. Zeitschrift
fiir Mykologie 58(2): 185-196.
Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity for basidiomycetes—
application to the identification of mycorrhizae and rusts. Molecular Ecology 2(2): 113-118.
http://dx.doi.org/10.1111/j.1365-294x.1993.tb00005
Kokkonen K. 2015. A survey of boreal Entoloma with emphasis on the subgenus Rhodopolia.
Mycological Progress 14: 116. [52 p.]. http://dx.doi.org/10.1007/s11557-015-1135-y
Largent DL. 1994. Entolomatoid fungi of the western United States and Alaska. Mad River Press
Inc., Eureka, California. 516 p.
Morgado LN, Noordeloos ME, Lamoureux Y, Geml J. 2013. Multi-gene phylogenetic
analyses reveal species limits, phylogenetic patterns, and evolutionary histories of key
morphological traits in Entoloma (Agaricales, Basidiomycota). Persoonia 31: 159-178.
http://dx.doi.org/10.3767/003158513x673521
Noordeloos ME. 1981. Introduction to the taxonomy of the genus Entoloma sensu lato (Agaricales).
Persoonia 11: 121-151.
Noordeloos ME. 1992. Fungi Europaei vol. 5: Entoloma s.l. Ed. Candusso, Saronno, Italy. 760 p.
Noordeloos ME. 2004. Fungi Europaei, vol. 5A: Entoloma s.l., supplement. Ed. Candusso, Alassio,
Italy. 617 p.
Entoloma ochreoprunuloides in Italy ... 887
Noordeloos ME, Hausknecht A. 1998. Rezente R6tlingsfunde aus Osterreich und Italien
Osterreichische Zeitschrift fiir Pilzkunde 7: 227-261.
Osmundson TW, Eyre CA, Hayden KM, Dhillon J, Garbelotto MM. 2013. Back to basics: an
evaluation of NaOH and alternative rapid DNA extraction protocols for DNA barcoding,
genotyping, and disease diagnostics from fungal and oomycete samples. Molecular Ecology
Resources 13(1): 66-74. http://dx.doi.org/10.1111/1755-0998.12031
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in: MA Innis et al. (eds). PCR protocols: a guide to
methods and applications. San Diego, Academic Press.
http://dx.doi.org/10.1002/em.2850160211
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 © 2016. Mycotaxon, Ltd.
October-December 2016—Volume 131, pp. 889-896
http://dx.doi.org/10.5248/131.889
Phaeocollybia pakistanica sp. nov.,
the first representative of the genus from Pakistan
JUNAID KHAN’, HASSAN SHER’ & ABDUL NASIR KHALID?
‘Center for Plant Sciences and Biodiversity, University of Swat, Pakistan
*Department of Botany, University of the Punjab,
Quaid-e-Azam Campus-54590, Lahore, Pakistan
“ CORRESPONDENCE TO: Junaid. [email protected]
ABSTRACT—A new species of Phaeocollybia, P. pakistanica, is described that represents
the first record of the genus from Pakistan. Diagnostic characters include purplish red
to brownish red pilei, lilaceous gills, a monopodial radicating cartilaginous stipe, small
ellipsoidal verruculose brown spores, and thin-walled subcapitate cheilocystidia. ITS-nrDNA
sequence analyses support P pakistanica as an independent new species.
KEY worps—Agaricomycetes, Hymenogastraceae, coniferous forest, pseudorhiza, Swat
district
Introduction
Phaeocollybia R. Heim is a genus of agaricoid fungi, currently accepted
in Hymenogastraceae (Matheny et al. 2006). The genus is easy to recognize
in the field due to the presence of the cartilaginous stipe and deeply rooting
pseudorhiza, moist to viscid umbonate pilei, and brown spores. Microscopically
the genus is characterized by gelatinous tissues, roughened brown spores
with an apical callus, the presence of cheilocystidia, and tibiiform diverticula
(Norvell & Exeter 2008). The genus is widely distributed in forested temperate
regions worldwide and currently comprises about 95 described species
(http://www.indexfungorum.org/).
Species later placed in Phaeocollybia were first included by Fries (1838) in
the heterogeneous assemblage of brown-spored agarics within the [unranked;
section] Gymnoti under [unranked; subgenus] Naucoria. Kammer (1871) and
Quélet (1872) independently raised Naucoria to generic level. Heim (1931)
890 ... Khan, Sher & Khalid
established Phaeocollybia with P. lugubris (Fr.) R. Heim as type to accommodate
Naucoria species characterized by yellow brown spores, viscid caps, and
cartilaginous radicating stipes.
The genus is widely distributed throughout forests in Great Britain, Europe,
Asia, Australasia, and South, Central, and North America (Norvell 1998a).
Nowhere common, the genus can be considered quite rare for Pakistan, and
there is no previous Phaeocollybia record for the country (Ahmad et al. 1997).
In this paper we report the first occurrence of Phaeocollybia for Pakistan and
describe a new species based on morphological and molecular analyses.
The specimens were collected from moist temperate forests of Malam Jabba,
Khyber Pakhtunkhwa, Pakistan. Malam Jabba valley, an important biodiversity
hotspot for Pakistan that hosts a variety of important medicinal and
aromatic plants (Sher & Al-Yemeni 2011), lies in northern Pakistan between
the Himalayas and the Hindu Kush foothills. The region (35°20’-35°45’N
72°12’-73°32’E) lies 52 km from Saidu Sharif, the capital of Swat District in
the Malakand division of Khyber Pakhtunkhwa, bordering Shangla District to
the northeast and District Buner to the southwest. Altitudes range from 990
m (valley entrance) to 2880 m (the highest peak of Shagar Sar; Ali et al. 2011).
The valley benefits from varied agro-climatic conditions and geographic areas
that facilitate a large number of important plants (Ali & Qasier 1986). The lush
green coniferous forests of the Malam Jabba are also home to large numbers of
important herbs, and the forest floors rich in humus and moist environments
favor the growth of many macrofungi.
Materials & methods
Collection, morphological and anatomical study of basidiomata
Basidiomes were collected according to Lodge et al. (2004) slightly modified by
excavation to trace their pseudorhizal origins (Norvell 1998b). Fresh specimens were
photographed and important ephemeral characters and habitat data were recorded in
the field. Surface features were examined using a hand lens. The collected specimens
were covered in blotting paper prior to transport to the laboratory where they were
dried at 40-50°C using a fan heater.
Macroscopic descriptions are based on the fresh field collections. Colors were
coded according to Munsell (1975). Certain morphological and developmental terms
(e.g., tibiiform diverticula, vertical-monopodia, pseudorhizae) follow Norvell (1998a,b).
The dried specimens have been deposited in Swat University herbarium (SWAT) and
Herbarium, University of the Punjab, Pakistan (LAH).
For microscopic examination, tissues were rehydrated in distilled water and mounted
in 5% KOH, with Congo red as a stain. Anatomical features were measured using
calibrated Piximétre software connected to a BOECO BM 120 compound microscope
through a Byomic MVV 3000 microscopic camera and visualized on a computer screen.
Twenty basidiospores, basidia, and cystidia were measured; Q = the length/width ratio
Phaeocollybia pakistanica sp. nov. (Pakistan) ... 891
JN102520 Phaeocollybia gregaria
GQ165650 Phaeocollybia gregaria
GQ165653 Phaeocollybia gregaria
EU846286 Phaeocollybia fallax
EU846281 Phaeocollybia fallax
JN102535 Phaeocollybia olivacea
96 | JN102530 Phaeocollybia olivacea
711 GQ165679 Phaeocollybia olivacea
JN102495 Phaeocollybia ammiratit
99'GQ165629 Phaeocollybia ammirati
JN102546 Phaeocollybia redheadii
N102545 Phaeocoliybia redheadit
JN 102541 Phaeocollybia redheadii
77; GQ165682 Phaeocollybia oregonensis
99 |! GQ165685 Phacocollybia oregonensis
GQ165684 Phaeocollybia oregonensis
KJ450910 Phaeocollybia benzokaufimanii
KJ450907 Phaeocollybia benzokaufimanti
99|KJ450917 Phaeocollybia benzokaufimani
KJ450916 Phaeocollybia benzokaufimann
JN 102499 Phaeocollybia attenuata
JN102500 Phaeocollybia attenuata
100 | GQ165634 Phaeocollybia attenuata
JN 102497 Phaeocollybia attenuata
JN102515 Phaeocollybia fallax
ai JN102512 Phaeocollybia fallax
400 | KF219601 Phaeocollybia phaeogaleroides
KF219600 Phaeocollybia phaeogaleroides
100 - @ KY007615 Phaeocollybia pakistanica
@ KY007616 Phaeocollybia pakistanica
96 | JN 102548 Phaeocollybia sipei
EU644706 Phaeocollybia sipei
EU644705 Phaeocollybia sipei
KF219568 Phaeocollybia dissiliens
EU669354 Phaeocollybia dissiliens
63! KF219569 Phaeocollybia dissiliens
AJ585496 Galerina marginata
0.02
Fic. 1. Maximum Likelihood phylogeny of Phaeocollybia spp. Cluster support percentage is
shown next to the branches. The initial tree for the heuristic search was obtained by applying the
Neighbor-Joining method to a matrix of pairwise distances estimated by the Maximum Composite
Likelihood (MCL) approach. ‘The tree is drawn to scale, with branch lengths representing number
of substitutions per site. The analysis involved 34 nucleotide sequences. There were a total of 422
positions in the final dataset.
892 ... Khan, Sher & Khalid
of a single spore; Qe = average length/width ratio of all spores; Me = average L x W of
all spores measured.
DNA extraction, amplification, sequencing, and molecular phylogenetic analysis
About 50 mg of dried gills were ground into fine powder using liquid nitrogen, and
the DNA was extracted according to Porebski et al. (1997). The universal primer pair
ITS1F and ITS 4 (White et al. 1990, Gardes & Bruns 1993) was used to amplify the rDNA
ITS (ITS1+5.8s+ITS2) region in 50 uL reaction volumes following Gardes & Bruns
(1993). The PCR amplified product was sequenced by Beijing Genomic Institute (Hong
Kong). BLAST analysis was performed using the National Center for Biotechnology
Information (USA) database, and closely matching sequences were downloaded for
further phylogenetic analysis. Sequences were aligned using MEGA 6 software (Tamura
et al. 2013). Galerina marginata (Batsch) Kiihner was selected as outgroup. Sequences
are deposited in GenBank.
Results
Phylogenetic analysis FIG. 1
Amplification of the entire ITS region using the ITSI and ITS4 primers
generated a 690bp sequence. The initial BLAST comparison of the Pakistan
sequences showed 85% identity and 96% query cover with Phaeocollybia
dissiliens A.H. Sm. & Trappe (KF219569, KF219568) and 84% identity and
96% query cover with P sipei A.H. Sm. (JN102548, EU644705, EU644706).
The MEGA6 maximum likelihood analysis clustered our Pakistan sequences
with the P. dissiliens and P. sipei sequences in a separate clade with a strong
bootstrap value of 81%, thereby supporting P pakistanica phylogenetically as
an independent species.
Taxonomy
Phaeocollybia pakistanica J. Khan, Sher & Khalid, sp. nov. Figs 2, 3
MycoBAnk MB 818193
Differs from Phaeocollybia sipei by possession of clamp connections, and from both P
dissiliens and P. sipei by its lilaceous cap and gill color.
Type: Pakistan, Khyber Pakhtunkhwa Province, Swat District, Malam Jabba, 2500 m
a.s.l, small groups on forest soil near Abies pindrow (Royle ex D. Don) Royle and Pinus
wallichiana A.B. Jacks., 14 Sep. 2015, Junaid Khan MJ1560 (Holotype, SWAT15-1560;
GenBank KY007615)
Erymo oey: referring to Pakistan, the country where the species was first collected.
Piteus 70-90 mm diam., conical to cuspidate when young, becoming convex
and papillate at maturity, margin initially straight, later uplifted to revolute and
undulating; edge and outer margin striate to rugulose almost two-thirds toward
the central disc; viscid to glutinous when wet, shiny when dry; hygrophanous
with a darker edge, color initially purplish red (LORP6), dulling to brownish red
(10R7/4) and finally brownish (10R6/2) on exposure. CONTEXT concolorous
with or slightly paler than pileus, thin, <3 mm thick at the disc and 1 mm at the
Phaeocollybia pakistanica sp. nov. (Pakistan) ... 893
aa oh
cay
Yt
Fic. 2. Phaeocollybia pakistanica (holotype, SWAT15-1560). A. basidiomata in situ; B. detail
of shiny pileus and violet lamellae; C. purplish-red stipe and lamellae; D. excavated basidioma
showing purplish stipe apex. Scale bars = 10 mm.
outer edge, moist to dry, soft; odor fruity to mildly mushroomy; taste mild, not
distinctive. LAMELLAE adnexed to slightly sinuate, close, color purplish with
a reddish tone (7.5 RP7) at least when young before turning brown (10R4/8),
edges eroded, more or less straight, crisped or curled toward the stipe in some
specimens; lamellulae frequent, with crisped terminal ends, L+ll/cm <25.
StTrPE including pseudorhiza overall <160 mm, aerial portion <100 mm long,
apex 5 mm diam.; central, terete, cylindrical or slightly widening towards
the base, even slightly bulbous in some specimens; concolorous with the cap
or slightly paler, with a paler purplish tinted (7.5 R8/2) upper portion and
darker (7.5R6/8) lower portion without any purplish tints, glabrous or slightly
fibrous when young, not bruising, hollow, cartilaginous, cortex 1-1.5 mm
thick, lined with fibrils. PsEUDORHIZA <60 mm, (approximately 1/3 of overall
stipe+pseudorhiza length), vertical monopodial, tapering with a blunt origin,
more or less concolorous with the aerial stipe, but slightly paler orange in upper
part and slightly darker below.
BASIDIOSPORES (6—)6.4—7.1(-7.2) x (3.4-)3.6-4.5 um, Q = (1.3) 1.5-1.8
(1.9), Me = 6.7 x 4.1 um, Qe = 1.6, ellipsoid to elongate in side view, ovoid in
face view, finely verruculose in oil immersion, apiculate, brownish amber in
KOH. Basrp1A <30 um long, narrowly clavate to cylindrical, hyaline, 4-spored,
894 ... Khan, Sher & Khalid
Fic. 3. Phaeocollybia pakistanica (holotype, SWAT15-1560). A. basidiospores; B. basidiole and
basidium; C. subcapitate cheilocystidia; D. hymenium showing immature and sterigmate basidia;
E. pileipellis with narrow, branched and anastomosing hyphae of the suprapellis (top) overlying
shorter and wider unbranched subpellis hyphae (middle) and wider thick-walled tramal hyphae
(bottom); FE. pseudorhiza with rhizopellis layer shown above thick-walled tramal cells. Scale bars:
A = 4.5 um; B = 12 um; C = 20.5 um; D = 10 um; E = 21 um; F= 35 um.
sterigmata <3 um long. CHEILOCYSTIDIA <40 um long, sub-capitate, numerous,
thin-walled. PrrerPeLiis bilaminate, suprapellis a <23 um-thick layer with
narrow (<2-3 um diam) branched, gelatinized, pale brownish to hyaline
hyphae with occasional clamp connections at the septa overlying a slightly
darker (KOH) subpellis composed of somewhat inflated thick-walled cells
(<10 um diam and lacking clamp connections) interspersed with <10 um diam,
non-septate, golden brown, branched oleifers. PILEUS TRAMA cells shorter,
<25 um diam., thick-walled. StrprTIPELLis cells <100 x 10 um, cylindrical, thick-
walled. PSEUDORHIZAL PELLIS cells narrow, <5 um diam, elongate, without any
clamps. STIPE & PSEUDORHIZA TRAMAS Sarcodimitic, with thinner branching
flexuous cells intermixed among ‘vessel elements’ that are thick-walled, <250
x 30 um, more or less fusoid, brown to golden in KOH. CLAMP CONNECTIONS
very rare; observed occasionally in pileipellis. TrsFORM DIVERTICULA present
on pseudorhizal pellis.
ADDITIONAL SPECIMENS EXAMINED: PAKISTAN, KHYBER PAKHTUNKHWA PROVINCE,
SwaT District, Malam Jabba, 2500 m asl, in small groups under Abies pindrow, 10 Aug
Phaeocollybia pakistanica sp. nov. (Pakistan) ... 895
2014, Junaid Khan MJ65 (LAH35009); 31 Jul, 2016, Junaid Khan MJ1660 (SWAT16-
0021)
Discussion
Molecular analysis clusters the present Pakistani collection with P. dissiliens
and P. sipei, but P pakistanica is both morphologically and molecularly well
separated from those two species. Phaeocollybia dissiliens (Smith & Trappe
1972) and P. sipei (Smith 1957), both originally described from the North
American Pacific coast, are distinguished by their bright orange to brownish
orange coloration and lack the lilaceous gill colors characterizing P. pakistanica.
The vertical monopodial pseudorhiza of P. pakistanica lacks the thread-like to
racemose pseudorhiza of P dissiliens and P. sipei noted by Norvell & Exeter
(2008). The finely verruculose or punctate roughened ellipsoidal basidiospores
are also morphologically similar to the two North American species. The
rarity of clamp connections in the Pakistani collections (with a few found
only in the suprapellis) further distinguishes P pakistanica from P. dissiliens
(with clamp connections relatively frequent in the pileus suprapellis and at the
cheilocystidial and basidial bases) and P. sipei (which lacks clamp connections
throughout).
Phaeocollybia spoliata E. Horak, described from India, slightly resembles
P. pakistanica in its reddish coloration (although orange-brown more than
purplish) and striate cap margin but is easily distinguished by its larger (9.5-10
x 5-5.5 um) more heavily ornamented almond-shaped spores (Horak 1974).
Phaeocollybia rancida E. Horak, also described from high coniferous forests
in India and characterized by lilaceous violet lamellae, capitate cheilocystidia,
and ellipsoid basidiospores, is easily separated by its ochraceous coloration,
glutinous pilei, slightly smaller (5-6 x 3-3.5 um) basidiospores, and absence of
clamp connections (Horak 1974).
Acknowledgements
We are highly indebted to Higher Education Commission (HEC), Pakistan for
financial assistance under NRPU Project. Sincere thanks to Dr. Najam-ul-Sahar Afshan,
Assistant Professor (Centre for Undergraduate Studies, University of the Punjab, Lahore,
Pakistan) and Dr. Lorelei Norvell (Pacific Northwest Mycology Service, Portland
Oregon U.S.A.) for presubmission reviews.
Literature cited
Ahmad §, Iqbal S, Khalid AN. 1997. Fungi of Pakistan. Sultan Ahmad Mycological Society of
Pakistan. Lahore.
Ali SI, Qasier M. 1986. A phytogeographical analysis of the phanerogams of Pakistan and
Kashmir. Proceedings of the Royal Society of Edinburgh 89B: 89-101.
http://dx.doi.org/10.1017/s0269727000008939
896 ... Khan, Sher & Khalid
Ali H, Sannai J, Sher H. Rashid A. 2011. Ethnobotanical profile of some plant resources in Malam
Jabba valley of Swat, Pakistan. Journal of Medicinal Plants Research 5: 4676-4687.
Bruns TD, Fogel R, Taylor JW. 1990. Amplification and sequencing of DNA from fungal herbarium
specimens. Mycologia 82: 175-184. http://dx.doi.org/10.2307/3759846
Fries EM. 1836-38. Epicrisis systematis mycologici, synopsis hymenomycetum. Uppsala:
Typographia Academia.
Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity for basidiomycetes-
application to the identification of mycorrhizae and rusts. Molecular Ecology 2: 113-118.
http://dx.doi.org/10.1111/j.1365-294X.1993.tb00005.x
Horak E. 1974. Two new species of Phaeocollybia (Agaricales, Fungi) from India. Acta Botanica
India 2: 69-73.
Kummer P. 1871. Der Fuhrer in die Pilzkunde. Zerbst: C.Luppe.
Lodge DJ, Ammirati JF, O'Dell TE, Mueller GM. 2004. Collecting and describing macrofungi.
128-158, in: GM Mueller, G Bills, MS Foster (eds.). Biodiversity of fungi: inventory and
monitoring methods. San Diego, California: Elsevier Academic.
Matheny PB, Curtis JM, Hofstetter V, Aime MC, Moncalvo J-M, Ge Z-W, Yang Z-L, Slot JC,
Ammirati JF, Baroni TJ, Bougher NL, Hughes KW, Lodge DJ, Kerrigan RW, Seidl MT, Aanen
DK, DeNitis M, Daniele GM, Desjardin DE, Kropp BR, Norvell LL, Parker A, Vellinga EC,
Vilgalys R, Hibbett DS. 2006. Major clades of Agaricales: a multilocus phylogenetic overview.
Mycologia 98: 982-995. http://dx.doi.org/10.3852/mycologia.98.6.982
Munsell AH. 1975. Munsell™. Soil color charts. Baltimore.
Norvell LL. 1998a. The biology and taxonomy of Pacific Northwest species of Phaeocollybia
Heim (Agaricales, Cortinariaceae). Ph.D. dissertation, Department of Botany, University of
Washington, Seattle, Wash. 391 p.
Norvell LL. 1998b. Observations on development, morphology and biology in Phaeocollybia.
Mycological Research 102: 615-630. http://dx.doi.org/10.1017/S0953756297005431
Norvell LL, Exeter RL. 2008. Phaeocollybia of Pacific Northwest North America. U.S. Dept. of the
Interior, Bureau of Land Management, Salem District. USDI BLM/OR/WA/GI-08/100-1792.
ISBN-13: 978-0-9791310-1-1; ISBN-10: 0-9791310-1-4. 228 pp.
Porebski S, Bailey LG, Baum BR. 1997. Modification of a CTAB DNA extraction protocol for
plants containing high polysaccharide and polyphenol components. Plant Molecular Biology
Reporter 15: 8-15. http://dx.doi.org/10.1007/BF02772108
Quélet, L. 1872. Les champignons de Jura et des Vosges. Mémoires de la Société d’ Emulation de
Montbéliard, 2e Sér., 5: 43-332.
Sher H, Al-yemeni M. 2011. Economically and ecologically important plant communities in high
altitude coniferous forest of Malam Jabba, Swat, Pakistan. Saudi Journal of Biological Sciences
18: 53-61. http://dx.doi.org/10.1016/j.sjbs.2010.09.002
Smith AH. 1957. A contribution toward a monograph of Phaeocollybia. Brittonia 9:195-217.
http://dx.doi.org/10.2307/2804723
Smith AH, Trappe JM. 1972. The higher fungi of Oregon’s Cascade Head Experimental Forest and
vicinity. I. The genus Phaeocollybia (Agaricales) and notes and descriptions of other species in
the Agaricales. Mycologia. 64: 1138-1153. http://dx.doi.org/10.2307/3758079
Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. 2013. MEGA6: Molecular Evolutionary
Genetics Analysis Version 6.0. Molecular Biology and Evolution 30: 2725-2729.
http://dx.doi.org/10.1093/molbev/mst197
White TJ, Bruns TD, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal
ribosomal RNA genes for phylogenetics. 315-322, in: MA Innis, DH Gelfand, JJ Sninsky, TJ
White (eds). PCR protocols: a guide to methods and applications. Academic Press, San Diego.
http://dx.doi.org/10.1016/B978-0-12-372180-8.50042-1
MYCOTAXON
ISSN (print) 0093-4666 (online) 2154-8889 © 2016. Mycotaxon, Ltd.
October-December 2016—Volume 131, pp. 897-906
http://dx.doi.org/10.5248/131.897
Mucor indicus isolated from the semiarid region of Brazil:
a first record for South America
Car os A.F. DE SouzA’, DioGo X. LIMA’, RAFAEL J.V. DE OLIVEIRA’,
LucIANA M.S. GURGEL”, ANDRE L.C.M. DE A. SANTIAGO’
‘Post-graduate course in Fungal Biology, Universidade Federal de Pernambuco,
Av. Prof. Nelson Chaves, s/n, 50670-420, Recife, PE, Brazil
?Instituto Agronédmico de Pernambuco (IPA),
Av. General San Martin, 1371 Bongi, Recife, PE, Brazil
* CORRESPONDENCE TO: [email protected]
ABSTRACT—A specimen of Mucor indicus was isolated from a dung sample collected in the
city of Sertania in the Brazilian state of Pernambuco and its identity confirmed through LSU
rDNA sequence analysis. The taxon is described and illustrated for the first time from South
America. An identification key is provided for Mucor species from the northeast Brazilian
semiarid region (Caatinga).
Keyworps—lower fungi, phylogenetic analysis, Mucoromycotina, Zygomycota
Introduction
Mucor Fresen. (Mucoraceae) comprises species characterized by the
formation of non-apophysate sporangia, producing simple or branched
sporangiophores that emerge directly from the substrate. Few species have
rhizoids and stolons are not produced (Benny 2014). This genus has a worldwide
distribution and most of the species described are saprobes commonly isolated
from a wide variety of substrates such as soil, stored grains, fruits, rotting
vegetables, fleshy agarics, and herbivore dung (Viriato & Trufem 1985, Alves
et al. 2002, Schoenlein-Crusius et al. 2006, Jacobs & Botha 2008, Santiago &
Souza-Motta 2008, Santiago et al. 2013).
Although over 300 species have been cited in the literature (Jacobs & Botha
2008), the exact number of authentic taxa is unknown. According to Gherbawy
et al. (2010), it is possible that the number of authentic species could range
898 ... Souza & al.
between 50 and 75. Schipper (1973, 1975, 1976, 1978) described 39 species,
four varieties, and 11 forms of Mucor. Subsequently, 17 additional species have
been proposed (Mehrotra & Mehrotra 1978, Mirza et al. 1979, Subrahmanyam
1983, Chen & Zheng 1986, Schipper 1989, Schipper & Samson 1994, Watanabe
1994, Zalar et al. 1997, Pei 2000, Alves et al. 2002, Jacobs & Botha 2008, Alvarez
et al. 2011, Hermet et al. 2012, Madden et al. 2012).
Previous studies have treated Mucor as polyphyletic (O'Donnell et al. 2001,
Kwasna et al. 2006, Jacobs & Botha 2008, Budziszewska & Piatkowska 2010,
Alvarez et al. 2011). Based on the phylogeny of ITS and LSU rDNA regions
of several mucoralean species, Walther et al. (2013) observed that some
Mucor species with curved sporangiophores represent a natural grouping with
Backusella Hesselt. & J.J. Ellis, and transferred nine Mucor species to Backusella.
The aim of the present study was to describe and illustrate M. indicus
from dung samples collected in the city of Sertania, Pernambuco, Brazil. An
identification key for Mucor species from the semiarid region of Brazil is also
provided.
Material & methods
Isolation and morphological & physiological identification of M. indicus
Samples of goat (Capra hircus Linnaeus) dung were collected at the Agronomic
Institute of Pernambuco stations, located in the city of Sertania (8°03’38”S 37°13’32”W)
in the state of Pernambuco, 326 km away from Recife, Brazil. The mean annual
temperature is 25°C, with rainfall of 635 mm per year. The area has a hyperxerophilic
Caatinga vegetation. The samples were placed in clean plastic bags for transportation to
the laboratory and then incubated in triplicate in moist chambers for 10 days. The plates
were left on a bench at room temperature (28 + 2°C) exposed to alternating light and
dark periods. Fragments of mycelium were removed directly from Petri dishes under
a Leica EZ4 stereomicroscope and transferred to Petri dishes with malt extract agar
(MEA) (Benny 2008). The specimen was identified through observation of macroscopic
(color, appearance, and diameter of the colony) and microscopic (e.g., shape and size of
sporangiophores, columellae, sporangia, and sporangiospores) characteristics based on
the descriptions of Schipper (1978). The thermotolerance of M. indicus was confirmed
by growing it at 40°C for 7 days. The colony colors were designated according to Maerz
& Paul (1950).
Molecular analysis
Cultures grown in test tubes containing malt extract were incubated at 28°C for
6 days to generate fungal biomass. The material was transferred to 2 mL microtubes
with screw caps. Subsequently, 0.5 g acid-washed glass beads of two different diameters
(150-212 um and 425-600 um, 1:1; Sigma, USA) were added to each tube. The material
was crushed by stirring at high speed in a FastPrep homogenizer. The genomic DNA
extraction procedure was conducted as described by Goes-Neto et al. (2005). The
mycelium was washed with chloroform: isoamyl alcohol (24:1) and then homogenized
0.1
Mucor indicus, new for South America (Brazil) ... 899
soo Cireinella angarensis JN206551
‘00 C. chinensis JN206549
o.zef~ Mucor fuscus JN206442
°°L M. fuscus JN206443
M. exponens JN206441
M. laxorrhizus JN206444
1,00
100 ogg M. mucedo HM849687
°L__ WV. piriformis HM849681
ee — ™. flavus JN206469
One M. luteus HM849685
|e BSS M. japonicus JN206446
i M. endophyticus JN206448
Og. M. hiemalis f. hiemalis HM849683
1 M. irregularis JX976213
1.00 | M. irregularis JN206450
0.63. 100
: M. odoratus JN206495
1.00 M. inaequisporus JN206501
083 M. amphibiorum HM849688
M. falcatus JN206509
0.99
res 00. M. variosporus JN206508
oor | 1 M. indicus HM849690
- is we M. indicus KU646991
s.o07/ M. genevensis JN206435
°"L M. genevensis JN206436
— soo ™. circinelloides JN206430
100L__ WV. circinelloides JN206413
991, M. plumbeus HM849677
4.00.” |; M. racemosus HM849676
0.99. M. racemosus JN206433
Fig. 1. Phylogenetic tree of Mucor species constructed using partial LSU rDNA sequences. Circinella
angarensis and C. chinensis were used as outgroup. Sequences are labeled with their GenBank
accession numbers. Branch support values are from Bayesian inference (above) and maximum
likelihood (below) analyses. The sequence obtained in this study is in boldface.
900 ... Souza & al.
in 2% cetyltrimethylammonium bromide (CTAB) buffer. The DNA was precipitated
in chilled isopropanol, washed with 70% ethanol, and resuspended in 50 uL ultrapure
water.
The primer pairs LR1/LSU2 were used to amplify a fragment of the large subunit
(LSU) nuclear ribosomal DNA (rDNA) (van Tuinen et al. 1998, Santiago et al. 2014).
The polymerase chain reactions were carried out as described by Oliveira et al. (2014).
The newly obtained sequence was deposited in the National Center for Biotechnology
Information GenBank database (accession number KU646991).
Phylogenetic reconstructions were obtained by analyzing the partial LSU rDNA
sequences. The fungal sequences were aligned with ClustalX (Larkin et al. 2007)
and edited with BioEdit (Hall 1999). Prior to the phylogenetic analysis, the optimal
nucleotide substitution model was estimated using Topali 2.5 (Milne et al. 2004).
Bayesian inference (two runs over 10° generations with a burn-in of 2500) analysis
was performed with MrBayes 3.1.2 (Ronquist & Huelsenbeck 2003), launched from
Topali 2.5.
Results
Phylogenetic analysis
The Blastn analysis of the LSU sequences showed a 99% similarity between
our Brazilian material (URM7222) and M. indicus (CBS 226.29; GenBank
HM849690). Phylogenetic analysis of the sequence datasets (Fic. 1) showed
that URM7222 formed a well-supported clade (BI 1.00/ML 98%) with the
sequence of M. indicus (HM849690).
Taxonomy
Mucor indicus Lendn., Bull. Soc. Bot. Genéve 21: 258 (1930). Fic. 2
Co.ony initially white and becoming deep yellowish (MP 11C1 - Amber
White) with yellowish reverse (MP 11J6), reaching 9.4 cm in diam. and 9 mm in
height after 4 days in MEA at 28°C. SPORANGIOPHORES erect (rarely circinate),
repeatedly sympodially branched, with long branches, (4—)5-12.5(-14.5) um
diam., hyaline to yellowish, smooth-walled. SpPoranGra globose to subglobose,
(22.5-)32.5-45(-50) um diam., brownish, with diffluent wall. CoLUMELLAE
globose (27.5—)30-47.5(-50) um, subglobose (25.5-)27.5-28.5 x 42.5-45(-47.5),
or applanate (18-)20-21.25 x 27.5-30(-32.5) diam., grayish or yellowish brown,
smooth-walled; CoLLARS small and infrequent. SPORANGIOSPORES hyaline,
smooth-walled, often ellipsoid (3.75-)4-6.25 x 3-6.5(-7.5) um and subglobose
4-6(-7.5) um in diam. CHLAMYDOSPORES present. ZYGOSPORANGIA not
observed. Growth reasonably good at 40°C (7.6 cm in 168 hours) in MEA with
rare sporangiophore production and poor sporulation.
HasiratT: Recorded on goat dung in the semiarid region of Pernambuco,
northeastern Brazil.
Mucor indicus, new for South America (Brazil) ... 901
A B
50 pm | 50 pm
od ER
De’ E
)
»,
» 32
)
»)
D 2
5
s =)
Dy 3
3) ? »
xy, AY yy
5) >
; }
ua yp ») ; ma
“a eee $e)
gi 2
" =
> ?
2 2 dy 4 =
50 7m 25 pm
Fig. 2. Mucor indicus (URM 7222): A. Sporangiophore simple with sporangia; B. Sporangiophore
simple with columella; C. Sporangiophore branch with columella; D. Chlamydospores;
E. Sporangiospores.
SPECIMEN EXAMINED: BRAZIL, PERNAMBUCO, Sertania: Instituto Agrondédmico de
Pernambuco (IPA), 8°03’38”S 37°13’32”W, from goat dung, 5.X1.2014, leg. C.A.F de
Souza (URM 7222).
GEOGRAPHIC DISTRIBUTION: India (Lendner 1930, Abe et al. 2004), Poland
(Szwedek-Trzaska & Glowacka 2011), Spain (Luna et al. 1986, Garcia-Pantaleén
et al. 1992, Herrero et al. 1996), USA (Oliver et al. 1996, Sobel 2001, Alvarez et
902 ... Souza & al.
al. 2009), and Vietnam (Lee & Fujio 1999). Our Brazilian collection represents
the first report from South America.
Discussion
The morphological characteristics of M. indicus reported here show a
close similarity with the description by Schipper (1978), although there are
differences in the diameter of sporangiospores and columellae. Sporangiospore
sizes reported in the literature (5.4-5.7 x 4.4 um; Schipper 1978) are smaller
than our maximum measurements, whereas columellae were larger (<56 x 53
um; Schipper 1978) than observed in our isolate. Mucor indicus strains may
exhibit morphological similarities to M. circinelloides Tiegh. (Schipper 1978).
However, M. indicus lacks the abundant short branches reported for M.
circinelloides and its predominantly globose columellae differ from the obovoid
type found in M. circinelloides. Moreover, the thermotolerance inherent to
M. indicus is not found in M. circinelloides (Schipper 1978). Walther et al. (2013)
have reported that although some M. indicus cultures morphologically resemble
M. circinelloides, there are clear genetic differences between these two species.
The LSU phylogenetic tree (Fic. 1) suggests that M. indicus and M. vario-
sporus Schipper are genetically closely related. Morphologically, however,
M. indicus colonies are lower than those of M. variosporus, which can reach
20 mm in height (Schipper 1978). Differences in sporangiophore diameters
have also been observed, with M. variosporus producing larger (14(-23) um)
sporangiophores. Finally, M. variosporus sporangia are yellow and larger (<150
um diam.) than those of M. indicus, which are brownish and smaller.
This manuscript reports the first occurrence of M. indicus in South America,
thereby expanding our knowledge of mucoralean distribution. In the semiarid
region of Brazil (Caatinga), other Mucor species have been isolated, such as
M. circinelloides Tiegh. f. circinelloides, M. hiemalis Wehmer, M. luteus Linnem.
ex Wrzosek., M. prayagensis B.S. Mehrotra & Nand ex Schipper, M. racemosus
Fresen., and M. subtilissimus Oudem. (Santiago 2016). During a recent
survey of Mucorales from other Brazilian semiarid regions, M. circinelloides
Tiegh. f. griseocyanus (Hagem) Schipper, M. circinelloides Tiegh. f. janssenii
(Lendn.) Schipper, M. circinelloides Tiegh. f. lusitanicus (Bruderl.) Schipper,
M. racemosus Fresen. f. racemosus, and M. variosporus Schipper were also
isolated (unpublished data).
Identification key for Mucor taxa isolated from
the semiarid region of Brazil
Li Sporangiospares devular in forin1-andi size’ sare ls sh Se sar liv. wipe dy < gts Sepeors Senate a)
1. Sporangiospores variable in size and shape: globose, ovoid, cylindrical, and
PUSHOUIA tc cot em Ncee phrase v attasee oatets Gseheced autect eae tMaN Seas Ne M. variosporus
Mucor indicus, new for South America (Brazil) ... 903
2. Sporangiophores unbranched or slightly sympodially branched ................ 3
2. Sporangiophores repeatedly branched se scwsse ee a sen aee enae o ale eed Bes 6
3. Columellae globose to subglobose or globose to applanate;
sporangiospores <15 um long with or without a granule ................... 4
3. Columellae spherical or ellipsoidal with a truncated base;
SpotansiosporeseSS corel Ovi IONE. eh. masts. Badpens Patel te Bake, wv Boden n Mody oth Boks. fe)
aN
. Sporangiophores unbranched; columellae subglobose to applanate;
sporangiospores ellipsoidal or flattened on one side ........... M. prayagensis
aN
. Sporangiophores sparsely branched; columellae globose to subglobose
(rarely ellipsoidal); sporangiospores ellipsoidal with a granule at
CCR CHGAER Praline pete test ncaa h ieee Tater aigeeh ral eet M. subtilissimus
5. Columellae ellipsoidal with a truncate base; sporangiospores ellipsoid,
sometimes flattened on one side, 2.5-10 x 2-7.5 um .............. M. hiemalis
5. Columellae globose;
sporangiospores long-elliptical and fusiform 2.5-8.1 x 1-5 um....... M. luteus
Gz -ADSenCe ero wAliat AOCE 7 ee Mer teed et tats oleh at Nate A Nady oh ee Gata B a iNath i
GC SOGESHOW1 lh: At AOS 5. eenteetn Mn arden Ba at en peers Babel cer Sah es Sansaharh aesere M. indicus
7. Sporangiophores sympodially branched; chlamydospores present or not,
when present not abundant and never formed in sporangiophores or
COMIC Ae ar ee ater acter tte ge Sige Ph alk gr See rae SM Todi peak geal ual yor STALEY ra 8
7. Sporangiophores sympodially and monopodially branched;
chlamydospores abundant, some formed in sporangiophores and
CONIA ae AT ak Ns oe ot ee ht Me A RP RAO M. racemosus f. racemosus
8. Colonies initially white, then becoming gray;
sporangiophores <10 um in diam.; sporangia brownish-black ............... 9
8. Colonies initially yellow than turning brownish;
sporangiophores <17 um in diam.; sporangia gray-brownish............... 10
o-spotansiospores ellipsoid MAS. OS on wl M. circinelloides f. griseocyanus
9. Sporangiospores globose to slightly subglobose ........ M. circinelloides f. janssenii
10. Columellae obovoid;
sporangiospores ellipsoid .................... M. circinelloides f. circinelloides
10. Columellae globose;
sporangiospores ellipsoid, some irregular in shape . circinelloides f. lusitanicus
Acknowledgments
The authors thank the Fundacao de Amparo a Ciéncia e Tecnologia do
Estado de Pernambuco (FACEPE-APQ 0842-2.12/14), the Conselho Nacional de
Desenvolvimento Cientifico e Tecnolédgico (CNPq - 458391/2014-0), the Programa de
Pesquisa em Biodiversidade do Semiarido (MCT/CNPQ/PPBio - 457498/2012-9). We
also thank Dr. Matias Cafaro and Dr. José Ivanildo de Souza for the critical revision of
the manuscript.
904 ... Souza & al.
Literature cited
Abe A, Sujaya IN, Sone T, Asano K, Oda Y. 2004. Microflora and selected metabolites of potato pulp
fermented with an Indonesian starter Ragi Tapé. Food Technology Biotechnology 42: 169-173.
Alvarez E, Sutton DA, Cano J, Fothergill AW, Stchigel A, Rinaldi MG, Guarro J. 2009. Spectrum
of Zygomycete species identification in clinically significant specimen in the United States.
Journal of Clinical Microbiology 47: 1650-1656. http://dx.doi.org/10.1128/JCM.00036-09
Alvarez E, Cano J, Stchigel AM, Sutton DA, Fothergill AW, Salas V, Rinaldi MG, Guarro J.
2011. Two new species of Mucor from clinical samples. Medical Mycology 49: 62-72.
http://dx.doi.org/10.3109/13693786.2010.499521
Alves MH, Trufem SFB, Milanez AI. 2002. Taxons de Mucor Fresen. (Zygomycota) em fezes de
herbivoros, Recife, PE, Brasil. Revista Brasileira de Botanica 25 (2): 147-160.
Benny GL. 2008. The methods used by Dr. R.K. Benjamin, and other Mycologists to isolate
Zygomycetes. Aliso 26: 37-61. http://dx.doi.org/10.5642/aliso.20082601.08
Benny GL. 2014. Zygomycetes [http://www.zygomycetes.org (viewed on line on 16 jan, 2016)].
Budziszewska J, Piatkowska J. 2010. Taxonomic position of Mucor hiemalis f. luteus. Mycotaxon
111: 75-85. http://dx.doi.org/10.5248/111.75
Chen GQ, Zheng RY. 1986. A new species of Mucor with giant spores. Acta Mycologica Sinica,
Supplement I 1: 56-60.
Domsch KH, Gams W, Anderson TH. 1993. Compendium of soil fungi. 1. San Francisco, Academic
Press.
Garcia-Pantaleédn FI, Soldevilla CG, Vilches ED, Romero JA, Molina AM. 1992.
Air spore microfungi in dwellings of south of Spain. Aerobiologia 8: 245-253.
http://dx.doi.org/10.1007/BF0207 1633
Gherbawy Y, Kesselboth C, Elhariry H, Hoffmann K. 2010. Molecular barcoding of microscopic
fungi with emphasis on the mucoralean genera Mucor and Rhizopus. 225-265, in Y Gherbawy,
K Voight (eds.). Molecular identification of fungi. Berlin Heidelberg, Springer-Verlag.
Go6es-Neto A, Loguercio-Leite C, Guerrero RT, 2005. DNA extraction from frozen field collected
and dehydrated herbarium fungal basidiomata: performance of SDS and CTAB- base methods.
Biotemas 18: 19-32.
Hall TA. 1999: BioEdit: a user-friendly biological sequence alignment editor and analysis program
for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95-98.
Herrero B, Fombella-Blanco MA, Fernandez-Gonzalez D, Valencia-Barrera RM. 1996.
Aerobiological study of fungal spores from Palencia (Spain). Aerobiologia 12: 27-35.
http://dx.doi.org/10.1007/BF02248120
Hermet A, Méheust D, Monunier J, Barbier G, Jany JL. 2012. Molecular systematics in the genus
Mucor with special regards to species encountered in cheese. Fungal Biology 116: 692-705.
http://dx.doi.org/10.1016/j.funbio.2012.04.002
de Hoog GS de, Guarro J, Gen J, Figueras MJ. 2000. Atlas of Clinical Fungi. 2nd ed. Utrecht,
Centraalbureau voor Schimmelcultures.
Jacobs K, Botha A. 2008. Mucor renisporus sp. nov., a new coprophilous species from Southern
Africa. Fungal Diversity 29: 27-35.
Kwasna H, Ward E, Bateman GL. 2006. Phylogenetic relationships among Zygomycetes
from soil based on ITS1/2 rDNA sequences. Mycological Research 110: 501-510.
http://dx.doi.org/10.1016/j.mycres.2006.02.004
Lee AC, Fujio Y. 1999. Microflora of banh men, a fermentation starter from Vietnam. World Journal
of Microbiology & Biotechnology 15: 51-55. http://dx.doi.org/10.1023/A:1008897909680
Lendner A. 1930. Determination de Mucorinées et description de 2 nouveaux Mucors. Bulletin de
la Société Botanique de Genéve 21: 256-263.
Mucor indicus, new for South America (Brazil) ... 905
Luna A, Infante F, Dominguez E. 1986. Mycoflora of potential sanitary interest present in illicit
heroin. Zeitschrift Rechtsmedizin 96: 297-302. http://dx.doi.org/10.1007/BF00200709
Madden AA, Stchigel AM, Guarro J, Sutton D, Starks PT. 2011. Mucor nidicola sp. nov., a novel
fungal species isolated from an invasive paper wasp nest. International Journal of Systematic
and Evolutionary Microbiology 62: 1710-1714. http://dx.doi.org/10.1099/ijs.0.033050-0
Maerz AJ, Paul MR. 1950. A dictionary of color. 2nd ed. New York, McGraw-Hill Book company,
Inc.
Mehrotra BS, Mehrotra BM. 1978 [1979]. Another azygosporic species of Mucor from India.
Sydowia 31: 94-96.
Millati R, Edebo L, Taherzadeh MJ. 2005. Performance of Rhizopus, Rhizomucor, and Mucor in
ethanol production from glucose, xylose, and wood hydrolyzates. Enzyme and Microbial
Technology 36: 294-300. http://dx.doi.org/10.1016/j.enzmictec.2004.09.007
Milne I, Wright F, Rowe G, Marshal DF, Husmeier D, McGuire G. 2004. TOPALi: software for
automatic identification of recombinant sequences within DNA multiple alignments.
Bioinformatics 20: 1806-1807. http://dx.doi.org/10.1093/bioinformatics/bth155
Mirza JH, Khan SM, Begum S, Shagufta S. 1979. Mucorales of Pakistan. Pakistan, University of
Agriculture, Faisalabad.
O’Donnell K, Lutzoni FM, Ward TJ, Benny GL. 2001. Evolutionary relationships among mucoralean
fungi (Zygomycota): evidence for family polyphyly on a large scale. Mycologia 93: 286-296
http://dx.doi.org/10.2307/3761650
Oliveira RJV, Lima TEF, Cunha IB, Coimbra VRM, Silva GA, Bezerra JL, Cavalcanti MAQ.
2014. Corniculariella brasiliensis, a new species of coelomycetes in the rhizosphere of
Caesalpinia echinata (Fabaceae, Caesalpinioideae) in Brazil. Phytotaxa 178 (3): 197-204.
http://dx.doi.org/10.11646/phytotaxa.178.3.5
Oliver MR, van Voorhis WC, Boeckh M, Mattson D, Bowden RA. 1996. Hepatic mucormycosis in
a bone marrow transplant recipient who ingested naturopathic medicine. Clinical Infections
Diseases 22: 521-524. http://dx.doi.org/10.1093/clinids/22.3.521
Pei KQ. 2000. A new variety of Mucor variosporus and the validation of M. luteus Linnemann and
M. variosporus Schipper. Mycosystema 19: 10-12.
Ribes JA, Vanover-Sams CL, Baker DJ. 2000. Zygomycetes in human disease. Clinical Microbiology
Reviews 13: 236-301. http://dx.doi.org/10.1128/CMR.13.2.236-301.2000
Ronquist F, Huelsenbeck JP. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed
models. Bioinformatics 19 (12): 1572-1574. http://dx.doi.org/10.1093/bioinformatics/btg180
Santiago ALCMA 2016. Mucorales in Lista de Espécies da Flora do Brasil [http://floradobrasil.jbrj.
gov.br/jabot/floradobrasil/FB120276 (viewed on line on 22 January 2015)].
Santiago ALCMA, Souza-Motta CM. 2008. Isolation of Mucorales from processed maize (Zea
mays L.) and screening for protease activity. Brazilian Journal of Microbiology 39 (4): 698-700.
http://dx.doi.org/10.1590/S1517-83822008000400019
Santiago ALCMA, Santos PJP, Maia LC. 2013. Mucorales from the semiarid of Pernambuco, Brazil.
Brazilian Journal of Microbiology 44: 1678-4405.
http://dx.doi.org/10.1590/S1517-83822013005000027
Santiago ALCMA, Hoffmann K, Lima DX, de Oliveira RJV, Vieira HEE, Maloso E, Maia LC, da Silva
GA. 2014. A new species of Lichtheimia (Mucoromycotina, Mucorales) isolated from Brazilian
soil. Mycological Progress 13: 343-352. http://dx.doi.org/10.1007/s11557-013-0920-8
Schipper MAA. 1973. A study on variability in Mucor hiemalis and related species. Studies in
Mycology 4: 1-40.
Schipper MAA. 1975. Mucor mucedo, Mucor flavus and related species. Studies in Mycology 10:
1335
906 ... Souza & al.
Schipper MAA. 1976. On Mucor circinelloides, Mucor racemosus and related species. Studies in
Mycology 12: 1-40.
Schipper MAA. 1978. On certain species of Mucor with a key to all accepted species. Studies in
Mycology 17: 1-69.
Schipper MAA. 1989. Mucor laxorrhizus. Studies in Mycology 31: 151-155.
Schipper MAA, Samson RA. 1994. Miscellaneous notes on Mucoraceae. Mycotaxon 50: 475-491.
Schoenlein-Crusius IH, Milanez AI, Trufem SFB, Pires-Zottarelli CLA, Grandi RAP, Santos ML,
Giustra KC. 2006. Microscopic fungi in the Atlantic rainforest in Cubatao, Sao Paulo, Brazil.
Brazilian Journal of Microbiology 37: 267-275.
http://dx.doi.org/10.1590/S1517-83822006000300014
Sobel JD. 2001. Vaginal mucormycosis: a case report. Infectious Diseases in Obstetrics and
Gynecology 9: 117-118. http://dx.doi.org/10.1155/S$1064744901000205
Subrahamanyam A. 1983. Studies on themomycology. Mucor thermo-hyalospora sp. nov.
Bibliotheca Mycologica 91: 421-423.
Szwedek-Trzaska A, Glowacka A. 2011. Seeking ways to eradicate potentially pathogenic fungi
isolated from soil. Polish Journal of Environmental Studies 20: 1313-1318.
van Tuinen D, Zhao B, Gianinazzi-Pearson V. 1998. PCR in studies of AM fungi: from primers to
application. 387-399, in Varma AK (ed.), Mycorrhizal manual. Berlin, Springer.
Viriato A, Trufem SFB. 1985. Mucorales de Sao Paulo.7. Espécies Merosporangiadas. Rickia 12:
147-154.
Walther G, Pawlowska J, Alastruey-Izquierdo A, Wrzosek M, Rodriguez-Tudela JL, Dolatabadi S,
Chakrabarti A, de Hoog GS. 2013. DNA barcoding in Mucorales: an inventory of biodiversity.
Persoonia 30: 11-47. http://dx.doi.org/10.3767/003158513X665070
Watanabe T. 1994. Two new species of homothallic Mucor in Japan. Mycologia 86: 691-695.
http://dx.doi.org/10.2307/3760541
Zalar P, Hennebert GL, Gunde-Cimerman N, Cimerman A. 1997. Mucor troglophilus, a new
species from cave crickets. Mycotaxon 65: 507-516.
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 © 2016. Mycotaxon, Ltd.
October-December 2016—Volume 131, pp. 907-911
http://dx.doi.org/10.5248/131.907
Blodgettia saprophytica sp. nov. and Uberispora tropicalis,
new records from southern China
CHUN-LING YANG’, KAI ZHANG’, JIN-YE WANG’, JI- WEN X14’, YING-RuI Ma’,
JIAN-MEI GAO’, X1U-GUO ZHANG’ & ZHUANG LI’*
‘Department of Plant Pathology, Shandong Agricultural University, Taian, 271018, China
?Department of Landscaping, Shandong Yingcai University, Jinan, 250104, China
*CORRESPONDENCE TO: [email protected]; [email protected]; [email protected]
ABSTRACT—A new species, Blodgettia saprophytica, is described and illustrated from
specimens collected on dead branches in Guangxi Province, China. Uberispora tropicalis is
newly recorded from China.
Key worps—hyphomycetes, taxonomy
Introduction
Blodgettia Harv. (Harvey 1858), comprising algal and fungal elements, has
commonly been considered an illegitimate name under the former ICBN Art.
70 (Stafleu et al. 1972) so that Blodgettia E.P. Wright (Wright 1881) has been
used for the fungal element. However, Seifert et al. (2011), who interpreted
Wright's treatment as emending Blodgettia Harv. by selecting the fungal element,
as now required by the current International Code of Nomenclature (McNeill
et al. 2012), regarded Blodgettia bornetii E.P. Wright as a later synonym of
B. confervoides. Two other species, B. indica Subram. and B. aquatica Udaiyan,
have been included in the genus (Subramanian 1954, Udaiyan 1992).
Here we propose an additional Blodgettia species on dead branches from
southern China. We also report Uberispora tropicalis on dead branches as a new
record from China.
Material & methods
Samples were processed, examined, and photographed following the methods
described in Xia et al. (2014). Adobe Photoshop 7.0 was used to process individual
908 ... Yang & al.
Fic. 1. Blodgettia saprophytica (holotype, HSAUP H7855). A. Colonies on natural substratum.
B. Conidia and hyphae. C. Conidia covered by a mucilaginous tunica. D. Conidia.
Blodgettia saprophytica sp. nov. (China) ... 909
images into photomicrographic plates, with backgrounds modified for esthetic
reasons. In view of our failure to obtain cultures of this species, no molecular data are
presented here. The specimens are deposited in the Herbarium of Department of Plant
Pathology, Shandong Agricultural University, Taian, Shandong, China (HSAUP) and
the Mycological Herbarium, Institute of Microbiology, Chinese Academy of Sciences,
Beijing, China (HMAS).
Blodgettia saprophytica C.L. Yang, Z. Li & X.G. Zhang, sp. nov. Fig. 1
MycoBAnk MB 819496
Differs from Blodgettia aquatica and B. indica by its larger, hyaline or subhyaline conidia
with more numerous septa and their occasional coverage by a mucilaginous tunica.
Type: China, Guangxi Province, Nanning, Longhushan, on dead stems of unidentified
broadleaf tree, 15 Nov. 2015, C.L. Yang (Holotype, HSAUP H7855; isotype, HMAS
245638).
ErymMo oey: In reference to the saprophytic habit on dead wood.
CoLonliEs on the natural substratum effuse, inosculating, hyaline or subhyaline,
twinkling. Mycelium superficial and immersed, composed of very long and
yellowish, mostly unbranched, aseptate, smooth hyphae. Conrp1a solitary,
broadly fusiform, straight or slightly curved, moniliform, sometimes covered
by a mucilaginous tunica, forming strings of eight cells, 7-septate, distinctly
constricted at the septa, with the 2 middle cells greatly enlarged, and guttulate
in every cell, globose or ellipsoidal, smooth, hyaline or subhyaline, the two
apical cells attenuated and sometimes triangular, with a rounded tip, 52.5-64
STE S17 tm,
ComMENTs—Among the known species, Blodgettia saprophytica slightly
resembles B. aquatica and B. indica in conidial shape. However, the conidia
of B. aquatica (32-52 x 15-25 um, 3-5-septate; Udaiyan 1992) and B. indica
(20-50 x 7.5-17.5 um, 3-5(-6)-septate; Subramanian 1954) are smaller and
have fewer septa than those of B. saprophytica. In addition, the conidia of
B. aquatica and B. indica are not covered by a mucilaginous tunica.
Uberispora tropicalis Bhat & W.B. Kendr., Mycotaxon 49: 73, 1993. FIG. 2
COLONIES on natural substrate effuse, brown, velvety. CONIDIOPHORES
mononematous, erect, straight or slightly flexuous, rarely branched, pale
brown, 3-7-septate, 40-120 x 2.5-4.8 um. CONIDIOGENOUS CELLS integrated,
terminal, monoblastic, cylindrical, almost colorless, 8-18 x 0.85-2.6 um.
Conip1a solitary, dry, septate, 17-22 um diam, with a central thick-walled,
dark brown, smooth, angular cell, 14-18 um diam, and 3 lateral, almost
colorless, conical cells with obtuse apices and truncate bases 7-14 x 8.5-12 um,
with a conico-truncate basal cell 1.5-4.5 x 1.3-2.6 um, often carrying the upper
27 eeF
i a
“ee
ve
99
Fic. 2. Uberispora tropicalis (HSAUP H9783). A. Conidiophores, conidiogenous cells,
and conidia. B. Conidia. C. Conidiophore and conidiogenous cell.
y
1
&
S
Blodgettia saprophytica sp. nov. (China) ... 911
portion of the conidiogenous cell as a basal frill, seceding rhexolytically, with
seceding conidia sometimes remaining attached to the side of the conidiophore
by a wall remnant.
SPECIMEN EXAMINED: CHINA, GUANGXI PROVINCE: subtropical forest of Lengshui, on
dead stems of unidentified broadleaf tree, 16 Nov. 2015, J.M. Gao (HSAUP H9783).
ComMENtTS—Uberispora tropicalis is reported for the first time from China.
The Chinese specimen closely matches the original description by Bhat &
Kendrick (1993), except that the Chinese specimen has a curved and much
narrower conidiogenous cell (0.85-2.6 um vs 2.5-3.5 um). However, in our
opinion they are basically the same species.
Acknowledgments
The authors express gratitude to Dr. Rafael F Castafieda-Ruiz and Dr. De-Wei Li for
serving as pre-submission reviewers and for their valuable comments and suggestions.
This project was supported by the National Natural Science Foundation of China (Nos.
31093440, 31230001, 31493010, 31493011, 31200013) and the Ministry of Science and
Technology of the People’s Republic of China (Nos. 2006FY 120100).
Literature cited
Bhat DJ, Kendrick WB. 1993. Twenty-five new conidial fungi from the Western Ghats and the
Andaman Islands (India). Mycotaxon 49: 19-90.
Harvey WH. 1858. Nereis Boreali- Americana. Part III, Chlorospermeae. Smithsonian Contributions
to Knowledge 10(2). 142 p.
McNeill J, Barrie FR, Buck WR, Demoulin V, Greuter W, Hawksworth DL, Herendeen PS, Knapp
S, Marhold K, Prado J, Prud’homme van Reine WF, Smith GF, Wiersema JH, Turland NJ. 2012.
International Code of Nomenclature for algae, fungi, and plants (Melbourne Code). Regnum
Vegetabile 154. http://www.iapt-taxon.org/nomen/main.php
Seifert K, Morgan-Jones G, Gams W, Kendrick B. 2011. The genera of hyphomycetes. CBS
Biodiversity Series 9. 997 p.
Stafleu FA, Bonner CEB, McVaugh R, Meikle RD, Rollins RC, Ross R, Schopf JM, Schulze GM,
Vilmorin R de, Voss EG. 1972. International Code of Botanical Nomenclature, adopted by
the Eleventh International Botanical Congress, Seattle, August 1969. Regnum Vegetabile 82.
426 p.
Subramanian CV. 1954. Fungi imperfecti from Madras-VI. Journal of the Indian Botanical Society
33: 36-42.
Udaiyan K. 1992 [“1991”]. Some interesting hyphomycetes from the industrial water cooling
towers of Madras. Journal of Economic and Taxonomic Botany 15(3): 627-647.
Wright EP. 1881. On Blodgettia confervoides of Harvey, forming a new genus and species of fungi.
Proceedings of the Royal Irish Academy 28: 21-26.
Xia JW, Ma LG, Castafieda-Ruiz RE, Zhang XG. 2014. A new species of Sporidesmiopsis and three
new records of other dematiaceous hyphomycetes from southern China. Nova Hedwigia
98(1-2): 103-111. http://dx.doi.org/10.1127/0029-5035/2013/0145
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 © 2016. Mycotaxon, Ltd.
October-December 2016—Volume 131, pp. 913-923
http://dx.doi.org/10.5248/131.913
New record of Beauveria pseudobassiana from Morocco
ABDESSAMAD IMOULAN”” , YI L1®3, WEN-JING WANG’,
ABDELLATIF EL MEZIANE? & YI-JIAN YAO”
'State Key Laboratory of Mycology, Institute of Microbiology, Chinese Academy of Sciences,
Beijing 100101, China
? Cadi-Ayyad University, Faculty of Science and Techniques, Marrakesh 40000, Morocco
° College of Plant Protection, Fujian Agriculture and Forest University,
Fuzhou, 350002, China
* CORRESPONDENCE TO: [email protected]; [email protected]
ABSTRACT—Two species of Beauveria were identified from isolates obtained from endemic
Argania spinosa forests in Morocco, using both morphological characteristics and molecular
data. Although isolates exhibited similar reproductive structures, ITS-rDNA_ based
phylogenetic analysis grouped the Moroccan isolates into two clades with known sequences
of either B. bassiana or B. pseudobassiana. Morphological comparison of the colonies
distinguished the two groups of isolates, in full agreement with the ITS phylogenetic analysis.
Beauveria pseudobassiana is recorded for the first time in Morocco.
KEY worDs—Ascomycetes, entomopathogenic fungus, taxonomy
Introduction
Beauveria Vuill. (Cordycipitaceae, Hypocreales) is a genus of cosmopolitan
entomopathogenic fungi found in various types of habitats and ecosystems
(Meyling & Eilenberg 2007). Its species are known to infect a wide range of
insects from many different orders in natural and agricultural environments
(Roy et al. 2010). Preparations from B. bassiana have been developed and
commercialized as biological control agents (Zimmermann 2007). Other
Beauveria species hold great potential for the discovery of mycoinsecticidal
effect (Thomas & Read 2007) and the production of different bioactive and
pathogenetic compounds (Ames & Walsh 2010). Traditionally Beauveria
species have been identified principally by conidial morphology. However,
914 ... Imoulan & al.
the extensive overlap in morphological characters complicates and limits their
usefulness for species identification. Furthermore, the discovery of cryptic
species using molecular markers (Rehner & Buckley 2005, Ghikas et al. 2010,
Rehner et al. 2011, Meyling et al. 2012) makes species identification a challenge
within the genus (Fisher et al. 2011). Accordingly, accurate identification,
including phylogenetic analyses, has been significantly improved using
molecular methods (Rehner et al. 2011).
Through ITS and EF1-alpha sequence analyses, Rehner & Buckley (2005)
demonstrated that the morphospecies B. bassiana was not monophyletic
but comprised two morphologically indistinguishable clades that have been
recently recognized as separate species (Rehner et al. 2011, Meyling et al.
2012). Recently, robust molecular phylogenies based on multi-loci sequences
have resolved 12 well-supported terminal lineages within Beauveria (Rehner
et al. 2011). Similarly, recent sequence analyses have resulted in the recent
description of four new species (Zhang et al. 2012, Chen et al. 2013, Agrawal et
al. 2014, Robéne-Soustrade et al. 2015).
In a previous study of entomopathogenic fungi in forests of endemic Argania
spinosa (L.) Skeels (Sapotaceae) in Morocco, Beauveria and Metarhizium
species were found but only a few isolates were identified as B. bassiana using
molecular analysis of the internal transcribed spacer regions of ribosomal DNA
(ITS-rDNA) sequences (Imoulan et al. 2011). The present study aims to adapt
the phylogenetic species recognition concept (Rehner et al. 2011) by identifying
the strains obtained from the Moroccan forests based on both morphological
and molecular analyses.
Materials & methods
Fungal isolates, growth conditions, and morphological observation
Beauveria isolates were recovered from soil samples collected from Argania spinosa
forests in Morocco using a Galleria mellonella baiting method and maintained on Potato
Dextrose Agar (PDA) slants at 4°C in complete darkness (Imoulan et al. 2011). The
designation of isolates and their geographical origin are given in TaBLE 1. To establish
monosporic cultures, conidial suspensions of 1 x 10° conidia ml' were prepared from
fungal cultures grown on PDA for 2 weeks and plated on PDA plates. The single colony
propagated from single conidia was transferred into a new PDA dish and incubated at
25°C. Dried agar culture vouchers were deposited in Herbarium Mycologium, Chinese
Academy of Sciences, Beijing, China (HMAS).
Microscopic measurements of conidia were taken from slide-cultures produced by
inoculating a small amount of mycelium on a block of the appropriate nutrient agar
overlaid by a cover slip. Images were acquired using an AxioCam MRc digital camera
on a Zeiss AxioScope microscope. Microscopic measurements were performed with
Beauveria pseudobassiana new to Morocco ... 915
TABLE 1. Beauveria and Cordyceps strains and ITS sequences used in phylogenetic
analysis. GenBank numbers in bold are newly generated sequences.
SPECIES
B. pseudobassiana
B. bassiana
B. australis
B. brongniartii
B. asiatica
B. sungii
B. malawiensis
B. vermiconia
B. caledonica
B. amorpha
B. rudraprayagi
B. varroae
B. sinensis
B. lii
B. kipukae
C. militaris
STRAIN
2706
2629
2634
2640
2649
2650
2653
2659
2660
2661
2687
2689
2645
ARSEF1855
ARSEF3405 (T)
ARSEF6229
2721
2718
ARSEF1040
ARSEE751
ARSEF1564 (T)
ARSEF4622
ARSEF4598 (T)
ARSEF617 (T)
ARSEE7058
ARSEE7517
ARSEF4850 (T)
ARSEF4384
ARSEF 1685 (T)
ARSEE7279
ARSEE7760
BCC17613
ARSEF2922 (T)
ARSEF2251
AESEF2567 (T)
ARSEEF2641 (T)
ARSEF4149
MTCC8017 (T)
ARSEF8257 (T)
ARSEF8259
RCEF3903 (T)
RCEF5500 (T)
ARSEEF7032 (T)
ARSEF5050
LOCALITY
Morocco
Morocco
Morocco
Morocco
Morocco
Morocco
Morocco
Morocco
Morocco
Morocco
Morocco
Morocco
Morocco
Canada
USA
China
Morocco
Morocco
Japan
Vietnam
Italy
Australia
Australia
France
USA
Japan
Korea
China
Korea
Korea
Malawi
Australia
Chile
Brazil
Scotland
Brazil
Australia
India
France
France
China
China
USA
USA
Host/SUBSTRATE
Soil
Soil
Soil
Soil
Soil
Soil
Soil
Soil
Soil
Soil
Soil
Soil
Soil
Coleoptera: Scolytidae
Lepidoptera: Tortricidae
Coleoptera: Scolytidae
Soil
Soil
Lepidoptera: Bombycidae
Coleoptera: Chrysomelidae
Lepidoptera: Arctiidae
Orthoptera: Acridiidae
Soil
Coleoptera: Scarabaeidae
Hymenoptera: Formicidae
Coleoptera: Scarabaeidae
Coleoptera: Cerambycidae
Coleoptera: Scarabaeidae
Coleoptera: Scarabaeidae
Coleoptera: Scarabaeidae
Coleoptera: Cerambycidae
Soil
Coleoptera
Soil
Hymenoptera: Formicidae
Coleoptera: Scarabaeidae
Silkworm
Acari: Varroidae
Acari: Varroidae
Lepidoptera: Geometridae
Coleoptera: Coccinellidae
Homoptera: Delphacidae
Lepidoptera
GENBANK NO.
KU364339
KU364340
KU364341
KU364342
KU364343
KU364344
KU364345
KU364346
KU364347
KU364348
KU364349
KU364350
KU364351
HQ880796
AY532022
HQ880799
KU364352
KU364353
AY531972
AY532045
HQ880761
HQ880788
HQ880789
HQ880776
HQ880773
HQ880767
AY531936
AY532026
AY531990
HQ880813
DQ376247
HQ880824
AY532012
AY532003
AY532006
AY532008
HQ880804
JQ266173
HQ880800
HQ880801
HQ270152
JN689372
HQ880803
HQ880829
916 ... Imoulan & al.
AxioVision Rel. 4.6 software (Zeiss, Welwyn Garden City, UK). Length : width ratios
are given as Q, and mean values are indicated by L™ (length), W™ (width), and Q™ (Q).
Genomic DNA extraction, PCR and sequencing
Isolates recovered from single conidia were grown as mycelia for 2 weeks in 250-ml
flasks containing 100ml of potato dextrose broth. Cultures were then shaken at 150 rpm
on a rotary shaker at 25°C for 7d in darkness. The mycelial samples were pelleted from
liquid cultures by centrifugation for 10 min at 3500 rpm (Eppendorf AG Centrifuge,
Hamburg), subsequently washed twice with sterile double distilled water, and then
lyophilized and stored at -80°C.
For each isolate, 400—500mg of lyophilized mycelium was ground in a sterile mortar
using a pestle. Total genomic DNA was extracted following the modified CTAB method
described by Yao et al. (1999). The mixtures were incubated for 2 hours at 65°C, then
extracted twice with 24 : 1 chloroform : isoamy] alcohol, and centrifuged at 10,000 rpm
at 4°C for 15 min. The supernatant was transferred to a clean tube and mixed with 1/10
volume of sodium acetate (3 M, pH 5.2). Total genomic DNA was precipitated by adding
2/3 (v/v) of cold isopropanol and chilled overnight at -20°C. DNA was recovered by
centrifugation at 10,000 rpm, 4°C for 10 min and washed twice with 70% alcohol, dried
at room temperature and resuspended in TE buffer (10Mm Tris-HCl, pH 8.0; lmM
EDTA, pH 8.0). The extracted DNA was stored at -20°C until use.
Genomic DNA was used as template for PCR amplification of ITS region using
universal primers ITS5/ITS4 (White et al. 1990). The PCR reactions were performed
in a final volume of 50 ul containing 25ul 2x Taq PCR Master Mix (Tiangen Biotech
Co., Ltd, China), 0.5 ul of each primer (10 uM), 1 ul of genomic DNA and 23 ul of
RNase-Free water. The PCR reactions were performed in a GeneAmp PCR System 9700
thermocycler (Applied Biosystems) as follows: 94°C for 5 min, followed by 35 cycles of
94°C for 30 s, 53°C for 30 s, 72°C for 45 s and final extension step of 72°C for 8 min. PCR
products were checked by electrophoresis on an agarose gel (1%) at 100 V in 0.5x TAE
buffer (40 mM Tris-Acetic acid, pH 8.0, 1 mM EDTA), and sequenced with the same
primer pairs. The sequencing was performed at Beijing Genomics Institute (Beijing,
China) by using an Applied Biosystems 3730 Analyzer capillary sequencer (Foster
City, CA, USA). All sequences generated in this study (KU364339-KU364353) were
submitted to GenBank (TABLE 1).
Phylogenetic and data analyses
Only two (of 100) B. bassiana strains sequenced for ITS from Morocco were used
as representatives, while all Moroccan strains identified as B. pseudobassiana were
included in the analyses. Also included were 29 representative Beauveria sequences
and one sequence of Cordyceps militaris (ARSEF 5050; as outgroup) retrieved from
GenBank (TABLE 1). The sequences were aligned using ClustalW Multiple alignment
tool (Thompson et al. 1997) and edited manually to avoid some obvious misalignment
using BioEdit ver. 7.2.5 (Hall 1999).
The sequence data set was analyzed for maximum parsimony (MP) and Bayesian
inference (BI). MP analyses were conducted with PAUP* 4.0b10 (Swofford 2003) and
Beauveria pseudobassiana new to Morocco ... 917
executed with 1000 replicates of heuristic search option of random sequence additions
with branch swapping algorithm by tree bisection reconnection (TBR). Alignment gaps
were treated as missing data, and all characters were unordered and equally weighted.
Branch support was estimated by bootstrap analysis with 1,000 replicates (Felsenstein
1985) executing the same search strategy as described above. Bayesian inference (BI)
analyses were carried out in MrBayes 3.1.2 (Ronquist & Huelsenbeck 2003) using
a general time-reversible model and gamma-distributed rate variation to account
for rates of variation across sites, with a proportion of invariant sites. The remaining
parameters were default values. One tree was saved every 1,000 generations from a total
of 5,000,000 Markov chain Monte Carlo (MCMC) generations; the first 25% of the trees
were discarded as burn-in. Clades with bootstrap values for MP =50% and Bayesian
posterior probability =>70% are labeled above the nodes in the phylogenetic tree.
Results
Morphological observation
Microscopically Beauveria isolates from Morocco appeared typical to those
described elsewhere (e.g., Humber 1997, Rehner et al. 2005). The colony
characteristics were: white or pale-yellow mycelium closely (or not) appressed
to agar surface, becoming farinaceous during sporulation and the reverse side
uncoloured or yellowish white (Fics 1, 2). Conidiophores appeared like dense
spherical clusters of subglobose to flask-shaped conidiogenous cells extending
upward with an elongating sympodial denticulate rachis (zigzag appearance)
giving rise to sessile, hyaline, holoblastic smooth conidia (Fics 3, 4). Two
isolate groups were morphologically distinguished based on the colony colour
as shown by aerial hyphae during conidiation: off-white and loosely floccose vs.
yellowish-brown and densely farinaceous (Fics 1, 2).
Phylogenetic analyses
The amplification of ITS-rDNA region produced a uniform fragment size of
560bp. Using Blast search, the sequences exhibited high sequence homology to
those named B. bassiana or B. pseudobassiana in GenBank.
The ITS dataset comprised 571 characters after the exclusion of ambiguous
positions from both ends. There were 488 constant, 37 parsimony-
uninformative, and 46 parsimony-informative characters. The heuristic search
yielded six most-parsimonious trees with tree length (L) = 139, consistency
index (CI) = 0.719, homoplasy index (HI) = 0.281, retention index (RI) = 0.807.
MP and BI phylogenetic analyses produced trees with similar topologies
that resolved most Beauveria lineages in separate terminal branches (Fic. 9).
Independently of the algorithm used for phylogenetic analyses, B. brongniartii
and B. australis were not well distinguished as unique clusters based on
ITS-rDNA sequences.
918 ... Imoulan & al.
Moroccan strains of Beauveria were grouped into two individual terminal
clades corresponding to B. bassiana and B. pseudobassiana with MP bootstrap
support 276% and BI posterior probabilities >99% (Fic. 9). These two groups
corresponded well to their colony colours, off-white in the B. bassiana clade
and yellowish-brown in the B. pseudobassiana clade.
Taxonomy
Imoulan et al. (2011) previously reported Beauveria bassiana from Morocco.
Here we describe B. pseudobassiana as a new record for Morocco.
Beauveria pseudobassiana S.A. Rehner & Humber, Mycologia 103: 1068
(2011) Fics 2-8
Colonies growing fairly well on PDA at 25°C in the dark, reaching a diameter
of 28-37 mm after 7 days incubation, and attaining a diameter of 36—42mm
in 10 days; velutinous to cottony with an overgrowth of aerial hyphae up to
the agar surface, white first and changing to yellowish-brown or pale yellow;
becoming less powdery in older cultures and rarely with a dense farinaceous
surface layer. Reverse side yellow with white margin. Vegetative hyphae septate,
branched, hyaline, smooth-walled, 1-3 um wide. Conidiogenous cells solitary
but usually consisting of dense lateral clusters, base subspherical to flask-shaped
(sometimes ampulliform), 2.0—-9.0 x 1.5-3 um, apex with an indeterminate
denticulate rachis, produced laterally on aerial hyphae or from subtending
cells. Conidia globose to subglobose, 2—4 x 1-3.5 um, Q = 1-2.5 (L™ = 2.6 um,
W” = 2.1 um, Q™ = 1.4), rarely ellipsoid; hyaline, walls thin and smooth;
produced from conidiogenous cells and occasionally directly from hyphal tips
or laterally from hyphae.
MATERIAL EXAMINED: MOROCCO, Ovypa; from soil under Argania spinosa tree, 23
March 2009, coll. A. Imoulan, strain numbers 2629, 2634, 2640, 2645, 2649, 2650, 2653,
2659, 2660, 2661 (HMAS 254118-254127, dried agar cultures); Tamanar, 28 March
2009, coll. A. Imoulan, strain numbers 2687, 2689 (HMAS 254128-254129, dried agar
cultures); Amskroud, 29 March 2009, coll. A. Imoulan, strain number 2706 (HMAS
254131, dried agar culture).
REMARKS: Beauveria pseudobassiana from Morocco differed from B. bassiana
by its colony surface, which is yellowish-brown to pale yellow (Fic. 2)
becoming less powdery when old, and by its occasional production of ellipsoid
conidia (Fic. 7). The colony surface of B. bassiana is usually white to off-white
Fics 1-8. Beauveria bassiana (strain 2718): 1. colony and aerial hyphae. Beauveria pseudobassiana
(strain 2629): 2. colony and aerial hyphae; 3-8. conidiophores, conidiogenous cells, and conidia —
note conidiogenous cell produced from subtending cells (6), conidia forming from a hyphal tip (7),
and conidia produced directly from mycelium (8). Scale bars: 1, 2 = 10 mm; 3-8 = 5 um.
Beauveria pseudobassiana new to Morocco ... 919
920 ... Imoulan & al.
(Fic. 1) becoming powdery when old, owing to the production of a large
number of globose to subglobose conidia.
Discussion
The study of mycology in Morocco is less developed with few works being
published on Moroccan fungi, particularly on entomopathogenic fungi
(Imoulan et al. 2011, Imoulan & El Meziane 2013). The new species record
for Morocco reported here demonstrates that B. pseudobassiana occurs in
A. spinosa forests along with other entomopathogenic fungi such as B. bassiana,
Metarhizium anisopliae, and Paecilomyces lilacinus identified previously by
Imoulan et al. (2011).
As shown in the most recent taxonomic revision based on the phenotypic
criteria combined with molecular evidence (Rehner & Buckley 2005, Rehner
et al. 2011), B. pseudobassiana and B. bassiana comprise a morphospecies
group, morphologically indistinguishable yet phylogenetically only distantly
related. Interestingly, our morphological observation nonetheless revealed that
characters of both colony and conidial spores were sufficient to discriminate
the two species. As these morphological distinctions have not been mentioned
elsewhere, it is unclear whether our experience represents an unusual case or
if it is possible to find additional characters to distinguish Beauveria species
morphologically. It would be very useful if such characters could support
DNA-based phylogenies in Beauveria.
In the current study, ITS-rDNA-based phylogenetic analyses succeed in
distinguishing B. bassiana and B. pseudobassiana among the species analyzed.
Because Beauveria includes cryptic species that cannot be resolved solely
by ITS analyses, multilocus-based phylogenies are becoming increasingly
important for accurate assignment of strains to specific clades. Molecular
phylogenies involving multiple genes of translation elongation factor-1a (TEF),
RNA polymerase II largest subunit (RPB1), RNA polymerase II second largest
subunit (RPB2), and the Bloc nuclear intergenic have become well-established
for determining unique terminal lineages for all Beauveria species (Rehner
et al. 2011, Zhang et al. 2012, Chen et al. 2013, Agrawal et al. 2014, Robéne-
Soustrade et al. 2015). However, our ITS sequence analyses performed well in
distinguishing 12 of the 15 species included, with B. australis and B. brongniartii
grouping in a single unresolved clade, and B. rudraprayagi (MTCC8017)
grouping with B. pseudobassiana (Fic. 9). Although the additional genes are
required in resolving closed related species, ITS sequence is still powerful in
identifying most of the known species of Beauveria as shown in Fie. 9.
Beauveria pseudobassiana new to Morocco ... 921
2718
2533
2721
7659 ARSEF 1020 B. bassiana
7795
ARSEF 1564
ARSEF 751
ARSEF 1567
B. caledonica
1OO'100 ARSEF 2251
ARSEF 2922 __» B. vermiconia
soo. | ARSEF 2641 Bp omorgha
ARSEF 4149
43 Moroccan
$5100 strains é ete
55:73 ARSEF 1855 o PAGER Y Ore Rt
ARSEF
ARSEF 3.405 ,
MTCC 3017 __, B. rudrapravagi
52:59 | ARSEF 1685 B. sungii
723 ARSEF 7279
6599 RCEF 3903 —__» B. sinensis
toorco | ANSEF 775 B. malawiensis
5oC 17613
ARSEF 7032 ——-+» B. kipukae
135 ARSEF £334 Basiarica
ARSEF £69)
RSEF .
vax | ARSEF 4553] australis
oat ARSEF 4822
ARSEF 617
ARSEF 7053 B. brongniatii
ARSEF 7517
age | ARSEF 8257
ARSEF 8259
B. varroas
RCEF 5500 ——-» B. li
ARSEFSOSO Cordvceps militaris
— icange
Fic. 9. Phylogenetic tree of Beauveria based on Maximum parsimony and Bayesian inference of the
ITS-rDNA sequences. Bootstrap values >50% and posterior probabilities >70% are labeled above
branches and separated by /. Terminal clades are labeled according to ARSEF accession numbers
of individual isolates reported in Rehner et al. (2011) except RCEF5500 and RCEF3903 (Zhang et
al. 2012, Chen et al. 2013).
922 ... Imoulan & al.
Acknowledgments
The authors are very thankful to Dr Nicolai V. Meyling and Pavel Hyrsl for providing
Galleria mellonella used in the isolation of Beauveria spp. from soil. We are grateful to
Drs Paul Kirk and Bo Huang for reviewing the manuscript. This work was financially
supported by a grant to AI from the World Academy of Sciences and Chinese Academy
of Sciences.
Literature cited
Agrawal Y, Mual P, Shenoy BD. 2014. Multi-gene genealogies reveal cryptic species Beauveria
rudraprayagi sp. nov. from India. Mycosphere 5: 719-736.
Ames BD, Walsh CT. 2010. Anthranilate-activating modules from fungal nonribosomal peptide
assembly lines. Biochemistry 49: 3351-3365. http://dx.doi.org/10.1021/bil00198y
Chen MJ, Huang B, Li ZZ, Spatafora JW. 2013. Morphological and _ genetic
characterisation of Beauveria sinensis sp. nov. from China. Mycotaxon 124: 301-308.
http://dx.doi.org/10.5248/124.301
Felsenstein J. 1985. Confidence limits on phylogenies: An approach using the bootstrap. Evolution
39: 783-791. http://dx.doi.org/10.2307/2408678
Fisher JJ, Rehner SA, Bruck DJ. 2011. Diversity of rhizosphere associated entomopathogenic
fungi of perennial herbs, shrubs and coniferous trees. Journal of Invertebrate Pathology 106:
289-295. http://dx.doi.org/10.1016/j.jip.2010.11.001
Ghikas DV, Kouvelis VN, Typas MA. 2010. Phylogenetic and biogeographic implications inferred
by mitochondrial intergenic region analyses and ITS1-5.8S-ITS2 of the entomopathogenic
fungi Beauveria bassiana and B. brongniartii. BMC Microbiology 10: 174.
Hall TA. 1999. Biokdit: a user-friendly biological sequence alignment editor and analysis program
for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95-98.
Humber RA. 1997. Fungi: identification. 153-185. in LA Lacey (eds.), Manual of techniques in
insect pathology. San Diego: Academic Press.
http://dx.doi.org/10.1016/B978-012432555-5/50011-7
Imoulan A, El Meziane A. 2013. Pathogenicity of Beauveria bassiana isolated from
Moroccan Argan forests soil against larvae of Ceratitis capitata (Diptera: Tephritidae) in
laboratory conditions. World Journal of Microbiology and Biotechnology 30: 959-965.
http://dx.doi.org/10.1007/s11274-013-1514-y
Imoulan A, Alaoui A, El Meziane A. 2011. Natural occurrence of soil-borne entomopathogenic
fungi in the Moroccan endemic forest of Argania spinosa and their pathogenicity to
Ceratitis capitata. World Journal of Microbiology and Biotechnology 27: 2619-2628.
http://dx.doi.org/10.1007/s11274-011-0735-1
Meyling NV, Eilenberg J. 2007. Ecology of the entomopathogenic fungi Beauveria bassiana and
Metarhizium anisopliae in temperate agroecosystems: potential for conservation biological
control. Biological Control 43: 145-155. http://dx.doi.org/10.1016/j.biocontrol.2007.07.007
Meyling NV, Pilz C, Keller S, Widmer F, Enkerli J. 2012. Diversity of Beauveria spp. isolates from
pollen beetles Meligethes aeneus in Switzerland. Journal of Invertebrate Pathology 109: 76-82.
http://dx.doi.org/10.1016/j.jip.2011.10.001
Rehner SA, Buckley E. 2005. A Beauveria phylogeny inferred from nuclear ITS and EF1-alpha
sequences: evidence for cryptic diversification and links to Cordyceps teleomorphs. Mycologia
97(1): 84-98. http://dx.doi.org/10.3852/mycologia.97.1.84
Beauveria pseudobassiana new to Morocco ... 923
Rehner SA, Minnis AM, Sung G-H, Luangsa-Ard JJ, Devotto L, Humber RA. 2011. Phylogeny
and systematics of the anamorphic, entomopathogenic genus Beauveria. Mycologia 103(5):
1055-1073. http://dx.doi.org/10.3852/10-302
Robéne-Soustrade I, Jouen E, Pastou D, Payet-Hoarau M, Goble T, Linderme D, Lefeuvre P, Calmés
C, Reynaud B, Nibouche S, Costet L. 2015. Description and phylogenetic placement of Beauveria
hoplocheli sp. nov. used in the biological control of the sugarcane white grub, Hoplochelus
marginalis, on Reunion Island. Mycologia 107(6): 1221-1232. https://doi.org/10.3852/14-344
Ronquist F, Huelsenbeck JP. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed
models. Bioinformatics 19: 1572-1574. http://dx.doi.org/10.1093/bioinformatics/btg180
Roy HE, Vega FE, Chandler D, Goettel MS, Pell JK, Wajnberg E. 2010. The Ecology of Fungal
Entomopathogens. Springer Verlag. http://dx.doi.org/10.1007/978-90-481-3966-8
Swofford DL. 2003. PAUP”: phylogenetic analysis using parsimony (*and other methods). Version
4. Sunderland, Massachusetts: Sinauer Associates.
Thomas MB, Read AF 2007. Can fungal biopesticides control malaria? Nature Reviews
Microbiology 5: 377-383.
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. 1997. The Clustal X windows
interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.
Nucleic Acid Research 24: 4876-4882. http://dx.doi.org/10.1093/nar/25.24.4876
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of
fungal ribosomal RNA genes for phylogenetics. 315-322, in: MA Innis et al. (eds).
PCR protocols: a guide to methods and applications. San Diego: Academic Press.
http://dx.doi.org/10.1016/B978-0-12-372180-8.50042-1
Yao Y-J, Pegler DN, Chase MW. 1999. Application of ITS (nrDNA) sequences in
the phylogenetic study of Tyromyces s.l. Mycological Research 103: 219-229.
http://dx.doi.org/10.1017/S0953756298007138
Zhang SL, He LM, Chen X, Huang B. 2013. Beauveria lii sp. nov. isolated from Henosepilachna
vigintioctopunctata. Mycotaxon 121: 199-206. http://dx.doi.org/10.54248/121.199
Zimmermann G. 2007. Review on safety of the entomopathogenic fungi Beauveria bassiana and
Beauveria brongniartii. Biocontrol Science and Technology 17: 553-596.
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 © 2016. Mycotaxon, Ltd.
October-December 2016— Volume 131, pp. 925-937
http://dx.doi.org/10.5248/131.925
New records of Graphis from Cameroon,
with a key to African species of Graphis
SANTOSH JOSHI’, D.K. UPRETI', ANDREW ENOW EGBE? & JAE-SEOUN HuR?*
'Lichenology Laboratory, CSIR-National Botanical Research Institute,
Rana Pratap Marg, Lucknow (UP)-226001, India
? Life Sciences Laboratories, Faculty of Science, University of Buea,
PO. Box 63, Buea, Cameroon
*Korean Lichen Research Institute, Sunchon National University, Suncheon-540 950, Korea
* CORRESPONDENCE TO: [email protected]
ABSTRACT—New records of Graphis species are reported from Cameroon, West Africa:
G. ajarekarii, G. alboglaucescens, G. brahmanensis, G. daintreensis, G. exalbata, G. gloriosensis,
G. gonimica, G. handelii, G. immersella, G. novopalmicola, G. pseudoaquilonia, and
G. supracola. The material was collected in the tropical rain forests of Mount Cameroon. The
diagnostic characters of the species are briefly discussed and illustrated. An artificial key is
provided to facilitate identification of Graphis species known from the African Palaeotropics.
Key worps—corticolous, crustose lichens, taxonomy, Graphidaceae, Ostropales
Introduction
Mount Cameroon (ca. 4°N 9°E) is the highest mountain (4095 m) in West
Africa, being located near the Gulf of Guinea in the Southwest Region of
Cameroon (Fonge et al. 2005, Proctor et al. 2007). The Mount Cameroon region
has a diversity of complex ecosystems due to frequent disturbances, (especially
volcanic activities) that have made it possible to study different successional
stages in a relatively confined area (Focho et al. 2010). The western rain forests
of Africa, despite having luxuriant forests with high organismic diversity,
are little explored in terms of lichen diversity (including the Graphidaceae)
compared to the Eastern Palaeotropics in Asia.
In the course of an ongoing research project, crustose lichens, particularly
graphidoid representatives, were collected from rainforests at different
926 ... Joshi & al.
elevations at Mount Cameroon. The thelotremoid lichens in the Graphidaceae
have been exhaustively studied in the region (Frisch et al. 2006); however, no
detailed account on graphidoid taxa from this region is available and only
scattered reports from the African Palaeotropics exist in the literature for this
group (Miller 1890, Staiger 2002, Liicking et al. 2009).
Here we report twelve new species representing the genus Graphis Adans.
collected in the Mount Cameroon area: G. ajarekarii, G. alboglaucescens,
G. brahmanensis, G. daintreensis, G. exalbata, G. gloriosensis, G. gonimica,
G. handelii, G. immersella, G. novopalmicola, G. pseudoaquilonia, and
G. supracola. We also present an artificial key to the species of Graphis known
from the African Palaeotropics.
Materials & methods
During January 2015 a field excursion organized by Prof. Andrew Enow Egbe,
University of Buea, targeted one area in the Mount Cameroon region, Federal
Republic of Cameroon. Lichen specimens are deposited in the lichen herbarium of
the Korean Lichen Research Institute, Suncheon, South Korea (KoLRIJ), and duplicates
are preserved in the Faculty of Science in the University of Buea, Cameroon. Samples
were studied in CSIR-National Botanical Research Institute, Lucknow, India. The
material was examined for morpho-anatomical and chemical features using a MSZ-
TR dissecting microscope and a Leica DM 500 compound microscope. The protocol
for color spot reaction tests and thin-layer chromatography (TLC) was derived from
Orange et al. (2010). Thin-layer chromatography was performed in solvent systems A
[toluene (180): 1, 4-dioxane (45): acetic acid (5)] and C [toluene (170): acetic acid (30)].
Lugol's solution (I) was used to check amyloidity of the ascospores. Illustrations were
prepared using Corel Draw (vers. 12).
Taxonomy: new records
Graphis ajarekarii Patw. & C.R. Kulk., Norw. J. Bot. 26: 45, 1979. Dirk
Thallus epiperidermal, slightly uneven, dull to + glossy, <250 um thick;
prothallus dark brown; lirellae immersed to erumpent, strongly branched,
1-2 cm long, with a lateral to apically thin complete thalline margin; disc
concealed; labia entire, epruinose; proper exciple laterally carbonized becoming
completely carbonized in old lirellae, 50-70 um thick; epihymenium brownish
and granular, 15-20 um high; hymenium hyaline, clear, 90-100 um high;
subhymenium 20-30 um high; asci 8-spored, 100-130 x 20-25 um; ascospores
fusiform, transversely septate, 8-10-locular, amyloid, 28-48 x 8-11 um.
CHEMISTRY—Norstictic and stictic acids detected with TLC.
DISTRIBUTION & ECOLOGY—Found growing in association with other
graphidoid taxa on rough barked trees at higher altitudes.
Graphis spp. new to Cameroon ... 927
SPECIMEN EXAMINED: CAMEROON. SOUTHWEST PROVINCE: Mount Cameroon,
4°09’01”N 9°17'02”E, on bark, 25 February 2015, J-S. Hur CR150020 (KoLRI).
REMARKS—Graphis filiformis Adaw. & Makhija, which otherwise resembles
G. ajarekarii in producing norstictic acid and small ascospores, lacks stictic
acid. Graphis ajarekarii was previously known from the Eastern Palaeotropics
(Licking et al. 2009).
Graphis alboglaucescens Adaw. & Makhija, Mycotaxon 99: 312, 2007. PL. 1B
Thallus epiperidermal, ecorticate, farinose, greenish-white to glaucous
green; lirellae immersed, elongate (1-2 cm long) and irregularly branched with
lateral thalline margin; disc slightly exposed, white pruinose (scripta-morph);
labia entire; proper exciple apically carbonized, 30-40 um thick; epihymenium
brownish, granular, 10-15 um high; hymenium hyaline and clear, 90-100 um
high; subhymenium indistinct; asci 8-spored; ascospores fusiform, transversely
septate, 5-10-locular, amyloid, 24-26 x 4-6 um.
CHEMISTRY—Norstictic acid detected with TLC.
DISTRIBUTION & ECOLOGY—Found in small patches on hard and rough
barked trees in evergreen forests at higher altitudes.
SPECIMEN EXAMINED: CAMEROON. SOUTHWEST PROVINCE: Mount Cameroon,
4°07'26”N 9°11'17’E, alt. ca. 1200 m on bark, 26 February 2015, J-S. Hur CR150067
(KoLRI).
REMARKS—In its anatomy, G. alboglaucescens resembles G. glaucescens Fée,
which is distinguished by its lack of secondary metabolites and occasionally
striate labia. Graphis alboglaucescens was originally described as producing
lirellae covered up to the top by a thalline margin (Adawadkar & Makhija
2007), a character Licking et al. (2009) later defined as a lateral thalline margin.
The species exhibits a pantropical distribution (Licking et al. 2009).
Graphis brahmanensis Aptroot, Lichenologist 41: 434, 2009. PRTC
Thallus epiperidermal, thin, pale-brown, fawn to off-white, 80-100 um,
evanescent, indistinctly corticate reflecting bark; algal layer continuous, 28-30
um thick; medulla mostly endoperidermal; lirellae prominent, 1-1.5 cm long,
sparsely and irregularly branched with basal thalline margin (striatula-morph);
labia striate (3-4-striations), epruinose; proper exciple laterally carbonized,
50-100 um thick; epihymenium brownish, 10-15 um high; hyaline and clear;
hymenium 90-100 um high; subhymenium 10-15 um high; asci 8-spored;
ascospores fusiform, transversely septate, 5-8-locular, amyloid, 25-30 x 6-8
um.
CHEMISTRY—Stictic acid detected with TLC.
928 ... Joshi & al.
DISTRIBUTION & ECOLOGY—Found growing in association with other
corticolous lichen taxa at low altitudes on smooth barked trees of tropical rain
forests.
SPECIMEN EXAMINED: CAMEROON. SOUTHWEST PROVINCE: Mount Cameroon,
4°05’41”N 9°22’24’E, alt. ca. 100 m, on bark, 26 February 2015, J-S. Hur CR150072
(KoLRI).
REMARKS—In most characters, G. brahmanensis resembles G. vittata Mull.
Arg., which differs in producing lirellae with a lateral thalline margin. The
otherwise similar G. duplicata Ach. lacks secondary compounds.
Graphis brahmanensis was previously known from the Neotropics,
(particularly in the southeastern USA) and Eastern Palaeotropics (Lticking et
al. 2009).
Graphis daintreensis (A.W. Archer) A.W. Archer, Telopea 11: 72, 2005. PL. iD
Thallus epiperidermal, silver-gray to greenish gray or whitish-gray, off-
white, glossy, uneven, 200-250 um thick, corticate; cortex continuous, 20-30
uum thick; algal layer 40-140 um thick, embedded with large and small crystals;
indistinct to endoperidermal medulla; indistinct to off white prothallus; lirellae
elongate (1-2 cm long), densely and irregularly branched, prominent with basal
thalline margin (hossei-morph); disc concealed; labia entire and epruinose;
proper exciple laterally carbonized, 40-60 um thick; epihymenium brownish,
crystalline, 15-20 um high; hymenium hyaline and clear, 130-150 um high;
subhymenium indistinct; asci broadly clavate, 1-spored, 110-120 x 25-30 um;
ascospores muriform, multi-celled, amyloid, 60-90 x 20-25 um.
CHEMISTRY—No chemicals detected with TLC.
DISTRIBUTION & ECOLOGY—In Cameroon, this taxon was collected from
the rainforests at very low altitudes, and was found growing in large patches on
rough barked trees.
SPECIMEN EXAMINED: CAMEROON. SOUTHWEST PROVINCE: Mount Cameroon,
4°04’09”N 9°22’36’E, alt. ca. 30 m, on bark, 26 February 2015, J-S. Hur CR150081
(KoLRI).
REMARKS—Graphis nanodes Vain., which resembles G. daintreensis in most
taxonomic characters, differs in its lirellae with lateral thalline margins
(lineola-morph) and smaller ascospores (<50 um long).
Graphis daintreensis was previously known only from the Eastern
Palaeotropics (Licking et al. 2009).
Graphis exalbata Nyl., Lich. Ins. Guin.: 28, 1889. PL. 1E
Thallus epiperidermal, whitish, smooth to slightly uneven, glossy, indistinctly
verruculose, continuous, ecorticate, 100-200 um, and embedded with crystals;
Graphis spp. new to Cameroon ... 929
algal layer <90 um thick, embedded with crystals; medulla endoperidermal;
prothallus indistinctly whitish; lirellae + immersed to erumpent, elongate
(1-2 cm long), radially branched with lateral thalline margin; disc concealed;
labia indistinctly striate, white pruinose (glaucescens-morph); proper exciple
apically carbonized, 30-60 um thick; epihymenium grayish crystalline, 5-10
um high; hymenium hyaline and clear, 90-100 um high; subhymenium 15-20
um high; asci 8-spored, 90-100 x 10-15 um; ascospores transversely septate,
8-10-locular, amyloid, 30-38 x 8-9 um.
CHEMISTRY—Norstictic acid detected with TLC.
DISTRIBUTION & ECOLOGY—Found growing in large patches on thin and
smooth barked trees in evergreen forests.
SPECIMEN EXAMINED: CAMEROON. SOUTHWEST PROVINCE: Mount Cameroon,
4°09’01”N 9°17'02”E, on bark, 25 February 2015, J-S. Hur CR150024 (KoLRI).
REMARKS—Graphis eburnea Adaw. & Makhija, which is morphologically
and chemically close to G. exalbata, is distinguished by its epruinose labia
(nigrosina-morph).
Liicking et al. (2009) previously reported G. exalbata from the Palaeotropics.
Graphis gloriosensis A.W. Archer & Elix, Telopea 11: 454, 2007 PL. 1F
Thallus epiperidermal, thin, pale-brown, fawn to off-white, indistinctly
corticate 50-100 tum thick, reflecting bark; algal layer continuous,
28-30 um thick; medulla mostly endoperidermal; lirellae prominent,
sparsely and irregularly branched, 1-1.5 cm long with lateral thalline margin
(marginata-morph); labia entire, epruinose; proper exciple completely
carbonized, 50-100 um thick; epihymenium brown, granular,10-15 um high;
hymenium hyaline and densely inspersed (with oil droplets), 90-100 um
high; subhymenium 10-15 um high; asci 8-spored; ascospores fusiform,
transversely septate, 10-15-locular, amyloid, 40-70 x 10-15 um.
CHEMISTRY—Stictic and hypostictic acids detected with TLC.
DISTRIBUTION & ECOLOGY—Collected from tree bark in evergreen forests
at higher altitudes.
SPECIMEN EXAMINED: CAMEROON. SOUTHWEST PROVINCE: Mount Cameroon,
4°07’40”N 9°11'54”E, alt. 1150 m, on bark, 26 February 2015, J-S. Hur CR150060
(KoLRI).
ReMARKS—In thallus color and texture and in chemistry G. gloriosensis
superficially resembles G. brahmanensis, which differs in its striate labia,
laterally carbonized proper exciple, and clear hymenium.
Liicking et al. (2009) reported G. gloriosensis from the Eastern Paleotropics.
930 ... Joshi & al.
Graphis gonimica Zahlbr., Ann. Mycol. 30: 431, 1932. PL. 1G
Thallus epiperidermal, whitish-gray, silver-gray, white or dark-gray,
glossy, <200 um thick; cortex 30-40 um thick, continuous; algal layer
45-60 um thick; medulla white, crystalline, 60-100 um thick; prothallus dark
brown; lirellae immersed, short (0.5-1 cm long) and scarcely furcated with
lateral thalline margin (lineola- or deserpens-morph); disc concealed; labia
entire and epruinose; proper exciple + completely carbonized, 60-150 um
thick; epihymenium brownish, granular, 10-15 um high; hymenium densely
inspersed (with oil droplets), 140-160 um high; subhymenium indistinct; asci
8-spored; ascospores fusiform, transversely septate, 6-12-locular, amyloid,
30-50 x 7-9 um.
CHEMISTRY—Norstictic acid detected with TLC.
DISTRIBUTION & ECOLOGY—Found growing in small patches associated
with Glyphis cicatricosa Ach. and Arthonia sp. on uneven and thick barked trees
in evergreen forests.
SPECIMEN EXAMINED: CAMEROON. SOUTHWEST PROVINCE: Mount Cameroon,
4°09’01”N 9°17'02”E, on bark, 25 February 2015, J-S. Hur CR150035, CR150036
(KoLRI).
REMARKS— The morphologically similar G. cincta (Pers.) Aptroot differs in its
laterally carbonized proper exciple.
Liicking et al. (2009) previously reported G. gonimica from the Paleotropics.
Part of our material sometimes produces stictic acid and atranorin (in
traces) as additional compounds, but we refrain from proposing a taxon new to
science until further collection and evaluation.
Graphis handelii Zahlbr., Symb. Sinic. 3: 44, 1930. PL. 1H
Thallus epiperidermal, off-white, grayish-green to gray, 100-150 um
thick; cortex continuous, 20-30 um thick; algal layer continuous, 30-40 um
thick; medulla white crystalline, epi- to endoperidermal, 50-80 um thick;
lirellae erumpent to prominent, short (<5 mm long), simple to furcate; disc
exposed and epruinose, brown; labia entire and epruinose; proper exciple
laterally carbonized 20-50 um thick; epihymenium brownish, 10-15 um
high; hymenium hyaline and inspersed (with oil droplets), 90-100 um high;
subhymenium 20-30 um high; asci 8-spored, 70-90 x 10-15 um; ascospores
fusiform, transversely septate, 5-9-locular, amyloid, 28-32 x 5-7 um.
CHEMISTRY—Norstictic acid detected with TLC.
DISTRIBUTION & ECOLOGY—Collected from smooth barked trees in
evergreen forests.
Graphis spp. new to Cameroon... 931
SPECIMENS EXAMINED: CAMEROON. SOUTHWEST PROVINCE: Mount Cameroon,
4°09’01”N 9°17'02”E, on bark, 25 February 2015, J-S. Hur CR150028, CR150038
(KoLRI).
REMARKS—Graphis crebra Vain. is similar but is distinguished by its white-
pruinose disc.
Liicking et al. (2009) report a pantropical distribution for G. handelii.
Graphis immersella Mill. Arg., Bull. Herb. Boissier 3: 319, 1895. Pai
Thallus epiperidermal, off white, greenish-gray, <150 pm_ thick;
cortex continuous, 30-50 um thick; algal layer 30-40 um thick; medulla
endoperidermal; prothallus blackish; lirellae erumpent, short (<1 cm long) and
sparsely branched (lineola-morph) with lateral thalline margin; disc concealed;
labia entire and epruinose; exciple laterally carbonized, 20-60 um thick proper;
epihymenium dark brown, crystalline, 10-15 um high; hymenium hyaline
and clear, 100-150 um high; subhymenium indistinct; asci broadly clavate,
8-spored, 90-100 x 10-15 um; ascospores transversely septate, 8-11-locular,
amyloid, 35-55 x 8-10 um.
CHEMISTRY—Stictic acid detected with TLC.
DISTRIBUTION & ECOLOGY—Collected from rather smooth barked trees in
evergreen forests.
SPECIMEN EXAMINED: CAMEROON. SOUTHWEST PROVINCE: Mount Cameroon,
4°07’41”N 9°12’20”E, on bark, 26 February 2015, J-S. Hur CR150057 (KoLRI).
REMARKS—Graphis pinicola Zahlbr. is morphologically similar to G. immersella
but lacks lichen compounds.
Liicking et al. (2009) report a palaeotropical distribution for G. immersella.
Graphis novopalmicola A.W. Archer & Licking, Lichenologist 41: 439, 2009. PL. 1J
Thallus epiperidermal, pale-gray to yellowish-gray, dull, loosely corticate,
150-200 um thick, continuous in large patches; cortex 20-30 um thick
embedded with crystals; algal layer continuous, 40-50 um thick; medulla
mostly endoperidermal and crystalline, 100-150 um thick; prothallus whitish;
lirellae erumpent to prominent, simple to furcate, short to elongate (1-1.5 cm
long) with a thick lateral thalline margin (subserpentina-morph); concealed
disc; entire and epruinose labia; proper exciple completely carbonized, <50 um
thick; epihymenium brownish crystalline, 10-15 um high; hymenium densely
inspersed (with oil droplets) 150-170 um high; subhymenium indistinct to 20
um high; asci broadly clavate, 1-spored; ascospores large, muriform, multi-
celled, amyloid, 90-110 x 20-30 um.
CHEMISTRY—Norstictic acid detected with TLC.
932 ... Joshi & al.
DISTRIBUTION & ECOLOGY—Collected from smooth barked trees in
evergreen forests near foothills.
SPECIMENS EXAMINED: CAMEROON. SOUTHWEST PROVINCE: Mount Cameroon,
4°04’09”N 9°22’36’E, alt. ca. 30 m, on bark, 26 February 2015, J-S. Hur CR150079,
CR150080 (KoLRI).
REMARKS—Graphis leprographa Nyl., which resembles G. novopalmicola in
having 1-2-spored asci and similar chemistry, differs in its very short and
unbranched lirellae (dussii-morph).
Liicking et al. (2009) report a pantropical distribution for G. novopalmicola.
Graphis pseudoaquilonia Licking, Lichenologist 44: 393, 2012. PL. ak
Thallus epiperidermal, cartilaginous, grayish-green, dark-gray to gray,
continuous, glossy, corticate, spreading in large wide patches; lirellae prominent,
elongate (1-2 cm long), sinuous, irregularly branched with complete thalline
margin; disc concealed; labia striate (archeri-morph); proper exciple completely
carbonized, 90-100 um thick; epihymenium brownish, granular, 10-15 um
high; hymenium hyaline and clear, 100-150 um high; subhymenium 20-30
um high; asci 2-6-spored; ascospores fusiform, terminally muriform, amyloid
[(10-15-septate in the middle x 1-2 longitudinal septa per cell in the terminal
segments)], 50-80 x 9-15 um.
CHEMISTRY—Norstictic acid detected with TLC.
DISTRIBUTION & ECOLOGY—Found growing in large patches on uneven and
thick barked trees in evergreen forests.
SPECIMENS EXAMINED: CAMEROON. SOUTHWEST PROVINCE: Mount Cameroon,
4°09’01”N 9°17'02”E, on bark, 25 February 2015, J-S. Hur CR150011, CR150025
(KoLRI).
REMARKS—Graphis norvestitoides Sutjaritt., which is otherwise similar to
G. pseudoaquilonia in all characters, is distinguished by its strongly inspersed
hymenium (Licking et al. 2012).
Graphis pseudoaquilonia has previously been reported from the Neotropics
and Eastern Palaeotropics (Licking et al. 2009, Liicking et al. 2012).
Graphis supracola A.W. Archer, Aust. Syst. Bot. 14(2): 267, 2001. PLah
Thallus whitish-gray to gray, greenish-gray, loosely corticate, <100 um thick,
smooth to slightly verruculose, spread in patches; cortex discontinuous <15 um
thick, overlying a discontinuous layer of crystals; algal layer 40-60 um thick;
medulla mostly endoperidermal; prothallus dark brown; lirellae immersed,
simple to furcate, 1-2 cm long with lateral thalline margin; disc concealed to
sometimes slightly open; labia entire and white pruinose (caesiella-morph);
Graphis spp. new to Cameroon ... 933
proper exciple laterally carbonized, 30-50 um thick; epihymenium brownish,
5-10 um high; hymenium hyaline and clear, 50-100 um high; subhymenium
35-45 um high; asci 8-spored; ascospores fusiform, transversely septate,
6-10-locular, amyloid, 25-32 x 7-10 um.
CHEMISTRY—Protocetraric acid detected with TLC.
DISTRIBUTION & ECOLOGy—Found growing on tree barks in evergreen
forests at low altitudes.
SPECIMENS EXAMINED: CAMEROON. SOUTHWEST PROVINCE: Mount Cameroon,
4°09’01”N 9°17'02”E, on bark, 25 February 2015, J-S. Hur CR150023 (KoLRI);
4°05’41”N 9°22’24’E, alt. ca. 100 m, on bark, 26 February 2015, J-S. Hur 150069
(KoLRI).
REMARKS— This taxon can be confused with Graphis distincta Makhija &
Adaw., which differs in additionally producing stictic and constictic acids.
Licking et al. (2009) report a pantropical distribution for G. supracola.
Key to Graphis species recorded from the African Palaeotropics
Taxonomic key characters of Graphis species not included in our collections derived
primarily from Licking et al. (2009) and Broeck et al. (2014)
—_
. Lirellae orange-pigmented, prominent to sessile, short to elongate,
sparsely to irregularly branched; ascospores terminally muriform,
70-120 x 10-15 um; no lichen substances present .......... G. subchrysocarpa
Poflite Wace Gli cheno diy on pias o apie ae «gine x eos Sonata eames bnypt nae tegheer es See pee et Z
2*labia.entire: hymeniunr cleator inspersed ic iiis< ns ee ape inne ee nee ean eee Sees 8
Ds rabia-sthiate alin tn eH TMC leak fic. Fea aw. c- Fire oncedie 4 acces nna dse te ancedAt nen tens 2, EA eee 32
5..-broper-exciple completely carbonizede ...5 ta%s.0 teats teeth) tetatd beats waists allt t 4
3.. Proper-exciple apically-to laterally carbonized ims: Lites bbivinblysnbees noes) 16
ASELVTMCHIETIT INS DELSEU! sk MR PT NPT talk, ciadll rk ah tk cath ear alt tat eect tat acl rk ld Berk 5
AS ELYVINISTIMAN COAT Soc nce wala a Bielo < Miteye SM Bite o 6 Ato EA Ree cE to Ste wh ie eM wt ahd 8
5. Ascospores muriform, 90-110 x 20-30 um;
Horstictie dcid. present flo Bl Fl eles hipster tgs See bw deeb pres G. novopalmicola
5. ASCOSPOLES TANS VETSE]Y SEP TALS Hace 6 He cwiies« WBcwieno Mcwijare Memes Mbeya ewice 2 was sewing 6
6. Lichen substances absent; lirellae erumpent
with complete thalline margin (subserpentina-morph);
ascospores 18-20-locular, 100-120 x 14-18um .................. G. superans
Gp Licherssubs tame es, presente <. tetas cates neem atten seeteeen aes haters Pee aoe eben s 7
7. Stictic acid present; ascospores 10-15-locular, 50-90 x 10-15 um .... G. gloriosensis
7. Norstictic acid present; ascospores 6-12-locular, 30-50 x 7-9 um ...... G. gonimica
St LACM SMMSLIDStALICES IPOS TIL gauss sx seed cs BSA a see sro ugl deh road! dem Bev dat gree detox ee BAL em De 9
S, MIGHenest DSUAR Ce ssa DSOIN ao ne ag.c <ptgs ager tnghece eagtan «Auten wap egeeeen tenet gl 11
934 ... Joshi & al.
9. Constictic and stictic acids present; lirellae prominent,
+ simple with lateral to almost complete thalline margins;
ascospores muriform, 60-110 um long ................. G. vandenboomiana
9. Stictic acid present; ascospores transversely septate .............. 0. eee ee eee 10
10. Lirellae with apically thick complete thalline margin (subserpentina-morph);
ASCOSPOTES 5 20 =) Onptt OTS Io esl, ce give nna gl seth mgtee Gun alnunse-ciaheit & G. schroederi
10. Lirellae with thick lateral thalline margin (marginata-morph);
ascOspores45 120) pitt LONG. 5 5s 426i abe s bsg wih sus! dab sha nese G. rustica
11. Ascospores muriform, 20-30 um long; lirellae erumpent, short to sparsely
branched with basal thalline margin (subregularis-morph) ......... G. comma
ll. Ascosporestransversely septate, S50,liny long Fics 08 haath s Sets haath g be lig watts 12
i> sLirellaewith-complete thallinie margin gr gacs.8 facets bests Best s Seales Sed oats: 13
12. Lirellae with basal to lateral thalline margin .......................000 0008. is)
13. Unknown lichen substances present; ascospores 3-septate,
} AN Ee 0 00 1G) 9 Cac A AD RO G. aptrootiana
13. No lichen substances present; ascospores 3- or more septate ..............-.. 14
14. Lirellae short and sparsely branched (negrosina-morph) ............ G. negrosina
14. Lirellae elongate, irregularly branched (farinulenta-morph) ............ G. sitiana
15. Lirellae short, stellate with basal thalline margin (geraensis-morph) G. dracaenae
15. Lirellae elongate, irregularly branched with
thick lateral thalline margin (marginata-morph) ................. G. oxyclada
16. Proper exciple apically carbonized; hymenium clear ...................0005. MZ
16. Proper exciple laterally carbonized; hymenium clear or inspersed............. 18
17. Lirellae immersed to erumpent, short, sparsely or stellately branched
(lineola- or coarctata-morph); ascospores muriform,
25-45 x 13-20 um; lichen substances absent .................. G. pergracilis
17. Lirellae immersed, ascospores transversely septate,
24-26 x 4-6 um; norstictic acid present................06. G. alboglaucescens
PSS y PEN FUL ATIS CES CU cca FE a ccsaly hy seas Senate st pe net tt once ge reese peace aah 19
1S Elymenitina clears: satin. foe eh Sty eh Stk ee hae cee pees eign cee tine e ins 22
TORAscospores-miUritOrMt, 6.9 Sk ee EGS ee Leo Ri Eh bey kee 20
[osAscospores transverse h- septate st 48.51 At a Aha er tha ia tok anit ear berk ea os 21
20. Norstictic acid present; lirellae immersed to erumpent, elongate &
irregularly branched with thick lateral to complete thalline margin
(subserpentina-morph); ascospores 50-110 x 15-30 um........... G. insulana
20. Lichen substances absent; lirellae erumpent, short to elongate,
sparsely to irregularly branched with lateral thalline margin
(lineola- or deserpens-morph); ascospores 35-50 x 8-15 uum ....... G. subvelata
Graphis spp. new to Cameroon ... 935
PLATE 1. Graphis species from Cameroon. A. G. ajarekarii; B. G. alboglaucescens; C. G. brahmanensis;
D. G. daintreensis; E. G. exalbata; EF. G. gloriosensis; G. G. gonimica; H. G. handelii; I. G. immersella;
J. G. novopalmicola; K. G. pseudoaquilonia; L. G. supracola. Scales: A, B, D, EF, G, J, L = 10 mm,
C)E, Hy liK = 0-3-1,
21. Disc exposed, epruinose (handelii-morph); norstictic acid present;
ascospores 5-9-locular, 28-32 5-7 UM ... 2. eee eee eee eee G. handelii
21. Disc concealed, labia epruinose (lineola-morph); no lichen substances;
ascospores 6-10-locular, 20-40 x 6-9 UM «2... eee eee eee ee G. lineola
227 ASC OSPOVES MIE TOT out psbg%s nt cSeda ent f atoms te ete tate bentia tate wt-n Tah) cathy cole sade cele ey ae 73
PDS ASCOSPOLESMTAlISVOTSELY,SE PLAate = Wiig. Na Non Ma Nau ctiay nts aes ty sa oprah oectre afl cra ae. 2S
23. Norstictic acid present; lirellae erumpent, elongate & irregularly
branched with lateral thalline margin (deserpens-morph);
ascospores. 20=35-< 8= 1A inh fox, clue en relat im al als deeds tones) decd G. renschiana
23. Lichen substances absent; ascospores more than 50 um long ................. 24
936 ... Joshi & al.
24.
24.
Zo
25,
26.
26.
27s
2H.
28.
28.
29.
29;
30.
aU:
5)
_
a
_
32:
32,
ao:
a3:
34.
34.
a3:
35.
36.
36.
OY,
37.
Lirellae prominent with basal thalline margin (hossei-morph) ..... G. daintreensis
Lirellae erumpent with lateral to apically thick complete thalline margin
(SUDSEMPENING-THORDIY) 23 6 9th a Mell yk all on ease Te G. subhiascens
Lichen substances absent; ascospores <45 um long .......... eee eee eee ee 26
Lichen substances present; ascospores <60 um long........... 0.0... eee eee 27
Thallus partly ecorticate; lirellae thin, flexuous with gently sloping in thalline
margin; labia white pruinose (caesiella-morph) ................... G. furcata
Thallus corticate; lirellae thick; straight or curved with abruptly sloping thalline
margin; labia epruinose (lineola- or deserpens-morph) ............ G. pinicola
Norstictic or stictic or protocetraric acids present ................- eee ee eee 28
Stictic acid additionally with atranorin or norstictic acid present ............. S.
Norsitietic acid, présént:... oo 82.56 55448 deny Sex gh Bey phone pee ee ye ee eee ams 29
Morsticticacidalsenie hit Pht Real Mall Rea Si el Pet eataal eal ae teed 30
Lirellae erumpent, ascospores <45 um long ............. 00. e eee eee eee G. librata
Lirellae immersed to erumpent, short & sparsely branched (Jineola-morph);
ascospores 45-60 um long ........... cece eee eee eee ee G. erythrocardia
Stictic acid present; labia epruinose (lineola-morph) .............. G. immersella
Protocetraric acid present; labia white pruinose (caesiella-morph) ... G. supracola
. Stictic acid & traces of atranorin present;
ascospores 4-locular, 12-17 um long ...................000- G. tetralocularis
. Stictic acid & norstictic acid present;
ascospores 8-10-locular, 35-55 um long ...................004. G. ajarekarii
Propercexciple:completelycakDOniZed ore < Semis « Phowng in Phemed a fete a, fe neport Werner a elects 33
Proper exciple apically to laterally carbonized; ascospores transversely septate .. 34
Ascospores muriform, 30-65 x 10-15 ym; lirellae erumpent, elongate & irregularly
branched with lateral thalline margin; disc concealed; labia epruinose
(tenella-morph); no lichen substances present ................. G. plurispora
Ascospores terminally muriform, 50-80 x 9-15 um;
NOPSLICtCACIC Present Stl alr ead See were ep eee G. pseudoaquilonia
Propercexcipleapically carbonized. Sc s «Pee se Mecwites< Smcmne,e Ssruijess Necense< Stee oir 35
Propeniexcipleélaterallys carbonized’. ..29 ba's28 gash-2 bast 8 heat g be sth Beales watts 36
Norstictic acid present; ascospores 30-38 um long.................. G. exalbata
Lichen substances absent; ascospores 25-35 um long ............ G. glaucescens
Stictic acid present; ascospores 5-8-locular, 25-30 x 6-8 um .... G. brahmanensis
rchiemrsubstances-absenit 6 Aviat cutters ws othe a MaMa tS te et te a area 37
Lirellae erumpent, short & sparsely branched with lateral thalline margin
(tenella-morph); ascospores 15-45 xX 6-9 UM ....... eee eee eee eee G. tenella
Lirellae prominent, elongate & irregularly branched, lacking or with basal thalline
margin (striatula-morph); ascospores 30-65 um x 7-12 um ....... G. striatula
Graphis spp. new to Cameroon ... 937
Acknowledgments
This work was supported by a grant from the National Research Foundation of Korea
(NRF-2014K1A3A1A09063058) and the Korea National Research Resource Center
Program (NRF-2014M3A9B8002115). Santosh Joshi is grateful to the Director, CSIR-
NBRI, Lucknow, India for providing laboratory facilities. Authors are grateful to Dr.
Robert Liicking (Botanical Garden and Botanical Museum, Berlin) and Dr. Ze-Feng Jia
(College of Life Sciences, Liaocheng University, China) for their valuable comments on
the manuscript.
Literature cited
Adawadkar BA, Makhija UV. 2007. New species and new records of Graphis from India with
partially carbonized exciples and transseptate ascospores. Mycotaxon 99: 303-326.
Broeck DV, Liicking R, Ertz D. 2014. Three new species of Graphidaceae from tropical Africa.
Phytotaxa 189(1): 325-330. http://dx.doi.org/10.11646/phytotaxa.189.1.23
Focho DA, Fonge BA, Fongod AGN, Essomo SE. 2010. A study of the distribution and diversity
of the family Orchidaceae on some selected lava flows of mount Cameroon. African Journal of
Environmental Science and Technology 4(5): 263-273.
Fonge BA, Yinda GS, Focho DA, Fongod AGN, Bussmann RW. 2005. Vegetation and soil status on
an 80 year old lava flow of Mt Cameroon, West Africa. Lyonia 8(1): 17-39.
Frisch A, Kalb K, Grube M. 2006. Contribution towards a new systematic of the lichen family
Thelotremataceae. Bibliotheca Lichenologica 92: 556 p.
Liicking R. 2009. The taxonomy of the genus Graphis sensu Staiger (Ascomycota: Ostropales:
Graphidaceae). Lichenologist 41: 319-362. http://dx.doi-org/10.1017/S0024282909008305
Licking R, Sutjaritturakan J, Kalb K. 2012. Validation of three species names and description of
a new species in the genus Graphis (Ascomycota: Ostropales: Graphidaceae). Lichenologist 44:
391-394. http://dx.doi.org/10.1017/S0024282911000855
Mangold A, Elix JA, Lumbsch HT. 2009. Thelotremataceae. Flora of Australia 57: 195-420.
Miiller J. 1890. Lichenes Africae tropico-orientalis. Flora 74: 334-347.
Orange A, James PW, White FJ. 2010. Microchemical Methods for the Identification of Lichens.
British Lichen Society.
Proctor J, Edwards ID, Payton RW, Nagy L. 2007. Zonation of forest vegetation and soils of Mount
Cameroon, West Africa. Plant Ecol. 192: 251-269. http://dx.doi.org/10.1007/s11258-007-9326-5
Rivas Plata E, Licking R, Sipman HJM, Mangold A, Kalb K, Lumbsch HT. 2010. A world-wide
key to the thelotremoid Graphidaceae, excluding the Ocellularia-Myriotrema-Stegobolous clade.
Lichenologist 42: 139-185. http://dx.doi.org/10.1017/S0024282909990491
Staiger B. 2002. Die Flechtenfamilie Graphidaceae. Studien in Richtung einer natiirlicheren
Gliederung. Bibliotheca Lichenologica 85. 526 p.
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 © 2016. Mycotaxon, Ltd.
October-December 2016—Volume 131, pp. 939-945
http://dx.doi.org/10.5248/131.939
Revision of some Peziza collections in herb. TAAM (Tartu)
GIANFRANCO MEDARDI”*, ANGELA LANTIERI? & GABRIELE CACIALLI?
'Via Giuseppe Mazzini 21, I-25086 Rezzato (Brescia), Italy
?Via Novaluce 38, I-95030 Tremestieri Etneo (Catania), Italy
°Via Goito 25, I-57127 Livorno, Italy
* CORRESPONDENCE TO: [email protected]
ABSTRACT—Forty samples representing the genus Peziza kept in the Mycological Herbarium,
Tartu, Estonia (TAAM) were studied. Collection data and taxonomic comments are presented.
KEY worps—Ascomycota, Pezizales, Pezizaceae
Introduction
This work, part of a series of papers concerning the revision of specimens
assigned to the genus Peziza Dill. ex Fr. kept in various herbaria, is intended
to confirm their importance for the studies on mycological diversity and
taxonomy.
Forty samples, initially labelled under various names and located in the
Mycological Herbarium, Institute of Agricultural and Environmental Sciences,
Estonian University of Life Sciences, Tartu, Estonia (TAAM) (founded in 1950
at the Institute of Biology of the Estonian SSR Academy of Sciences; Parmasto
2011), were studied. Our examinations revealed that not all specimens were
originally correctly determined; various specimens were shown to correspond
to different species, while others could not be definitely identified. Some of
these samples have also been used to carry out molecular analyses, the results
of which have been published in previous papers (Medardi et al. 2012, Medardi
et al. 2014).
Materials & methods
Morphological and microscopical examinations were carried out on Dried
specimens were rehydrated in water or KOH 5% and mounted in water with lactic blue
9AO ... Medardi, Lantieri & Cacialli
to highlight spore ornamentation and/or with Melzer’s reagent to observe the iodine
reaction of the asci. The tissues were examined microscopically with an Optika BK
1301 optical microscope with 40x or 100x (oil immersion) objectives; dimensions were
determined from 50 mature spores per collection.
Results
Peziza alcis Harmaja, Karstenia 26(2): 44. 1986.
MATERIAL EXAMINED: ESTONIA: JOGEVAMAA Co, Kursi, Puurmani Commune,
Altnurga, Forestry sq. 95, on moose dung, 8.10.1997, leg. et det. M. Opik (TAAM
171114, as P. fimeti); RAGAVERE CoMM., Uljaste, Laaéne-Viru Co., on ground and on
dung, in moist Betula—Picea forest, s.d., leg. K. Kalamees, det. A. Raitviir (TAAM 71260,
as P. fimeti). FINLAND: LAPLAND, Kevo, National Park, on moose dung, 28.08.1981,
leg. K. Kalamees, det. A. Raitviir (TAAM 122042, as P fimeti).
Notes: These materials, labeled in the herbarium as P. fimeti, have been
redetermined as P alcis. The spores were smooth and averaged 15-17(-18)
x (7-)7.5—9 um; the excipulum comprised only one layer (textura globulosa
or globulosa-angularis), differentiable into one subhymenium, one medullar
excipulum and one ectal excipulum by the cell sizes consistently wider towards
the outside of the apothecium. Molecular analysis of TAAM 171114 also
confirmed identification of P alcis (Medardi et al. 2012).
TAAM 122042 was judged not to be completely mature, based on the
numerous spores still contained in the asci. Sporormiella australis (Speg.) S.I.
Ahmed & Cain was also noted on the dung.
Peziza arvernensis Roze & Boud., Bull. Soc. Bot. Fr. 26 (Suppl.): LXXVI. 1879.
MATERIAL EXAMINED: DENMARK: ZEALAND, Grib Skov, on ground among stones,
14.08.1965, leg. P. Milan Petersen, det. H. Dissing (TAAM 187941); ESTONIA: Tartu
Co., along the road toward Tallinn, in a Populus forest, 13.05.2007, leg. L. Tedersoo, det.
K. Hansen (TAAM 192338).
Notes: The spores measured (16-)17-20 x (8-)9-10.5 um and were
ornamented with manifest punctiform warts. A section showed the typical
tissues of P arvernensis: subhymenium of textura globulosa-angularis, the
medullar excipulum comprising three layers (the upper and lower layers a
textura globulosa and the middle a textura intricata), and an ectal excipulum of
textura intricata. The habitat of this species is rather variable; that reported for
these two collections is within specifications.
Peziza atrospora Fuckel, Fungi Rhenani Exsic.: no. 1224. 1864.
MATERIAL EXAMINED: ESTONIA: Tartu Co., Nodo Comm., Peedu, on ground,
26.07.2000, leg. et det. B. Kullman (TAAM 179346, as P. pseudovesiculosa Donadini).
TAAM Peziza collections revised ... 941
Notes: TAAM 179346 comprises two specimens, both originally identified
as representing Peziza pseudovesiculosa. Our redetermination of the species
to P. atrospora is supported by spores measuring 17-18 x 7—9 um, most with
1-2 oil drops and with elongated warts often connected in short crests <1 um
high. Other characters include a subhymenium of textura intricata, a medullar
excipulum of textura globulosa-angularis with cells 60-80(-110) um diam.,
and an ectal excipulum of textura globulosa-angularis.
Peziza cinatica Pfister, Mycotaxon 8(1): 189. 1979.
MATERIAL EXAMINED: ESTONIA: Harju Co., Viimsi Comm., Prangli Island, near
Idaotsa Farm, on clay soil of a well in Pinus forest, 25.08.1960, leg. P. Poldmaa, (TAAM
028962, TAAM 028963, as PR domiciliana Cooke).
Notes: We redetermined this material, bearing the herbarium label
P. domiciliana, to P. cinatica. The ascospores, which measured 11—13(-14)
x (5-)6—-7 um and contained 2 oil droplets, were ornamented with fine
punctiform warts <1 um. The medullar excipulum is a textura intricata with
brownish hyphae (ca. 5 um diam.) often perpendicular to the hymenium, and
the ectal excipulum is a textura globulosa, with some rounded (20-50 um
diam.) and elongated (20—40 x 15—25 um) cells intermixed.
Peziza cinatica is not widely distributed but does not appear to be restricted
to one habitat type. Previously reported substrates include ash (Pfister 1979)
and burn residue (Dougoud 2001), but the above material (TAAM 028962,
TAAM 028963) was collected on clay soil.
Peziza fimeti (Fuckel) E.C. Hansen, Vidensk. Meddel. Naturhist. Foren. Kjobenhavn
59: 267. 1877 [“1876”].
MATERIAL EXAMINED: RUSSIA: Kamcuatka, 47 km from Krapivnaya, on dung of
Ursus ursus, 6.08.1978, leg. B. Kullman (TAAM 187899, TAAM 187900); KRASNODAR,
Umpyr, Caucasus Nature Reserve, on dung, 10.08.1976, leg. M. Pallo, det. A. Raitviir
(TAAM 064318); Malaya Laba, Caucasus Nature Reserve, on dung, 12.08.1976, leg. M.
Pallo, det. A. Raitviir (TAAM 064369); Kurix ISLANDS, Kunashir Island, Lagunnoye, on
excrements, 12.08.1970, leg. B. Kullman (TAAM 061513); RESPUBLIKA TyvVA, Erzin, on
dung, 18.07.1972, leg. B. Kullman (TAAM 065761). TAJIKISTAN. Ramit State Nature
Reserve, Mount Hissar, on dung, 12.04.1977, leg. et det. A. Raitviir (TAAM 064569);
HOVALING, on bovine excrement, 22. 04.1985, leg. B. Kullman, det.. A. Raitviir (TAAM
115898). UZBEKISTAN: Dshisaki, Turkestan Chain, Kulsai, Zaamini Nature Reserve,
in Juniperus forest, 24.05.1980, leg. K. Kalamees, det. A. Raitviir (TAAM 199165).
Notes: Ascospores measuring (19-)20.5—22(—22.5) x (10-)11—12 um and
flesh composed of globose or globose-angulated cells differentiated into a
subhymenium, a medullar excipulum (with some filamentous hyphae visible),
and an ectal excipulum confirm Peziza fimeti.
942 ... Medardi, Lantieri & Cacialli
Our molecular analyses (Medardi et al. 2012) of TAAM 187900 and TAAM
064318 also supported Peziza fimeti. Sporormiella australis was also found in
TAAM 064318. TAAM 115898 is immature.
Noteworthy is the fact that the apothecia TAAM 187899 and TAAM 187900
were found (dung of Ursus), a previously unreported substrate.
Peziza howsei Roze & Boud., Bull. Soc. Bot. Fr. 26 (Suppl.): LXXV. 1879.
MATERIAL EXAMINED: ESTONIA: Hiru Co., Hiiesaare Light House, on ground,
18/09/2001, leg L. Vaher, det. B. Kullman ([TAAM 179773, as Pachyella celtica (Boud.)
Haffner); Tartu Co., Vonnu Comm., Jarvselja Forest [sq n. 226 (4)], on ground,
27.09.2001, leg. et det. B. Kullman (TAAM 179788).
Notes: Both samples were characterized by a subhymenium of textura
intricata (hyphae 5-6 um diam.), a 2-layered medullar excipulum (upper a
textura globulosa-angularis with cells <25 um diam.; lower a textura + intricata
toward the upper layer and tending to globulosa-angularis with cells similar to
those of the upper layer), and an ectal excipulum of textura globulosa with cells
10-25 um diam. Ascospores were 17.5—19.5(-22.5) x 8.5—9.5 um, with fine
punctiform warts (0.5-1 um diam., <0.5 um high), more or less isolated but
occasionally joined to form short crests.
Peziza howsei is morphologically similar to P emileia Cooke, but despite
several overlapping characters, their different ITS sequences support them as
two separate species (Medardi et al. 2014).
Peziza lividula W. Phillips, in Cooke, Mycographia: 161. 1877.
MATERIAL EXAMINED: ESTONIA: PARNU Co., Koonga Comm., between Mihkli and
Koonga, in Picea forest, 16.08.1960, leg. et det. A. Raitviir (TAAM 040951, as P. howsei);
SAARE Co., Limanda Comm., Koimia, on ground, 24.08.1960, leg. et det. A. Raitviir
(TAAM 041035, as P. howsei); H11ru Co., Kardia Comm., next to Kardia, near the road to
Kaina, in Corylus forest, 4.09.1960, leg. et det. A. Raitviir (TAAM 041235, as P. howsei);
LAANE Co., Hanila Comm., Puhtulaid islet, near Virtsu, in a forest of mixed deciduous
trees, 6.09.1960, leg. et det. A. Raitviir (TAAM 041243, as P. howsei); TARTU Co., Vonnu
Comm., Jarvselja forest [sq n. 226 (4)], on ground, 27.09.2001, leg. et det. B. Kullman
(TAA 179791, as P. howsei). RUSSIA: IRKUTSKAYA OBLAST, Ust-Kutskiy, Erlenga, along
a path in a forest, 27.08.1967, leg. M.A. Bondarceva, det. A. Raitviir (TAAM 199080, as
P. howsei).
Notes: In this group all samples were at first labelled P howsei. We
redetermined them to P lividula based on the following characters: ascospores
15-19 x 8—-10(-10.5) um, each with 2 oil droplets and punctiform warts +
wide (1—1.5 um diam.), at times more elongate and closed near the extremities
where they resemble low skulls; a subhymenium of textura prismatica or
prismatica-angularis.
TAAM Peziza collections revised ... 943
Peziza perparva Harmaja, Karstenia 26(2): 47. 1986.
MATERIAL EXAMINED: RUSSIA: SVERDLOVSKAYA OBLAST, Kytlym, on unidentified
dung, 20.07.1973, leg. A. Raitviir (TAAM 062952, as P fimeti).
Notes: We redetermined TAAM 062952 (labeled as P. fimeti) to P perparva.
The ascospores measured (11-)12—13 x 6—7 um and were ornamented with
a weak +open reticulum; the tissues were arranged differently than those
found in P fimeti: subhymenium of textura intricata mixed with a few globose
cells, medullar excipulum of textura globulosa or globulosa-angularis, and
ectal excipulum with a structure similar to that of the medullar layer but with
smaller cells. Also diagnostic of P perparva are the very small apothecia, only
1-3 mm diam.
TAAM 062952, which represents just the second collection of P perparva
in Europe (the type collected in Finland and published by Harmaja 1986),
expands the range and habitat of this remarkable fungus. Harmaja (1986) stated
that P perparva fruits “in moist place on a forest path used by elks, growing in
dead plant litter apparently earlier impregnated by elk urine. . ” The Russian
specimens appear to grow instead on rodent dung (showing that the fungus is
not restricted to elk) at a lower latitude (Lantieri et al. 2011).
Sporormiella australis was also identified on some of the dung associated
with the Russian collection.
Peziza varia (Hedw.) Alb. & Schwein. Consp. Fung. Lusat.: 311. 1805.
MATERIAL EXAMINED: ESTONIA: Tartu Co., Tartu Comm., 57 Voru Street, along the
border of a woody floor in a cottage, 12.09.1962, leg. et det. A. Raitviir (TAAM 043232,
as P. domiciliana); near a cement base, 19.12.1977, leg. et det. B. Kullman (TAAM
199053, as P. domiciliana); 27-632 Narva Street, on a plastered block of a construction,
20.06.1994, leg. V. Kastanje, det. A. Jakobson (TAAM 199058, as P domiciliana);
VILJANDI Co., Kolga-Jaani Comm., Potaste, Vaibla Forest [sq n. 29], Pedja Natural
Reserve, on ground, 11.09.1997, leg. et det. B. Kullman (TAAM 157677, 2 collections,
as P. arvernensis). RUSSIA: KAMCHATKA, 47 km from Krapivnaya, on dung of Ursus
ursus, 6.08.1978, leg. B. Kullman (TAAM 116381, as P. fimeti); YAMALO-NENETSKIY
AVTONOMNYY OKRUG, Ovgort, on dung of Ursus ursus and ground around, 28.08.1976,
leg. Murdvee (TAAM 110066, as P. fimeti).
Notes: We redetermined the original identifications of TAAM 116381 and
TAAM 110066 (P fimeti); TAAM 157677 (P. arvernensis, both specimens); and
TAAM 043232, TAAM 199053, and TAAM 199058 (P. domiciliana) to Peziza
varia. We detected a faint superficial roughness on the spores, which measured
(14.5-)15—-16 x (7-)7.5—8.5(—9) um (smaller than those of P fimeti at 20—22.5
x 10-12 um), and the medullar excipulum showed a median, more or less thin
layer of textura intricata, typical of P. varia.
944 ... Medardi, Lantieri & Cacialli
Our study of TAAM 116381 and TAAM 110066 revealed that P. varia is
also able to grow on dung, solving the long-standing question regarding two
conflicting interpretations given in P. fimeti literature (Medardi et al. 2012).
The excipular structure of P varia overlaps with that of P arvernensis and
P. domiciliana, which differ from P. varia in their larger spores with more or
less evident punctiform warts (P arvernensis, 16—19(-20) x 9-10(-11) um;
P. domiciliana, 15—17(-20) x 7—9(-10) um, with occasional warts). The builder's
rubble habitat of TAAM 043232, TAAM 199053, and TAAM 199058 belongs
to the large assortment of substrata on which P. varia is able to fruit (Medardi
et al. 2012).
Peziza cf. ampliata
MATERIAL EXAMINED: RUSSIA: CHELYABINSKAYA OBLAST, Miass, on unidentified
dung, 16.08.1973, leg. I. Parmasto (TAAM 062922, as P. fimeti).
Notes: TAAM 062922, bearing the herbarium label of P. fimeti, was
redetermined as P cf. ampliata. This specimen was previously studied by
Hansen et al. (2002). Our molecular analyses group it with P ampliata Pers.
(Medardi et al. 2012), although its macro- and microscopic features correspond
to those of P fimeti: ascospores measuring 18—20.5(—21) x (8.5-)9—11(-11.5)
um and a medullar excipulum comprising large, globose-angulated cells mixed
with filamentous hyphae.
Peziza cf. fimeti
MATERIAL EXAMINED: ESTONIA: JOGEva Co., Puurmani Comm., Alam-Pedja Nature
Reserve, on beaver dung, 21.08.1997, leg. A. Kollom, det. A. Raitviir, (TAAM 128087,
as P fimeti).
Notes: This material, labeled as P. fimeti, is the “Peziza sp. h” analyzed by
Hansen et al. (2002), who stated it is phylogenetically different from P. alcis,
despite its similar microscopic characters: smooth ascospores 15.5—17 x (7-)
8—9(—9.5) um and an excipulum consisting of practically only one tissue of
(textura globulosa or globulosa-angularis), with three layers differing only in
the cell dimensions.
Peziza sp.
MATERIAL EXAMINED: ESTONIA: PARNU Co., Koonga Comm., Mihkli Oaks, on ground
in oak forest, 16.08.1960, leg. et det. A. Raitviir (TAAM 040944, as P howsei); SAARE
Co., Part of “N” Reserve, Viidumae Natural Reserve, in Corylus forest, 26.08.1960, leg.
et det. A. Raitviir (TAAM 041077, as P. howsei); LAANE Co., Vormsi Comm., Huitbergi,
on ground near fir roots, 22.10.2010, leg. et det. B. Kullman (TAAM 190485, as Pachyella
celtica). RUSSIA: REsPpUBLIKA Tyva, Kyzyl, Mazaloek, on ground, 4.08.1972, leg. A.
Raitviir, det. B. Kullman (TAAM 065930, as Pachyella celtica); KRASNODARSKIY KRAY,
TAAM Peziza collections revised ... 945
Guzeripl, on ground, 25.05.1975, Leg. et det. A. Raitviir (TAAM 063473, as P. howsei);
KaMCHATKA, 47 km from Krapivnaya, on dung of Ursus ursus, 6.08.1978, leg. B.
Kullman (TAAM 187898, as P fimeti).
Notes: Our examinations of these samples did not provide sufficient data for
a sure identification, mainly due to the scarcity or lack of needed characters.
Acknowledgments
The authors thank Prof. G. Consiglio and Dr. C. Losi for critically reviewing the
manuscript. We want to express a particular gratitude to the late Dr. E. Parmasto, keeper
of TAAM (Tartu, Estonia), for his kindness in putting at our disposal the samples and
for permission to conduct molecular analysis on some of them, which enabled us to
publish our work.
Literature cited
Dougoud R. 2001. Clé des Discomycétes carbonicoles. Documents Mycologiques 30(120): 15-29.
Hansen K, Lessoe T, Pfister DH. 2002. Phylogenetic diversity in the core group of Peziza
inferred from ITS sequences and morphology. Mycological Research 106(8): 879-902.
http://dx.doi.org/10.1017/S0953756202006287.
Harmaja H. 1986. Studies on the Pezizales. Karstenia 26(2): 41-48.
Lantieri A, Cacialli G, Medardi G. 2011. Peziza perparva, seconda segnalazione europea, individuata
dallo studio di una raccolta russa. Rivista di Micologia 54(4): 307-313.
Medardi G, Lantieri A, Pfister DH, LoBuglio K, Cacialli G. 2012. Clarification of
Peziza fimeti with notes on P. varia collections on dung. Mycotaxon 121: 465-476.
http://dx.doi.org/10.5248/121.465.
Medardi G, LoBuglio K, Pfister DH, Lantieri A. 2014. Morphological and molecular study
of Peziza emileia and P. howsei, two distinct taxa. Mycological Progress 13: 1227-1234.
http://dx.doi.org/10.1007/s11557-014-1013-z
Parmasto E. 2011. Fungal herbarium EAA in Tartu (Estonia). Folia Cryptogamica Estonica 48:
69-72.
Pfister DH. 1979. Type studies in the genus Peziza. V. Species described by Rehm. Mycotaxon 8(1):
187-192.
MYCOTAXON
ISSN (print) 0093-4666 (online) 2154-8889 © 2016. Mycotaxon, Ltd.
October-December 2016— Volume 131, pp. 947-959
http://dx.doi.org/10.5248/131.947
BOOK REVIEWS AND NOTICES’
LORELEI L. NORVELL
Pacific Northwest Mycology Service, Portland OR 97229-1309 USA
ABSTRACT—Books reviewed include: GENERAL—The Outer Spores: Mushrooms of
Haida Gwaii (Kroeger & al. 2012); LICHENS & LICHENIZED FuNGI—Rare Lichens of
Oregon (Exeter, Glade & Loring 2016); Lichens of Uttar Pradesh (Nayaka & Upreti
2013); AscomycoTa—Plant pathogenic and endophytic Botryosphaeriales known from
culture (eds: Phillips & al. 2013); A polyphasic taxonomy of Daldinia (Xylariaceae)
(Stadler & al. 2014); Hypocrealean lineages of industrial and phytopathological
importance (eds: Lombard, Groenewald & Crous 2015).
GENERAL
The Outer Spores: Mushrooms of Haida Gwaii. i
By Paul Kroeger, Bryce Kendrick, Oluna
Ceska & Christine Roberts. 2012. Mycologue
Publications, Sidney-by-the-Sea BC [www.mycolog. Wahab pes
com] in cooperation with the Haida Gwaii Museum THE OUTER SPORES “=,
(Skidegate BC), Canada. 189 p., ~300 color photos MUSHROOMS
and drawings, paperback. ISBN—978-0-9692237-
3-3 Price (excl. postage): $20 (Canadian) Email:
[email protected].
of oluna ceska
HAIDA GWAII christine roberts
I have been happily immersed in the pages of this gem since last week, which I
found temporarily forgotten among the ‘books I must read soon” shelf. When
labors of love are as entertainingly written as this one, the reader definitely
benefits, and THE OUTER Sporss will charm and edify a great many other
mycologists and nature-lovers. The 15 x 23 cm volume covers the mushrooms
* Book reviews or books for consideration for coverage in this column should be sent to the
Editor-in-Chief <[email protected]> 6720 NW Skyline, Portland OR 97229 USA.
948 ... MycoTAxon 131(4)
as well as the history of Haida Gwaii (the post-2010 name for the Queen
Charlotte Islands), “a wild and unspoiled corner of the world and the home of
the Haida, a people with a deep and rich culture.” This overview of 635 species
identified from >2900 mushroom collections gathered during a 5-year survey
constitutes the ‘first ... guide dedicated to the fungi of Haida Gwaii.”
The obligatory first chapter “about mushrooms” (here defined as “fungal
fruiting bodies large enough to see’) packs an impressive amount of
information in ten pages and bears the imprimatur of the indomitable Bryce
Kendrick (author of THE FirTH KINGDOM) by answering What are fungi? and
What are Mushrooms? before moving on to ascomycete and basidiomycete
basics, biological strategies, and a delightful drawing from Oluna’s field
notebook. Next follows a brief description of the 150 islands “that comprise
a sort of miniature continent” accompanied by a map showing collection sites
on the Queen Charlotte Windward Mountains, Skidegate Plateau, and Queen
Charlotte Lowlands. A brief cultural history of the indigenous peoples follows;
although the Haida did not traditionally consume mushrooms for food, they
did venerate Tree-Fungus Man and used bracket fungi for tinder, medicines,
and pigments.
Edible mushroom coverage begins with the inevitable safety cautions; here
it appears that getting lost in the archipelago is more worrisome than the
possibility of death by mushroom: the local forest district and search & rescue
crews (motivated by the “significant cumulative cost of numerous searches”)
now find it more cost effective to distribute free survival kits (contained within
a 1-litre water bottle) to pickers. With much of the area closed to mushroom
picking, the authors devote five pages to where, when, and how to collect and
eat/or preserve the mushroom quarry, closing with two duplicate (somewhat
oddly, given the index on pp. 133-139) lists of the region’s 28 choice edibles
with references to later comments and/or photos, the first alphabetized by Latin
name and the second by common name. Coverage of the profitable commercial
mushroom harvest (primarily of golden, rainbow, blue, and winter chanterelles)
precedes a discussion of current and future forest management practices.
Species accounts of 14 edible and 22 “notable” mushrooms, accompanied
by generally excellent photos and distribution maps (plus one shot of a
dominant herbivore cluster of millipedes munching an Ganoderma tsugae in
the ‘edible’ mushroom chapter) precede observations on some little known
roles and interactions of fungi, such as the truffle-tree-animal triumvirate, sand
ecosystems, and nitrogen-seeking Hebeloma, Laccaria, and Onygena ‘corpse
finders’. Appropriately enough, next on the menu are toxins, symptoms, and
good to somewhat blurry portraits of and maps for the region’s 15 poisonous
Book Reviews ... 949
mushroom species. Found here is Inocybe calamistrata (a mushroom Id never
thought of consuming, but its blue pigmented ‘foot’ might attract those vainly
hoping for a hallucinogenic high). Also portrayed is a mushroom labeled
as Clitocybe (now the type species of Ampulloclitocybe) clavipes looking far
too slender, small, white, and suspiciously far more like Clitocybe fragrans,
another known poisonous mushroom. This is one book that stresses the deadly
poisonous Amanita franchetii—an otherwise beautiful mushroom common
throughout Haida Gwaii.
Moving from the deadly poisonous to the strictly hallucinogenic, the
next chapter focuses on two “main candidates” for “visionary mushrooms
traditionally used as ritual or spiritual intoxicants in Haida Gwaii:” the liberty
cap (Psilocybe semilanceata, probably introduced by immigrant farmers) and
the fly agaric (Amanita muscaria, an abundant endemic). Six pages are devoted
to the modern natural and legal history surrounding these “magic” mushrooms.
The atlas comprises 139 photos (of variable quality) covering 105 species,
including a salal leaf infected by Valdensia heterodoxa (which escaped the
clutches of the final checklist, although not the index). As this volume is
not intended to serve as an identification guide, these photos merely whet
the appetite for further information, and the atlas concludes with a list of
recommended guides and references.
The authors next summarize the scope of their prodigious five-year inventory
efforts: “Over the five years, we made eight field trips to Haida Gwaii of ten to
fourteen days. In all, 113 areas were visited ... and we made and preserved 2906
collections representing 635 species and documented 812 species of fungi (not
including lichens) from all available sources... We collected on nineteen islands
ranging in size of 0.5 hectares to the over 648,000 hectares of Graham Island.
The mushrooms ... remained largely unknown until 2003, when we began our
survey.’ The general bibliography precedes six wonderful photos showing the
authors (and Oluna’s photographer and botanist husband Adolf) in the field.
The final index and acknowledgments follow a 23-page checklist of the 635
species identified thus far from the surveys. Having participated in several long-
term fungal surveys (see Norvell & Exeter 2003), I understand all too well how
much work was involved in identifying the collections after all the fieldwork was
completed. To that end, I do wish the authors had provided a bit more detail on
which references they used to identify their finds. In his 2013 book review, Steve
Trudell suggested that in the absence of the usual identification caveats (e.g., cf.,
aff., sensu lato) the identifications should be “taken with a grain of mycological
salt” He recently amended this (Trudell 2017) by adding that although the
authors had originally included such identification disclaimers, the publisher
950 ... MycoTaxon 131(4)
unfortunately removed them from the published checklist. Misidentifications
or misapplications are to be expected, although the authors’ strengths in certain
genera (e.g., dark-spored saprobes for Paul, Inocybe for Oluna, and Russula for
Christine) lend more credibility to the checklist. All of us who have conducted
similar studies know full well that the real work of identification will continue
years after the fieldwork is complete and will applaud the authors for having
the courage to publish their results (however preliminary they might be) so
promptly and in so engaging a format.
For the most part there are relatively few typographical or spelling errors—
the few I noted were ‘Beauvaria’ for Beauveria, ‘Scerotinia’ for Sclerotinia,
and ‘prescottii’ for prescotii - and the nomenclature is more or less up-to-
date for 2012. I counted three synonym doublets: Bondarzewia mesenterica +
B. montana, Cystolepiota sistrata + Lepiota seminuda, and Galerina autumnalis
+ G. venenata (the last two synonyms of G. marginata). Oddly, while
‘Lichenomphalia is shown on p. 9, only Omphalina ericetorum (accepted as
L. umbellifera after a 25-year nomenclatural battle of epic proportions)
appears on the list. Other nomenclatural holdovers include Boletus (instead
of Chalciporus) piperatus, Clitocybe (instead of Arrhenia) hohensis, Coprinus
(instead of Coprinopsis) atramentarius, lagopus & phaeosporus, Gomphus
(instead of Turbinellus) kauffmanii, Mycena (instead of Roridomyces) rorida,
Omphalina viridis (instead of Arrhenia chlorocyanea), Paxillus (instead of
Tapinella) panuoides, Phlogiotis (instead of Guepinia) tremelloides, and Rozites
(instead of Cortinarius) caperata. Fortunately, as all names can easily be updated
using Index Fungorum, these discrepancies are hardly serious.
All in all, I find THe OUTER SpoREs: MUSHROOMS OF THE Harpa Gwall
eminently readable, enchanting, and educational and recommend it as an
excellent inspiration and guide for other surveys of hitherto untrammeled
wildernesses.
Kendrick, B. 2000. The Fifth Kingdom, 3" edn. Hackett Publishing, 400 p. + CD
ROM. ISBN 978-1-58510-022-4
Norvell LL, Exeter RL. 2004. Ectomycorrhizal epigeous basidiomycete diversity
in Oregon's coastal montane Pseudotsuga menziesii forests - preliminary
observations. IN Fungi in Forest Ecosystems: Diversity, Ecology, and Systematics,
Cathy Cripps (ed.). Memoirs of the New York Botanical Garden 89: 159-189.
Trudell S. 2017. Book Review: The Outer Spores: Mushrooms of Haida Gwaii. THE
MyYcopuiLeE May-June 53(3): 14-15. 2017 reissue accessed on 8 January 2017:
http://www.namyco.org/the_outer_spores_mushrooms_of.php
Book Reviews ... 951
LICHENS & LICHENIZED FUNGI
Rare Lichens of Oregon. By Ronald Exeter, ,
Charity Glade, Scot Loring. 2016.
Government Printing Office, Salem (Northwest
Oregon) District, Bureau of Land Management,
Oregon, USA. 190 p., ~290 color photos &
drawings, hard print + computer disc. ISBN— eggs
133.2978-0-9791310-6-6. 10:: 0-979-1310-6-5; = - ook
$30 (incl. postage, order by phone 1-503-375- Rare lechone
5646). Low resolution web version online:
https://www.researchgate.net/publication/309032897
of Oregon
Ronald L. Ex - Charity Glade - Scot Lorin
RARE LICHENS OF OREGON is the fourth lavishly illustrated and impressive
identification guide featuring rare, threatened, or endangered species
shepherded through the government printing office maze by the first author.
Ron, a botanist and colleague who adopted Ramaria as a genus needing
closer scrutiny during our six-year field studies of ectomycorrhizal fungi,
first approached the USDI-Bureau of Land Management Salem District
about printing a photographic regional monograph covering a good many
“species of interest’ cited by the Northwest Forest Plan. RAMARIA OF THE
PACIFIC NORTHWESTERN UNITED STATES (Exeter & al. 2006), which combined
descriptions derived from research papers and personal collections with
photographs taken by the original authorities and in the field, proved an
immediate success. It was followed two years later by the equally well-received
PNW Phaeocollybia monograph (Norvell & Exeter 2008) and then eight years
later by the outstanding RARE BRYOPHYTES OF OREGON (Exeter & al. 2016).
This valuable addition to Pacific Northwest lichen species literature
thoroughly covers 78 special status lichen species cited in the most recent RARE,
THREATENED AND ENDANGERED SPECIES OF OREGON (ORBIC 2016) plus
Leptogium compactum (Stone et al. 2016), a not-yet-listed recently described
species currently regarded as rare in Oregon. The 8%” x 11” print copy with
sturdy paper cover and glossy pages is an excellent size for displaying the many
detailed full color photos and maps.
Acknowledgments, a color bar key to sections, and table of contents
precede a brief 2-page introduction, color-coded map of Oregon's counties
and eco-regions, and a 3-page table summarizing in which eco-regions each
species has been found. The authors refer readers to MACROLICHENS OF THE
PaciFic NorTHWEST (McCune & Geiser 2009) and LICHENS OF NORTH
952 ... MyCOTAXON 131(4)
AMERICA (Brodo & al. 2001) for detailed lichen structure and biology, keys,
and glossaries, which are not included in this volume. The nomenclature has
been checked with IndexFungorum (www.indexfungorum.org), and special
note is made of nomenclatural changes for four species recently updated in
the ORBIC list: Circinaria (= Aspicilia) rogeri, Gyalolechia (= Caloplaca)
stantonii, Pseudocyphellaria hawaiiensis (= P. perpetua), and Usnea subgracilis
(= U. schadenbergiana).
The species descriptions are divided into two sections: 58 macrolichens
and 21 microlichens, with the species in each section listed alphabetically,
particularly handy given the lack of an index. Left-hand text pages headed by
the scientific name face right-hand illustration pages with (1)2-6 illustrations
(superbly sharp photos, most taken by coauthor Scot Loring, are occasionally
accompanied by lovely and equally detailed pencil habit drawings). Recent
synonyms, common names, a field summary, and diagnostic characters precede
a brief description of the thallus, apothecia or ascomata, chemistry, ecology,
distribution, and comparison with similar species. Each treatment concludes
with a list of references, flagging those with color plates. Not surprisingly in a
book devoted to rare species, there are ten macrolichen and five microlichen
species that are illustrated in color here for the first time.
The volume concludes with seven pages of maps showing distribution by
county, a list of abbreviations and symbols, two pages of micro-images of
the photobionts Dictyochloropsis, Stichocoocus, and Trentephohlia, a 9-page
bibliography, a map of North America, and the CD-disc in a sleeve on a back
cover illustrated with six (unfortunately not identified) lovely lichen photos.
The inclusion of the algal partner recalled this mycologist’s early days of trying
in vain to match one lovely ‘fungus’ (strangely always fruiting on a powdery
grayish green ‘substrate’) with the few Hymenoscyphus photos in Breitenbach &
Kranzlin (1984). (My gratification at eventually discovering the lichenological
nature of Icmadophila ericetorum only slightly offset my embarrassment at not
recognizing its ubiquitous algal symbiont in the first place.)
The only drawback to this lovely and welcome addition to Oregon's BLM
publishing pantheon is the retirement of its first author as Salem botanist
shortly after publication. We wish our man in Salem well, but who now will
serve as mycological guardian angel at the Northwest Oregon District Office?
Breitenbach J, Kranzlin F. 1984. FUNGI OF SWITZERLAND 1. ASCOMYCETES. Lucerne:
Edition Mykologia. 310 p.
Brodo IM, Sharnoff SD, Sharnoff S. 2001. LICHENS oF NORTH AMERICA. Yale
University Press, New Haven. 795 p.
Book Reviews ... 953
Exeter RL, Norvell L, Cazares E. 2006. RAMARIA OF THE PACIFIC NORTHWESTERN UNITED
StaTEs. USDI BLM/OR/WA/PT-06/050-1792, Salem, Oregon 157p. Lo-res web version:
https://www.researchgate.net/publication/255719422
Exeter RL, Harpel J, Wagner D. 2016. RaRE BRYOPHYTES OF OREGON. USDI-BLM Salem
District. ISBN—13: 978-0-29791310-4-2. 379 p. Lo-res web version: https://www.
researchgate.net/publication/305807271
McCune B, Geiser L. 2009. MACROLICHENS OF THE PACIFIC NORTHWEST, 2™ edn. Oregon State
University Press, Corvallis. 448 p.
Norvell LL, Exeter RL. 2009 (2008”). PHAEOCOLLYBIA OF PACIFIC NORTHWEST NORTH
America. USDI-BLM/OR/WA/GI-08/100-1792, Salem, Oregon 228 p. Lo-res web version:
https://www.researchgate.net/publication/307601665
ORBIC (Oregon Biodiversity Information Center). 2016. Rare, Threatened and Endangered
Species of Oregon. Institute for Natural Resources, Portland State University, Portland,
Oregon. 130 p.
Stone DF, Hinds JW, Anderson FL, Lendemer JC. 2016. A revision of the Leptogium saturninum
group in North America. THE LICHENOLOGIST 48(5): 387-421. https://doi.org/10.1017/
$00242829 16000323
Lek
@:
eS
Lichens of Uttar Pradesh. By Sanjeeva Nayaka & ff
D.K. Upreti. 2014 (“2013”). U.P. State Biodiversity
Board (printed by Shivam Arts), Lucknow, UP India.
177 p., ~405 color illustrations. PDF available online: UTTAR PRADESH
http://www.upsbdb.org/pdf/2014/09/Books/2-
Lichens_of_Uttar_Pradesh.pdf. Dever”
Uttar Pradesh State Biodiversity Board
LICHENS OF UTTAR PRADESH, which arrived by post some time ago, has been
buried on my desk patiently awaiting rediscovery. Prepared by two expert
lichenologists, this handy-sized (~14 x 22 cm) volume endeavors to expand
the lichen coverage of a diminished Uttar Pradesh after the 1999 partition of
Uttarakhand state, where until then most Uttar Pradesh collections had been
collected. This 2014 publication is based on “critical observation of more than
2250 lichen specimens in NBRI and based on field studies in 35 (out of 75)
districts in the state.” Nayaka & Upreti, who treat 135 taxa representing 46
genera in 25 families, contributed 41 new records, thereby adding 61 species
(11 new to India) to earlier lists, and excluded 15 cited in Nayaka & Upreti
(2011) based on erroneous identification or doubtful occurrence.
954 ... MycoTAXON 131(4)
Two forwards and an author preface precede a brief but engagingly written
introduction that touches on the symbiotic nature of lichens (“at a given time
[a] lichen can have members from two to three kingdoms altogether: Fungi,
Protista, and Monera sensu Cavalier Smith 2002)” as well as outlines their
household uses, medicinal potential, and importance in perfumery and dyes
and as air pollution indicators. I was intrigued to learn that lichens form an
integral ingredient in Garam Masala (India’s famed powdered spice) and that
several different species (35 identified in one spice mixture) may be used in a
single spice. Lichens are believed to have curative powers for everything from
headaches to leprosy and Uttar Pradeshis use smoke produced by burning
Thamnola vermicularis to kill germs in milk storage containers.
A brief overview of the geography of the state (home to almost 200 million
people) covers the climate, topography, and vegetation. There follow pages on
the status of lichen diversity in India, an outline of lichen study in Uttar Pradesh,
a note on the current state of knowledge on lichen diversity in the state, a list
of the now excluded previously reported 16 lichen taxa, and a conspectus of
the 135 taxa covered taxonomically. The introductory pages conclude with
methodological notes, a map of Uttar Pradesh districts, and photos of six
different lichen habitats.
A 5-page key to the lichen genera of Uttar Pradesh introduces the 139-
page taxonomic section, organized alphabetically by genus. Generic names
(with authorities and family) are accompanied by formal generic descriptions,
numbers of species reported both worldwide and in India, and important
literature references. Where needed, a species key precedes individual species
treatments, each of which presents a full morphological description, chemistry
analysis, and ecological notes accompanied by 3-4 illustrations with photos
depicting the lichen macromorphology and/or important anatomical characters
plus a district-linked distribution map. Although the photos are small and have
a somewhat soft focus, they are definitely adequate for identification purposes,
making the book quite useful in the field. References, a welcome 5-page
glossary, and a taxonomic index to families and species organized by genus
conclude the volume.
Nomenclaturally, the authors have definitely done their homework and
have updated names in accordance with Ertz (2009) Liicking (2009), Liicking
et al. (2009), Mangold et al. (2009), Sharma et al. (2012), and Staiger (2012); a
quick comparison of their names with those cited in IndexFungorum confirms
that the nomenclature is current. The care taken to exclude misdetermined (or
misreported) species from their 2011 list suggests that their taxonomy is equally
reliable. Unfortunately this care does not extent to proof-reading, as there
Book Reviews ... 955
are a great many typographical or grammatical errors sprinkled throughout
the text—a firm ‘fooling’ (for ‘footing’ in the first forward), Anisomeridium
‘calicicolum’ (p. 22, for calicolum,’ which should, however, be correctly
transcribed in Latin as calicola), and “Moussurie (p. 166, for “Missouri’)
Botanical Gardens are but a few—but fortunately these errors generally do not
obscure the meaning and do not detract significantly from the utility of the
book.
Given the size of the state, it is certain that additional lichen species will be
found. The authors are to be commended for providing such a useful resource
for continuing lichen research in Uttar Pradesh.
Ertz D. 2009. REVISION OF THE CORTICOLOUS OPEGRAPHA SPECIES FROM THE
PALAEOTROPICS. Bibl. Lichenol. 102. J. Cramer, Berlin & Stuttgart.
Licking R. 2009. The taxonomy of the genus Graphis sensu Staiger (Ascomycota;
Ostropales; Graphidaceae). LICHENOLOGIST 41(4): 319-362.
Licking R, Archer AW, Aptroot A. 2009. A world-wide key to the genus Graphis
(Ascomycota; Ostropales; Graphidaceae). LICHENOLOGIST 41(4): 363-452.
Mangold A, Elix JA, Lumbsch HT. 2009. Thelotremataceae. 195-420 in FLORA OF
AUSTRALIA VOLUME 57. LICHENS 5 (PM McCarthy, ed.). ABRS and CSIRO
Publishing, Canberra and Melbourne.
Nayaka S, Upreti DK. 2011. An inventory of lichens in Uttar Pradesh through
bibliographic compilation. 24-35 in NATIONAL CONFERENCE ON FOREST
BIODIVERSITY: EARTH’S LIVING TREASURE. Uttar Pradesh State Biodiversity
Board, Lucknow.
Sharma B, Khadlikar P, Makhija U.2012. New species and new combinations in the
lichen genera Fissurina and Hemithecium from India. LICHENOLOGIST 44: 339-
362.
Staiger B. 2012. Die FLECHTENFAMILIE GRAPHIDACEAE. STUDIEN IN RICHTUNG
EINER NATURLICHEN GLIEDERUNG. Biblioth. Lichenol. 85. J. Cramer, Berlin &
Stuttgart.
ASCOMYCOTA
In perusing my bookshelves, I was startled to discover several excellent texts
that MycoTtaxon—except for an occasional brief announcement—has pretty
much ignored. Because these invaluable SrupiEs In MycoLocy volumes
(published by the Centraalbureau voor Schimmelcultures) merit much closer
scrutiny, I have taken the liberty of briefly summarizing on the next pages the
contents of three past issues, all open access and thus immediately accessible
online through ScienceDirect.
All papers are accompanied by excellent phylogenetic analyses, superb
photographic plates (most tending toward the spectacular), and scientifically
rigorous taxonomic descriptions.
956 ... MycoTAXxoN 131(4)
4} Plant pathogenic and endophytic
Botryosphaeriales known from culture.
Alan J.L. Phillips, Bernard Slippers, Johannes
Z. Groenewald & Pedro Crous, eds. 2013.
STUDIES IN MycoLoGy 76 (September 2013).
PDFs online:
http://www.sciencedirect.com/science/
journal/01660616/76
This issue, dedicated to Dr. Robert A. Shoemaker, a Canadian plant pathologist
well known for his extensive studies on Dothideomycetes, presents three
papers. “A phylogenetic re-evaluation of Phyllosticta” by S Wikee, L Lombard,
C Nakashima, K Motohashi, E Chukeatirote, RCheewangkoon, EKH McKenzie,
KD Hyde & PW Crous (pp. 1-29) redefines Phyllosticta (noting “in moving to
a unit nomenclature for fungi...Phyllosticta was chosen over Guignardia) and
resurrects the older family name Phyllostictaceae. A multigene DNA dataset
used to investigate 129 Phyllosticta isolates (and representing ~170 species
names) showed that many were synonyms of P. capitalensis and supported
12 new species and two new combinations.
“Phylogenetic lineages in the Botryosphaeriales: a systematic and evolutionary
framework” by B Slippers, E Boissin, AJL Phillips, JZ Groenewald, L Lombard,
MJ Wingfield, A Postma, T Burgess & PW Crous (pp. 31-49) covers the
phylogenetic evaluation of botryosphaerialean genera known from culture
and recognizes six families: the previously named Botryosphaeriaceae,
Phyllostictaceae, and Planistromellaceae and the newly proposed
Aplosporellaceae, Melanopsaceae, and Saccaharataceae.
“The Botryosphaeriaceae: genera and species known from culture” by
AJL Phillips, A Alves, J Abdollahzadeh, B Slippers, MJ Wingfield, JZ Groenewald
& PW Crous (pp. 51-167) focuses on the phylogenetic recognition of 17 genera
and 110 species presently known only from culture. Keys to the genera and
species are provided, and one new species (Neofusicoccum batangarum) and 12
new combinations (in Botryosphaeria, Cophinforma, Dothiorella, Lasiodiplodia,
Neoscytalidium, and Sphaeropsis) are proposed.
Book Reviews ... 957
A polyphasic taxonomy of Daldinia
(Xylariaceae). By Marc Stadler. Thomas
Leessge, Jacques Fournier, Cony Decock,
Beata Schmieschek, Hans-Volker Tichy &
Derek PerSoh. 2014. Srupigs 1s MycoLocy 77
(March 2014): 1-143. PDF online:
http://www.sciencedirect.com/science/
journal/01660616/77
For someone only dimly aware that there were more species in Daldinia than
D. concentrica, this thorough exposition of 47 taxa and their morphology,
biogeography, chorology, ecology, and secondary metabolites was most welcome.
The genus, divided into 5 major groups based on morphological and chemo-
taxonomic characters and supported by molecular analysis, demonstrates the
additional taxonomic value that fungal secondary metabolite profiles can provide
beyond the species rank. The genus as amended incorporates many new
synonymies, excludes several previously published names, and admits 6 new
species and two new combinations to the genus. The rDNA-based phylotree
separates Daldinia from Annulohypoxylon and Hypoxylon while nesting
representatives of small predominantly tropical genera within its clade.
Hypocrealean lineages of industrial and
phytopathological importance. By Lorenzo
Lombard, Johannes Z. Groenewald & Pedro
Crous, eds. 2015. Srupirs In MycoLocy
80 (March 2015). PDFs online: http://www.
sciencedirect.com/science/journal/01660616/80
Dedicated to Amy Rossman, an American
mycologist “well known to mycologists and
plant pathologists around the world for her
scientific passion for ... hypocrealean fungi”
958 ... MycoTAxon 131(4)
[not to mention her engagingly cheerful and encouraging personality], these
five papers focus on the taxonomy and revision of the generic and species
concepts in the Hypocreaceae and Nectriaceae (Hypocreales).
“Biodiversity of Trichoderma (Hypocreaceae) in southern Europe and
Macaronesia” by WM Jaklitsch & H Voglmayr (pp. 1-87) recognizes 90
Trichoderma species (the 17 new to science dazzlingly illustrated by excellent
photos) supported by TEF1-, RPB2-, and acLi-based sequence analyses from
>650 identified specimens.
“Diversity and potential impact of Calonectria species in Eucalyptus
plantations in Brazil” by RF Alfenas, L Lombard, OL Pereira, AC Alfenas, and
PW Crous (pp. 88-130) identifies 20 Calonectria species new to science plus
C. pseudopteridis (nom. nov. for Cylindrocladium macrosporum) based on
sequence analyses of the 6-tubulin, cMp, TEF1a, and HIs3 DNA regions and
reveals the C. pteridis complex as the most common species complex in Brazil's
Eucalyptus plantations.
“Novel taxa in the Fusarium fujikuroi species complex from Pinus spp.’
by DA Herron, MJ Wingfield, BD Wingfield, CA Rodas, S Marincowitz &
ET Steenkamp (pp. 131-150) explores the diversity of Fusarium species
associated with four species of diseased pine in Colombian plantations and
nurseries. 6-tubulin and TEF1a sequence analyses of 57 isolates sampled from
plants displaying stem cankers, branch dieback, and seedling root/collar rot
identified more than ten Fusarium species, of which five are named as new.
Four of the new species displayed a level of pathogenicity on Pinus patula
comparable to that of the pitch canker pathogen F. circinatum.
“New species, hyper-diversity and potential importance of Calonectria spp.
from Eucalyptus in South China” by L Lombard, SF Chen, X Mou, CD Zhou,
PW Crous & MJ Wingfield (pp. 151-188) summarizes surveys of Eucalyptus
displaying symptoms of leaf blight in Guangdong, Guangxi, and Hainan
provinces that produced a large number of Calonectria isolates. Of the 21 isolates
identified using the Consolidated Species Concept employing morphological
characters and DNA sequence comparisons of the B-tubulin, cmp, TEF1a,
and HIS3 gene regions, 18 represented new taxa (12 in the Sphaero-Naviculate
Group; 6 in the Prolate Group). Southeast Asia appears to represent a centre of
biodiversity for the Sphaero-Naviculate Group, which could be an important
constraint to eucalypt forestry in China.
“Generic concepts in Nectriaceae” by L Lombard, NA van der Merwe,
JZ Groenewald & PW Crous (pp. 189-245). Nectriaceous species are unified by
phenotypic characters such as uniloculate ascomata that are yellow or orange-
Book Reviews ... 959
red to purple and exhibit phialidic asexual morphs. The family’s generic concepts
have been poorly defined due to the unavailability of DNA sequence data
for many genera. A multi-gene phylogenetic analysis of known nectriaceous
genera using partial 28S LSU sequences and the ITS1+5.8S+ITS2, AcL1, RPB1,
RPB2, ACT, TUB2, CMDA, HIS3, & TEF1 regions from available type and authentic
strains support six new genera (Aquanectria, Bisifusarium, Coccinonectria,
Paracremonium, Rectifusarium, Xenoacremonium) that accommodate species
previously classified based solely on morphology. Additionally several
generic names are proposed for synonymy based on the abolishment of dual
nomenclature, and a new family (Tilachilidiaceae) is introduced for two genera
previously accommodated in the Nectriaceae.
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 © 2016. Mycotaxon, Ltd.
October-Dece, ber 2016— Volume 131, p. 961
http://dx.doi.org/10.5248/131.961
NOMENCLATURAL NOVELTIES AND TYPIFICATIONS
PROPOSED IN MYCOTAXON 131(4)
Abieticola Hyang B. Lee [MB 811702], p. 755
Abieticola koreana Hyang B. Lee [MB 811703], p. 755
Alternaria parvicaespitosa Gannibal & D.P. Lawr. [MB 816666], p. 784
Apiosordaria hamata B. Wu, K.D. Hyde, Jing Z. Sun & Xing Z. Liu
[MB 812280], p. 852
Arthromoniliphora S.S. Silva, Gusmao & R.F. Castaneda
[MB 813427], p. 822
Arthromoniliphora araucariae S.S. Silva, Gusmao & R.E Castaneda
[MB 813428], p. 822
Blodgettia saprophytica C.L. Yang, Z. Li & X.G. Zhang [MB 819496], p. 909
Discopycnothyrium Hongsanan & K.D. Hyde [IF 551024], p. 862
Discopycnothyrium palmae Hongsanan & K.D. Hyde [IF 551023], p. 863
Entalbostroma J.D. Rogers & P.R. Johnst. [MB 817225], p. 766
Entalbostroma erumpens J.D. Rogers & P.R. Johnst. [MB 817226], p. 768
Nawawia oviformis J. Peng & Z.F. Yu [MB 815592], p. 737
Pezicula chiangraiensis Ekanayaka & K.D. Hyde, [IF 551789], p. 744
Phaeocollybia pakistanica J. Khan, Sher & Khalid [MB 818193], p. 892
Podosporiopsis Jian Ma, X.G. Zhang & R.F. Castafieda [IF 551862], p. 774
Podosporiopsis obclavata Jian Ma, X.G. Zhang & R.F. Castaneda
[IF 551864], p. 775
Podosporiopsis sinensis Jian Ma, X.G. Zhang & R.E Castafieda
[IF 551863], p. 774
Podosporium bacilliforme J.Y. Wang, Yu M. Cai & X.G. Zhang
[MB 819468], p. 842
Strigula sinoaustralis S.H. Jiang, X.L. Wei & J.C. Wei [FN 570267], p. 797
Thelenella haradae J. Halda, Xin Y. Wang, J.A. Ryu & Hur [MB 819398], p. 806
Zasmidium oleae Y.L. Guo, X.W. Xie & B.J. Li [FN 570159], p. 791
MY COTAXON
ISSN (print) 0093-4666 (online) 2154-8889 © 2016. Mycotaxon, Ltd.
October-December 2016—Volume 131, pp. 963-1000
http://dx.doi.org/10.5248/131.963
Richard Paul Korf (1925-2016): A Celebration
LORELEI L. NORVELL, EDITOR
Mycotaxon Editor-in-Chief, 6720 NW Skyline Boulevard, Portland OR 97229 USA
ITHACA JOURNAL, DECEMBER 9, 2016—“Richard Paul Korf, age 91, died August 20, 2016, at
home in Ithaca, NY, leaving behind his wife, Kumi, with whom he was enchanted for over
50 years, and his adored children Noni, Mia, Ian, and Mario, and grandchildren Maia Vidal,
Zak Korf, Zephyr Gettelman, Mason Korf, and Matéa LeBeau. Dick’s academic life began at
Cornell University in 1941 at the age of 16, and he received his Ph.D. in Mycology from the
Department of Plant Pathology in 1950. He taught one year in the Botany Department of
Glasgow University (Scotland) before returning to his alma mater where he continued in his
teaching and research until his retirement as an Emeritus Professor in 1992. Dick was elected
President of the Mycological Society of America, received two Fulbright awards (Japan and
Belgium) and an NSF Senior Postdoctoral Fellowship (Japan). He was offered but declined
a Guggenheim Fellowship, and has received several honorary awards for his teaching and
research.”
ABSTRACT— With this section, MycoTaxon celebrates the life of its mentor and co-founder,
Richard Korf, who died after a brief illness at home in 2016 surrounded by his family and
faithful companion, Meena. Materials from other publications and web posts accompany
reminiscences by Dick’s colleagues, students, authors, and family.
PREFACE: Eliciting contributions from friends and colleagues after any death is difficult,
but arranging them into a coherent whole in a scholarly research journal established
by the ‘honoree’ himself has proved doubly so. Those who knew Prof. Korf as ‘Dick’
submitted fond memories that amuse, inspire, and make readers wish they had known
him better. His many contributions were so varied that we have chosen to cite only a few.
Dick would undoubtedly be gratified that this collection of reminiscences is published
more or less as submitted and forgive us for allowing his full accomplishments to be
enumerated elsewhere; he would, however, heartily disapprove of my shameful use of
material previously published or blogged elsewhere.
A complete scholarly obituary should include all publications written, offices held,
organizations joined, and end with one sentence dispensing of family relationships.
However, Korf’s papers and books are listed on www.MycoTaxon.com/pubsRPK.html
and the Richard P. Korf Wikipedia entry cites three genera and 16 species named after
964 ... Norvell (editor)
him and outlines his formidable curriculum vitae, and so we opt instead to celebrate
his life with an eclectic mixture of photos and fond reminiscences. Mourning the
passing of our self-professed curmudgeon and in the spirit (if not the words) of
Shakespeare’s Marc Anthony, we all have come here to praise him.
K.E. Loeffler; courtesy of the CUP image collection
Fic. 1—Dick at his microscope in his Cornell office in 1985
Mycotaxon remembers
Not surprisingly, I first became acquainted with Dick through the colorful
MycoTaxon volumes on the Oregon Mycological Society library shelves.
Informed by 1979 OMS Foray guest mycologist Harry Thiers that we needed
a species checklist, I had begun compiling a master list of Pacific Northwest
macrofungi from journals, books, and reprints. The tedious page-by-page
scrutiny of MycoTAXON prompted me to write to its Editor seeking some sort
of index. By return mail a manila envelope arrived from a Dr. Richard P. Korf
filled with a bundle of typed sheets covering the first 8 volumes accompanied
by request for a quick return of this, his only copy, as he soon intended to
publish a cumulative index (i.e., Korf & Gruff 1985). Researchers today—with
immediate access to INDEX FUNGORUM, MycoBank, and the Internet—cannot
appreciate the true value of what Dick so generously shared with a complete
stranger whose only credential was an interest in fungi. It did, however, net him
an appreciative individual subscriber.
R.P. Korf (1925-2016): A celebration ... 965
I met Professor Korf in person in 1990 as a first-year graduate student.
My supervisor, Joe Ammirati, dispatched me to escort our esteemed visitor
across the University of Washington campus to the Suzzallo Library. Praising
the MycoTaxon submission procedure, I thanked him again for his 1980
generosity; he in turn proudly spoke to MycoTaxon’s success (despite dire
predictions to the contrary) as a journal prepared by authors mentored by
their chosen peer reviewers. We agreed that open peer review was peculiarly
suited to taxonomy where the ultimate peer is the scientist who must test post-
publication hypotheses and that delays inherent in journal-controlled blind
reviews were unnecessary. (Needless to say, three years later my first research
papers were published in Mycotaxon. Dick’s acceptance letters, generally
concluding with a kindly “Thank you for your fine contribution” were the
source of much preening on my part.)
The 1991 Mycological Society of America meeting (my first) in San Antonio
underscored the extent of Dr. Korf’s prodigious mycological contributions. We
chatted briefly before the awards ceremony where he received the Distinguished
Mycologist award from a society that he had served as Councilor (1958-1960,
1965-1968), Secretary-Treasurer [and MSA Newsletter editor] (1969-1970),
Vice-President, and President (1970-1971). Not confined to one continent, Dick
Fics 2 & 3—Fathers of Mycology:
Fia. 2. Elias Magnus Fries (1794-1878), sometime after his 80" birthday. Fic.3. Richard ‘Elias Fries’
Korf (1925-2016), aged 69 in full Friesian regalia for a performance as Elias Fries at Cornell.
Noni Korf
966 ... Norvell (editor)
Chandler Photographers; Courtesy Amy Rossman
ag Mics eee
.
Fic. 4—Dick Korf chatting with ‘Case’ Bas at the
First International Mycological Congress at Exeter, UK, in 1971.
Amy Rossman
Fic. 5—Back in Eliasian fieldgear, Dick reprises his performance at Oslo’s
seventh International Mycological Congress in 2002 and gives a big hug to Karen Hansen.
R.P. Korf (1925-2016): A celebration ... 967
had also served on the International Botanical Congress (IBC) Nomenclature
Sections Committee for Fungi & Lichens and was 1973-1977 chair of the
International Mycological Congress's Standing Nomenclature Committee. An
international force to be reckoned with, Dick received the Ainsworth Medal,
the International Mycological Association's highest award, in 2010.
Back in 1994, I waltzed up to his 200-year-old Friesian persona at IMCV
in Vancouver and, in an ill-advised attempt at humor, ‘complimented’ him
with, “you really don't look as OLD as you are!” Immediately drawing himself
up, he glared haughtily at me. I’m still not certain whether he didn't ‘get’ it
or merely remained steadfastly in character. Whatever his true feelings,
I promptly wilted and scurried away, abashed.
Despite his self-proclaimed status as
curmudgeon, Dick (whom in 1998 I still
addressed somewhat timorously as “Dr.
Korf’) offered a sympathetic pair of eyes
and amusing advice during my years as
INocuLuM Editor and MSA Secretary.
On the heels of my second MSA
newsletter, I received a cordial note
with the news that Heinz Clémencon Frc. 6—The infamous “oh no, another erratum”
cartoon shared by Dick
was associated with the University of
Lausanne (not Lucerne) accompanied by a small cartoon to soften his proof
that I was not perfect. This goaded me to establish an ‘Embarrassing omissions,
additions, and corrections’ section, printed far too often to suit either of us.
He followed the cartoon with later gems: [August 1998] “Nothing new to add,
but on page 11 I learned that in 1988 Scot Rogers became a Department of
Botany at the University of Washington. Pll bet he was surprized [sic]!” and
[October 1998] “Dr. Richard Hanlin’s proper first name is “Dick (as in Hanlin),
not Robert (as in Heinlein).” My pleasure at his correctly kenning the source of
my temporary confusion re Dick Hanlin did not, however, lessen my chagrin at
misplacing the name of so amiable an MSA former president and friend.
‘Dr. Korf’s phone call in 2003 asking me to serve as next MyCOTAXON
Editor-in-Chief left me flabbergasted. Thoroughly tired of deadlines, errata,
and other editorial nightmares, I had placed editorships behind me. Despite
the small honorarium, however, Dick’s offer was too professionally tempting
to refuse. It would be fun, I mused, to cobble together something for a change
without having to write anything (ignoring former Editor-in-Chief Jean Boise
Cargill’s dry warning that Don Pfister’s estimate of one day per week for her
editorial work fell short of the mark). I mused wrongly, of course, but accepted
Dick's offer and prepared by ordering my last few back MycoTaxon volumes.
968 ... Norvell (editor)
MycotTaxon was Dick’s mycological
love child. In his farewell to co-
founder Grégoire Hennebert, who
retired from our masthead after 32
years as French Language Editor
(including 17 years as Book Review
Editor), Dick proudly recapitulated
the founding and evolution of their
Bi
m
io}
M
a4
fad
Ga
°
a
n
5}
Bit
a
=|
°
O
journal even as he worried over
the economic feasibility of printed
taxonomic publications (Korf 2007).
From its 1973 inception to 2016's
thwarted free open access, thejournal
remained a source of joy and worry
for its Cornell co-founder. After
| ‘retiring’ from active duty as 1974-
Fic. 7—Grégoire Hennebert and Dick Korf 1991 Managing & English Language
plot out their new journal, Mycoraxon, at the Editor, Dick used the title Editor-in-
Université catholique de Louvain (Belgium) in (Chief for his appointed successors—
ye Jean Boise-Cargill (1991-1998),
Pavel Lizon (1998-2003), and me (2004-present)—who ostensibly handled
the day-to-day production side. Dick nonetheless held onto the reins as chief
Journal Preparation wrangler (1991-2004), Business & Subscriptions Manager
(1991-2006), and Mycotaxon Ltd. Treasurer (1999-2015).
A surprisingly patient Dick projected two volumes of two 250-page issues
for 2004 before returning in 2005 to four 500+-page volumes. That first year we
imposed a cohesive MycoTaxon style upon the previous assortment of differing
font sizes and styles and moved from print-ready pages and reviews mailed in by
authors to computer-prepared files submitted by email. Although prone to fretting
about overworking his all-too-willing new E-i-C, Dick was mightily pleased that
we managed the changeover by the end of 2004, although we both despaired of
making my overly complicated ‘Instructions to Authors’ easily understood by
foreign authors and word-processing neophytes.
Dick granted his E-i-C complete freedom but did wistfully ask that we retain
his journal's title and size. He needn't have worried. The name MycotTaxon is
sacrosanct, and although a book format may appear outdated for hard copy, its
smaller page size permits readers to scan a complete page on-screen without having
to scroll up and down moving from column to column. (We did have a bit of a
‘discussion’ over my 2013 desire to shift the titles and sub-titles left from page center;
but after checking other journal formats, he somewhat grumpily acquiesced.)
R.P. Korf (1925-2016): A celebration ... 969
Nontheless, when his new E-i-C changed the unwieldy subtitle—ANn
international journal for research on taxonomy & nomenclature of fungi,
including lichens—to “THE international journal of fungal taxonomy and
nomenclature, Dick was ‘thrilled’ that Grégoire'’s and his journal now rightfully
merited the word “THE. He fretted that lichenologists might feel excluded until
I pointed out that ‘fungal’ democratically covered symbionts, myxomycetes,
and other fellow travelers.
Dick definitely encouraged my nabbing Shaun Pennycook as Nomenclature
Editor in 2005 when I realized that adding nomenclatural research to author
and reviewer correspondence, manuscript revision, and converting separate
text and illustration files into PDFs was too much for one person. Shaun's
volunteering to take over manuscript accession proved an unexpected boon
and soon neither of us could envision the journal without him.
Dick was passionate in his desire that MyCoTAXON survive without page-
charges through subscriptions alone. [Whenever I asked whether MycoTaxon
showed a profit, Dick would respond, “Occasionally, and then change the
subject by telling me not to concern myself with financial matters.] It had
long been obvious that rising postal rates would soon preclude our mailing
heavy print volumes to subscribers. However, after he paid out of pocket what
I considered an enormous sum to keep the journal solvent for one year, even
Dick realized that our financial model had to change. Aware that the next
International Code would permit publication of names online (see Norvell
2011), Dick urged the editorial advisory board and owners to move to online
publication in 2011. They agreed.
Unfortunately, although less expensive than hard copy, online publication
is not free. Webmaster and daughter Noni found an acceptable online host
(Ingenta), but as subscriber fees still could not cover journal costs, Dick and
Bookkeeper Hannes Maddens agreed to institute page charges. A highly
distressed Dick, who had hoped to offer a completely open-access journal,
discovered that obligatory open access fees were too high for many long-time
authors. Dick was bitterly unhappy that a completely open access MyCOTAXON
was economically unfeasible in 2011.
Naturally two strong-willed editorial types did disagree on occasion, and
there were definitely times when I felt the founder’s axe poised dangerously
close to my neck—usually when a quarterly deadline passed without a
publication. MycoTaxon was founded on a prompt turn-around. Our moves
to editorially prepared copy and rigorous scientific and nomenclatural editorial
review produced countless delays. Predictably submissions lagged, due also to
our newly instituted page charges, competition from an increasing number of
online mycological journals, and in 2012 a “perfect storm” of editorial illnesses.
970 ... Norvell (editor)
Our 500-page target proved increasingly unattainable; Dick felt that anything
under 300 pages did not merit the term ‘volume. We eventually resolved this
unhappy situation by changing ‘volume’ to refer to the annual publication of
four quarterly issues delivered more or less on time. [It is sadly ironic that this
paper has delayed publication of the final issue of volume 131.]
Fortunately such collisions were few, and I always looked forward to our
weekly chats, generally launched with neutral weather and health reports
before moving on to thornier problems, such as the discovery that for seven
volumes Else Vellinga had been identified as “BooL REviEw EpIToR” on the
masthead, and no one had noticed.
Dick also dispatched frequent pep-talks. To banish my doldrums over
author errors, he wrote, “We started with the concept that errors were the fault
of authors, not ours as editors/publishers. Any paper that requires editorial
correction by you (as opposed to corrections suggested by reviewers) should
be rejected outright until authors (or their reviewers) make their corrections.
If the title is incorrectly punctuated or misleading or non-informative, I'd
reject the paper outright till they get it right ... Your health is more important
than always trying to be the best friend of folks who don't deserve your pains!
Curmudgeonly, and simultaneously compassionately, Dick.”
When after too many years of stomach-crunching deadline madness, he
buttressed my decision (to correct only PDFs with editorial errors but not
author errors suddenly discovered by the authors after conversion) with,
“Dear over-worked E-i-C, Good idea. I think all author errors should appear in
the errata; we will change only editorial errors in PDFs before publication. Their
submission is what we print... Anything that will relieve your stress and Shaun's
is an improvement. I also highly applaud a much stricter rejection option.
Authors and reviewers both need to be made aware of their shortcomings.
Fondly, Dick.”
In 2011, amused by his body’s commitment to fungi after the successful
removal of a nasal melanoma, Dick wrote, “One bright yellow “mushroom”
almost as big as a golf ball (but flatter) remains, holding the skin graft from my
neck area in place while the blood vessels grow up into it and my nose becomes
grafted correctly. Mushroom probably has to be there a week or so. Think [ll
stay close to home for the next few days. Dick”
Ever the optimist, Dick always looked forward, as witness his response to
his co-founder’s condolences on our move to online publication. Grégoire had
written, “I do not know who chose the cover color [black] of the last printed issue
of MycoTaAxon after 36 years of printed life. For me it expresses adequately my
feeling receiving the last physical volume of your child. ...Now after its physical
R.P. Korf (1925-2016): A celebration ... 971
death, its soul will continue a virtual life, only easily accessible and usable to
illuminated minds.” Dick responded, “The color choice is always Lorelei’s. Her
feelings were like yours about the death of the printed journal. I did not agree.
I would have preferred some verdant GREEN or STARBURST to celebrate the
journal being reborn in a less environmentally destructive format.”
Richard Paul Korf was golden. Not to mention immortal, as noted by his
former student and friend, Wen- Ying Zhuang: “Dick left us, but his contribution
to mycology will stay forever.”
Unfortunately, that doesn’t mean we don't miss him—fiercely.
—LORELEI NORVELL
MycoTaxon Editor-in-Chief, Portland, OR
Fic. 8 (LEFT)—Meredith Blackwell, H. Peter Kahn, and Don Pfister with Dick during a 1994
Cornell Hoot at the Ringwood Preserve, Cornell Botanic Gardens. Fic. 9 (RIGHT)—Former MSA
presidents Robert W. Lichtwardt (1971-1972) and Richard P. Korf (1970-1971) with President
Orson K. Miller, Jr., and Kumi Korf at the 2000 MSA annual meeting in Burlington, VT.
“I was sad when I heard that Dick passed away. Dick meant a lot to me. He was
like a grandfather, mentor, and close friend. Even though I’m sad that he isn’t
around anymore, | will always have lots of happy memories of all of the great
things he has done.
“IT know I will never forget Dick. As I’m typing this at my desk, there are
reminders of him everywhere I look. ’m typing this on my MacBook, which
Dick got me hooked on after giving me his old Macintosh about 10 years ago.
On top of the stack of mostly MycotTaxon-related mail on my desk, is a bank
statement for one of my first bank accounts that Dick helped me set up. When
I look out of my window at my driveway, I see the forsythia hedge that Dick
helped to pay as a housewarming gift when I bought my house. In the kitchen
is the microwave he bought for my girlfriend and me when we first moved in
together. On the kitchen counter I see bottles of Guinness, one of my favorite
beers that I first tasted during one of the many times Dick took me out to eat.
Hanging on our coat rack is my favorite old fishing hat that Dick gave me about
15 years ago. I still think of him whenever I wear it.
972 ... Norvell (editor)
“These little reminders bring back lots of happy memories about good
conversations and stories during long car rides, fishing and swimming, late
night card games, and the many delicious dinners (like fish head soup) that
Dick prepared. Besides happy memories, all these little reminders of him also
bring back memories of all the good things I have seen him do over the years.
“I'm not going to spend hours writing about all of his kind and charitable acts
towards me and other people. I’m assuming most of his students, colleagues,
and friends must have experienced his kindness themselves. I just want to share
Dick's greatest gift to me.
“Dick’s greatest gift to me was his confidence in me. Dick's trust and
confidence in me has given me so much self-confidence. Dick believed I would
be successful in life, and he was always looking for ways that he could support
me. He always encouraged me to continue my education, but when I wanted
to work as soon as | graduated high school instead, he helped connect me with
people who could give me a job. Maybe he somehow knew I would attend
college the next year. When I went on my first date with my girlfriend, he let
me use his Miata sports car. When I told him I wanted to try living in a cabin
in the woods like Thoreau, he didn’t tell me I was crazy. Instead he sold me a
small piece of land he owned in Dryden. And, what I am most proud of is that
he trusted me to help run the journal MycoTaxon that meant so much to him.
I think Dick’s generosity and kindness towards so many came from the fact that
he believed in the goodness of people the same way he believed in me.
“T like to think that the kindness that Dick showed me lives on in me. Dick
once gave me a gift membership to the American Civil Liberties Union (a
charity I had never heard of), and now I am proud to support this and other
charities that he introduced me to. At work, I enjoy giving students confidence
that may help them get through school, just like Dick did for me.
“Like Dick, I am also trying to help Mycotaxon become an open access
journal, or if that is not possible, I would like go back to allowing taxonomists
to publish manuscripts quickly for free. Dick and I spent lots of time trying to
decide whether to continue to allow authors to publish for free (this was how
Dick ran the journal) or charging authors so that we could make the journal
free to everyone.
“Even though Dick isn’t here now, his memories, his generosity, and his
many kind acts will always be with us.’
— HANnNES MADDENS
Mycotaxon Bookkeeper & Subscriptions Manager, Ithaca NY
R.P. Korf (1925-2016): A celebration ... 973
The Theatre
Anyone acquainted with Dick was fully
aware of his theatricality, but they might not
have known of his real acting chops. Regarding
this extra-mycological passion, friend and
former MycoTAxon E-i-C Pavel noted (Lizon
2016), “Dick was performing as an amateur
actor both on stage and in the recording studio,
and for few years he even served as the Chair of
the Department of Theatre Arts at Cornell?
Dick himself explained, “My acting career
began at an early age in Riverdale Country
School in New York City, eventually being cast in
major roles in three annual outdoor productions
ous 2016
Courtesy of IMA Fun
Fic. 10—Dick’s 1980 actor’s
promotional photo
of Shakespeare's plays. ...The theatre has been my lifelong passion. I performed
during my college years at Cornell University (where I later became a professor)
and I continued, both on stage and in radio dramas. While on my final sabbatical
leave before retirement I took a fling at off-off-Broadway performances of three
plays while in New York City.” (Korf 2006)
Ezra, Cornell's quarterly magazine, revisited Dick's participation in the 1946
production ofa play on the founding of the college (Wilensky 2013): “Richard Korf
‘46, Ph.D. ‘50, Cornell professor emeritus of mycology, played ‘Angus Dangit’ in
‘Once Upon a Hill’ (one of his lines: “‘Humph. Makin’ a school outa Ezry’s farm!’).
Reprinted from Wilensky 2013
FiG.11—The soon-to-be illustrious Professor Korf as a hayseed peeks out at the audience
(extreme stage right, second from bottom) in a 1946 Cornell curtain call.
974 ... Norvell (editor)
(<¢9
It was just a fun thing to be in, he recalls, noting that his dog also got to
be in the show, wearing a Cornell sweater. He also remembers that there was a
spittoon sound effect used off stage, which was ‘used to emphasize some of our
comments.”
Korf at Cornell
Amy Rossman and Wen-
Ying Zhuang (2016) recall Dick's
introduction to his alma mater and
mycology. “Having entered Cornell
University intending to become a
gentleman farmer of Cornish game
hens (as I remember it), he soon
switched to mycology under the
influence of Harry M. Fitzpatrick
(1886-1949), completing his PhD
in 1950. With the untimely death of
his major professor, Dick joined the
faculty of the Department of Plant
Howard H. Lyon; courtesy of the CUP image collection
Pathology at a relatively young age.
He was thus the major professor for
several students who were about his
age or older. He started as Assistant
Fic. 12—Professor Korf at the blackboard Professor in 1951, and eventually
of Plant Science 326 lab in 1972. served as full Professor of Mycology
[at Cornell] from 1961-1992”
In his 90" birthday wishes, Pavel (Lizon 2016) rightly referred to Cornell as
Dick's life-long companion. “Under his guidance, more than 20 PhD students
graduated (Korf 1991), the first three—Robert A. Shoemaker, Robert L. Shaffer,
and Martin A. Rosinski—already in 1955.”
The Cornell Hoot
“When hunting mushrooms, it’s easy to lose students in the woods. ‘That's
why we practice the Cornell Hoot. Learning the Hoot is a highlight of the
first Fall field trip. With students gathered round, I describe the exquisite
art of collecting mushrooms, hand out crisp Cornell apples and maps, and
demonstrate the Cornell Hoot: a rising “Ah-OOOT!” My students shuffle
uncomfortably, but soon they can't help but smile. Now we practice together
Ah-OOT! Ah-OOOOT! Ah-OOOOOT! Even the shy ones can’t resist it. We
do it again in unison, very loudly. A distinctive sound.
R.P. Korf (1925-2016): A celebration ... 975
Courtesy of Pavel Lizon
at the Ringwood Preserve, Cornell Botanic Gardens.
“I've wondered where the Cornell Hoot came from. I learned it from my
predecessor, Dick Korf. Imagine my tingling excitement when I encountered
this passage in the 1903 travel diary of my great-great predecessor at Cornell,
George Atkinson, who was visiting the Botanical Gardens at Kew, in England:
“As time for closing the gates came on I heard musical voices from different
parts of the garden sing “all out, all out.” A custom very old, and now it is such
a perfunctory call that one can scarcely distinguish the words. It often sounds
more like ‘Ah-laio-
“... Then I heard back from Dick Korf. He said ‘Oh, it’s the Cornell Hoot
now, is it?’ And he told me it was ENTIRELY HIS OWN INVENTION. Recent
and local, not at all what I was thinking! It made me laugh out loud. But an
enchanting story still. Here's his tale: ‘It was when I was at Ringwood with one
of my first class field trips, maybe in 1951, and noticed that all students had not
returned. I thought it to be the loudest and most distinctive calls in my vocal
repertoire. I am pretty sure it didn’t come from one of the many plays I did
as an undergraduate and graduate student, learning to project my voice, even
a whisper, to reach the back row in the theatre, which Professor Alexander
Magnus Drummond demanded of us.” — Karuie T. Hopeg, Director
Cornell Plant Pathology Herbarium, Ithaca NY
Fic. 14—Dick chats with MycoTaxon E-i-C Pavel
during the 1994 hoot.
Courtesy of Pavel Lizon
976 ... Norvell (editor)
CUP—Cornell Plant Pathology Herbarium
Four days before my usually scheduled phone call to Dick, I learned of
his sudden demise from Scott LaGreca, who wrote, “We are sad to share that
Richard P. Korf passed away yesterday, at the age of 91. There was a small
reception at Noni’ house last night in Ithaca and I’ve never seen such an up-
beat group, celebrating a persons life. It was heartwarming.” Scott later added,
“At a reception Saturday night in Ithaca, his remarkable family and friends
raised toasts of Guinness (his drink of choice); remembered his generosity,
humor, and wisdom; and sang his favorite songs.’ Below is Scott's formal
contribution to our celebration of Dicks life.
Dick’s many personal and professional connections have made our herbarium
(CUP) what it is today. Dick contributed thousands of specimens from around
the world to our collection. I work every day surrounded by those specimens;
they are part of Dick Korf’s legacy: thousands of specimens, as well as his
notebooks and correspondence. Those specimens have people's names and
places on them, which tell Dick’s entire story.
My very first herbarium specimen (LaGreca no. 1!), also deposited in CUP,
was identified by Dick: Sarcosphaera gigantea (Rehm) Kanouse. I collected it
in 1989 after completing Dick's Field Mycology course. It was a hot summer
day when I brought the specimen to him for identification, and I was shocked
to see him shirtless in his lab: seeing my formal professor in such an informal
situation was strange to me! But I quickly got over my surprise when he
excitedly took the fungi from my collecting bag and started poring over his
identification books, quickly making a slide to examine its spores. Later, he also
showed me how to make the cups “poof” their spores. I'll never forget that day.
Right up until his death, Dick’s collaborations with other scientists around
the world inspired activity and growth for us here at CUP. For example: there
was a mycology student in the Canary Islands (Luis Quijada) who had just
completed his PhD in the systematics and floristics of cup fungi on the Canary
Islands. Dick ran an NSF-funded project on Canary Islands cup fungi for years
(resulting in many publications) and so Luis emailed Dick with some questions,
which led in turn to his requesting multiple loans of Canary Islands specimens
from us, which allowed (a) completion of his dissertation and (b) improvement
of our specimens here at Cornell with Luis’s examinations/annotations.
Another example: Madame Francoise Candoussau, a long-time friend
of Dick’s in France, has just this year decided to give her valuable personal
herbarium (comprising thousands of specimens, mostly from Europe) to
Cornell as a direct result of her friendship and longtime professional association
with Dick Korf.
R.P. Korf (1925-2016): A celebration ... 977
I should also mention that Dr. Korf was innovative in his teaching. At a
time when team-teaching was almost unheard of, he divided the work of his
Introductory Mycology class, inviting specialists of different groups of fungi to
teach for different weeks. Dick himself taught the first half of the course, while
other, ‘guest’ teachers took over the last half of the course. This allowed for a
more thorough mycology education for his grateful students. I know this sort
of thing is commonplace now, but at the time (25 years ago—1991) this was a
rare thing.
After I left Cornell and came back to work here with a PhD in lichenology, I
joked with Dick that hed inadvertently turned me into a lichenologist because
he always dismissed any lichen specimens that students (including me) brought
him. “Lichen!” is all he would say, tossing the specimen aside. I found it
fascinating that such a great mycologist had such a poor opinion of (and lack
of interest in) lichenized fungi, and this spurred me on to learn more. So in an
indirect way, I credit Dick for inspiring my career as a lichenologist.
—ScoTT LAGRECA, Curator
Cornell Plant Pathology Herbarium, Ithaca
a,
<x
—"
Dp
S
S
AQ
=
om
2
a)
°
a)
Fic. 15—Professor Emeritus Richard P. Korf,
CUP Director Kathie Hodge, and Curator
Robert Dirig pose with some specimens from
Cornell’s Fungi of China collection in 2009.
From China to CUP and back again
“Shu Chun Teng traveled halfway around the world on a scholarship to
study mycology at Cornell University in 1923. He left five years later with a
knowledge of fungi unequaled in China, then spent the next decade traveling
on horseback gathering up molds, lichens, yeasts, rusts and morels in the
forests, fields and marshes of his homeland. ...During the Japanese invasion
in 1937, Teng arranged for his best specimens to be removed from a national
botany institute he directed in Nanking to save them from destruction. During
World War II, they were smuggled by ox cart to Indochina and then by sea to
the United States, and 2,278 of the specimen packets ended up at Teng’s alma
mater.
“At Cornell’s initiative, the university is dividing up and sharing its Fungi of
China Collection with the Academy of Sciences in Beijing to help advance the
978 ... Norvell (editor)
<s oo (Sp
Fic. 16—Dick at the microscope in 1988 at the
Key Laboratory for Systematics & Microbiology in Beijing.
exploration of fungal species. ...In a repatriation ceremony Monday, Cornell
President David Skorton presented a high-level Chinese delegation with a rare
mushroom called Lentinus tigrinus, reafirming the university's desire to share a
collection he said it ‘has held in safekeeping for the global scientific community
since 1940’ ..Some 1,700 specimens will be delivered to China in the fall,
including 57 considered irreplaceable. Cornell will retain fungi that can't be
divided, but make them available to scholars.
“At the start of the devastating Cultural Revolution in the 1960s, Teng was
tagged as a ‘counterrevolutionary academic authority. Discharged from his
lab, he was subjected to daily beatings and mental persecution that ruined his
health and career, according to the science academy. He died in 1970 at age
67. Years later, his family managed to recover Teng’s confiscated manuscripts.
His daughter, Rosaline Deng, worked with a Cornell professor of mycology,
Richard Korf, to complete and publish THE FUNGI oF CHINA in 1996 (Teng
1996).
“Transferring the fungi ‘is our decision, said the 83-year-old Korf, who
taught at Cornell until 1998. “The whole reason really is that it makes scientific
sense, especially with the warming of U.S.-China ties over the last 30 years. ... It’s
clear we are cooperating in ways we never knew we could:
Wen-yen Zhuang; Courtesy of IMA Fungus 2016
R.P. Korf (1925-2016): A celebration ... 979
“Another impulse ... is I had a brilliant student, Wen-Ying Zhuang, come
to work with me from China in the 1980s and get her Ph.D. She became a
major figure in the Chinese mycological field. She certainly pressed me on how
important it would be for Chinese scientists to be able to easily access those
specimens.” —BeEn Dossin, Associated Press (Dobbin 2009)
~s
a
os 5
oe)
Wy ed
ie aed
Rs)
Wen-yen Zhuang;
* ¥ as ic| ™
| pa NOIAN PLAZA ie
Fic. 17—Seeing the sights on the way home
from the 1986 MSA Annual Meeting in Gainesville, Florida.
Students and Fellow Travelers
“Dick obviously enjoyed his students, believed in them, and wanted them
to be successful. As such he encouraged them to attend scientific meetings
doing whatever he could to ensure that they managed to get there. This
included towing his own pop-up camper staying with his students in a
campground near the meeting site.” —Rossman & Zhuang (2016)
“One of the world’s most notable mycologists of all times died on August 20,
after ninety-one years of a well-lived life.
“Dick Korf, Professor at the Plant Pathology Department at Cornell
University, was a leading figure in the study of discomycetes (Leotiomycetes and
Pezizomycetes) and a mentor to many in this field. Not only did he convey his
love and appreciation of fungi but also taught us the importance of rigorously
studying the morphology of fungi and their role in nature and the environment.
+E
me
So
aq
nN
Bf
g
3
jam
x
a
nN
vo
2
bol
3
fc}
Os
980 ... Norvell (editor)
This came with hours of hours of observations of each specimen under the
microscope, methodically recording morphological and anatomical features
and chemical reactions. He always brought an inquisitive mind, teaching us to
formulate questions, to doubt dogma and try to answer questions with rigor.
At the same time he taught us the intricacies of nomenclature, again with rigor.
“The first issue of MycoTaxon, a journal founded by him, dedicated to
the taxonomy and nomenclature of fungi, came out in 1974. It is today in its
volume 131 and has been a leading journal for descriptive mycology.
“Dick was an advocate for social justice, cared for others, and helped many
in need.
“Today is a sad day for his family, to whom he was completely devoted. It
is a sad day for us, his students, and for the many that he mentored, advised,
and helped through his well-lived life as a caring person and as an eminent
mycologist.” — TERESA ITURRIAGA
MSc (1983), PhD student (1990) Cornell, under R.P. Korf
Fic. 18 (LeEFT)—Dick, Linda Kohn (student & future 1999-2000 MSA president), Trond
Schumacher (future 2000-2006 IMA president), and Japanese colleague in 1983 at the Sanshi Imai
Memorial Discomycete Foray after IMC3 in Nikko, Japan. Fic. 19 (RIGHT)—Kumi and Dick at
Satoshi and Harumi Inoue'’s wedding at Cornell’s Stadler Hotel on September 25, 1995
“When I entered Department of Plant Pathology of Cornell University as a
graduate student in 1990, Dick was one of a few professors I met during my
orientation days. I had graduated from Tohoku University in Sendai in 1981
with Agrimony background and didn’t know much about Mycology. Our
conversation was not so much at that time yet.
“I started my M.S. degree with Dr. Jim Aist and selected Mycology as my
major. One for that decision was that I did not want to take a course “SADISTICS”
(statistics).
“I ended up taking almost of all the courses offered by Dick during my M.S.
degree period. One of the toughest courses that I have ever taken is Advanced
Mycology (PL PA 739) during the 1992 fall semester. The TA for the class was
Julie Carroll and my classmates were Linda Hanson, Ker-Chun Kuo, and Kathie
Satoshi Inoue
R.P. Korf (1925-2016): A celebration ... 981
Hodge (who is currently teaching Mycology at Cornell). Dick gave us a very
strange project and we struggled to collect and identify ten (10) uncommon
species of hyphomycetes.
“I obtained my M.S. degree and entered my Ph.D. program in 1993. In
1995, just after I passed my A-exam, I married Harumi. We moved to Dick and
Kumi Korf’s apartment and lived there for two years until I obtained my Ph.D.
and returned to Japan. Our son, Amane, was born there in 1996. We spent a
very happy time with Dick’s family and have beautiful memories of them. I
remember it as if it were just yesterday.
“With my deepest sympathies on the death of Dick.”
SATOSHI INOUE, PhD (1997), Cornell under R.P. Korf
Director of Forage Seed Department, Kaneko Seeds Co. Ltd., Japan
“When I was a senior at Colgate, I was assigned the task of “refreshing” cultures
of Rhizopus nigricans to restore their ability to form zygospores. Knowing
nothing about a process to accomplish this, I wrote to Korf at Cornell, who
kindly sent me two new cultures and a method to demonstrate zygospore
development.
“And so it was that I applied to Cornell and entered in Fall 1956. My
intention was to perform taxonomy on jelly fungi, but I suffered a self-inflicted
wound when I skipped numerous labs in Plant Path 1 and earned a C in the
course, which violated Cornell’s dictum of grades of Bs or better for continued
enrollment. I was informed that while I might eke out a master’s degree, I surely
would not be allowed to continue thereafter.
“Thus it was that I enrolled at Columbia University under Lindsay Olive.
And the rest is history. In one of my rare subsequent meetings with Dick Korf,
he referred to me as “the one that got away.”
“Although Dick was not high on the marquee in his last years, his name
will surface for generations as the co-founder of MycotTaxon, discomycete
taxonomist, and outstanding personality in the mycological community.”
—Ron PETERSEN. Professor Emeritus & MSA President (1993-1994)
Ecology & Evolutionary Biology, University of Tennessee
“Dick Korf was instrumental in my existence as a mycologist. In 1970 I was a
floundering second year graduate student in mycology with no real idea of a
research project or direction. Dick wrote to my major professor, Bill Denison
(a student of Dick’s) at Oregon State University, inviting him on a collecting
trip in Puerto Rico and Dominica. Bill couldn't go, but I jumped at the chance.
That trip was magic, and I met my lifelong friend Don Pfister. During the day
we groveled in the litter finding tiny discomycetes as well as heaps of delightful
yellow and red perithecia and black, twig-like xylarias. In the evenings we
crowded around the microscope attempting to identify them at least to genus.
982 ... Norvell (editor)
Wen-yen Zhuang;, courtsy of IMA Fungus 2010
Fic. 20—Newly installed MSA President Amy Rossman with Richard ‘Elias Fries’ Korf
at IMCV, Vancouver, BC (Canada) in 1994.
Later I learned, at least for the nectria-like fungi, that, no, I wasn't stupid, there
really were no keys to tropical species, and that was the inspiration for research
on these fungi.
“The home of Dick and his wife Kumi was always open to itinerant
mycologists even when their four children were small. Although chaotic during
the day, Dick would rise early in the morning to work on MycoTaxon in those
quiet hours. He was totally supportive of graduate students and postdocs
writing glowing letters of recommendations—perhaps tapping into his creative
writing tendencies! But they worked, as most of us found good jobs in the
always-tough mycological employment marketplace. He shared his time and
resources, always willing to stop his own work to discuss nomenclature issues
or read over a draft manuscript.’ — Amy Y. RossMAN
Oregon State University, Corvallis
Amy Rossman (IMA Fungus 2016)
Fic. 21—Kumi & Dick at Amy Rossman’s home in Beltsville in 2000.
Fic. 22—At Amy’s in 2005: mmmm... roast QUORN!
R.P. Korf (1925-2016): A celebration ... 983
Fungal taxonomy and nomenclature goes international
These messages and reminiscences are organized alphabetically by country.
VALE DICK KORF
Sad news about the passing of Dick Korf
Among his numerous contributions to mycology, Dick Korf was Secretary
of the NCF (then the Committee for Fungi and Lichens) in the 1980s and co-
founder and long-time supporter of MycoTAxon.
Two enduring images are early career Korf at the blackboard (note the peace
sign belt buckle in Fra. 12): and later, channeling Elias Fries.
— Tom W. May, Secretary, IBC Nomenclature Committee for Fungi
Royal Botanic Gardens Victoria, Melbourne, Australia
We regret so much for Dick Korf.
We'll always remember him for his great mycological contributions and
inspiration. — FRANCISCO CALACA
Lab. de Biodiversidade do Cerrado - Fungos Coprofilos
Unidade Universitaria de Ciéncias Exatas e Tecnoldégica, Anapolis, Brazil
Dick’s passing marks the end of an incredible career and great loss for mycology.
I thank him for his friendship and kindly guidance and send my sincerest
condolences to his family and friends. —Scott REDHEAD, Curator, DAOM
Agriculture & Agri-food Canada, Ottawa
Dick began his association with the
Institute of Microbiology (Chinese
Academy of Sciences) in Beijing
and had worked hard to promote
Chinese mycology, _ especially
through publishing major books
on fungi through MycoTaxon
(IMA 2013).
In China, “an 88" birthday is
regarded as particularly special,
and those that reach it are called
“Mi-shou. In honour Dick's
attainment of “Mi-shou” status, the 4
June 2013 issue of MycosysTEMA AS y=
(on whose editorial board Dick ? iv ‘ = te
served since its founding in 1987) RY VF its Me » be a
was dedicated to him (IMA 2013). ALG e | q ‘ ig
The excellent photos of Dick’s 1988 Fic. 23—Dick at the Jinzhong temple in
Yunnan, China (1988)
sus 2016)
|
3
jan
<
2
984 ... Norvell (editor)
Korf in China in 1998. Fic. 24 (left): Before Tanzhesi temple in Beijing.
Fic. 25 (right): searching lily pads at the Xishuangbanna Tropical Botanical Gardens.
visit to China (Fics 23-25) were captured by Wen-ying, his student and much-
valued colleague and close friend. —WEN- YING ZHUANG,
Key Laboratory of Systematic Mycology & Lichenology
Institute of Microbiology, Chinese Academy of Sciences, Beijing, China
Courtesy of Pavel Lizon
* Ss
, b
‘ 4
3 q ¥ ' ?
a Pp , eS
if —
— = \' co
AS 4 - .
YS - >
ay P . ; =
— "ax
a= . \
= J 4 4
z - “ a .
A = : -
Ne = - ’
. —" =]
< “. : * =
. . ES Sa,
i ' : a : BY
Fic. 26—The discomycete team at IMC7 outside the Oslo convention center in 2002.
Wen-yen Zhuang ?
R.P. Korf (1925-2016): A celebration ... 985
Fic. 27—Marc Stadler (Germany), José
Guarro (Spain), Teresa Iturriaga (Venezuela),
Dick (USA), and Rafael Castafieda-Ruiz
(Cuba) represent three continents at the
2011 Latin American Mycological Congress
in Costa Rica.
I have received the terrible news from Teresa Iturriaga. Please pass my
condolences to the family of Richard Korf and share this photo (Fic. 27) of Dick
with friends at the 2011 Latin American Mycological congress in Costa Rica.
Un abrazo, Rafael —RaFAEL F. CasTANEDA-RUIZ
Fundamentales en Agricultura Tropical “Alejandro de Humboldt’,
Santiago de Las Vegas, Cuba
It has just come to my attention that Richard Korf, co-founder of MycoTaxon,
has passed away on Aug. 20th. Please accept my sincere condolences for an
outstanding mycologist and a visionary who will undoubtedly be remembered
as one of the all-time greats in mycology. —MICHAEL LOIZIDES
Cyprus Mycological Association, Limassol, Cyprus
Nobody like Dr. Korf, so professional, so enthusiastic of small discomycetes,
but most of all, a good person. We will never forget him.
—Rosario MEDEL ORTIZ, Instituto de Investigaciones Forestales
Universidad Vercruzana, Vera Cruz, Mexico
Dear Dick
I first met you when you visited me when I was working in the University
of Hong Kong in the mid nineties. You were so generous and supportive of my
work at the time and gave me encouragement to continue my efforts
The next time I met you was at the International Mycological Congress in
Norway. You found it so funny that I did not recognize you dressed up as that
‘other’ famous scientist.
Since then you have always been so supportive and provided advice and
encouragement.
I will dearly miss you. —Kevin Davip HyDE
Editor-in-Chief, FUNGAL DIVERSITY
Director, Center of Excellence in Fungal Research
Mae Fah Luang University, Chiang Rai, Thailand
986 ... Norvell (editor)
Was so sad to learn of the passing of Dick. He was hugely influential in
mycology. Truly one of the greats of the 20th century.
—Davip W. MINTER
President, International Society of Fungal Conservation
Egham, Surrey U.K.
Dick was inspirational and I shall make sure that the BMS office knows. I had
a lovely dinner with him in Louvain in the late 1990’s and I certainly valued his
help, advice, and support. — ANTHONY J.S. WHALLEY
School of Biomolecular Sciences
John Moores University, Liverpool England U.K.
I first met Dick at IMC1 at Exeter (UK) in 1971. [had joined the Commonwealth
Mycological Institute two years before, and this was my first exposure to the
international mycological community. I especially remember a discussion on
nomenclature he chaired, and which led to the establishment of a Nomenclature
Secretariat under the auspices of the IMA. He was especially concerned about
the problems due to the later starting point for names of non-lichenized
fungi, including publishing a series of papers he characteristically entitled
‘Later starting point blues;’ the rules were changed in 1981. As Secretary of
the Nomenclature Committee for Fungi, he played a major role in debates at
International, Botanical Congresses, representing mycological interests, where
his acting skills were often put to good effect.
His love of fungi and fieldwork inspired not only his many graduate
students, but also many others throughout the world, especially tropical areas
still so little known for discomycetes. I was pleased to recognize this a little
when introducing Korfiomyces (along with Teresa Iturriaga) for a little disco
from Venezuela that had puzzled him. Perhaps the most important thing
I learned from my contacts with Dick was the importance of always being
fully aware of the historical background of issues and thoroughly researching
the consequences of any contemplated actions. We did not always agree on
controversial matters, but always respected each other’s views.
His foresight in establishing Mycotaxon to address a then developing
log-jam in getting systematic mycology papers in print, with the innovative
requirement for authors to produce their own camera-ready copy, was an
enormous stimulus to the health of the subject. He was a most generous man,
and kindly ‘loaned’ me a set of the printed volumes after I left the International
Mycological Institute at the end of 1997. The neat rows of brightly coloured
volumes, which I repeatedly have to consult, are an incredible legacy.
Dick was always keen to promote mycology selflessly throughout the world,
not least in China where he helped safeguard collections, get several major
R.P. Korf (1925-2016): A celebration ... 987
works published, and was one of a small group ‘foreign’ mycologists involved
in the establishment of MycosyTema prepared by the Chinese Academy of
Sciences, which has now also grown into a major journal in the region.
An inspirational mycologist who touched the lives of numerous mycologists
around the world, many of whom came to occupy significant positions. The
carefully executed works from their ongoing research—and of those they in
turn train and inspire—that have the stamp of Dick’s concern for accuracy and
quality will be a self-perpetuating memorial. I feel privileged to have known
him, and would have loved to have been able to spend more time benefitting
from his vast experience and insights. —Davip L. HawKsworTH
Comparative Plant and Fungal Biology, Royal Botanic Gardens, Kew, U.K. &
Department of Life Sciences, Natural History Museum, London, U.K.
Fic. 28—Dick, wearing his ‘Reunite
Gondwanaland” t-shirt, makes a fine point
at the 2003 New England Mycological
Foray (NEMF) in Deposit, NY. Of the 24
species he identified, five were new to the
27-year old NEMF master list.
Diane Smith; NEMF foray website
My first acquaintance with Dick Korf was as a new member of Mycological
Society of America in the early 1960’s. He and Clark Rogerson literally
WERE the MSA. He had an imperious personage—handsome, self-confident,
theatrical, and well spoken. He seemed initially remote from young mycologists,
but accepted them as colleagues over time. I was flattered when he asked me to
be a founding member of the editorial board of MycoTaxon, a position that I
enjoyed for many years.
Dick was a consummate teacher of mycologists. He took them on field
trips to places that seemed exotic to a small-town man. His former students
are among the leaders of mycology—Jim Kimbrough and Don Pfister among
many others. He was also a teacher at MSA meetings—quizzing students and
professionals on details of their studies and offering advice on improvements.
It was as perhaps nomenclaturist that he was most widely known. He spent
much of his time solving nomenclatorial problems for colleagues worldwide.
He was dismayed with massive changes in the mycological part of CODE OF
BOTANICAL NOMENCLATURE and I suspect that, had he been younger and
988 ... Norvell (editor)
healthier, that he would have used his vast intellect and assertiveness to prevent
the most irrational changes.
Let us praise this great scholar! Mycology is poorer without him and we
shall never see his like again.
— JACK ROGERS,
Professor Emeritus & (1977-1978) MSA President
Washington State University, Pullman, WA U.S.A.
The Lion in Winter
Except for a 1950-1951 tour as
Lecturer at Scotland’s University of
Glasgow, Dick devoted his entire
research life to Cornell. His heart,
however, belonged to his family, and
an impressive one it is. In its praise
of “Hidden Books: the art of Kumi
Korf”” (2011), the National Museum
of Women in the Arts refers to Kumi
as “one of the most original artists in
the United States.” Works by Dick's
wife have been exhibited worldwide
and (of the 25 collections cited)
include the Library of Congress,
Harvard’s Houghton Library, the
New York Public Library, London's
Victoria and Albert Museum and Tate
Library, Hungary's Savaria Muzeum,
and the Cleveland Museum of Art.
He and Kumiare the proud parents of
Mia (an American film and television
actress), Ian (Associate Director of
Bioinformatics at UC Davis), Ian’s
twin Mario (Principal Technical
Writer at Akamai Technologies),
and Noni (Director of Learning
Innovation & Design at University
of Michigan in Ann Arbor). On his
retirement, Dick obviously basked
in the glow of his family’s creative
energies.
“During his stay at the Yokohama
National University (1957-58) as
a Fulbright fellow, Dick met and
Courtesy of Pavel Lizon
Mia Korf; reprinted from Wilensky 2013
Fic. 29 (above). Dick & Kumi at home in Ithaca
with Pavel in 2005. Fic. 30 (below). Dick relaxing
during the summer of 2013.
R.P. Korf (1925-2016): A celebration ... 989
married Kumiko Tachibana. Kumi graduated in architecture and later print-
making at Cornell. She is very active as a visual artist to this day.’ (Lizon 2016)
Courtesy of Pavel Lizon
Fic. 31—1993-1998 MycoTaxon
E-i-C & close friend Lizon chats
with Dick in Ithaca in 2005.
“Exe Island on Big Rideau Lake in Canada was purchased by the Korfs in
1972 (later transferred to Mycotaxon Ltd as Exe Island Biological Station). The
simple cottage and 3-acre island became a favourite holiday destination for
their four children and friends.
From my own experience I must say that it is a great place for swimming
and diving, sailing and waterskiing, fishing, barbecuing, or just having a good
time. Dick organized famous Crazy Eights card tournaments not only on the
island but also during several mycological meetings and everyone who has
participated remembers having a lot of fun.” (Lizon 2016)
: In mid-2007, an audio gem from
SUBS UCU O SEMI NPIBY | Dick arrived in the editorial mailbox:
his 12-disc audio recording of the
epic poem, JOHN BRown’s Bopy.
Next fall’s solo 1500-mile road trip
transformed a welcome gift into
one of my most valued possessions.
Dick’s voice so mesmerized me
during my Montana journey to visit
JOHN BROWN’S BODY my father that I listened to it all over
by Stephen Vincent Benét again on my return to Oregon. This
An unabridged 1929 tour-de-force grips from the first
Pulitzer Prize-winning book-length poem
Narrated by Dick Korf disc and never bores. The text below
Audio Book © 2006, MYcoraxon, Li. has been ‘cribbed’ from Dick’s liner
Fic. 32—Dick’s tour de force at age 80. notes and a blog by John Brown's
great-great-great-granddaughter.
Cover design by Noni Korf
990 ... Norvell (editor)
“This recording was made in 2006, a last gasp of an 80-year-old lifelong actor,
the culmination of a 20-year dream. It is dedicated to my actress daughter,
Mia Korf, for encouragement, and to my wife, Kumi, for everything.
“I grew up as a ravenous reader, encountering Stephen Vincent Benét’s John
Browns Body at the age of 14, I was captivated by the book, which I read and
reread over the ensuing sixty-some years. It surely helped form me into an anti-
war activist...
“Poetry has a very special place in my heart, and as a youth I began reading
and writing poetry. I agree with Stephen Vincent Benét: poetry begs to be read
aloud. The skilled poet may embed in his poems frequent ‘stage directions’
in the choice of typographic tools (punctuation, the use of parentheses, italic
typeface, paragraphs, long dashes, indentations), and of course changes in
meter or rhyme. Benét’s use of these tools simplified my narration of the poem;
these are treated here as not only readers’ but narrator's guidelines.” (Korf 2006)
“THURSDAY TREASURE - RECORDING OF JOHN BRown’s Bopy” (MeCoy 2009):
“Over the past 30 years, I have been the recipient of some fascinating letters,
emails, FaceBook notifications, and phone calls from people regarding John
Brown. One such FaceBook connection occurred in June of this year and
resulted in today’s featured treasure. Emeritus Professor of Mycology at Cornell
University, Richard P. Korf wrote me the following:
“T assume you are the lady I read about in an article sent to me by my cousin
from her local paper, indicating that you are a great-great-great-granddaughter
of John Brown of Harpers Ferry fame. I have a strong connection, in that I
was very influenced by the story, and particularly the book-length poem called
John Brown's Body by Stephen Vincent Benét, which received the Pulitzer Prize
in 1929. Probably you have read it. Oddly enough it never was made into an
audio book. I finally discovered that there is a copyright issue, and managed to
get permission to do a “not for sale” version (I am now 84, and a lifetime actor)
which I recorded in 2006. I have a few copies left and would be happy to send
you one (it ison 12 CD discs, 13-1/2 hours long!). You can send me your postal
address if so.
“Think about this, Professor Korf was so enthralled with John Browns Body
by Stephen Vincent Benét, that he spent considerable time, effort, and his own
money to manufacture 100 limited editions of a 12 CD set that he cannot sell
due to copyright regulations.
“I immediately responded that I would be honored to receive one of his
recordings. A few days later I received a package in the mail with a professionally
packaged, produced set of CDs. Professor Korf’s voice is a joy to listen to,
and the set is amazing. The front cover of the box features the Stephen Benét
R.P. Korf (1925-2016): A celebration ... 991
postage stamp, while the back is the 1859 photograph of John Brown with his
full beard. Inside each CD is labeled and tucked into its own pocket. ...A truly
impressive presentation. It is a shame that due to copyright legalities, Professor
Korf is not permitted to offer his incredibly moving rendition of this important
work of literature, but I am truly blessed to have received a copy from him. Iam
holding onto this treasure. When I walk past my bookshelves and see the case, I
always think fondly of the Professor whom I have never met, yet he felt inclined
to share his lifelong dream with me?” (MeCoy 2009)
Kumi'’s mystery fungus, found
at home in August 2015. »
Fig. 33 (LEFT): Tiny red
cups delight Teresa & Dick;
Fic. 34 (RIGHT): The sketch
by Kumi with Don Pfister’s
annotations added; Fic. 35
(BOTTOM): Dick supervises
Teresa's note-taking skills.
KuUMI'S MYSTERY FUNGUS—Here are some
photos (Fics 33-37) of my last visit to Dick in |
August 2015 when he described and made me
take very detailed notes on ‘Kumi’ fungus...
while he described in detail the most impressive
manner how this fungus shattered. When I
returned to the Farlow with the specimen, Don
[Pfister] immediately looked at it under the | :
microscope, made drawings of the spores (also
attached), and identified it to Peziza phyllogena,
which Korf himself had worked on.
On that visit he impressed me once more
with his absolutely keen memory and sense of
humor when he told us the story of Schulzer
von Muggenbruck, who described twice as
new (and from the same specimen) Peziza
heterotropha Schulzer 1878 and later as a new
genus and species, Strossmayeria rackii Schulzer
1881 [now listed as S. basitricha (Sacc.) Dennis
on www.indexfungorum.org].
992 ... Norvell (editor)
The holotype of the name of S. rackii, along with most of the Schulzer
Herbarium, was lost, so Dick decided to undertake an expedition to find a
neotype for this fungus and two other type specimens needed to solve some
other taxonomic issues with other groups, which we described in detail (Korf
& al. 1988).
During such expeditions to collect discomycetes, he taught us how to find
these organisms: swimming among leaf litter, staring at little branches, twigs,
leaf blades, leaf petioles, in a place where at first nothing could be seen, and as
he stated “they'll start winking at you”... and so they did!
Each of those collections was carefully removed from its substrate with a
knife—at lunch time he would love to let us know he was opening the only
sardine can with the “dung knife”—and placed in a glassine envelope. Rigorous
notes were taken of textures, shapes, colors and sizes, and then the magic
of examining the microscopic structures started. Looking at the wonders of
ascospores, septa, ornamentation, crystals, colors, and the Melzer’s reaction
took us always late into the night. Sleep was of no concern to Dick when there
was so much fun looking at these amazing structures!
And by the way, we did make 50 collections of Strossmayeria rackii and thus
were able to neotypify this genus. —TERESA ITURRIAGA
Data Curator, Microfungi Digitization Project, University of Illinois
Fic. 36—Teresita and Dick,
August 2015
In a subsequent message, Teresita referred to a Vladimir Nabokov poem that
so enchanted Dick that he pasted it onto the arm of his microscope. It is only
fitting that her fond reminiscence of her friend and former professor conclude
with the stanzas from the Russian author & lepidopterist’s “On Discovering a
Butterfly” that convey the passion of all those longing to reveal Mother Nature's
hidden framework.
R.P. Korf (1925-2016): A celebration ... 993
Smoothly a screw is turned; out of the mist
two ambered hooks symmetrically slope,
or scales like battledores of amethyst
cross the charmed circle of the microscope.
I found it and I named it, being versed
in taxonomic Latin; thus became
godfather to an insect and its first
describer—and I want no other fame.
—Vladimir Nabokov (1943)
Fic. 37—Dick in the heart of his wife, children, and grandchildren
during the annual gathering of the clan (Summer of 2016).
A daughter's farewell
My dad’s passing means that there are many untold stories that can no
longer be told. Many photographs that can no longer be identified. He was
preceded in death by his older brother and his cousin and, at 91, by many his
friends, colleagues, and students. I would have liked to hear more stories about
his childhood, because looking back there are so many narrative threads that
could be followed to their source.
I do know that the publishing of the journal, MycoTaxon, was not his first
adventure in publishing. As a child he had a small letterpress at which he set
type, printing up a local gossip rag, some stories surely fabricated, which he
then sold to his neighbors. It was a novel and entrepreneurial undertaking,
quite unlike MycoTaxon but the connection is there.
994 ... Norvell (editor)
I remember the genesis of the journal, and the way that my father’s eye
would light up as he would describe the concept—a journal which allowed
authors to publish quickly and for free, that used offset printing technology
to shortcut more time intensive and expensive methods of printing, where the
journal wasn‘ responsible for the review process, and where volumes would be
issued when they reached a certain number of pages rather than a certain time
period. I don't know how novel the journal’s “find your own reviewer” peer-
review process was, but he told me he heard many stories of authors who were
able to get peer-reviews from people that they highly respected and to whom
they would not otherwise have dared to communicate.
Then there was all the stuff. We sold special paper that he designed that
had two sets of lines margins laid out in light blue ink so that authors could
type onto this paper, using either an elite or pica typewriter, and then mail in
camera-ready originals. We also sold, and used ourselves, special Letraset dry
transfers for numbering photos and creating somewhat consistent arrows, page
headers, and other typography. We would receive back from the printer rolls
and rolls of acetate which were cut up for reprints, sometimes mailed back to
authors if they requested it for them to make their own. And there were so
many different sizes of envelopes and boxes for shipping the journal out.
When an issue was published, there would be a stack of some 400 or so
brightly colored journals ready to be sent out. We tried many different ways
of printing up labels for these and back then we had to sort them all by zip code
bad taxonomy
©}
can KILL
Fic. 38—Noni designed this logo years ago for one piece of ‘stuff’—the official MycoTaxon t-shirt
worn proudly by journal disciples. With our move to online publication in 2011, Noni modified the
logo for use on our back covers, beginning with Mycoraxon 115. Dick approved!
Kumi Korf; courtesy of Teresa Iturriaga
R-P. Korf (1925-2016): A celebration ... 995
Fic. 39—Noni, Dick, and Teresita share a happy moment in August 2015
and country before dropping them at the post office. We made stuffing the
envelopes into a game, quizzing each other on the zip codes of certain cities, or
the middle names of our subscribers. I knew many, many names and addresses
of mycologists by heart, learned of libraries from all over the world, imagined
the journal traveling there to be opened by someone who must have wondered
why the journals they received were never the same color. It was a game, it was
a chore, it was something we all chipped in on 4 times a year. One time I slipped
a message into the envelope—it was being shipped to Linda Kohn—and I wrote
“help, I'm trapped in a cottage industry!”
Every now and then someone would order a backorder or two, or sometimes
even a whole run, and this was a cause for excitement, and more boxing, and
M-bags, and international postage. I sometimes thought that the post office was
my father’s home away from home. He was meticulous in understanding the
rules and could read the charts and scales as well as any postmaster. He always
tried to stamp the envelopes with the most exotic and fanciful of US postage,
in case the recipient was a stamp collector. He had many difficulties with the
post office, however, because the journal didn't fit into a certain category of a
quarterly publication, so we didn't qualify for 3rd class mail, and ultimately the
crushing cost of postage was one of the reasons we found we had to move to
publishing online.
As I got older I learned to work on the subscriptions management. At
the time this meant gathering checks, stamping them “for deposit only” and
entering the payments on 3x5 inch index cards. Some people were individual
996 ... Norvell (editor)
subscribers, some were institutional, some we invoiced, some had standing
orders, some were organized through companies such as Ebsco. It was all very
detailed and precise, and hand written. Once I started doing the subscriptions
management I became even better at the box stuffing game of “in what city
does mycologist X live?” As this modernized, the job included running credit
card slips through the embosser and mailing back receipts. Eventually there
were uploads via a dial-up modem. And there were also the odd international
money orders, which my father would have to cash at his home away from
home, the post office. So many memories of these little details and all the things
it took to keep the journal running.
At some point my father embraced the computer, bought a Mac Ie, and
began getting fascinated with the computer as both a administrative tool and
one useful for authors. I think we were all very tired of typing on that special
light-blue lined paper, and needing to use whiteout to make corrections.
The early volumes do have the DIY look of a zine, but the computer made
submissions of articles and reviewer notes much easier for the author, but also
added to the work of the editor. There’s no doubt my father loved working at
the computer, teaching himself new software, designing forms and databases
to track subscriptions, and authoring articles. I can see him in my mind's
eye, hunched over the keyboard, using only two fingers to hunt and peck at a
maniacal speed as he corrected a manuscript, or communicated with a former
student.
The printed word was very important to my father. He was a keen critic
of his own writing as well as that of others, helped many people to edit their
manuscript and was always on the lookout for readable prose and the proper use
of the English language. He would admonish writers to “kill your darlings” and
when we were developing the Mycotaxon website, pointed out that I had failed
to italicize a period. Before my father died we had a project to pull together all
of his writings and bind them together. I regret I wasn't able to complete the
project, the reprints were of so many different sizes I couldn't figure out how
to put them together. But together we marveled at the stack of pages. Over 400
different publications! I so wish I could have also added to the stack his first
published articles, the 1935 gossip rag from White Plains, NY.
I miss my dad, and know he would have edited the hell out of this piece.
NONI KORE
11 January 2017
R.P. Korf (1925-2016): A celebration ...
Ode to RPK
Awake, my Muse, and let us chant again,
for Richard has attained four score and ten,
A life well lived, and never could my song
number the landmarks of a life so long,
so rich, so varied, put to so good use,
for like that busy man, Odysseus,
patient, resourceful, skilled in many arts,
our Richard is a man of many parts:
In lusty youth he journeyed to Japan,
and bore away the fair Kumikosan,
whose beauty lives undimmed, though made to bear
sturdy twin sons, and daughters passing fair.
Master of mushroom lore, taxonomist,
shepherd of mushroom hunters, lengthy list,
whose fungal gleanings will survive the ages
in MycoTaxon’s printer-ready pages.
A scientist, a teacher wise and stern,
his life will sometimes take a different turn;
he is no stranger to the sacred rage,
that brings forth sound and fury on the stage;
sailor intrepid, always northward bound,
until one happy day he ran aground,
and entered on the heros life we know,
lord of the wooded isle in Big Rideau.
There let us leave him, Muse, for you grow faint;
a full length portrait genius alone could paint.
Let’s be content to let our rhyming cease,
a gift of love, though not a masterpiece,
a song with but a simple tale to tell:
Richard, we honor you, and love you well.
—Peter Wetherbee
in honor of Dick’s 90" birthday, 2015
997
998 ... Norvell (editor)
Mycotaxon, the fungal taxonomy journal that
Dick co-founded, will publish a tribute issue. + oti x
a oom pede chien celebrating the life of
you would like to contribute a piece. Once Richard P Korf
published, the issue will be available here:
hetp://tinyurl.com/mycotaxon
1925 - 2016
with special thanks for today’s celebration:
Department of Plant Pathology
Department of Music
Cornell Parking
Dana Paul
and all of you that came today.
cover photograph by Jaroslav Klan
9/20/1978
Bugac Puszta, Hungary
8th European Mycological Congress
Donations may be made to the
Richard P. Korf Graduate Student Excellence Fund
http://tinyurl.com/CornellKorfFund
drawing with morel by Bill Benson, 1989
for a Soirée held at LAuberge de Cochon Rouge
Fic. 4o—On December 18, 2016, the Korf family hosted a celebration of Dick's Life at Cornell. The
back of the program above provided the liner notes from Dick's audio book version of John Brown's
Body and his obituary, featuring the 1972 photo of Dick at the Plant Path lab blackboard. Scheduled
speakers included daughters Noni & Mia Korf, students Don Pfister & Kathie Hodge, sons Mario
& Ian Korf, and grand-daughter Maia Korf followed by memories shared at an open mic during
the reception on stage. Not surprisingly, festiities continued well into the evening at Noni’s place.
Acknowledgments
Many have contributed to this celebration, but special editorial thanks are due
Noni Korf, who has borne much during the past year yet agreed to serve as family
liaison and scribe in addition to MycoTAxon web-master while holding down a fulltime
new job. We both thank everyone who shared memories and photos in this memoriam:
Francisco Calaca, Rafael Castafieda, David Hawksworth, Kevin Hyde, Satoshi Inoue,
Teresita Iturriaga, Michael Loizides Hannes Maddens, Scott LaGreca, Pavel Lizon,
Tom May, Rosario Medel, David Miner, Ron Petersen, Scott Redhead, Jack Rogers,
Amy Rossman, Tony Whalley, and Wen-ying Zhuang. We also thank Pedro Crous,
David Hawksworth, Manon van den Hoeven-Verweij, Pavel Lizon, Amy Rossman, and
Wen-ying Zhuang for granting permission to reprint excerpts from IMA Funcus.
The Editor-in-Chief, who assumes sole responsibility for shamelessly purloining
reminiscences and photographs from the Internet, is especially grateful to Kathie Hodge
and Scott LaGreca for providing such entertaining and informative blogs about Cornell.
The photograph of Elias Fries downloaded from the MusHRooM, THE JOURNAL website
(www.mushroomthejournal.com) is elsewhere listed as in being the public domain.
Other attributions are placed next to the photos, presented in the text above, or covered
in the references cited.
Kathie Hodge
R.P. Korf (1925-2016): A celebration ... 999
ite " ray!
ei
Fic. 41. Watkins Glen State Park, NY
Excuse me, while I disappear.
References cited
Dobbin B. 2009 (posted 14 April). An Ivy League school is giving China back its treasured
mushrooms.” Chicagoer News [Accessed 12-29-16]:
http://www.chicoer.com/article/ZZ/20090414/NEWS/904149781
Hodge K. 2013. The Cornell Hoot. Cornell Mushroom Blog: blog.mycology.cornell.edu [accessed
January 16, 2017]
IMA Fungus. 2010. Ainsworth Medal: Richard P Korf. IMA Fungus 1(2): 15-16.
IMA Fungus. 2013. Personalia— Richard P. Korf - Mi-shou. IMA Fungus 4(1): 15.
Iturriaga T. 2016 (posted August 22). Richard Korf and his love for the discomycetes. MiCC
(Microfungi Collections Consortium). www.facebook.com/microfungi.org/ [Accessed online
December 27, 2016]
Korf RP. 1991. An historical perspective: mycology in the Departments of Botany and of Plant
Pathology at Cornell University and the Geneva Agricultural Experiment Station. Mycotaxon
40: 107-128.
Korf RP. 2006. John Brown's Body by Stephen Vincent Benét, narrated by Dick Korf. Mycotaxon
Ltd, Ithaca NY. Available for download at audio.ithaca-ny.com/jbb
Korf RP. 2007. A tribute to Grégoire Laurent Hennebert and Mycotaxon’s 100" volume. Mycotaxon
100: 1-4.
Korf RP, Gruff SC. 1985. Mycotaxon cumulative index for volumes i-xx (1974-1984). Mycotaxon,
Ltd., Ithaca NY. ISBN 0-930845-00-5.
Korf RP, Iturriaga T, Zhuang WY. 1988. Lost and found: a discomycete pilgrimage. Mycotaxon 31:
85-88.
1000 ... Norvell (editor)
Kumi. [accessed January 11, 2017]. Artist’s statement. www.kumikorf.com
Lizon P. 2005. Birthday Greetings: Richard (“Dick”) P. Korf’s 90" birthday. IMA Fungus 6(1): 20.
Mecoy AK. 2009 (November 13). Thursday Treasure - Recording of John Brown’ Body. John
Brown Kin. [Accessed December 12, 2016-January 18, 2017]
http://johnbrownkin.blogspot.com/2009/11/thursday-treasure-recording-of-john.html
Norvell LL. 2011. Fungal Nomenclature. 1. Melbourne approves a new Code. Mycotaxon 116:
481-490. https://doi,org/10.5248/116.481
Obituary. 2016. Korf, Richard Paul. Dec. 9, 2016. Ithaca Journal.
Rossman AY, Zhuang WY. 2016. In Memoriam: Richard Paul Korf (1925-2016): leading specialist
on discomycetes and inspiring mentor. IMA Fungus 7(2): 62-64.
Teng SC. 1996. Fungi of China, Richard P. Korf, ed. Mycotaxon, Ltd., Ithaca NY. xiv + 586 pp. ISBN
0-930845-05-6.
Wilensky J. 2013 (Spring). Once upon a hill: Cornell's story as told by a 1946 student music hall
show. Ezra: Cornell's Quarterly Magazine 5(3): 16-18. Accessed online, 16 January 2017:
https://ezramagazine.cornell.edu/SPRING13/CornellHistory.html
MEENA, CHANNELING DICK
(2016)
Jafar Shokrollah Zadeh