QL
Su]
187%
ENT
NOTA
LEPIDOPTEROLOGICA
Published by Societas Europaea Lepidopterologica (SEL)
Noemie 25 - Number? - 2012
SOCIETAS EUROPAEA LEPIDOPTEROLOGICA e.V.
http://www.soceurlep.eu
HONORARY MEMBERS
Günter Ebert (D), Pamela Gilbert (GB), Barry Goater (GB), Peter Hättenschwiler (CH),
Prof. Dr Niels P. Kristensen (DK)
COUNCIL
President: Dr Gerhard Tarmann (A)
Vice-President: Prof. Dr Joaquin Baixeras (E)
General Secretary: Dr Erik van Nieukerken (NL)
Treasurer: Dr Robert Trusch (D)
Membership Secretary: Willy De Prins (B)
Ordinary Council Members: Prof. Dr Stoyan Beshkov (BG), Dr Feza Can (TR),
Eric Drouet (F), Matthias Nuss (D),
Thomas Simonsen (UK)
NOTA LEPIDOPTEROLOGICA
A journal focussed on Palaearctic and General Lepidopterology
Published by the Societas Europaea Lepidopterologica e.V.
Editor. Jadranka Rota
Associate Editor. Paul Sokoloff
Editorial Board. Franziska Bauer (Dresden, D), Sven Erlacher (subject editor; Chemnitz, D),
Thomas Fartmann (subject editor; Miinster, D), Zdenék F. Fric (subject editor; Ceské Budéjo-
vice, CZ), Axel Hausmann (subject editor; Munich, D), Peter Huemer (subject editor; Inns-
bruck, A), Lauri Kaila (subject editor; Helsinki, FI), Ole Karsholt (Copenhagen, DK), Bernard
Landry (subject editor; Genève, CH), Carlos Lopez-Vaamonde (subject editor; Orléans, F),
Vazrick Nazari (subject editor: Ottawa, CA), Erik J. van Nieukerken (subject editor; Leiden, NL),
Matthias Nuss (Dresden, D), Thomas Schmitt (subject editor; Trier, D), Wolfgang Speidel (Bonn, D),
Alberto Zilli (subject editor; Romo, I).
© Societas Europaea Lepidopterologica (SEL)
ISSN 0342-7536
Type setting: blattwerk | dd
Printed by Druckhaus Dresden GmbH
All rights reserved. No part of this journal may be reproduced or transmitted in any form or by any means, electronic or
mechanical including photocopying, recording or any other information storage and retrieval system, without written
permission from the publisher. Authors are responsible for the contents of their papers.
ENNTHSONIAT
MAY 23 2013
NOTA LEPIDOPTEROLOGICA
Volume 35 No.2 +: Dresden, 15.11.2012 - ISSN 0342-7536
Tomasz W. Pyrcz. Obituary: Janusz Wojtusiak (1942-2012) woe cceeeetteeeeeeees 111-113
Kari Nupponen. Redescription of Pelochrista maculiferana (Kennel, 1900),
bona sp., with notes on eight poorly known species of leafrollers from the
Voleo-Uralzegion (Lepidoptera: Tortricidae): 2... cicsccsacedectcccsessteensccoacseteccesosees’> 115-124
Daniel Bartsch. Revision of types of several species of Bembecia Hübner, 1819
from northern Africa and southwestern Europe (Sesiidae) ..............cccscccccceeeeeeeeeees 125-133
Erik J. van Nieukerken, Camiel Doorenweerd, Willem N. Ellis,
K.J. (Hans) Huisman, J.C. (Sjaak) Koster, Wolfram Mey, Tymo S.T. Muus &
Arnold Schreurs. Bucculatrix ainsliella Murtfeldt, a new North American invader
already widespread on northern red oaks (Quercus rubra) in Western Europe
(Buceulatnieidae) ea... nee ae nee ee eee ton 135-159
Jan Sumpich & Jan Skyva. New faunistic records for a number of Microlepidoptera,
including description of three new taxa from Agonoxenidae, Depressariidae,
and.GeleehiidaestGelechioidea) 2. nee idees tee le 161-179
Leif Aarvik. Symmoca sparsella Joannis, 1891 (Gelechioidea, Autostichidae)
LE Vy AO UIC ONG ee seine commen ea pense tos 181-183
Helen Alipanah, Jan Asselbergs & Mansour Sarani. Redescription of Nephopterygia
austeritella Amsel, 1965 (Pyralidae: Phycitinae) with description of its hitherto
IMIR OWEN CIN AG rear ee een 185-191
Juan José Guerrero, Antonio S. Ortiz & Rosa Maria Rubio. On the distribution
of /daea gelbrechti Hausmann, 2003 in the Ibero-Maghrebian region
(Geomeinidaes>teirhinae) Issue becs es eeecenecsee sa rmnse tetes een 193-196
Vladimir Mironov & Ulrich Ratzel. Eupithecia Curtis, 1825 of Afghanistan
(Geometridae »larentünae) see este 197-231
Book eye we Pen en ne à nee ca coule 134
Nota lepidopterologica index to volume 35 by taxon and author names,
AVALOS OU DIRE AU OMIG ALES ites ee ee een 233-234
fi
I
*
1
i
y
Nota lepid. 35 (2): 111-113 111
Janusz Wojtusiak
1942 — 2012
Janusz Wojtusiak was born in 1942 in Kraköw, Poland. Since early childhood, he
was fascinated by nature, and particularly butterflies. Beyond any doubt, this interest
was instilled in him by his father, the well-known Polish biologist, Roman Wojtusiak,
Professor at the Jagiellonian University. With his father he observed and collected but-
terflies in then extremely rich and diversified locations around Krakow, such as Podgörki
Tynieckie, Kostrze, Ojcöw and the Niepotomicka Forest, as well as during summer va-
cations in their favourite Koscielisko locality and in Podhale and the Tatra Mts.
He began his biological studies at the Jagiellonian University in 1959. During
his studies he was very active in the academic life — he organised the Club of Young
Naturalists, led a number of speleological expeditions in the Polish Jura and Tatra Mts.,
and led scientific camps for students. After graduating in 1964, he was employed as
an Assistant in the Department of Systematic Zoology and Zoogeography under the
leaderships of Professor Stanistaw Smreczynski. Throughout the 1960s and in the ear-
ly 1970s he was particularly involved in the activities of the Polish Mountaineering
Association, driven, as he himself put it, by his affection for mountains and by the
desire to go beyond the border into the unknown. In 1966 and 1967 and in 1973 he par-
ticipated in the first Polish climbing expeditions in the Hindu Kush Mts. in Afghanistan
and in Kashmir in Pakistan. During these expeditions, Janusz amassed a rich and ex-
Nota lepidopterologica, 15.11.2012, ISSN 0342-7536
112 Obituary: Janusz Wojtusiak (1942-2012)
tremely valuable collection of butterflies including several thousands of rare specimens
of Parnassius, as well as Baltia whites and Karanasa satyrines. As Janusz recalled,
when other members of the expeditions were occupied with climbing the snow-covered
peaks, he was rather interested in penetrating the high-mountain valleys in search of
interesting insects. The material brought from these expeditions enriched the collection
of the Zoological Museum of the Jagiellonian University. During expeditions to Asia,
he also shot many hours of documentary films that have recently been converted into
digital format.
His Ph.D. thesis, presented in 1971, concerned the morphology of microlepidopter-
ans from the family Adelidae and was one of the pioneering studies of this group. He
described in detail and illustrated the female copulatory apparatus of adelids, together
with its associated musculature. Soon after gaining the title of doctor habilitatus at
the beginning of the 1980s, he was appointed Head of the Zoological Museum of the
Jagiellonian University. Immediately afterwards, he was offered a contract to teach at
a university in Nigeria, which, in these difficult times, provided him with a rare op-
portunity to receive a decent salary as a Polish academic teacher. Between 1982 and
1986, Janusz taught zoology and entomology at the University of Nigeria in Nsukka.
Throughout that period, he spent almost all his free time undertaking excursions into
forests and savannas looking for interesting film footage and insects for the scientific
collection of the Zoological Museum. The material collected by him, principally in
southeastern Nigeria, in the Nsukka and Okomu forests, as well as the Obudu and Oban
mountains, includes thousands of specimens and is one of the most exhaustive collec-
tions of butterflies and moths from this region in the world. Many specimens constituted
species new to science, described later by specialists in various groups, and the number
of type specimens deposited in Krakow elevated the scientific value of the collection at
the Jagiellonian. Another scientific result of his stay in Nigeria was the description of a
new morphological organ in the ants of the genus Oecophylla, namely pretarsal pads,
which allow these insects to push large prey on smooth and almost vertical surfaces.
After returning from Nigeria, Janusz continued his research in the field of entomol-
ogy. His interests focused on circadian cycles in insects, various aspects of the behav-
iour of social insects such as ants, bees, and termites, as well as issues in taxonomy and
the faunistics of butterflies.
In 1989 and 1990 he gave lectures in forest entomology at the invitation of the
University of Wisconsin in Stevens Point. At that time he started an active co-operation
with the leading zoological museums in Europe and the United States, above all with
the Natural History Museum in London. This project aimed at producing a comprehen-
sive work detailing the scientific collection of butterflies in the Zoological Museum of
the Jagiellonian University. In 1991, he published a textbook on the ethology of insects,
which is the only such comprehensive treatment of this topic in the Polish language to
date. For several years, Janusz continued his studies aimed at updating and publishing
a new edition of this textbook, but these plans were thwarted by his illness. At the turn
of the 1980s and 1990s he again collected butterflies in tropical countries on several
occasions: in India and Tanzania, and under the scientific programme of the Zoological
Museum in Sao Tome and Principe. The latter expeditions have again resulted in very
Nota lepid. 35 (2): 111-113 | 113
interesting scientific material serving as a source for a number of scientific publications
concerning, inter alia, fauna, and taxonomy, including new species, as well as various
aspects of the biology and ecology of butterflies of that region.
In 1994, Janusz received a professorial nomination from the President ofthe Republic
of Poland, Lech Walesa. Fom the mid 1990s, the scientific interests of Professor Janusz
Wojtusiak were geared towards the mountainous areas of South America, as he noticed
the hidden scientific potential in the mostly unknown fauna of many groups of butter-
flies of this region. From 1996 he either participated in or organised more than ten sci-
entific expeditions into the Andes: in 1996 into the Cordillera de Merida in Venezuela;
in 1997 to western Colombia; in 1998 to northern Peru; in 2000 and again in 2008 to
Bolivia; in 2002 to central Peru; several times to Ecuador from 2002 to 2004, under the
project sponsored by the State Committee for Scientific Research (KBN); and in 2007
again to Venezuela. During these scientific expeditions, extraordinarily valuable and
extensive material of a large number of various lepidopteran groups across the whole
order were collected, which resulted in more than 100 scientific publications and de-
scriptions of more than 400 new species of butterflies and moths, principally belonging
to Tortricidae, in co-authorship with Professor Jözef Razowski. Together with the latter,
Janusz described a new olfactory organ located on the abdomen of the African repre-
sentatives of Adelidae. One of his most interesting achievements was discovering and
describing the first brachypterous and non-flying male moth in the world, in the genus
Xenomigia (Notodontidae).
Janusz was the initiator of research and teaching co-operation agreements between
the Jagiellonian University and several leading scientific institutions and universities
in South America, including the Venezuelan Institute for Scientific Research and the
National University of San Marcos in Lima. These agreements facilitated to a great
extent the research activities of scientific staff, doctoral students, and undergraduates of
the Jagiellonian University, carried out in the almost uncharted mountainous forests of
this continent. The exploration of the Andes placed the Zoological Museum on the list
of the most highly regarded museums and research institutions in Europe with respect
to the studies of butterfly fauna and global biodiversity.
Janusz was an academic teacher highly regarded and well liked by his students. For
many years he had taught the ethology of insects, zoogeography, and entomological tech-
niques. Since 2007 he had co-organised and was one of the lecturers in Tropical Ecology,
a course whose fieldwork component was being undertaken each year in Venezuela — first
such course in Poland. In recent years he devoted much time to his new hobby, making
films about nature. He shot and edited many hours of documentaries that are used as
teaching aids and in the promotional activities of the Jagiellonian University.
He filled his free time with making field excursions in the Tatras, Alps, and Rocky
Mountains, from which he always brought back interesting insect specimens. Janusz
was a very active advocate for the establishment of a new chair at the Zoological
Museum of the Jagiellonian University and for creating a modern basis for teaching
within the Centre for Natural Sciences Education, whose planning he supervised as a
senior consultant.
TOMASZ W. PYRCZ
Pd
ñ
N
>
=
Nota lepid. 35 (2): 115-124 115
Redescription of Pelochrista maculiferana (Kennel, 1900),
bona sp., with notes on eight poorly known species of leaf-
rollers from the Volgo-Ural region (Lepidoptera: Tortricidae)
KARI NUPPONEN
Merenneidontie 19 D, FI-02320 Espoo, Finland; [email protected]
Received 23 January 2012; reviews returned 27 February 2012; accepted 19 April 2012.
Subject Editor: Jadranka Rota.
Abstract. The status of Pelochrista maculiferana (Kennel, 1900), bona sp., comb. nov., which was until
now considered a synonym of Epiblema junctanum (Herrich-Schäffer, 1856), is revised and this species,
now considered a good species, is redescribed. Additionally, notes on eight poorly known species of Tor-
tricidae from the Volgo-Ural region are provided. Lobesia subherculeana (Filipjev, 1924), Asketria lepta
Falkovitsh, 1964, Eucosma pergratana (Rebel, 1914), and Dichrorampha alaicana (Rebel, 1910) are
reported as new to Europe, and Eucosma medvedevi (Gerasimov, 1928), Clepsis nybomi (Hackman, 1950),
and Asketria lepta Falkovitsh, 1964 as new to Russia. The adults of seven of these species and the genitalia
of four of them are illustrated.
Introduction
The leaf-roller (Tortricidae) fauna of the Volgo-Ural region is moderately well known.
Eversmann (1844) made thorough faunistic investigations mainly in the southern Urals
in the middle of the 19" century and listed 132 species of Tortricidae for this region.
The vicinity of Sarepta in the Lower Volga region was intensively studied at the end
of the 19% century by Hugo Christoph (Amsel 1964) and some other entomologists,
and numerous new species were described from there (Christoph 1872; Kennel 1900;
Staudinger 1871, 1877). From the beginning of the 20" century there have been no
serious studies of microlepidoptera in the Volgo-Ural region until 1996, when research
in the southern Urals was commenced by the author and several colleagues. The majority
of the findings from about 30 expeditions made between 1996 and 2011 in the region
remain unpublished. Anikin et al. (2006) summarised the data on Tortricidae from the
Volgo-Ural region, which include 510 species. However, their list lacks several species
recently recorded in the steppes of the southern Urals. In the present article, faunistic
and/or taxonomically significant new records of nine species of Tortricidae from the
region are reported.
Material and methods
This contribution is based on material collected by the author during 1996-2006 on
about 30 expeditions to the southern Urals and the Lower Volga region, three of them
Joint with Timo Nupponen. The material was collected both by artificial light (ultraviolet
tube lamps: Philips TL K 40W/ O9N, Sylvania blacklight 20W & 40W/350 BL; solar
lamp Osram Ultra Vitalux 300W) at night and by netting and sweeping during the
daytime. The material is deposited in the private collection of T. & K. Nupponen. The
Nota lepidopterologica, 15.11.2012, ISSN 0342-7536
116 Nupronen: Tortricidae of the Volgo-Ural region
Fig. 1. Rocky steppe slopes in Guberlinsky Mountains, the southern Ural range, Russia. Habitat of Pelo-
christa maculiferana (Kenn.). Fig. 2. Chalk steppe in Schibendy Valley, the southern Ural range, Russia.
Habitat of Asketria lepta Flkv. and Lobesia subherculeana (Fil.). (Photos: K. Nupponen).
following abbreviation ıs used in the text: ZIN (Zoological Institute, Russian Academy
of Sciences, St. Petersburg, Russia).
Systematics
Pelochrista maculiferana (Kennel) was described from a single male specimen col-
lected in the Guberlinsky Mountains, South Ural in 1892. No additional specimens
have been reported since. Razowski (1999: 481) synonymised maculiferana with Epi-
blema junctanum (Herrich-Schäffer, 1856), and this opinion was followed in several
subsequent publications (e.g., Razowski 2001, 2003; Sinev & Nedoshivina 2008; Lepi-
forum 2011).
During an expedition to the southern Urals in late June 2003, I collected two male
specimens of a peculiar small tortricid moth in the Guberlinsky Mountains, Orenburg
district. After dissecting one of them, it became obvious that the genitalia exhibited
characteristics typical for the genus Pelochrista (see Razowski 2003). However, I was
unable to find a comparable illustration in the literature. A few years later, I studied leaf-
rollers in the collection of ZIN with special attention to two specimens of Pelochrista
maculiferana, which were externally identical to the newly-collected specimens from
southern Ural and were collected from the same locality. The specimens were not
dissected, but the valvae of the holotype were sufficiently exposed to see the essential
characteristics (see below). Based on facies and male genitalia, these two specimens
are undoubtedly conspecific with the holotype of maculiferana.
The labels of the type specimens of P maculiferana are somewhat confusing. The
description is based on a single specimen labelled “Guberli, 19.6.1892, Christoph [leg.]”.
The holotype in ZIN lacks the label with date and collector, and the red holotype label
is not the original one. The second specimen is labelled as paratype, but no paratypes
were designated by Kennel (1900).
The habitats in the Guberlinsky Mountains are steppe hills with steep, xerothermic
rocky slopes (Fig. 1). The recently-collected specimens were swept in late afternoon
Nota lepid. 35 (2): 115-124 ny
Guberli.
Fig. 3. Imago of Pelochrista maculiferana (Kenn.) (male, holotype; S Ural; ex. coll. ZIN). Scale = 5 mm.
from /nula salicina L. (Asteraceae), which is reported as a host plant for E. junctanum
(Buhl et al. 1999). The known specimens of P. maculiferana have been observed in the
second half of June, but the flight period probably extends into mid-July. The species
is known only from the type locality, the Guberlinsky Mountains in the southern Ural
range. The redescription of the moth and description of the male genitalia are given
below.
Pelochrista maculiferana (Kennel, 1900), bona sp., comb. nov.
Epiblema maculiferana Kennel, 1900, Dt. ent. Z. Iris 13: 152, pl. 5 fig. 28.
Epiblema junctanum (Herrich-Schäffer, 1856), auct. Razowski 2003, nec. Kennel 1900.
Material. Holotype ©, Russia, ‘© | Guberli <white label with black edges>; coll. of Grand Duke |
Nikolai | Mikhailovich [Romanov] <white label, text in Russian>; Holotypus | Epiblema | maculiferana
(Kenn.) <red label>; Photograph | Marek Kopec <blue label>’ (ZIN). — Paratype: ©, same data (ZIN). —
Other material: 20°C, Russia, S Ural, Orenburg district, 51°15’N 58°08’E, 340 m, Orsk 40 km W, near
Guberlja village, 26.vi.2003, leg. K. Nupponen. Genitalia slide: K. Nupponen prep. no. 1/2.1.2005.
Diagnosis. P. maculiferana is rather easily distinguished from other known species of
the genus Pelochrista both externally and by the characters in the male genitalia. The
moth is small, and the rusty brown forewings with a distinct dorsal patch surrounded
by large dark blotches are characteristic. The male genitalia are unmistakeable, and
readily separated from the other known species of Pelochrista by a very thick neck of
the valva and a rounded cucullus with one ventral and two distal spines. In the original
description of P. maculiferana, the species was compared to E. junctanum. In the latter
species, the forewings are greyish or fuscous, the dorsal patch is wider and not divided
into two areas, the dorsal blotches are smaller and blackish, the hindwings are much
paler, and the male genitalia are completely different.
Redescription (Figs 3, 4). Head: Vertex rusty brown; antenna concolourous; labial
palp yellowish brown, inner surface paler. Thorax: Tegulae, collar, and thorax rusty
brown. Legs pale rusty brown, hindlegs paler. Wingspan: 12.0-12.5 mm. Forewing
with costal fold to 1/3, basally broad, apex rather pointed; ground colour rusty brown,
118 Nupponen: Tortricidae of the Volgo-Ural region
Figs 4-5. Pelochrista maculiferana (Kenn.). 4. Male, wingspan 12 mm (S Ural, Guberli 26.vi.2003).
5. Male genitalia (S Ural; slide KN 1/02.1.2005).
scattered black scales over wing surface, more frequently in distal fourth; dorsal patch
dirty white, consisting of two parallel lines angled outwards, reaching mid-wing; dorso-
postbasal and tornal blotches dark brown, latter somewhat extended; apical half of costa
with distinct strigulae; inner spots of speculum indistinct; cilia line blackish, fringe
paler than forewing. Hindwing dark fuscous, cilia line distinct, fringe paler than wing.
Underside of wings unicolourous fuscous, except costa of forewing pale yellowish
brown. Abdomen: Dark fuscous. Male genitalia (Fig. 5) with uncus short,
rounded. Socii rather long, bent and hairy. Tegumen 1.5 x higher than wide. Valva
robust, ventral incision almost absent, neck thick; cucullus round and hairy, ventrally
with long and stout spine; two further spines at middle of apical margin. Sacculus 0.4 x
length of valva, caudal edge indistinct. Vinculum short and rounded. Phallus half length
of valva, thick, slightly bent at 0.4, apical third tapered, cornuti absent (or lost during
mating, but their sockets are invisible).
Records of eight species of Tortricidae
The dates and localities of records for each species are given, as well as the known
distributional range and basic information about the bionomy. Data on the geographical
range of the species are from Kuznetsov (1989), Kuznetsov et al. (1996), Razowski
(2002, 2003), and Sinev & Nedoshivina (2008).
Phtheochroa exasperantana (Christoph, 1872) Fig. 6
Material. Russia, Astrahan district, 48°08-09’N 46°49—52’E, -15—100 m, Baskunzak salt lake SW,
Bogdo Hill, 29 ©, 26.viii.2006, 10°, 28.viii.2006, leg. K. Nupponen; 47°34’N 47°01’E, -5 m, Sasykoli
village 3 km NE, Peski Voniutchie, 39 9, 29.viii.2006, leg. K. Nupponen; 48°02 —03’N 46°37—40’E, 5 m,
Peski Thikili near Bogdo village, 20° ©, 19, 30.v111.2006, leg. K. Nupponen.
Distribution. Russia (Lower Volga), Tajikistan; recently recorded from the Ustyurt
range in SW Kazakhstan (K. Nupponen, unpublished).
Remarks. The species inhabits desert steppes and semideserts in the northern Caspian
Sea region. The flight period extends from the last third of August to late September.
Nota lepid. 35 (2): 115-124 | 119
Fig. 6. Phtheochroa exasperantana (Christ.). Female, wingspan 16.5 mm; Lower Volga, near Bogdo
30.v111.2006). Fig. 7. Eugnosta medvedevi (Geras.). Female, wingspan 22 mm; Lower Volga, by Ilovla
village 5.1x.2002).
The larva feeds on Caroxylon laricinum (Pall.) Tzvelev (Chenopodiaceae) (Anikin et
al. 2006). P exasperantana is easily distinguished from related species by its ochreous
forewings with well-defined dark brown subterminal and median fasciae, the dorsal part
of the latter is very broad forming a roundish blotch. The male and female genitalia are
illustrated by Razowski (2002: pl. 6 fig. 58; pl. 44 fig. 58). The two adults illustrated by
Razowski (2002: pl. IV figs 58 & 58a) as P exasperantana are actually P. krulikowskii
(Obraztsov, 1944). P. exasperantana has less elongated ochreous forewings, with a
dorsally broad and subcostally cut off dark brown median fascia. Based on examination
of a lot of material of both species (several hundreds of P. krulikowskii from S Ural,
Lower Volga, and W Kazakhstan, and over 30 exx of P exasperantana from Lower
Volga and W Kazakhstan), it is clear that P krulikowskii is externally a very variable
species. It seems that specimens that are somewhat doubtful as to their identification
are usually mottled forms of P krulikowskii, and not P. exasperantana. With this on
mind, the two species are fairly easy to separate from each other both by the external
appearance and by the male genitalia.
Eugnosta medvedevi (Gerasimov, 1928) Fig. 7
Material. Russia, Volgograd district, 49°14—19’N 43°43—56’E, 60 m, Ilovla village 10 km WSW, 20
exx, 5.1x.2002, leg. K. Nupponen.
Distribution. Ukraine, Russia (Lower Volga). New to Russia.
Remarks. This species was previously known only from the type series collected in
eastern Ukraine. The habitat in the Russian locality is a sandy steppe. The moths are
nocturnal and came to artificial light. The male and female genitalia are illustrated by
Razowski (2002: pl. 14 fig. 136; pl. 50 fig. 136).
Clepsis nybomi (Hackman, 1950)
Material. Russia, S Ural, Bashkiria/Cheliabinsk district, 54°33’N 58°50’E, 900 m, Iremel Mountains,
19, 25.vi.1996, leg. K. Nupponen.
120 NuPPONEN: Tortricidae of the Volgo-Ural region
yak ge
RU
Figs 8-11. Lobesia subherculeana (Fil.). 8. Male, wingspan 19 mm; S Ural, Schibendy Valley 7.v1.1998).
9. Female, wingspan 19 mm; S Ural, Schibendy Valley 23.vi.1999). 10. Male genitalia (S Ural; slide KN
1/8.1.2012). 11. Female genitalia (S Ural; slide KN 2/5.1.2012).
Distribution. Finland, N Sweden, Russia (S Ural). First record outside Fennoscandia,
new to Russia.
Remarks. The moth was observed at 0830 hr flying slowly about 1 m above the ground;
it landed on a branch of Picea abies (L.) H. Karst. (Pinaceae). The habitat where it was
collected is a taiga forest with luxurious lower vegetation. For further notes on the
species, see Bengtsson (2004).
Lobesia subherculeana (Filipjev, 1924) Figs 8-11
Material. Russia, S Ural, Orenburg district, 50°40—41’N 54°27-28’E, 170-230 m, Pokrovka village
20 km S, Schibendy valley, 2¢C, 7.vi.1998, 19, 21.vi.1999, 20°C, 22.vi.1999, 209, 23.vi.1999, leg.
T. & K. Nupponen; Ibidem, 19, 2.vii.2003, 19, 21.viii.2006, leg. K. Nupponen; 51°22-23’N 56°48’E,
Nota lepid. 35 (2): 115-124 | 121
130-340 m, Donskoje village 4 km W, Verbljushka, 10°, 27.viii.2000, 30°C, 28.viii.2000, 39 9, 9.1x.2002,
19, 27.vi.2003, 10, 28.v1.2003, 19, 299, 6.1x.2009, leg. K. Nupponen. Genitalia slides: K. Nupponen
prep. no. 1/8.1.2012 (©), 2/5.1.2012 (Q).
Distribution. Russia (Krasnojarsk district, Tuva Rep., S Ural). Recently recorded
also from W Kazakhstan (K. Nupponen, unpublished). The present records are the
westernmost, representing the first from the Urals and from Europe.
Remarks. Externally L. subherculeana resembles L. indusiana (Zeller, 1847), but
the former is much larger (wingspan: range 14—20 mm, mainly 18-19 mm) and
the forewing pattern elements have greater contrast. The moths were observed on
xerothermic rocky steppe slopes (Fig. 2). The species occurs in two generations in June
and from late August through first third of September.
Asketria lepta Falkovitsh, 1964 Figs 12-15
Material. Russia, S Ural, Orenburg district, 50°40-41’N 54°27—28’E, 170-230 m, Pokrovka village
20 km S, Schibendy valley, 19, 1.v11.2003, 19, 2.v11.2003, 299, 3.viii.2005, 10°, 20.viii.2006, leg.
K. Nupponen. Genitalia slides: K. Nupponen prep. no. 2/11.x.2005 (I); 1/5.1.2012 (9).
Distribution. SE Kazakhstan, Mongolia, Russia (S Ural). New to Russia and Europe.
Remarks. This species inhabits chalk steppes in South Ural (Fig. 2). The flight
period extends from late June into the second half of August, possibly representing
two generations. Falkovitsh (1964) reported Atraphaxis virgata (Reg.) Krassn.
(Polygonaceae) as a larval host plant.
Thiodia irinae Budashkin, 1990
Material. Russia, S Ural, Orenburg district, 51°22—23’N 56°48’E, 130-340 m, Donskoje village
4 km W, Verbljushka, 19, 30.v.1998, leg. T. & K. Nupponen, genitalia preparation preserved in glycerol;
Cheliabinsk district, 52°39’N 59°34’E, 320 m, Arkaim reserve near Amurskii village, 19, 15.v1.1999, leg.
K. Nupponen.
Distribution. Ukraine (Crimea), Russia (Lower Volga, S Ural). Recently recorded from
W Kazakhstan (K. Nupponen, unpublished). The present records are the easternmost
known and the first from the Urals.
Remarks. The larva feeds on leaves of Galatella villosa (L.) Rchb. f. (Asteraceae)
(Razowski 2003). The adult and male and female genitalia are illustrated by Razowski
(2003).
Eucosma pergratana (Rebel, 1914) Fig. 16
Material. Russia, S Ural, Cheliabinsk district, 53°01’N 62°02’E, 185 m, Ajat River near Nikolaevka
village, Sokolovskaja Gora, 19, 24.vii.1998, 19, 25.vii.1998, leg. K. Nupponen.
Distribution. Russia (Tuva Rep., Transbaikalia, S Ural), Kazakhstan, Kyrgyzstan,
Mongolia, China. The present records are the westernmost Known and the first from
the Urals and Europe.
Remarks. The moths were observed on a xerothermic rocky steppe slope along a river.
The male genitalia are illustrated by Kuznetsov (1989).
122 NuPPONEN: Tortricidae of the Volgo-Ural region
Figs 12-15. Asketria lepta Flkv. 12. Male, wingspan 9 mm; S Ural, Schibendy Valley 20.v111.2006).
13. Female, wingspan 11 mm; S Ural, Schibendy Valley 1.vii.2003). 14. Male genitalia (S Ural; slide
KN 2/11.x.2005). 15. Female genitalia (S Ural; slide KN 1/5.1.2012).
Dichrorampha alaicana Rebel, 1910 Figs 17-18
Material. Russia, S Ural, Cheliabinsk district, 53°56-57’N 59°03-04’E, 500-600 m, near Moskovo
village, 10°, 10.v11.1997, 10°, 12.vii.1998, leg. K. Nupponen; Ibidem, 10°, 26.V.1998, 10°, 18.vi.1998, leg.
T. & K. Nupponen. Genitalia slide: K. Nupponen prep. no. 3/5.1.2012 (©).
Distribution. C Asia (mountain ranges of Kazakhstan, Kyrgyzstan and NW China),
Russia (Altai, Tuva, S Ural). The present records are the westernmost known and the
first from the Urals and Europe.
Remarks. The species occurs on rocky steppe slopes in the Urals. In Southern Siberia
and Central Asia it inhabits steppes and dry meadows in mountain ranges.
Nota lepid. 35 (2): 115-124 | 123
Fig. 16. Eucosma pergratana (Rbl.). Female, wing-
span 17mm (S Ural, Ajat River 25.viii.1998).
Figs 17-18. Dichrorampha alaicana Rbl. 17. Male,
wingspan 16mm (S Ural, Moskovo 26.v.1998).
18. Male genitalia (S Ural; slide KN 3/5.1.2012).
Acknowledgements
I thank Vladimir Olschwang (Ekaterinburg, Russia) and Pavel Gorbunov (Ekaterinburg, Russia) for or-
ganising the expeditions to the southern Urals and the Lower Volga region. Sergey Sinev (St. Petersburg,
Russia) allowed me to study the collection of ZIN. Boyan Zlatkov (Sofia, Bulgaria) and an anonymous
referee improved the manuscript by helpful comments and suggestions. My thanks are also due to the
following for various kinds of help during the expeditions or preparing the present article: Lauri Kaila
(Helsinki, Finland), Sergey Kornev (Orenburg, Russia), Alexander Lagunov (Miass, Russia), Alexander
Malozemov (Ekaterinburg, Russia), Elena Nupponen (Espoo, Finland), Timo Nupponen (Espoo, Finland),
and Kimmo Silvonen (Espoo, Finland).
References
Amsel, H. G. 1964. Hugo Christoph. — Zeitschrift der Wiener Entomologischen Gesellschaft 49: 91—92.
Anikin, V. V., S. A. Sachkov, V. V. Zolotuhin, S. V. Nedoshivina, & T. A. Trofimova 2006. “Fauna Lepi-
dopterologica Volgo-Uralensis” 150 years later: Changes and additions. Part 9. Tortricidae. — Atalanta
37 (3/4): 409-445.
Bengtsson, B. À. 2004. En ny vecklarart, Clepsis nybomi Hackman 1950, funnen i Sverige (Tortricidae,
Lepidoptera). — Entomologisk Tidskrift 125 (4): 205-209.
Buhl, O., P. Falck, B. Jorgensen, O. Karsholt, K. Larsen & F. Vilhelmsen 1999. Fund af smäsommerfugle
fra Danmark 1 1998. — Entomologiske Meddelelser 67: 103-112.
Christoph, H. 1872. Neue Lepidoptera des europaeischen Faunengebietes. — Horae Societatis Entomologicae
Rossicae 9: 9— 39,
Falkovitsh, M. I. 1964: New and little-known species of Tortricidae from Kazakhstan. [In Russian]. —
Trudy Zoollogicheskogo Instituta Academii Nauk SSSR, Leningrad 37: 266-282.
Eversmann, E. 1844. Fauna Lepidopterologica Volgo — Uralensis. Casani Typis Universitatis. XIV + 633 pp.
Kennel, J. 1900. Neue paläarktische Tortriciden, nebst Bemerkungen über einige bereits beschriebene Ar-
ten. — Deutsche Entomologische Zeitschrift Iris 13 (1): 124-159 [1900] + Taf. V [1901].
124 NuPPONEN: Tortricidae of the Volgo-Ural region
Kuznetsov, V. I. 1989. Family Tortricidae (Olethreutidae, Cochylidae) —Tortricid Moths. Pp: 279-956. — In:
G. S. Medvedev (ed.), Keys to the Insects of the European Part of the USSR, Volume IV, Lepidoptera,
Part I, E. J. Brill, Leiden. [English translation].
Kuznetsov, V. I., L. Kaila & K. Mikkola 1996. The leaf-rollers (Lepidoptera, Tortricidae) of the Tian-Shan
Mountains in Kazakhstan and Kyrgyzstan, with description of a new species. — Acta Zoologica Fen-
nica 200: 41-55.
Lepiforum 2011. http://www. lepiforum.de/cgi-bin/lepiwiki.pl?Epiblema_Junctana. Accessed 2.1.2012.
Razowski, J. 1999. Catalogue of the species of Tortricidae. Part V: Palaearctic Eucosmina and Enarmoniina
(Insecta: Lepidoptera). — SHILAP Revista de Lepidopterologia 27 (108): 437-506.
Razowski, J. 2001. Die Tortriciden (Lepidoptera, Tortricidae) Mitteleuropas. Bestimmung — Verbreitung —
Flugstandort — Lebensweise der Raupen. — Bratislava. 319 pp.
Razowski, J. 2002. Tortricidae of Europe. Vol. 1, Tortricinae and Chlidanotinae. — Bratislava. 247 pp.
Razowski, J. 2003. Tortricidae of Europe. Vol. 2, Olethreutinae. — Bratislava. 301 pp.
Sinev, S. Yu. & S. V. Nedoshivina 2008. Tortricidae. Pp. 114-148. — Jn: S. Yu. Sinev (ed.), Catalogue of
the Lepidoptera of Russia, KMK Scientific Press Ltd., St. Petersburg—Moscow.
Staudinger, O. 1871. Beschreibung neuer Lepidopteren des europäischen Faunengebiets. — Berliner Ento-
mologische Zeitschrift 14: 273-330.
Staudinger, O. 1877. Neue Lepidopteren des europäischen Faunengebiets aus meiner Sammlung. — Stetti-
ner Entomologische Zeitung 38: 175-208.
Nota lepid. 35 (2): 125-133 125
Revision of types of several species of Bembecia Hübner, 1819
from northern Africa and southwestern Europe (Sesiidae)
DANIEL BARTSCH
Staatliches Museum für Naturkunde Stuttgart, Rosenstein 1, 70191 Stuttgart, Germany;
[email protected]
Received 14 March 2012; reviews returned 18 April 2012; accepted 18 August 2012.
Subject Editor: Jadranka Rota.
Abstract. The type specimens of Sesia sirphiformis Lucas, 1849 from Lac Tonga in Algeria and Dipso-
sphecia megillaeformis v. tunetana Le Cerf, 1920 syn. n. from the vicinity of Tunis were examined and
found to be conspecific. Bembecia sirphiformis belongs to the B. ichneumoniformis (Denis & Schiffer-
müller, 1775) species group and is currently known only from northern Africa. Records from Sicily, Sar-
dinia, Corsica, southern Italy, and Morocco (as B. funetana) are here considered doubtful and may belong
to other species. B. astragali (Joannis, 1909) stat. rev., which was described from northern Spain and
southern France and was previously considered conspecific with B. sirphiformis, actually appears not to
be so closely related to B. sirphiformis and seems to belong to the B. megillaeformis (Hübner, 1813) spe-
cies group. B. igueri Bettag & Bläsius, 1998 syn. n. from Morocco is now considered to be a synonym of
B. astragalı.
Zusammenfassung. Die Typusexemplare von Sesia sirphiformis Lucas, 1849 vom Lac Tonga in Algerien
und Dipsosphecia megillaeformis v. tunetana Le Cerf, 1920 syn. n. aus der Umgebung von Tunis wur-
den untersucht und ihre Artgleichheit festgestellt. Bembecia sirphiformis ist eine Art der B. ichneumoni-
formis (Denis & Schiffermüller, 1775) Artengruppe und bisher nur von Nordafrika bekannt. Meldungen
von Sizilien, Sardinien, Korsika, Süditalien und Marokko (als B. tunetana) sind zweifelhaft und wahr-
scheinlich anderen Arten zuzuordnen. Die bisher als konspezifisch mit B. sirphiformis angesehene, aus
Nordspanien und Südfrankreich beschriebene B. astragali (Joannis, 1909) stat. rev. ist nicht unmittelbar
verwandt, sondern gehört der B. megillaeformis (Hübner, 1813) Artengruppe an. Synonym zu B. astragali
ist B. igueri Bettag & Bläsius, 1998 syn. n. von Marokko.
Introduction
During the examination of Sesiidae types in the Muséum National d’Histoire Naturelle,
Paris (MNHP), the author noticed a significant similarity between the type specimens
of Sesia sirphiformis Lucas, 1849 and Dipsosphecia megillaeformis v. tunetana Le
Cerf, 1920. This was also noted but not published by Ferdinand Le Cerf, documented
by a handwritten label “Dips. sirphiformis Luc. v. tunetana Le Cerf, 9 Type”, which
was added by Le Cerf to one of the primary types of D. megillaeformis v. tunetana.
This specimen, a female, was later selected as lectotype by Spatenka (1992). The simi-
larity between the two taxa, sirphiformis and funetana, ıs in conflict with the current
understanding of S. sirphiformis, which is considered conspecific with Sesia astra-
gali Joannis, 1909 (Spatenka et al. 1993, 1999). Only two of three primary types of
D. megillaeformis v. tunetana, a male and a female, were found in the MNHP and were
examined by Spatenka (1992). He dissected the genitalia of the male, designated the
female as lectotype and listed it as subspecies of Bembecia albanensis (Rebel, 1918).
Several years later, the genitalia of the lectotype were also dissected and Bembecia tu-
netana Was treated as a distinct species by Bettag & Bläsius (1999). In agreement with
Nota lepidopterologica, 15.11.2012, ISSN 0342-7536
126 Bartscu: Types of Bembecia Hübner, 1819 (Sesiidae)
this conclusion, B. tunetana 1s listed with species rank on the Fauna Europaea website
with the comment suggesting that “... taxonomic research is needed”. The aim of this
paper is to clarify the identity of the taxa in question. Unless otherwise noted, the mate-
rial examined is from the collection of the author.
Abbreviations and notation
MNHP Museum National d'Histoire Naturelle, Paris
NHMM Naturhistorisches Museum Mainz
CRB collection of Rolf Bläsius, Eppelheim, Germany
CDB collection of the author
‘21.vi./vi-v11.2005’ means that larva(e) or pupa(e) were found on June 21 and the adults emerged in July
and August.
Bembecia sirphiformis (Lucas, 1849) Figs 1-6, 13, 17
Sesia sirphiformis Lucas, 1849: 367. Syntype 9 [without head and abdomen] (Fig. 1): “C’est en juin, dans
les bois du lac Tonga, aux environs du cercle de Lacalle, que j’ai pris cette jolie petite espèce, dont je
n’ai rencontré que deux individus.” (MNHP).
Material. Syntype: 19 (Fig. 1), ‘Sesia | sirphiformis, Luc.’, ‘1544’, ‘Museum Paris’, ‘Holotypus | Sesia
| sirphiformis Lucas | 1849 | K. Spatenka rev. 1991’. — Italy, Sardinia: 170, 219, Caglari, Villaputzu,
Porto Corallo, larva/pupa reared from Lotus creticus, 21.v./v—vi.2004; 170, same data, pheromone; 119,
349, Cagları, Muravera, Stagno di Saline, larva/pupa reared from Lotus creticus, 26.v./v—vi.2004; 89,
59, same data, by net; 69, 29, Oristano, San Giovanni di Sinis, vic. Tharros, larva reared from Lotus
creticus, 24.v./v—vi.2004; 50°, Oristano, Stagno s’Ena Arrubia, 24.v.2004, pheromone; 10, Ogliastra, Bari
Sardo, 18.vi.2009; 19, Nuoro, 5 km S Orosei, larva reared from Lotus creticus, 17.v./30.v1.2004; 28¢,
109, Ogliastra, vic. Arzana, larva reared from Psoralea bituminosa, 21.vi./vii—v111.2005; 780°, same data,
pheromone. Italy, Sicily: 30, 89, Madonie, vic. Polizzi Generosa, larva reared from Psoralea bituminosa,
15.v./vi—vii.2007; 30, 39, vic. Lercara, larva/pupa reared from Hedysarum coronarium, 16.v./v—v1.2007.
Morocco: 50, 49, Middle Atlas Mts, Jbel bou Iblane, vic. Tafferte, larva reared from Ononis spinosa,
10.v./vi-vii.2006; 99, 29, same locality, 5.viii.1997; 79, 59, 10 km W Tiznit, larva reared from Lotus
creticus, 18.v./vi—vii.2005; 20°, same data, larva 11.2006; 10°, 29, same data, larva v-vii.2005; 20°, 10 km
S Agadir, larva reared from Lotus creticus, v1.2005.
Dipsosphecia megillaeformis v. tunetana Le Cerf, 1920: 305 syn. n., Lectotype 9, des. Spatenka, 1992:
487 (Fig. 2): “Environs de Tunis, ex racines de Sulla, VI, coll. F. Le Cerf.” (MNHP).
Material. 19 (Fig. 2) [lectotype of Dipsosphecia megillaeformis v. tunetana Le Cerf, 1920], “Tunis |
e.l. VI | Hedys. coron.’ ‘tératolog. | nerv 2 bifurg. | aile inf. dr.’, ‘Dips. sirphiformis Luc. | v. tunetana Le
Cerf | Q Type | Et. Lep. Cie. XVII | Coll. F. Le Cerf”, ‘Dipsosphecia | megillaeformis | var. tunetana Le
Cerf | Et. Lepid. comp., | XVII, 1920, p. 305’, ‘Lectotypus Q | Dipsosphecia | megillaeformis | v. tunetana
Le Cerf, | 1920 | K. Spatenka des. 1991’, ‘Bembecia | tunetana 9 | det. E. Bettag 1998’ [genitalia dissected,
fixed on paper card and figured by Bettag & Bläsius (1999)]. — 19 (Fig. 3) [paralectotype of Dipsosphecia
megillaeformis v. tunetana Le Cerf, 1920], ‘chenille dans | racines de Sulla | eclos V-1911 | envoi de Tunis’,
‘Dipsosphecis | ichneumoniformis F. | coll. F. Le Cerf ©”, ‘Paralectotypus © | Dipsosphecia | megillae-
formis | v. tunetana Le Cerf | 1920 | K. Spatenka des. 1991”, ‘Bembecia | tunetana Le Cerf | R. Bläsius det.
11/1998’ (MNHP). — Tunisia: 50 (Figs 4, 13), 49 (Figs 5, 6, 17), vic. Beja, 1 —31.vii.2000, ex larva reared
from Hedysarum coronarium, leg. R. Bläsius (CRB, CDB).
In his original description, Lucas (1849) mentions two specimens of Sesia sirphiformis,
only one of which is currently deposited in the collection of the MNHP. This is a syn-
type and not the holotype as mentioned by Spatenka (1992). The second syntype may
have been destroyed or lost a long time ago (Le Cerf 1920), thus my decision is to
Nota lepid. 35 (2): 125-133 | 127
Ds OS deci
RE
AV, Io, Ad
J 19900
Dey Re Ei I i j IM i
‘jt VE formes và e | te 7 a 4 Exemplar + Etiketten
uf El
NACE te G u } re 27 A dokumentiert
a Led 2 : Specimen + label
te
© : ; Le ta documented
en eh. Cr guy es! |
en pe. LE CER re Mar‘ Een, dr. da F v
el 200%
Le
dys. ron,
Figs 1-6. Adults of Bembecia sirphiformis (Lucas, 1849), scale bar: 10 mm. 1. 9 syntype [insert: Original
figure in Lucas, 1849]. 2. Q lectotype of Dipsosphecia megillaeformis v. tunetana Le Cerf, 1920. 3. © para-
lectotype (MNHP). 4—6. Specimens from Tunisia, vic. Beja, larva reared from Hedysarum coronarium.
4. Male. 5. Female, dark form with reduced LTA and small ETA. 6. Female, pale form with small LTA and
large ETA.
refrain from a lectotype designation. The remaining syntype is in a bad condition. The
head, abdomen, and legs apart from the right hindleg are missing; the wings are not
128 Bartscu: Types of Bembecia Hübner, 1819 (Sesiidae)
spread making the hindwings incompletely visible. A lack of a longitudinal transpar-
ent area confirms the female gender of the specimen, despite the missing antennae and
abdomen. The illustration of Sesia sirphiformis in Lucas (1849) (Fig. 1, insert) shows
the tergites of the abdomen marked with five relatively consistent yellow posterior
annulations. Females of B. astragali have only tergite 2, 4, and 6 with such complete
yellow annulations and that on tergite 3 is indistinct or absent. Furthermore, the syntype
of sirphiformis differs clearly from female specimens of B. astragali by the absence
of a longitudinal transparent area (LTA), which is always present in both genders of B.
astragali, and by the narrow external transparent area (ETA), consisting of three well-
developed cells and mostly an additional very indistinct narrow cell (ETA distinctly
broader, consisting of four well-developed cells in 2. astragali).
The type series of Dipsosphecia megillaeformis var. tunetana was reared from lar-
vae, which were found in the roots of Hedysarum coronarium (Fabaceae) (Le Cerf
1920). Since then, specimens that can be identified as conspecific without doubt have
been collected only once. A series of five males and four females was reared by Bläsius
from larvae found on A. coronarium in the vicinity of Beja, Tunisia. The females ex-
hibit some variation in size and colouration, in the intensity of the forewing discal spot
and in the extension of the transparent areas. The LTA is mostly absent, but sometimes
very small, the ETA consists of 2, 3, or 4 partially very small cells (Figs 1, 2, 5, 6). The
type localities of both B. sirphiformis and D. megillaeformis var. tunetana are separated
by only about 200 km, and Beja is located almost in the middle. No other related spe-
cies are known from this area. For the above reasons, D. megillaeformis var. tunetana
is considered a synonym of B. sirphiformis.
B. sirphiformis appears to belong to the B. ichneumoniformis (Denis & Schiffermüller,
1775) species group and is closely related and habitually almost indistinguishable
from B. albanensis (Rebel, 1918) from Southern and Central Europe, B. handiensis
Rämisch, 1997 from Fuerteventura and Morocco, and B. psoraleae Bartsch & Bettag,
1997 from the Iberian Peninsula, southern France, and northwestern Italy. The males
of B. albanensis have the yellow annulations less brilliant and more greyish. Small dif-
ferences exist in the morphology of the genitalia. Male genitalia (Fig. 13) differ by the
shape of the crista sacculi of the valva. In B. sirphiformis it has a short bald, apically
directed ridge distally, which is lacking in B. albanensis (Fig. 14). The saccus is shorter
and broader in B. sirphiformis. Furthermore, B. sirphiformis differs from B. albanensis
and B. handiensis by the size of the medial crista of the gnathos, which is less promi-
nent in B. albanensis and much bigger in B. handiensis. The females (Fig. 17) differ
in the shape of the ostium bursae, which is y-shaped in B. sirphiformis, v-shaped in 2.
psoraleae, and with semi-circled lateral hemispheres in B. albanensis (Fig. 18), as well
as the surface structure of the ante vaginal plate (densely grained, without folds in B.
sirphiformis (Fig. 17, detail) and B. albanensis (Fig. 18, detail); scarcely grained, with
strong folds in B. psoraleae). B. psoraleae differs further by a small sclerotised signum
of the corpus bursae.
Bembecia sirphiformis (as B. tunetana) has been reported from northern Africa,
Sicily, Sardinia, Corsica, and southern Italy (Bertaccini & Fiumi 2002; Lastuvka &
Laëtüvka 2001; Spatenka et al 1999). The European populations and specimens from
Nota lepid. 35 (2): 125-133 129
Morocco, reported by Bettag & Bläsıus (1999), however, differ significantly in oc-
currence time and host-plant preference and have conspicuously different barcode se-
quences (Pühringer, ın litt.). Therefore, the records of B. sirphiformis from Europe and
Morocco are doubtful and may belong to other species. The relationships of the species
in this complex and their distributions remain unclear and need further investigation.
Bembecia astragali (Joannis, 1909) stat. rev. Figs 7-12, 15, 16, 19, 20
Sesia astragali Joannis, 1909: 183. Lectotype 9, des. Spatenka, 1992: 487 (Fig. 8): “Sur les collines en-
tourant l’etang de la Bonde (par la Motte d’Aigues, Vaucluse)” (MNHP). ‘Cotype | exemplar dessiné
| Astragalus, la Bonde (Vaucluse), 21.v11.08 | astragali | 1920-1932 coll. L. & J. de Joannis, Muséum
Paris’ (Spatenka 1992).
Material. Paralectotype: 19 (Fig. 8), “Astragalus | la Bonde (Vaucluse) | 21 VII 08’, ‘P.E.L. Viette det.
19 | Sesia | astragali | Joannis’, ‘Paralectotypus Q | Sesia astragali | Joannis, 1909 | K. Spatenka des. 1991’
(MNHP). — Southern France, Provence: 70°, 39, Dpt. Vaucluse, Rustrel, larva reared from Astragalus mon-
spessulanum, 4.v1./vii.1992 (10, 19, Figs 9, 10; genitalia Figs 15, 20, two other specimens with the same
data); 19, 19, same data, 27.vi./vi1.1993; 70°, 49, same data, 2.iv./vii—vini.1999; 10°, same data, 27.vi./10.
vii.2006; 19, 19, same locality; pupa reared from Colutea arborescens, 4.viii./vin.1993; 40°, same lo-
cality, 5.vi11.1993, pheromone; 20°, Dpt. Drome, Montbrun les Bains, 28-30.v1.2006, pheromone; 2¢,
Dpt. Drome, Col Aulan, 27.vi.2006, pheromone; 30°, same data, 5.vi11.1993; 30°, same data, 25.vii.1992;
19, Dpt. Drome, Buis, Plaisians, 26.v11.1992, pheromone; 19, Dpt. Drome, Caseneuve, 3.v111.1993,
pheromone; 19, Dpt. Vaucluse, Luberon, Cereste, 1.vi11.1993, pheromone; 10°, Dpt. Haut Alpes, Serres,
Savournon, larva reared from Astragalus monspessulanum, 21.v1./v11.2010. Spain, Andalusia, Serrania de
Ronda: 250°, vic. Ronda, 24—28.vi.1993, pheromone; 60, Atajate, 24.vi.1994, pheromone; 80°, Cortes de
la Frontera, 19.v11.2004, pheromone; 30’, el Burgo, 17-21.v11.2004, pheromone. Italy, Piemonte: 10,
139, Arquata Scrivia, Sottovale, ex larva reared from Astragalus monspessulanum, 30.v./vii—viii.2010.
Morocco, High Atlas: 310°, Tizi-n-Tichka, 10—11.vi.1996, pheromone; 80, Imilchil, Tizi-n-Tirhadouine,
26.v1.2008, pheromone; 49, Marrakech, Telouet, 26.vi.2008, pheromone; 10°, Marrakech, Tizi-n-Fedrhat,
27.v1.2008, pheromone; 140°, Ait Bou Guemez, Jbel M’Goun, 28.vi.2008, pheromone; 30°, Tizi-n-Ouano,
2.v11.2008, pheromone; 19, 19 (Figs 11, 12), Iguer, larva reared from Colutea atlantica. Middle Atlas: 19,
Jbel bou Iblane, 6.vii.2008, pheromone; Tizi-n-Ifar, 20° 6.vi.1999, 20 16.vi.2007, pheromone; 19, same
locality, larva reared from Astragalus sp.; 19, same locality, larva reared from Colutea atlantica. Slovenia:
19, vic. Koper, 20.vi.—23.vii.2003; 39, same locality, larva reared from Genista tinctoria, v11.2004.
Croatia: 10, Krk, 10.vii.1996, pheromone. Greece: Pindos Mts: 60°, Kastanea, 5.v111.2002, pheromone;
19, same data, ovipositing at Astragalus glycyphyllos; 40, Kranea, 6.v111.2002; 20°, Timphristos, Fourna,
14.v11.2008, pheromone. 40°, Timfi Mts, Vrissohori, Aoosbridge, 4.v111.2002, pheromone. Mitsikeli Mts:
119, Kopuai, larva reared from Colutea arborescens, 27.v./vi1.1995; 29, Karyes, 31.v./vi1.1995; 39, vic.
Konitza, larva reared from Colutea arborescens, 3.v1./v11.1997.
Bembecia igueri Bettag & Bläsius, 1998: 71 syn. n.
= Bembecia sirphiformis sensu auctorum (nec. Lucas, 1849).
Material. 10 (Figs 7, 16), Morocco ‘Morocco / H. Atlas | Tizi-n-Test. 2100 m | 15.08.1997 | leg E.
Bettag’, ‘Holotypus | Bembecia igueri | Bettag / Bläsius 1998’, ‘Nat. Hist. Museum | Mainz | E-2011/0425’
(NHMM). — 10, same data, ‘Paratypus, Bembecia igueri Bettag / Bläsius 1998’, ‘Nat. Hist. Museum
Mainz E-2011/0426’ (genitalia Fig. 16) [dissected by Bettag] (NHMM).
Bembecia astragali was described from a series of three males and six females. All
specimens except one female were reared from larvae that were found in southern
France, la Bonde, Vaucluse, in rootstocks of Astragalus monspessulanum (Fabaceae).
One female was collected at Montserrat, Barcelona (Joannis 1909). Only one of the
female paralectotypes from la Bonde was actually found in MNHP (Fig. 8). B. astra-
gali (as B. sirphiformis) is a well-known member of the B. megillaeformis (Hiibner,
130 Bartscu: Types of Bembecia Hübner, 1819 (Sesiidae)
een R AE
IMarokko / H. Atlas
ITizi-n-Test,, 2100 m | i
| 15.08.1997 |
ileg. E. Bettag |
Re | TU
Nat. Hist. Museum ges ec
Mainz | tor blobr Slide we |
E-2011/0425 | Ze [15-27 |
photogs 196%
E
E
À
0!
Figs 7-12. Adults of Bembecia astragali (Joannis, 1909). 7. © holotype of Bembecia igueri Bettag &
Bläsius, 1998 (NHMM). 8. 9 paralectotype (without scale bar) (MNHP). 9-10. Male and female, France,
Vaucluse, Rustrel, larva reared from Astragalus monspessulanum. 11-12. Male and female, Morocco,
High Atlas, Iguer, larva reared from Colutea atlantica.
1813) species group (Bertaccini & Fiumi 2002; Freina 1997; Laëtüvka & LaStüvka
1995, 2001; Spatenka et al. 1999). The genitalia, especially that ofthe males, are very
Nota lepid. 35 (2): 125-133 131
Figs 13-20. Genitalia structure of Bembecia species, scale bar: 1 mm; inserts (ostium details) scale bar:
0.2 mm. 13. B. sirphiformis ©, Tunisia, vic. Beja. 14. B. albanensis ©, Parnass Mts, Greece. 15. B. as-
tragali ©, France, Rustrel. 16. B. astragali S, Morocco, Tizi-n-Test (paratype of B. igueri, NHMM). 17.
B. sirphiformis 9, Tunisia, vic. Beja. 18. B. albanensis 9, Markgröningen, Germany. 19. B. astragali 9,
Morocco, Tizi-n-Test. 20. B. astragali 9 France, Rustrel.
homogeneous within this group and scarcely suitable for determination (Laëtüvka &
LaStüvka 2001). Larger specimens of B. astragali are very typical and unmistakable,
132 BARTSCH: Types of Bembecia Hübner, 1819 (Sesiidae)
whereas small specimens can be confused with B. iberica Spatenka, 1992, which, how-
ever, has a very different morphology of the genitalia. The Moroccan 2. igueri Bettag &
Bläsius, 1998 syn. n. is here considered conspecific with B. astragali. It was described
from a series of six males that were captured with the help of synthetic sexual phero-
mones at the Tizi-n-Test, in the western part of the High Atlas Mountains. A male and
a female specimen from the type locality were reared by the author from larvae, which
were found in rootstocks of Colutea atlantica (Fabaceae) (Figs 11, 12). This male and
the specimens of the type series agree perfectly. They differ only marginally from typi-
cal French specimens of B. astragali, which were reared from Colutea arborescens
and Astragalus monspessulanum. Males of B. astragali are strongly attracted by vari-
ous synthetic pheromones and have been collected in large numbers. The males from
Morocco show greater individual variation than specimens from Europe. The ground
colour of the forewing, including the apıcal area, varies from nearly completely black
to orange-yellow, and the discal spot is sometimes completely orange-yellow. The ETA
can consist of four or five cells and its wıdth ıs very variable, with occasionally only a
very small apical area. The population of the Tizi-n-Test is in the southwestern extreme
of the known range. Its representatives are generally somewhat darker with slightly
smaller transparent areas and somewhat more prominent discal spots. Differences
mentioned in the original description of B. igueri cannot be confirmed: “Arten der
Bembecia sirphiformis-Gruppe [auctorum] unterscheiden sich am auffalligsten von der
neuen Art und von Bembecia megillaeformis durch die kurze Stielung der Adern M,-
Cu, und durch lange Haarschuppen an den Vordercoxen [...]” (Bettag & Bläsius 1998).
Investigation of several specimens of B. megillaeformis and B. astragali shows that the
common stalk of veins M,-CuA, varies much more in length as noted, broadly over-
lapping for both species. The long, hair-like scales of the forecoxa are common to all
freshly emerged male specimens of Bembecia.
Acknowledgements
I wish to thank Joël Minet (MNHP) for his kind support and for the permission to take photographs of
the sesiid type specimens and to Carsten Renker (NHMM) for the loan of type specimens. I am further
grateful to Rolf Bläsius (Eppelheim) for his generous donation of sesiid specimens revised in this study,
and to Theo Garrevoet (Antwerp) and Axel Kallies (Melbourne) for constructive comments and linguis-
tic help.
References
Bertaccini, E. & G. Fiumi 2002. Bombici e Sfingi d’ Italia, vol. 4, Lepidoptera, Sesioidea. — Societa per gli
studi natrualistici della Romagna, Italy. 181 pp.
Bettag, E. & R. Bläsius 1998. Eine neue Glasflüglerart aus Marokko (Lepidoptera: Sesiidae). — Phegea 26
(2): 71-75.
Bettag, E. & R. Bläsius 1999. Uber den Status von Dipsosphecia megillaeformis var. tunetana (Lepidoptera:
Sesiidae). — Phegea 27 (3): 93-101.
Freina, J. J. de 1997. Die Bombyces und Sphinges der Westpalaearktis (Insecta, Lepidoptera), vol. 4, Se-
siidae. — Edition Forschung & Wissenschaft Verlag GmbH, München. 432 pp.
Joannis, J. de 1909. Description d’une nouvelle espèce francaise du genre Sesia (Lep. Sesiidae). — Bulletin
de la Société entomologique de France 10: 183-186.
Nota lepid. 35 (2): 125-133 133
Lastüvka, Z. & A. Laëtüvka 1995. An illustrated key to European Sesiidae (Lepidoptera). — Faculty of
Agronomy, Mendel University of Agriculture and Forestry, Brno, Czech Republic. 174 pp.
Lastüvka, Z. & A. Laëtüvka 2001. The Sesiidae of Europe. — Apollo Books, Stenstrup, Denmark. 245 pp.
Le Cerf, F. 1920. Contributions à l’étude des Aegeriidae (II). Révision des Aegeriidae de Barbarie. Pp.
181-583. — In: C. Oberthür, Etudes de Lépidoptérologie comparée 17.
Lucas, P. H. 1849. Histoire naturelle des animaux articules. 527 pp. — In: Exploration scientifique de |’ Al-
gérie (Zoologie) 2 (3), M. Dumenil, Paris, France.
Spatenka, K. 1992. Contribution à la stabilisation de la taxinomie des Sésiides paléarktiques (Lepidoptera,
Sesiidae). — Alexanor 17 (8): 479-503.
Spatenka, K., LaStüvka, Z., Gorbunov, O., ToSevski, I. & Y. Arita 1993. Die Systematik und Synonymie der
paläarktischen Glasfliigler-Arten (Lepidoptera, Sesiidae). — Nachrichten des entomologischen Vereins
Apollo N.F. 14 (2): 81-114.
Spatenka, K., Gorbunov, O., Laëtüvka, Z., ToSevski, I. & Y. Arita 1999. Sesiidae — Clearwings moths. 569
pp. — Jn: C. Naumann (ed.), Handbook of Palaearctic Macrolepidoptera 1, Sesiidae, Clearwing Moths,
GEM Publications, Wallingford, England.
134 Book review
Thomas Sobczyk 2011. Psychidae (Lepidoptera). — Zn: M. Nuss (ed.), World Catalogue of Insects, Vol-
ume 10, Apollo Books Aps., Stenstrup, Denmark, 467 pp. Hard cover, Price EUR 138 (USA $192), exclud-
ing postage.
It has been more than 80 years since the last global catalogue of the bagworm family Psychidae by Dalla
Torre and Strand (1929) was published. As is carefully documented in the abstract section of this latest cata-
logue by German Lepidopterist, Thomas Sobczyk, many new taxonomic changes have occurred over the
ensuing years, and our knowledge of this biologically interesting family has increased significantly. A total
of 236 genera and 110 generic synonyms and unjustified emendations are listed, including 1,324 species
names, 45 subspecies, and 391 species synonyms. These totals do not include the five genera and 26 species
treated by Davis (2003) in the formerly considered family Arrhenophanidae, now regarded as a subfamily
of Psychidae (Mutanen et al. 2010). Sobczyk does refer to this reference in the introduction of his catalogue
and briefly refers to the most recent classification of Arrhenophaninae. These numbers were later added to
the taxon totals for the Psychidae in van Nieukerken et al. (2011), bringing the current world totals to 241
genera and 1,350 species. Also summarised in the abstract of the catalogue are many new nomenclatural
changes initiated by the author, including. the introduction of three new generic names, two new generic
synonyms, eight new species synonyms, a new replacement of a species name, and 144 new combinations.
The type designations of four species are also presented.
In the introduction following the abstract, Sobczyk briefly reviews major features of the biology, classi-
fication, distribution, fossil records, and publication history of the family. The catalogue proper begins with
references to all family group names in alphabetical sequence by subfamily. The genus and species names
are not associated with subfamilies and, consequently, are likewise arranged alphabetically. In addition to
the original literature reference, information about the type locality and type specimen(s) is provided for
each species name. Any pertinent additional information is included under remarks. Following the proce-
dure used in most recent Lepidoptera catalogues, gender agreement between the specific and generic names
as prescribed by article 31.2 of the International Code of Nomenclature (ICZN 1999) is not adhered to
(Sommerer 2002).
Concluding the catalogue are five sections listing names whose statuses remain uncertain, often because
no specimens are known to exist, or what material remains is poorly preserved, found to be misplaced to
family, are nomina nuda, or unrecognized for other reasons. These groups include 1) unplaced taxa, 2) una-
vailable names, 3) hybrids, 4) taxa excluded from Psychidae, and 5) one “unsolved” name.
Because of the abundance of taxon names in any large catalogue, the possibility for some misspell-
ings always exists. Although most names were not checked, one misspelling was noted: the generic name
Acoremata was misspelled “Acomerata” on page 42. Also, the genera Apoecis and Aprata (pp. 61-62)
occurred out of sequence in the text and should have been listed alphabetically before Apterona (p. 58).
This catalogue will be a vital, necessary reference for all entomologists seeking up to date information
on this biologically interesting and often economically important family. By providing an outstanding guide
to the literature and taxonomic diversity of Psychidae, the author has facilitated the study of these insects
appreciably.
References
Davis, D. R. 2003. A Monograph of the Family Arrhenophanidae (Lepidoptera, Tineoidea). — Smithsonian
Contributions to Zoology 260: 1-80.
Dalla Torre. K. W. v. & E. Strand 1929. Psychidae. Lepidopterorum Catalogus. Vol. 34. W. Junk, Berlin.
pp. 1-48.
Mutanen, M., N. Wahlberg, & L. Kaila 2010. Comprehensive gene and taxon coverage elucidates radiation
patterns in moths and butterflies. — Proceedings of the Royal Society B 277: 2839-2848.
van Nieukerken, E. K., L. Kaila, I. J. Kitching, N. P. Kristensen, D. C. Lees, J. Minet, C. Mitter, M. Mutanen,
J. C. Regier, T. J. Simonsen, N. Wahlberg, S.-H. Yen, Z. Zahiri, D. Adamski, J. Baixeras, D. Bartsch,
B. A. Bengtsson, J. W. Brown, S. R. Bucheli, D. R. Davis, J. De Prins, W. De Prins, M. E. Epstein, P.
Gentili-Poole, C. Gielis, P. Hättenschwiler, A. Hausmann, J. D. Holloway, A. Kallies, O. Karsholt, A.
Kawahara, S. Koster, M. Kozlov, J. D. Lafontaine, G. Lamas, J.-F. Landry, S. Lee, M. Nuss, C. Penz, J.
Rota, B. C. Schmidt, A. Schintlmeister, J.C. Sohn, M. A. Solis, G. M. Tarmann, A. D. Warren, S. Weller,
R. Yakovlev, V. Zolotuhin, A. Zwick 2011. Lepidoptera. Pp. 212—221.— Jn: Z.-Q. Zhang (ed.), Animal
biodiversity: an outline of higher-level classification and survey of taxonomic richness. Zootaxa 3148.
Auckland, New Zealand: Magnolia Press.
Sommerer, M. D. 2002. Opinion. To agree or not agree — the question of gender agreement in the International
Code of Zoological Nomenclature. — Nota lepidopterologica 25 (2-3): 191-204.
DONALD R. Davis
Nota lepid. 35 (2): 135-159 135
Bucculatrix ainsliella Murtfeldt, a new North American invader
already widespread on northern red oaks (Quercus rubra) in
Western Europe (Bucculatricidae)
ERIK J. VAN NIEUKERKEN !, CAMIEL DOORENWEERD!, WILLEM N. ELLIs!,
K.J. (HANS) HUISMAN*, J.C. (SJAAK) KOSTER !, WOLFRAM MEY,
Tymo S.T. Muus * & ARNOLD SCHREURS *
Naturalis Biodiversity Center, PO Box 9517, NL-2300 RA Leiden, Netherlands;
[email protected] (corresponding author)
Patrijzenlaan 4, NL-8091 BK Wezep, Netherlands
Leibniz-Institut für Evolutions- und Biodiversitätsforschung,
Invalidenstr. 4, DE-10115 Berlin, Germany
Hogewal 137, NL-8331 WP Steenwijk, Netherlands
Conventuelenstraat 3, NL-6467 AT Kerkrade, Netherlands
N
Ww
>
on
Received 28 June 2012; reviews returned 22 July 2012; accepted 9 August 2012.
Subject Editor: Jadranka Rota.
Abstract. Bucculatrix ainsliella Murtfeldt, 1905 is for the first time reported from Europe: the Netherlands,
Belgium, and adjacent Germany. DNA barcodes confirm its identity. It is the first North American lepidop-
teran species feeding on northern red oak Ouercus rubra ever found in Europe, and only the second North
American oak-feeding insect found in Europe. The species has regularly been found in the Netherlands
and northern Belgium since 2006, and in 2011 also in Nordrhein-Westfalen in Germany, adjacent to the
Dutch border, but the earliest records are from the Netherlands, Amersfoort in 1989 and 1990. Early stages,
leafmines, and the adult are described, illustrated, and diagnosed against oak-feeding Bucculatrix ulmella
Zeller, 1848 and other similar species. The biology and distribution are discussed. This species can be
abundant in Europe, but significant damage has not been observed.
Zusammenfassung. Bucculatrix ainsliella Murtfeldt, 1905 wird hier zum ersten Mal aus Europa gemel-
det. DNA Barcodes bestätigen die Identität. Die bisherigen Fundorte liegen in den Niederlanden, Belgien
und im angrenzenden Deutschland. Die in Nordamerika häufige Art lebt an Eichen (Quercus spp.), darun-
ter auch an Roteichen (Ouercus rubra). Nachdem bereits eine Blattlaus den Sprung über den Ozean ge-
schafft hat, ist B. ainsliella nun die zweite Insektenart, die jetzt in Europa an den bereits im 17. Jahrhundert
eingeführten Roteichen vorkommt. Die ersten Nachweise stammen von Amersfoort in den Niederlanden
und wurden 1989-1990 gemacht. In Belgien taucht die Art 2006 auf, und in Nordrhein-Westfalen wird
sie 2011 erstmals gefunden. Die Art ist mittlerweile in den Niederlanden und Belgien weit verbreitet und
häufig, jedoch ohne Schäden anzurichten. Die Beschreibung und Abbildungen von Larvenstadien, Puppen
und Blattminen werden vorgelegt und mit denen von B. ulmella Zeller, 1848 verglichen, die ebenfalls an
Eiche lebt. Biologie und Verbreitung der Art werden ausführlich diskutiert.
Introduction
Northern red oak (Ouercus rubra L.) was introduced into Western Europe at the end of
the 17" century and became an economically important and widely planted timber tree
in Central and Western Europe during the 19" and 20" century (Bauer 1953; Göhre &
Wagenknecht 1955; Goßner et al. 2009; Magni Diaz 2004). Many authors noted that the
number of insect species feeding on red oak in Europe is still very small and consists
mainly of relatively polyphagous species (Csöka & Szaböky 2005; Goßner & Brau
Nota lepidopterologica, 15.11.2012, ISSN 0342-7536
136 NIEUKERKEN et al.: Bucculatrix ainsliella Murtfeldt, a new North American invader
2004; Turéani et al. 2009). This is in sharp contrast to the very rich entomofauna on the
indigenous European deciduous oaks (in Northern and Western Europe mainly ©. robur
L. and ©. petraea (Matt.) Liebl.), on which hundreds of herbivore species are known to
feed (for Britain 423 species are cited: Kennedy & Southwood 1984; for Germany 699:
Brändle & Brandl 2001). The difference can probably be explained by the phylogeny of
the genus Quercus: the red oak belongs to a phylogenetically separate part of the genus
Quercus, the section Lobatae (commonly known as “red oaks’’), only known from the
New World, whereas all European deciduous oaks belong to the so called “white oaks”
(Quercus sensu stricto) that include both North American, European, and Asian species
(Manos et al. 1999). Both groups of oaks harbour different faunas in North America
(e.g,. Robinson et al. 2002), and in other studies it was shown that introduced oaks
belonging to the same taxonomic group as native oaks received a considerably higher
number of herbivores than oak species from different taxonomic groups (e.g., Connor
et al. 1980). In the late 20" century, the first, and hitherto only, North American insect
attacking Q. rubra was recorded from Europe, the aphid Myzocallis (Lineomyzocallis)
walshii Monell, 1879 (Hemiptera, Aphidoidea). It has since become invasive and prob-
lematic in city areas (Havelka & Stary 2007; Modic 2010; Osiadacz & Wieczorek
2006; Perez Hidalgo et al. 2009; Pons & Lumbierres 2010). As far as we know until
now, no species of Lepidoptera restricted to red oaks have been found in Europe. We
here report first records of the oak skeletoniser Bucculatrix ainsliella Murtfeldt, 1905
from the Netherlands, Belgium, and Germany.
One of us (KJH) collected Bucculatrix specimens in a light trap in his garden in
Wezep (Netherlands, province Gelderland) that he did not recognise and thus presented
to JCK for dissection and identification. Because he also could not recognise these
specimens as belonging to any species known from the Netherlands, photographs of
the male genitalia were sent to WM, who identified it as the North American spe-
cies Bucculatrix ainsliella in 2011. After that, we started looking for early life stages.
From the life history in its original distribution area, we knew we had to look for a
species likely feeding on Q. rubra, the only red oak that is commonly planted in the
Netherlands. The search started in Wezep, near KJH’s house, where ©. rubra is com-
mon. We found larvae and cocoons at two sites. After confirming the identity by breed-
ing adult moths from the larvae and cocoons, these findings prompted a press release on
13 July 2011 (http://www.naturalis.nl/nl/over-ons/pers/persberichten/201 1/eerste-ves-
tiging-amerikaanse-eikenmot-europa) and a short online story in Dutch on a website
for Microlepidoptera (van Nieukerken & Doorenweerd 2011).
Very soon after this media coverage, it became apparent that various records of this
species were already available as misidentified or unidentified records on national
observers’ websites (http://waarneming.nl/contact.php; http://waarnemingen.be/index.
php), and several collectors, including some of us, were able to record the species from
more localities after knowing where and what to look for. Finally, searching collection
holdings resulted in recognising several older specimens, including some from 1989
and 1990.
Bucculatricidae is a rather small family with 297 described species (van Nieukerken
et al. 2011), most belonging to the very uniform genus Bucculatrix Zeller, 1839. In
Nota lepid. 35 (2): 135-159 137
Europe, 55 species are known (Mey 2010), in North America more than 100 (Braun
1963; Opler 1974; Rubinoff & Osborne 1997), the majority feeding on Asteraceae.
Whereas there is only a single native Bucculatrix species feeding on oaks in Europe
(B. ulmella Zeller, 1848, a confusing name, since it does not feed on Ulmus), there are
at least 11 species associated with oaks in North America, which usually only feed on
a single Quercus species or a limited group of either white or red oaks (Braun 1963).
Most Bucculatrix species mine in their first larval instar, and later feed externally on
the parenchyma between veins, making small windows in the leaf. The ribbed cocoon
is one of the best characters and apomorphies for the genus. There is no single work
treating all European species, and only a few papers can be used for the identification
of a subset (Bengtsson & Johansson 2011; Langmaid et al. 2007; Mey 1999; Seksjaeva
1993; Svensson 1971), but a survey of European species is in preparation (Z. Tokar, per-
sonal information). All North American species are treated by Braun (1963), except the
few that were described later (Opler 1974; Rubinoff & Osborne 1997). Baryshnikova
(2008) provided the first phylogenetic analysis of the genus.
Material and Methods
Material
Specimens were either taken as adults collected at light, using various methods, or as
larvae or cocoons from Quercus rubra trees and shrubs. Later in the year, larvae and
cocoons were also found on fallen leaves, and cocoons were observed on tree trunks.
Rearing in small plastic containers proved easy for the summer generation, although
many parasitoids emerged as well. The material is either deposited in the collections
of the Naturalis Biodiversity Centre, Leiden, or in private collections. Many records
were identified from photographs provided by the observers. All data on specimens
and observations of B. ainsliella are given in Table 1, and for barcoded specimens
(also of other species) data are uploaded to the BOLD project “Lepidoptera of the
Netherlands — public [NLLA]” (http://www.barcodinglife.com), where also Genbank
Accession numbers can be found.
Morphological methods
Genitalia were dissected in the usual way (van Nieukerken 1985; Robinson 1976),
males were stained with phenosafranin and females with chlorazol black. Because the
valvae in the male genitalia of these species cannot be spread, we folded them down-
wards, whereas the socii remain in their posterior position (following Svensson 1971).
Photographs of moths, leafmines, genitalia slides, and wing slides were taken with a
Zeiss AxioCam digital camera attached, respectively, to a Zeiss Stemi SV11 stereo-
microscope, a motorised Zeiss SteREO Discovery.V12 or a Zeiss Axioskop H, us-
ing Carl Zeiss AxioVision software. In the field, various digital cameras were used.
Measurements of genitalia and mines were taken from photographs with AxioVision
software, and measurements of moths were taken with the stereomicroscope provided
138 NIEUKERKEN et al.: Bucculatrix ainsliella Murtfeldt, a new North American invader
with a calibrated eyepiece graticule. The distribution map was prepared with the pro-
gram “Klasse” (Anonymous 2011).
DNA barcoding
DNA was extracted destructively from larvae preserved in 96% ethanol or adult legs.
Extractions were carried out with the Qiagen DNeasy Blood and Tissue kit. A 658 bp
fragment of the mitochondrial COI gene was amplified using as primers Lep-F and Lep-R
(Hebert et al. 2004), often tailed with T7 promotor [TAATACGACTCACTATAGGG]
and T3 [ATTAACCCTCACTAAAG]. Amplification was performed in volumes of
25 ul. The PCR cycle consisted of 3 min initial denaturation at 94°C, 15 sec denatura-
tion at 94°C, 30 sec at 50°C, 40 sec extension at 72°C for 40 cycles. After completion
of all cycles, there was a final extension at 72°C for 5 min. A negative control with no
template was included for each series of amplifications. The amplified products were
separated on a 1% agarose gel and visualized under UV following staining with eth-
idium bromide before clean-up and sequencing.
PCR clean-up and bi-directional sequencing was outsourced to MACROGEN
Europe on an ABI 3730XL. The chromatograms were checked with Sequencher (Gene
Codes Corporation) and the resulting sequences were aligned by eye with reference
to amino acids in BIOEDIT 7.0.9.0 (Hall 2004). Neighbor-joining (NJ) trees based
on DNA barcode sequences of all available specimens, supplemented with publicly
available sequences of Bucculatricidae, were calculated with PAUP* 4.0b10 (Swofford
2003), using uncorrected P distance (Srivathsan & Meier 2012). Inter- and intraspecific
distances between the COI barcodes were calculated with the species delimitation plug-
in v1.04 by Brad Masters & Howard Ross for Geneious (Drummond et al. 2011).
Results
Bucculatrix ainsliella Murtfeldt Figs 1, 3-7, 13, 14, 17-19, 21-23, 26-30, 35
Bucculatrix ainsliella Murtfeldt 1905: 218. Holotype male: USA, Minnesota, Olmstead, cocoons, on/near
black oak [Quercus velutina], C.N. Ainslie, Type 65035 (USNM). [not examined]
B. ainsliella; Gibbons & Butcher 1961: 681 [biology], Braun 1963: 167 [redescription, taxonomy], Gelok et
al. 1999: 111 [recorded from British Columbia, phenology].
Material. See Table 1.
Diagnosis. Adults of Bucculatrix ainsliella can be distinguished from B. ulmella, the
other European oak-feeding species, by the more monochrome grey forewing with the
prominent elongate blackish brown spot on dorsum with white edging, the longer fore-
wings and the distinct separation of dark and pale areas in the frontal tuft. Further, B.
ainsliella is slightly larger. B. ulmifoliae (Hering, 1931) from U/mus is also rather simi-
lar, has a rather similar frontal tuft, but the dorsal spot is more square and often much
smaller, and the antennal annulation is regular. In living specimens, the spot in B. ain-
sliella is distinctly rounded and rendered more apparent by white edging. In European
collections, B. ainsliella specimens were misidentified as B. bechsteinella (Scharfen-
Nota lepid. 35 (2): 135-159 | 139
Figs 1, 2. Bucculatrix species reared from Quercus rubra, Wezep, adult habitus. 1. B. ainsliella, male,
RMNH.INS.544410. 2. B. ulmella, female, RMNH.INS.544416. Right antenna in Fig. 2 reconstructed
from left antenna. Scales 2 mm.
berg, 1805), B. demaryella (Duponchel, 1840), and even B. cidarella (Zeller, 1839).
These species have smaller dorsal spots than B. ainsliella and different antennal an-
nulation. Photographs on observers’ websites had been identified earlier as B. ulmella,
B. albedinella (Zeller, 1839) or B. noltei Petry, 1912. Among other European Buccu-
latrix specimens, B. ainsliella usually stands out by its larger wingspan and elongate
wings with the distinct spot. Annulation of antenna and legs also separate B. ainsliella
and ulmella from various other Palaearctic species. |
The male genitalia of B. ainsliella are large, bear a double row of cornuti in the bul-
bous basal part of the phallus, and the valva has a hooked apex. The male genitalia of
B. ulmella are much simpler and smaller, and those of B. ulmifoliae can be recognised
by the terminally hooked phallus and short socii (Fig. 16). Female genitalia are imme-
diately recognisable by the extremely long ductus bursae, several times longer than the
abdomen, presence of spines in ductus, and peculiarly shaped ostium and surrounding
sclerotisations.
Description. Adult (male, female) (Figs 1, 3—7). Forewing length 3.7—4.0 mm
(male), 3.4-3.9 mm (female), wingspan 7.6—8.8 mm (male), 7.6—8.4 mm (female).
Head: frons white, irrorate with some pale grey scales, vertex with tuft of hairscales
clearly separated in ferruginous central band and white lateral bands; neck tufts and
collar white; labial palpus hardly visible, white. Antenna with 56—62 segments in both
sexes; first flagellar segment strongly notched in male; scape dorsally white, irrorate
with greyish brown scales, ventrally shining white with greenish reflections, flagellum
dorsally greyish white, strongly annulated dark brownish grey, ventrally white, vaguely
annulated; annulation regular until 23 segments before tip, after that with characteris-
tic pattern as follows: segment formula (d=dark segment, w=white segment): 3d-1w-
Sd-1w-1d-1w-5d-1w-1d-4w (Fig. 7). Thorax and tegulae white, irrorate with greyish
brown scales, thorax with two dark brown posterior spots. Legs: white on inner side;
fore- and midfemur, -tibia and first segment of tarsus dark brownish grey with whitish
irroration on outer side; hindfemur: whitish with pale grey irroration; tarsus segments
2—4 of all legs white with dark brownish grey apical rings, tarsus segment 5 white,
apically tipped dark brownish grey, spurs dark greyish brown on outer side, white on
inner side. Forewing white, heavily irrorate with ochreous-grey to dark grey scales,
140 NIEUKERKEN et al.: Bucculatrix ainsliella Murtfeldt, a new North American invader
especially from fold to costa, a large blackish brown elongate spot on dorsum from just
before 1/2 to 2/5, in- and outwardly edged whitish, a blackish brown inward oblique
streak from costa at one-half to tornus, outwardly edged with white, tufts of raised
blackish brown scales at dorsum near base, at inner edge of elongate spot and at dorsal
end of inward oblique streak, two blackish brown cilia lines encircling apex, cilia pale
grey. Hindwing shining grey, cilia pale grey. Underside: forewing shining dark grey,
more ochreous towards apex, outer cilia line distinctly visible, hindwing shining grey.
Abdomen dorsally shining grey, laterally shining pale grey, ventrally shining white,
anal tuft white; abdomen in female widened posteriorly, covered with one broad anal
tuft; in male tapering, anal tuft smaller, not completely covering external genitalia.
Male genitalia (Figs 13-14). In size almost twice as large as genitalia of B. ul-
mella. Socii long and slender, setose, narrowing apically, tip rounded. Vinculum more
or less rounded, wider in the middle. Valva long (435—465 um), broad at base, narrow-
ing distally with narrowest part just beyond one-half, apex rounded and with a short
and slightly bent latero-ventral hook. Phallus long (ca. 650-730 um), bulbous at base,
distal part tubular, one and a half times length of basal part, slightly narrowing distally
and upwardly bent. Vesica with double row of eight long spiny cornuti.
Female genitalia (Figs 17-19). Anal papillae setose, posterior apophyses short,
anterior apophyses absent. Tergite 8 with centrally elevated group of special scales.
Ostium tubular, opening more or less triangular; connected laterally on sternum 8 to two
semicircular excavations, broadly connected in the middle. Ductus bursae narrow and
extremely long (almost 5 mm), coiled, ca. twice as long as abdomen, abruptly widen-
ing before entering corpus bursae and with anterior rows of spines, more or less along
midline. Corpus bursae elongate, signa forming ring around posterior half, comprising
rows of spined ribs, spines directed anteriorly.
Immature stages (Figs 21, 26-30). Larva. Early instar in mine yellow, with
brown head capsule and prothoracic plate (Fig. 21). Free-living larva up to 5 mm long
(Fig. 26), with pale yellowish green body; prothoracic and anal plates concolourous,
head slightly more pale brownish. Pinacula not distinguishable, major setae appearing
dark against light body. Rear end of the body tapering towards long anal prolegs (typi-
cal for the genus); the four abdominal prolegs relatively long. The free-living larvae are
easily distinguished from those of B. ulmella by the absence of colouration. Larvae of
B. ulmella are greyish green, with several indistinct darker longitudinal lines, and with
about eight whitish spots on each body segment. Pupa (Figs 28—30). Only exuviae were
studied (one on slide). Tenth abdominal segment (A10) with one pair of lateral tubercles,
similar to most Bucculatrix species, but unlike B. thoracella (Thunberg, 1794) which
has two pairs. Tergites A3-7 with 2—3 rows of rather coarse spines anteriorly, amidst a
strong network of microspines (Figs 29, 30). Macroscopically, T2 seems also to have an
indistinct row of spines, but this appears to be an indistinct row (or almost absent) when
studied in a slide under high magnification (Fig. 29). B. ulmella has only single rows of
large spines, none on T2, and the microspines are less strong (see also below).
Biology. Hostplants: Quercus velutina Lam. (eastern black oak) and Q. rubra L.
(northern red oak). Single records on chestnut oak (Quercus montana Willd.) (Drooz
Nota lepid. 35 (2): 135-159 141
Figs 3-12. Bucculatrix species, comparison between oak feeding species in mounted and live specimens.
3-7. B. ainsliella, female, Wezep, RMNH.INS.544411 (3 and 7), RMNH.INS.544412 (4-6). 8-12. B. ul-
mella, male, ‘t Harde, RMNH.INS.544414 (8-11), female, as Fig. 2 (12). 7 and 12 show aberrant antennal
annulation pattern, extra group of 3 dark segments in B. ainsliella arrowed. Some photos were mirrored
for reasons of comparison. Scales 1 mm, 2 mm (4), 0.5 mm (7 and 12).
1960, cited by Gibbons & Butcher 1961), a white oak, and chestnut (Castanea sp.)
(labels cited by Braun 1963) should be confirmed because of their different taxonomic
placement. Since cocoons can be placed on any surface, records of cocoons alone are
not sufficient proof for host records. In Europe only recorded from Quercus rubra.
Life history. The egg is deposited on the upperside of the leaf, adjacent to (but
never on) a major vein. The empty eggshell is oval in outline, and has a cockled sur-
142 NIEUKERKEN et al.: Bucculatrix ainsliella Murtfeldt, a new North American invader
face, making it iridescent under magnification. The mine (Figs 21-23) is a full-depth
gallery, more than 1 cm in total length (11—14 mm); except for the last few mm, the
gallery is strongly contorted. The sides are not straight but rather scalloped or jag-
ged. The larval exit is on the leaf underside. For most of its width, the gallery, larval
chamber excluded, is filled with lumpy, brownish-black frass. The mining larva does
not cross major veins. The mine itself is indistinguishable from that of B. ulmella, but
consistently longer in the few measured mines.
The free-living larvae window or skeletonise the underside of the leaves by consum-
ing the softer tissue between the minor veins. Skeletonised patches of several mm in di-
ameter in northern red oak leaves are a good indication of the presence of Bucculatrix,
but we are not sure how to discriminate between B. ainsliella and ulmella.
The larva makes two “moulting cocoons’, usually in vein axils on a leaf underside
and the final instar larva fashions an oval, ribbed cocoon, with 5—8 ribs, without a “pick-
et fence” (or palisade, see Braun 1963). Most cocoons lie adjacent to a major vein, at the
underside of the leaf, or at the leaf margin or the margin of a leaf hole. Unlike B. ulmella,
which has a somewhat dirty yellow cocoon, the cocoon of B. ainsliella is bright white.
Voltinism. In North America recorded as bivoltine: larvae occur from mid April to
early July and again from early August through mid-October. Cocoons of the first gener-
ation occur from late June to August, with moths flying from early July on, those of the
second generation from October. Hibernation occurs in the pupal stage, on fallen leaves,
trunks or other debris. Adults fly in spring mostly in April and early May, the summer
generation from early July to August, in southern localities in the US until September
(Braun 1963; Gelok et al. 1999; Gibbons & Butcher 1961). So far, the European records
fit this general pattern (Table 1). Adults were found on the wing from mid-April to early
October, thus a third generation might be a possibility.
Parasitoids. In the field, we very often observed cocoons with an exit hole of
a parasitoid (see e.g., Ellis 2012, photo of cocoon), but until now, only a few hyme-
nopterans have been reared from cocoons in Europe. They were all Ichneumonidae,
two specimens belonging to the subfamily Campopleginae, and one to the genus Gelis
Thunberg, 1827. The latter are often hyperparasitoids. In British Columbia and Canada
the majority of parasitoids were also Ichneumonidae, but many Chalcidoidea were
reared as well (Gelok et al. 1999).
From the native area of B. ainsliella the following parasitoids are recorded: Bra-
conidae: Pholetesor ornigis (Weed, 1887), Stiropius bucculatricis (Ashmead, 1889);
Eulophidae: Chrysocharis Forster, 1856 (unidentified species), Cirrospilus cinctithorax
(Girault, 1916), Cirrospilus flavicinctus Riley, 1883, Pnigalio maculipes (Crawford,
1913); and Eurytomidae: Eurytoma solenozopheriae Ashmead, 1887 (Yu 2012).
Distribution (Fig. 35). Widespread in eastern North America, from the southern end
of the Appalachians in South Carolina northward to the coastal area of New England,
Nova Scotia, west to Oregon and Minnesota (Braun 1963), introduced into British
Columbia in western Canada (Gelok et al. 1999).
Here, we record the species as new for Europe and currently found in The Nether-
lands, Belgium, and Germany. It is likely to be more widespread in Germany, and
Nota lepid. 35 (2): 135-159 143
Figs 13-16. Bucculatrix species, male genitalia. 13, 14. B. ainsliella, slides JCK7310 (= RMNH.INS.
544410), JCK3157. 15. B. ulmella, JCK1898. 16. B. ulmifoliae, slide JCK5549. Scales 200 um (13), 100 um
(15, 16), 50 um (14).
144 NIEUKERKEN et al.: Bucculatrix ainsliella Murtfeldt, a new North American invader
should be searched for in France, Denmark, and other countries. Details of the records
are presented in Table 1. The oldest specimens are from 1989-1990, and there is a gap
in records between the 1989-1990 findings from Amersfoort and those in the Veluwe
from 2003 onwards.
Damage. In North America, the species, known widely as the Oak Skeletonizer, can
have outbreaks which lead to damage: trees that sustain repeated attacks are weakened
and suffer crown thinning and die-back; ornamental trees appear especially vulnerable
(Gibbons & Butcher 1961; Hanson & Walker 2004; Solomon et al. 2000). The prepupal
larvae of B. ainsliella can be a nuisance when they are abundant because of their habit
of descending along a silken thread (Gelok et al. 1999) and/or spinning cocoons over
a variety of surfaces.
Remarks. The characteristic annulation of the antennae was also described by Braun
(1963), but slightly different (probably an observation error). The pattern we see is
constant in all specimens examined, and constantly different from B. ulmella that lacks
the first group of three dark segments. The annulation pattern may be an interesting
diagnostic character for the separation of Bucculatrix species. Braun described a com-
parable pattern for B. pomifoliella Clemens, 1860 and a slightly different one in B.
platyphylla Braun, 1963; an illustration of European B. demaryella shows a similar
pattern as well (Bengtsson & Johansson 2011).
Bucculatrix ulmella Zeller Figs 2, 8-12, 15, 20, 24, 25, 31-34
Bucculatrix ulmella Zeller 1848: 289. Syntypes: [GERMANY, POLAND]: Berlin, Glogau [Glogow], “an
Baumstämmen, besonders an Eichen” (types probably in London). [not examined]
Comparative notes. Adult (male, female) (Figs 2, 8-12) smaller than 2. ainsliella:
with forewing length ca. 3.1—3.4 mm, wingspan 6.7—7.6 mm. Antennal segments ca.
52-61, terminal segment formula: 5d-1w-1d-1w-5d-1w-1d-4w (Fig. 12), missing the
first group of three dark segments present in B. ainsliella; first flagellar segment in
male hardly notched. Head with tuft of scales completely ferruginous or yellow, only
some pale scales may be seen laterally, but not banded as in B. ainsliella. Forewings
with strong ochreous to ferruginous ground colour, black maculation variable, a squar-
ish dorsal spot usually present. Male genitalia (Fig. 15) small. Socii short and
triangular; valvae ca. 210-230 um long, without apical hook. Phallus a short tube
without cornuti. Female genitalia (Fig. 20) with short ostium, oval opening, no
semicircular excavations. Ductus bursae slender, only slightly longer than corpus bur-
sae, less than 1 mm long, without spines. Corpus bursae with signum comprising very
closely set spined ribs, with very long spines, directed anteriorly.
Immature stages (Figs 24, 31-34). Larva. The free-living larva is basically
greyish green, with several indistinct darker longitudinal lines, and with about eight
whitish spots on each body segment. Larva in mine yellow (Fig. 24). Pupa (Figs
32-34). A10 with one pair of lateral tubercles. Tergites A3-7 with a single anterior
row of rather coarse spines, in contrast to B. ainsliella that has 2—3 rows per seg-
Nota lepid. 35 (2): 135-159 145
Figs 17-20. Bucculatrix species, female genitalia. 17-19. B. ainsliella, slides JCK7744 (17) and JCK
7734 (18, 19). 20. B. ulmella, JCK7732. Scales 500 um.
ment. Microspines less conspicuous than in B. ainsliella. See also Patoëka & Turéani
2005.
146 NIEUKERKEN et al.: Bucculatrix ainsliella Murtfeldt, a new North American invader
Biology. Hostplants: Quercus faginea Lam., Q. petraea (Matt.) Liebl., O. pubes-
cens Willd., ©. robur L., ©. rubra L., ©. trojana Webb, and Castanea sativa Miller
(Ellis 2012).
Life history: Very similar to B. ainsliella. Mines (Figs 24, 25) in principle in-
separable, but smaller, with length of measured mines always less than 10 mm (ca. 8—
9 mm), both on Q. robur and Q. rubra. Cocoon dirty yellow.
Distribution. Throughout Europe where oaks occur, yet to be recorded from Spain,
Slovenia, Bosnia, Albania, and Bulgaria (Corley et al. 2006; Mey 2010).
Remark. The confusing name B. ulmella was suggested by Mann to Zeller (1848), who
quoted Mann (in litt.) as describing that hundreds of caterpillars went down on threads
from elms (U/mus) near Vienna. Zeller also quoted Mann’s description of the mine from
Ulmus. Zeller identified the moths that he found on oak trunks as the same species, an
understandable mistake, since the species that Mann described is probably B. ulmi-
foliae, a species externally rather similar to B. ulmella.
DNA barcodes
A neighbor-joining tree (Fig. 36) of DNA barcodes of our specimens of B. ainsliella
combined with some other species from the Netherlands, plus publicly available bar-
codes of Bucculatrix (http://www.barcodinglife.com), demonstrate the conspecifity of
Dutch and North American specimens. B. ainsliella is represented by 19 specimens,
five from the Netherlands [NLLA] and 14 from North America, which collectively
form a monophyletic cluster with an average (uncorrected) intraspecific distance of
0.7%. The Dutch specimens are represented by several haplotypes that are scattered
over this cluster. The closest neighbour to B. ainsliella in this dataset of COI barcodes,
which is lacking many species of Bucculatrix, is the North American B. canadensisella
Chambers, 1875 at an average distance of 7.9%. This distance can be considered as
relatively large for a distance to the nearest neighbour, when compared to other leaf-
mining Lepidoptera (e.g., van Nieukerken et al. 2012a). The average intraspecific dis-
tances in B. canadensisella are 1.1%. B. ulmella is the nearest neighbour to B. ainsliella
if the comparison is limited to European species, at an average distance of 8.0%. The
average intraspecific distances in the available B. ulmella are 0.5%. This makes the
identification of B. ainsliella by COI barcodes reliable.
Discussion
Lepidoptera on Quercus rubra
From the scarce literature data it appears that the northern red oak has a poor entomo-
fauna in Europe, with few oak specialists. Polyphagous external feeding caterpillars,
such as Tortricidae: Archips xylosteana (Linnaeus, 1758); Lasiocampidae: Malacosoma
Nota lepid. 35 (2): 135-159
Figs 21-26. Bucculatrix species, leafmines and larvae on Quercus rubra. 21-23, 26. B. ainsliella, Elmpt
(21, RMNH.INS.18752), Wezep, Engelandseweg (22, 23), Wezep, Patrijzenlaan (26). 24, 25. B. ulmella,
Wezep, Wezeper Hei, (24 = RMNH.INS. 18466). Scales 1 mm (22, 25), 2 mm (23, 26).
148 NIEUKERKEN et al.: Bucculatrix ainsliella Murtfeldt, a new North American invader
neustria (Linnaeus, 1758); Geometridae: Operophtera brumata (Linnaeus, 1758), Eran-
nis defoliaria (Clerck, 1759), Ectropis crepuscularia (Denis & Schiffermiiller, 1775),
and Colotois pennaria (Linnaeus, 1761); Notodontidae: Phalera bucephala (Linnaeus,
1758) and Thaumatopoea processionea (Linnaeus, 1758); and Erebidae (Lyman-
triinae): Lymantria dispar (Linnaeus, 1758), Calliteara pudibunda (Linnaeus, 1758),
Euproctis chrysorrhoea (Linnaeus, 1758), E. similis (Fuessly, 1775), and Orgyia anti-
qua (Linnaeus, 1758) have been recorded as defoliators on red oaks in Europe (Cséka
& Szaböky 2005; Göhre & Wagenknecht 1955; Goßner & Hausmann 2009). Leaf-
miners were rarely recorded, e.g., Tischeria ekebladella (Bjerkander, 1796) (Tischeri-
idae, Csöka & Szaböky 2005). While searching Bucculatrix mines in 2011, but also
earlier, we have observed several more specialised oak-feeding leafminers on Quercus
rubra, but usually in very low numbers, e.g., the Nepticulidae Stigmella roborella
(Johansson, 1971), S. cf. ruficapitella (Haworth, 1828), S. basiguttella (Heinemann,
1862), Ectoedemia albifasciella (Heinemann, 1871), and the Gracillariidae Caloptilia
sp., Acrocercops brongniardella (Fabricius, 1798), and Phyllonorycter lautella (Zeller,
1846). Only few of these were we able to rear, but since we did see completed mines,
we think it most likely that all of the above can utilise this host. Apart from the lepi-
dopteran leafminers, we also observed in June 2011 many old mines of the leaf-mining
weevil Orchestes quercus (Linnaeus, 1758).
During our survey on the “Veluwe” near Wezep, we found larvae and cocoons of
Bucculatrix ulmella (identity of mines proven by DNA barcodes) on Q. rubra at a
locality where this species is common on indigenous Quercus robur, and where both
trees grow intermingled. However, we have no evidence of the presence of B. ulmella
on Q. rubra elsewhere. Further observations are needed to determine if both species
occur syntopically more widely in Europe.
Quercus rubra has commonly been ignored by entomologists, because it is an exotic
tree. This has, no doubt, contributed to the delayed detection of B. ainsliella, which
has been present in Europe since at least 1989. Even though the general notion that ©.
rubra has a poor entomofauna in Europe is definitely true and can be explained by the
taxonomic separation between red and white oaks, it is also clear that there are gaps in
our knowledge. Hopefully, with this new knowledge entomologists will also give at-
tention to red oak trees so that a more complete record of insects associated with this
species in Europe can be obtained.
Import of Bucculatrix ainsliella
The oldest known records from Europe originate from Amersfoort, province of Utrecht,
the Netherlands. The (planted) forests in this area often consist entirely of Quercus
rubra. An accidental introduction of B. ainsliella, therefore, could easily have been
followed by establishment on its native hostplant. Close to Amersfoort is the former
US Air Force Base Soesterberg, only closed in 2008. It is conceivable that moths or
cocoons were transported by Air Force aircraft, or by military personal, living in this
area. Cocoons of the hibernating generation, spun over virtually any surface in the
vicinity of infested red oaks, including parked cars (Gelok et al. 1999), and which
are present for more than six months in any year, are the likely source of the intro-
Nota lepid. 35 (2): 135-159 149
Lits
RER
x
PS een
Ra Perens i
Figs 27—34. Bucculatrix species, cocoons and pupal exuviae of males. 27-30. B. ainsliella, Wezep, Enge-
landseweg, RMNH.INS.544410. 31—34. B. ulmella, ‘t Harde, RMNH.INS.544414. 29, 33. Details of spines
on T2 and 3. 30, 34. Details of spines on T6 and 7.
duction. However, it may also be a sampling artefact that our first records are from
near Amersfoort, and transport via containers on ships is another potential source of
the original introduction. For another North American leaf-mining moth in Europe,
Macrosaccus robiniella (Clemens, 1859) (as Phyllonorycter robiniella), it was sug-
gested that either transport by air or by freight containers was the most likely source
150 NIEUKERKEN et al.: Bucculatrix ainsliella Murtfeldt, a new North American invader
Table 1. Specimens and observations of Bucculatrix ainsliella in Europe.
Date
25-9-2011
| NL-DR [Bosco — 0
NL-DR | Havelterberg 18-7-2011
2 cocoons, several
mines
3 adults ep, 4 mines,
including 1 larva,
NL-DR |Lhee, Dwingelderveld, Lheederzand 19-8-2011
12 cocoons
NL-DR | Holtinge, Holtingerveld 21-7-2011
NL-FR 28-10-2011
NL-FR |Leeuwarden, Kleine Wielen 5-10-2011
NL-FR |Leeuwarden, Kleine Wielen 24-10-2011
Be NL-FR | Tytsjerk, Groot Vijversburg estate 24-10-2011
ae NL-GE | Beekbergen, Engeland 1-8-2011
ifemte | NL-GE | Beekbergen, Engeland 5-8-2011
cocoon on trunk of \
QO. rubra à
NL-GE | Beekbergen, Engeland 9-10-2011
1 male, 2 females
1 female e.p., 19-7-2011
cocoons,
4 coco
RMNHLINS.
18-9-2011
30-10-2011
15-7-2003
18-7-2005
16-7-2007
21-8-2010
15-8-2009
el 17-9-
RMNH.INS.
1 male JCK 7513 NL-GE | Wezep 20-8-2010
NL-GE |Zwolse Bos, Wezep-Heerde 18-7-2011
ne 410 NL-GE |Wezep, Engelandseweg 27-6-2011
Den All NL-GE | Wezep, Engelandseweg 27-6-2011
1 female Nr 412 NL-GE |Wezep, Patrijzenlaan 27-6-2011
> 250 cocoons, mines NL-LI |Brunssumerheide, Heikop 15-8-2011
NEE NL-LI |Meinweg, Elfenmeer 16-8-2011
EN Meinweg, Vlodrop Station 31-7-2011
Abbreviations of countries and provinces: BE — Belgium: AN — Antwerpen, LI — Limburg, OV — Oost-Vlaanderen,
WV — West-Vlaanderen. DE — Germany, Nordrhein-Westfalen. NL — Netherlands: DR — Drenthe, FR — Friesland,
GE - Gelderland, LI — Limburg, NB — Noord-Brabant, NH — Noord-Holland, OV — Overijssel, UT — Utrecht.
1 male | NL-GE |Wezep 21-8-2010
male | L} NE-GE |wezep 9) An
male | | NI-GE |Wezep DEN
coccons > TE aaa
zZ
Bi
q)
es
es)
@
=)
=)
©
D
©
10 cocoons
+150 mines, cocoons,
several © © ep
Nota lepid. 35 (2): 135-159 151
Table 1. Table continued.
Leg Method | Genitalia slide Latitude
T. Muus | 52.90006 6:22525
LE Cowes AT srl
J coll. Roosmalen
. van Roosmalen ose 52,811 6.248
J. Ebink 6.412
G. Sinnema DR 6.002
G. Sinnema Ra 5.886
G. Sinnema BETEN 5.886
G. Sinnema photograph * 33215 5.907
coll. Roosmalen.
coll. Roosmalen.
coll. Roosmalen.
L. Knijnsberg, J. van
Roosmalen & A. Wijker
L. Knijnsberg, J. van
Roosmalen & A. Wijker
J. van Roosmalen a
B
3:95
5-95
595
B
C. Geris
L. Knijnsberg, A. Wijker photograph * 524121 Su
RE coll. Ellis AD 5.86
. Wolschrijn | |JCK7744 Coll Wolschrijn | 52.2425 6.1084
. Wolschrijn ee
. Wolschrijn Sa Coll Wolschrijn | 52.2425 6.1084
. Wolschrijn liebe 4 Coll Wolschrijn | 52.2425 6.1084
. Wolschrijn ep Coll Wolschrijn | 52.2425 6.1084
JCK7310 52.4544 | 5.9847
H
JCK 7513 Coll Huisman 52.4544 5.9847
JCK7515 Coll Huisman 52.4544 5.9847
H
K.J. Huisman 5.9847
K.J. Huisman 5.9847
K.J. Huisman 5.9847
6.038
JCK7310 RMNH 52.45017 5.98397
52.45017 5.98397
coll Schreurs 50.928 6.006
coll Schreurs 31218 6.128
coll. Scheurs & 51.152 6.155
Seliger
7
Cc. Doorenweerd & E.J.
€. Doorenweerd & E.J.
< = [nn ne
SSeS |S AN esas =
5 > = Set wl oat le zZ
2925| mo} mo Is a3
Gon | Gon |= Se EE =
un n nm | =
Ao lao |B 5 | SUIS
> >
Cc. Doorenweerd & E.J.
Stiphout
A. Scheurs & R. Seliger
| | Coll Wolschrijn | 52.2425 6.1084
PI Pls
D
A |
M LE Zz,
BE IE Is
em (@)
o lo |
EIS Im
oa |w |e
x
o
a >
<
9
D
Method: al — at light, ep — reared from larva or cocoon.
* — details to be found at http://waarneming.nl/soort/view/211390
— details to be found at http://waarnemingen.be/soort/view/211390
*%*
152 NIEUKERKEN et al.: Bucculatrix ainsliella Murtfeldt, a new North American invader
Table 1. Table continued.
NL-OV 20-7-2011
NL-OV | Enschede, De Tip 24-7-2012
male
mines, 1 cocoon
19-4-2009
male
male
female
male
NL-UT | Amersfoort-Zuid 30-4-1990
NL-UT | Amersfoort-Zuid 5-8-1990
NL-UT | Amersfoort-Zuid 15-8-1990
NL-UT | Baarn, De Vuursche 7-5-2011
Registry #
2-7-2011
27.2009
49-2011
9-9-2009
13-8-2011
1-8-2011
28-2011
COCOONS
21-7-2010
11-7-2010
24-5-2011
27-6-2011
28-9-1989
oo |S le] © — ley | © |Q
Q./ OQ.) Qu. en en © |©
e|2|=3| € SJ 8 |e
ee le ot + °|5
>15
Nn
mine Soest - Monnikenbos 19-7-2012
29-7-2010
12-5-2006
1-5-2011
cocoons 10-9-2011
adult -
adult -
adult
50 cocoons
10 cocoons, heavily
parasited
adult
Several mines and
cocoons, 2 ep
cocoons, vacated
mines
cocoons, vacated
mines, | larva
27-9-2011
23-71-2010
3-10-2011
8-6-2011
BE-OV | Knesselare, Drongengoedbos 16-9-2011
BE-WV | Torhout, Groenhove area 0-7-2011
- 3
Elmpter Wald, near Dutch border 15-10-2011
Elmp, 2 km S, Dutch borderpole 938 | 16-10-2011
NL-NH | Amstelveen, Gaasperplaspark 2011
N
©
oO
I
Abbreviations of countries and provinces: BE — Belgium: AN — Antwerpen, LI — Limburg, OV — Oost-Vlaanderen,
WV — West-Vlaanderen. DE — Germany, Nordrhein-Westfalen. NL — Netherlands: DR — Drenthe, FR — Friesland,
GE — Gelderland, LI — Limburg, NB — Noord-Brabant, NH — Noord-Holland, OV — Overijssel, UT — Utrecht.
Nota lepid. 35 (2): 135-159 | 153
Table 1. Table continued.
Genitalia slide
[K.J.Huisman | ep | | CollHuisman | 51.152 6.155
T.Mus | a | | coll. Muus | 51.152 6.155
W. Wittland SR Tokär 607 coll. ÖZK 512152 6.155
V. Middelman & R. Vos | | | photograph * 51.182 6.046
(E. Clerx | al | | photograph* 51.143 6.002
eus | | | | 5077 38
W.N. Ellis os i ee coll Bilis 51.518 6.172
WN. Ellis FT. Ellis 31312 6.173
C. Doorenweerd, H. Dries RMNH 52.18958 529524
& T. Muus
C. Nolte | al | | photograph * 51.47 5.551
C.Note | al | photograph * 51.47 5.551
[C.Nolte | al | | photograph* | 51.48
[C.Nolte | al | | photograph* | 51.48
C. Doorenweerd &
T. Hakbijl ee | RNG si
es © | | | coll Muus | 52775 6.149
J.C. & P.M. Koster a a RN 72 152257 6.969
|G.Veurink | al | | photograph 52.523 6.049
K.N. Nieuwland JCK3157 RMNH 52.13881 | 5.38087
K.N. Nieuwland a | | RMNH | 5213881 | 5.38087
K.N. Nieuwland a | | RMNH | 52.13881_| 5.38087
K.N. Nieuwland [al |__| RMNH | 5213881 | 5.38087
| L. Knijnsberg, J. van coll. Roosmalen.
[H. Soetekouw | | | photograph 52.15 5.335
Ludwig Jansen light trap a photograph ** 31.172 5.143
a photograph + St 4.425
DR eee aes Photo rap 51.153 | 4.438
C. van Steenwinkel | | photograph ** 51.108 5.053
C. van Steenwinkel al | | photograph ** 31213 5.112
a Te photograph 51.167
H.Die. | al | | photograph** | 51.23 5.374
Eisayes coll. Snyers 50.933 Sn
lighttrap | | photograph** | 51.072 | 3.134
A. Scheurs & R. Seliger Fe | coll. Seliger 51.131 6.132
Method: al — at light, ep — reared from larva or cocoon.
* — details to be found at http://waarneming.nl/soort/view/211390
— details to be found at http://waarnemingen.be/soort/view/211390
2K
154 NIEUKERKEN et al.: Bucculatrix ainsliella Murtfeldt, a new North American invader
300
200
100
0 100 200
Fig. 35. Bucculatrix ainsliella, records in the Netherlands, Belgium and Germany. Red dot denotes first
record in 1989 in Amersfoort. For details see Table 1.
(Whitebread 1990). The fact that we found different COI barcode haplotypes even from
specimens at a single locality, suggests that multiple individuals have been imported.
With the current rate of transportation of goods and people between Western Europe
and North America and the ease with which B. ainsliella larvae can attach themselves
to almost any surface, in combination with the ideal habitat away from home that has
been created in Europe by widespread planting Q. rubra, it seems that it was only
Nota lepid. 35 (2): 135-159
0.02
155
MECO43-04 | Bucculatrix sexnotata|GU095578
MEC734-04 | Bucculatrix sexnotata | GU095579
MEC666-04 | Bucculatrix pomifoliella|GU095577
NLLAO04-11| RMNH.INS.544334 | Bucculatrix bechsteinella
PHLAD009-11|Bucculatrix demaryella|JN307283
NLLA001-11|RMNH.INS.540796 | Bucculatrix cidarella
NLLA002-11|RMNH.INS.540809] Bucculatrix cidarella
NLLEA743-12 | RMNH.INS.540938 | Bucculatrix cidarella
NLLAO03-11|RMNH.INS.540792 | Bucculatrix cidarella
PHLAC282-10|Bucculatrix ulmella |JF859885
NLLAO12-11|RMNH.INS.544330 | Bucculatrix ulmella
NLLAO08-11|RMNH.INS.544416 | Bucculatrix ulmella
NLLAOO9-11| RMNH.INS.544414 | Bucculatrix ulmella
NLLA010-11|RMNH.INS.18466 | Bucculatrix ulmella
NLLAO11-11|RMNH.INS.544332 | Bucculatrix ulmella
NLLEA1215-12 |RMNH.INS.544507 | Bucculatrix ulmella
LBCS062-07 | Bucculatrix ainsliella] FJ412219
LBCS437-07 | Bucculatrix ainsliella|FJ412218
MEC195-04 | Bucculatrix ainsliella| GU095560
MECB686-05 | Bucculatrix ainsliella | GU096245
MECB689-05 | Bucculatrix ainsliella|GU096250
MEC194-04 | Bucculatrix ainsliella| GU095559
MEC197-04 | Bucculatrix ainsliella| GU095561
NLLAOOS-11] RMNH.INS.544411| Bucculatrix ainsliella
MEC892-04 | Bucculatrix ainsliella| GU095563
MEC375-04 | Bucculatrix ainsliella | GU095562
MECB687-05 | Bucculatrix ainsliella | GU096246
MECB690-05 | Bucculatrix ainsliella| GU096247
NLLAOO6-11| RMNH.INS.544410| Bucculatrix ainsliella
NLLAO13-11| RMNH.INS.JCK.7310| Bucculatrix ainsliella
MEC893-04 | Bucculatrix ainsliella| GU095564
NLLA007-11|RMNH.INS.544412 | Bucculatrix ainsliella
MECB691-05 | Bucculatrix ainsliella | GU096249
MEC196-04 | Bucculatrix ainsliella| GU095558
MECB688-05 | Bucculatrix ainsliella| GU096248
NLLAO14-11| RMNH.INS.JCK.7513 | Bucculatrix ainsliella
PHLAC281-10| Bucculatrix thoracella | JF859884
MEC850-04| Bucculatrix polytita |GU095575
MEC895-04 | Bucculatrix polytita|GU095574
MEC888-04 | Bucculatrix polytita| GU095576
MEC899-04 | Bucculatrix polytita| GU095573
MECO41-04 | Bucculatrix canadensisella|GU095572
MEC437-04 | Bucculatrix canadensisella|GU095565
MEC591-04 | Bucculatrix canadensisella|GU095567
MEC812-04 | Bucculatrix canadensisella|GU095571
MEC421-04 | Bucculatrix canadensisella| GU095566
MEC643-04 | Bucculatrix canadensisella| GU095569
MEC620-04 | Bucculatrix canadensisella| GU095568
MEC665-04 | Bucculatrix canadensisella| GU095570
LBCS061-07 | Bucculatrix canadensisella|FJ412221
LBCS779-07 | Bucculatrix canadensisella|FJ412220
LEFIA1262-10|Ogmograptis scribula
LEFIA1263-10|Ogmograptis sp. 3
Fig. 36. Neighbor-joining tree of DNA barcodes of Bucculatricidae, using uncorrected P distance. The
Australian Ogmograptis scribula Meyrick, 1935 is used as outgroup. Red records are Dutch specimens of
B. ainsliella, green ones are from North America. The following are also North American species: B. sexno-
tata Braun, 1927, B. pomifoliella Clemens, 1860, B. polytita Braun, 1963, B. canadensisella Chambers,
1875. The remainder are European species. Details on vouchers of specimens with a “RMNH.INS” regis-
try number can be found in the BOLD project “Lepidoptera of the Netherlands — public [NLLA]” (http://
www.barcodinglife.com). Other public sequences are from other projects, and can be recognised here by
the added Genbank Accession number.
a matter of time before this American moth established itself in Europe. There are
ever-increasing examples of North American micromoths invading and successfully
156 NIEUKERKEN et al.: Bucculatrix ainsliella Murtfeldt, a new North American invader
establishing in Europe. Examples of recent introductions are in Heliozelidae: Antispila
oinophylla Van Nieukerken & Wagner, 2012 on Vitis (van Nieukerken et al. 2012b), a
species of Coptodisca on Juglans (Bernardo et al. 2012); in Gracillariidae: Parectopa
robiniella (Clemens, 1863) and Macrosaccus robiniella both on Robinia pseudoaca-
cia (Whitebread 1990), Phyllocnistis vitegenella Clemens, 1859 on Vitis (Posenato et
al. 1997); in Argyresthiidae: Argyresthia thuiella (Packard, 1871) on Thuja and other
Cupressaceae; and in Gelechiidae: Coleotechnites piceaella (Kearfott, 1903) on Picea
(Lopez-Vaamonde et al. 2010).
Risks?
In North America Bucculatrix ainsliella is known to have severe outbreaks from time
to time. Especially in British Columbia, where it is introduced, the species has become
a nuisance in urban areas due to its abundance, especially when prepupae balloon down
from trees and make their cocoons everywhere. In natural habitats, outbreaks are prob-
ably a natural phenomenon, followed by years of lower densities when parasitoid popu-
lations control their numbers. A similar alteration has been observed in the birch leaf
skeletoniser B. canadensisella on Betula species, which underwent several outbreaks
that lasted for two to three years (Friend 1927). In Europe, outbreaks are known from
the expanding native species B. thoracella on Tilia (Kuchlein & Frankenhuyzen 1994),
and we have observed similarly abundant ballooning larvae from Tilia trees in cities in
the Netherlands. Although B. ainsliella can be common in places in the Netherlands,
we have not yet seen an indication of an outbreak or indications of real foliar damage.
Many of the northern red oak trees where we found B. ainsliella on, were more visibly
damaged by caterpillars of indigenous polyphagous caterpillar and beetle species.
We urge forest entomologists and lepidopterists throughout Europe to look for this spe-
cies (adults, mines, or cocoons) in order to be able to more fully understand its range
expansion across the Palaearctic.
Acknowledgements
We are grateful to the many people who provided records or material: Eddy Clerx (Sint-Odiliénberg,
Netherlands), Sifra Corver (Aeugst Am Albis, Switzerland), Heidi Dries (Lommel, Belgium), Ewouth
Ebink (Leggeloo, Netherlands), Chris Geris (Bennekom, Netherlands), Tom Hakbijl (Naturalis, Leiden,
Netherlands), Ludwig Jansen (Ovifat, Belgium), Leo Janssen (Edegem, Belgium), Luc Knijnsberg
(Egmond aan den Hoef, Netherlands), P. M. Koster (Nieuw-Vennep, Netherlands), Carl Nolte (Nuenen,
Netherlands), John van Roosmalen (Alkmaar, Netherlands), Rudi Seliger (Schwalmtal, Germany), George
Sinnema (Leeuwarden, Netherlands), Hetty Soetekouw (Amersfoort, Netherlands), Chris Snyers (Wilrijk,
Belgium), Carina Van Steenwinkel (Meerhout, Belgium), Zdenko Tokar (Sala, Slovakia), Tom Vermeulen
(Daknam, Belgium), Gert Veurink (Zwolle, Netherlands), Arnold Wijker (Egmond aan Zee, Netherlands),
Wolfgang Wittland (Dalheim, Germany), Jacques Wolschrijn (Twello, Netherlands), Steve Wullaert
(Wielsbeke, Belgium). Kees van Achterberg (Naturalis, Leiden, Netherlands) is acknowledged for iden-
tification of the parasitoids. We thank Kees van den Berg (Naturalis, Leiden, Netherlands) for technical
assistance.
Nota lepid. 35 (2): 135-159 157
References
Anonymous 2011. Klasse [collection management software]. Version 1.1.42. — Amsterdam. Computer
programme. http://www.klasse-info.nl.
Baryshnikova, S. V. 2008. Systematics and phylogeny of the genus Bucculatrix (Lepidoptera: Buccula-
tricidae) with special attention to larval mode of life and trophic relationships. — Trudy Zoologicheskogo
Instituta Rossiskoy Akademii Nauk 312 (1-2): 95-113.
Bauer, F. 1953. Die Roteiche. — Sauerländer, Frankfurt am Main. 108 pp.
Bengtsson, B. A. & R. Johansson 2011. Fjarilar: Bronsmalar—rullvingemalar. Lepidoptera: Roeslerstammii-
dae-Lyonetiidae. — Nationalnyckeln till Sveriges flora och fauna (= Encyclopedia of the Swedish
Flora and Fauna), DE 1-13. ArtDatabanken, SLU, Uppsala. 512 pp.
Bernardo, U., R. Sasso, M. Gebiola & G. Viggiani 2012. First record of a walnut shield bearer Coptodisca
(Lepidoptera: Heliozelidae) in Europe. — Journal of Applied Entomology 136: 638-640. doi: 10.1111/j.
1439-0418.2011.01693.x.
Brändle, M. & R. Brandl 2001. Species richness of insects and mites on trees: expanding Southwood. —
Journal of Animal Ecology 70 (3): 491-504. doi: 10.1046/].1365-2656.2001.00506.x.
Braun, A. F. 1963. The genus Bucculatrix in America north of Mexico (Microlepidoptera). — Memoirs
of the American Entomological Society 18: 1—208. http://www.biodiversitylibrary.org/item/118941.
Connor, E. F., S. H. Faeth, D. Simberloff & P. A. Opler 1980. Taxonomic isolation and the accumulation
of herbivorous insects: a comparison of introduced and native trees. — Ecological Entomology 5 (3):
205-211. doi: 10.1111/1.1365-2311.1980.tb01143.x.
Corley, M. F. V., E. Maravalhas & J. P. d. Carvalho 2006. Miscellaneous additions to the Lepidoptera of
Portugal (Insecta: Lepidoptera). — SHILAP Revista de Lepidopterologia 34 (136): 407-427. http://
redalyc.uaemex.mx/sre/inicio/ArtPdfRed.jsp?iCve=45513611.
Csöka, G. & C. Szaböky 2005. Checklist of herbivorous insects of native and exotic oaks in Hungary I.
(Lepidoptera). — Acta Silvatica et Lignaria Hungarica 1: 59-72.
Drummond, A., B. Ashton, S. Buxton, M. Cheung, A. Cooper, C. Duran, M. Field, J. Heled, M. Kearse,
S. Markowitz, R. Moir, S. Stones-Havas, S. Sturrock, T. Thierer & A. Wilson 2011. Geneious. Version
5.4. - Computer programme. http://www.geneious.com.
Ellis, W. N. 2012. Bladmineerders van Europa / Leafminers of Europe. http://www.bladmineerders.nl/
index. htm.
Friend, R. B. 1927. The biology of the birch leaf skeletonizer, Bucculatrix canadensisella, Chambers. —
Connecticut Agricultural Experimental Station. Bulletin 288: 395-486. http://1a600602.us.archive.
org/Yitems/biologyofbirchle00frie/biologyofbirchle00frie.pdf.
Gelok, E., R. McGregor, D. Henderson & L. Poirier 1999. Seasonal occurrence and parasitism of Buccu-
latrix ainsliella (Lepidoptera: Lyonetiidae) on Quercus rubra in Burnaby, British Columbia. — Journal
of the Entomological Society of British Columbia 95: 111-116.
Gibbons, C. F. & J. W. Butcher 1961. The Oak Skeletonizer, Bucculatrix ainsliella, in a Michigan Wood-
lot. — Journal of Economic Entomology 54 (4): 681-684.
Gohre, K. & E. Wagenknecht 1955. Die Roteiche und ihr Holz. — Deutscher Bauernverlag, Berlin. 300 pp.
Goßner, M. & M. Bräu 2004. Die Wanzen der Neophyten Douglasie (Pseudotsuga menziesii) und Ame-
rikanischer Roteiche (Quercus rubra) im Vergleich zur Fichte und Tanne bzw. Stieleiche und Buche
in stidbayerischen Wäldern — Schwerpunkt arborikole Zönosen (Insecta: Heteroptera). — Beiträge zur
bayerischen Entomofaunistik 6: 217-235.
Goßner, M. M. & A. Hausmann 2009. DNA barcoding enables the identification of caterpillars feeding
on native and alien oak (Lepidoptera: Geometridae). — Mitteilungen der Miinchner Entomologischen
Gesellschaft 99: 135-140.
Goßner, M. M., A. Chao, R. I. Bailey & A. Prinzing 2009. Native fauna on exotic trees: phylogenetic con-
servatism and geographic contingency in two lineages of phytophages on two lineages of trees. — The
American Naturalist 173 (5): 599-614. doi: 10.1086/597603.
Hall, T. A. 2004. BioEdit sequence alignment editor. Version 7.0.1. — Isis Pharmaceuticals. Computer pro-
gramme. http://www.mbio.ncsu.edu/bioedit/bioedit.html.
Hanson, T. & E. B. Walker 2004. Field guide to common insect pests of urban trees in the Northeast.
Waterbury, VT: Department of Forests, Parks and Recreation. http://www.forestpests.org/vermont/
index.html.
158 NIEUKERKEN et al.: Bucculatrix ainsliella Murtfeldt, a new North American invader
Havelka, J. & P. Stary 2007. Myzocallis walshii (Hemiptera: Sternorrhyncha: Aphididae), an exotic inva-
sive aphid on Quercus rubra, the American red oak: Its bionomy in the Czech Republic. — European
Journal of Entomology 104 (3): 471-477. http://www.eje.cz/scripts/viewabstract.php?abstract=1256.
Hebert, P. D. N., E. H. Penton, J. M. Burns, D. H. Janzen & W. Hallwachs 2004. Ten species in one: DNA
barcoding reveals cryptic species in the neotropical skipper butterfly Astraptes fulgerator. — Proceedings
of the National Academy of Sciences of the United States of America 101 (41): 14812-14817. doi:
10.1073/pnas.0406166101.
Kennedy, C. E. J. & T. R. E. Southwood 1984. The number of species of insects associated with British
trees: A re-analysis. — Journal of Animal Ecology 53 (2): 455—478. http://www.jstor.org/stable/4528.
Kuchlein, J. H. & A. van Frankenhuyzen 1994. De kolonisatie door Bucculatrix thoracella (Lepidoptera:
Bucculatricidae) van Noordwest-Europa en speciaal van Nederland — Entomologische Berichten,
Amsterdam 54 (8): 145-153.
Langmaid, J. R., J. Porter & G. A. Collins 2007. Bucculatrix ulmifoliae M. Hering, 1931 (Lep.: Buccu-
latricidae) resident in England. — Entomologist’s Record and Journal of Variation 119 (9): 195-201.
Lopez-Vaamonde, C., D. Agassiz, S. Augustin, J. De Prins, W. De Prins, S. Gomboc, P. Ivinskis, ©. Karsholt,
A. Koutroumpas, F. Koutroumpa, Z. Laëtüvka, E. Marabuto, E. Olivella, L. Przybylowicz, A. Roques,
N. Ryrholm, H. Sefrova, P. Sima, I. Sims, S. Sinev, B. Skulev, R. Tomov, A. Zilli & D. Lees 2010.
Alien terrestrial arthropods of Europe, chapter 11. Lepidoptera. — BioRisk 4: 603-668. doi: 10.3897/
biorisk.4.50.
Magni Diaz, C. R. 2004. Reconstitution de l’introduction de Quercus rubra L. en Europe et conséquences
génétiques dans les populations allochtones. Sciences Forestières. — Paris, AgroParisTech ENGREF:
Xx111 + 429 pp.
Manos, P. S., J. J. Doyle & K. C. Nixon 1999. Phylogeny, Biogeography, and processes of molecular dif-
ferentiation in Quercus subgenus Quercus (Fagaceae). — Molecular Phylogenetics and Evolution 12
(3): 333-349. doi: 10.1006/mpev.1999.0614
Mey, W. 1999. Notes on some western Palaearctic species of Bucculatrix (Gracillarioidea, Bucculatrici-
dae). — Nota Lepidopterologica 22 (3): 212-226.
Mey, W. 2010. Fauna Europaea: Bedelliidae, Bucculatricidae, Galacticidae, Lyonetiidae. — Jn: O. Karsholt
& E. J. van Nieukerken (eds), Lepidoptera. Fauna Europaea version 2.4. Copenhagen, Amsterdam,
Paris. http://www.faunaeur.org.
Modic, S. 2010. Myzocallis (Lineomyzocallis) walshii, an invasive aphid on Quercus rubra, new to Slo-
venia. — Acta Entomologica Slovenica 18 (2): 163-167.
Murtfeldt, M. E. 1905. A new species of Bucculatrix. — Canadian Entomologist 37 (6): 218-219. http://
biodiversitylibrary.org/page/27877681.
Nieukerken, E. J. van 1985. A taxonomic revision of the western Palaearctic species of the subgenera
Zimmermannia Hering and Ectoedemia Busck s. str. (Lepidoptera, Nepticulidae), with notes on their
phylogeny. — Tijdschrift voor Entomologie 128 (1): 1- 164. http://biostor.org/reference/61076.
Nieukerken, E. J. van & C. Doorenweerd 2011. Bucculatrix ainsliella: een Amerikaanse mineerder op
Amerikaanse eik (Bucculatricidae). Bucculatrix ainsliella: an American leafminer on northern red oak
(Bucculatricidae). microlepidoptera.nl, Digitale gids voor de kleinere vlinders van Nederland. http://
www.microlepidoptera.nl/nieuws/art 2011.7.11.php.
Nieukerken, E. J. van, C. Doorenweerd, F. R. Stokvis & D. S. J. Groenenberg 2012a. DNA barcoding of
the leaf-mining moth subgenus Ectoedemia s. str. (Lepidoptera: Nepticulidae) with COI and EF 1-a:
two are better than one in recognising cryptic species. — Contributions to Zoology 81 (1): 1-24. http://
www.ctoz.nl/ctz/vol81/nr01/art01.
Nieukerken, E. J. van, D. L. Wagner, M. Baldessari, L. Mazzon, G. Angeli, V. Girolami, C. Duso & C.
Doorenweerd 2012b. Antispila oinophylla new species (Lepidoptera, Heliozelidae), a new North
American grapevine leafminer invading Italian vineyards: taxonomy, DNA barcodes and life cycle. —
ZooKeys 170: 29-77. doi: 10.3897/zookeys.170.2617.
Nieukerken, E. J. van, L. Kaila, I. J. Kitching, N. P. Kristensen, D. C. Lees, J. Minet, C. Mitter, M. Mu-
tanen, J. C. Regier, T. J. Simonsen, N. Wahlberg, S.-H. Yen, R. Zahiri, D. Adamski, J. Baixeras, D.
Bartsch, B. A. Bengtsson, J. W. Brown, S. R. Bucheli, D. R. Davis, J. De Prins, W. De Prins, M. E.
Epstein, P. Gentili-Poole, C. Gielis, P. Hättenschwiler, A. Hausmann, J. D. Holloway, A. Kallies, O.
Karsholt, A. Y. Kawahara, S. J. C. Koster, M. Kozlov, J. D. Lafontaine, G. Lamas, J.-F. Landry, S.
Lee, M. Nuss, K.-T. Park, C. Penz, J. Rota, A. Schintlmeister, B. C. Schmidt, J.-C. Sohn, M. A. Solis,
Nota lepid. 35 (2): 135-159 159
G. M. Tarmann, A. D. Warren, S. Weller, R. V. Yakovlev, V. V. Zolotuhin & A. Zwick 2011. Order
Lepidoptera Linnaeus, 1758. — In: Z.-Q. Zhang (ed.), Animal biodiversity: An outline of higher-level
classification and survey of taxonomic richness. — Zootaxa 3148: 212-221. http://www.mapress.com/
zootaxa/201 1/f/zt03148p22 1 .pdf.
Opler, P. A. 1974. Biology, ecology and host specificity of Microlepidoptera associated with Quercus agri-
folia (Fagaceae). — University of California Publications in Entomology 75: 1-83, pls 1-7.
Osiadacz, B. & K. Wieczorek 2006. Myzocallis (Lineomyzocallis) walshii Monell, 1879 (Hemiptera, Aphi-
doidea), an aphid species new to Poland. — Polskie Pismo Entomologiczne 75 (2): 233-238.
Patoëka, J. & M. Turéani 2005. Lepidoptera pupae: Central European species. — Apollo Books, Stenstrup.
862 pp. in 2 vols.
Perez Hidalgo, N., X. Espadaler & M. P. M. Durante 2009. Detected in Portugal Myzocallis (Lineomyzo-
callis) walshii (Hemiptera: Aphididae) on Quercus rubra. Detectado en Portugal Myzocallis (Lineo-
myzocallis) walshii (Hemiptera: Aphididae) sobre Quercus rubra. — Boletin de la Asociaciön Española
de Entomologia 33 (1-2): 263-265.
Pons, X. & B. Lumbierres 2010. A new problem in urban green areas: the aphid Myzocallis (Lineomyzocal-
lis) walshii (Hemiptera: Aphididae) and the American red oak (Ouercus rubra). Un nuevo problema en
espacios verdes urbanos: el pulgon Myzocallis (Lineomyzocallis) walshii (Hemiptera: Aphididae) y el
roble americano (Quercus rubra). — Boletin de Sanıdad Vegetal Plagas 36 (1): 45-59.
Posenato, G., V. Girolami & S. Zangheri 1997. La minatrice americana, un nuovo fillominatore della vite. —
L’Informatore Agrario 15: 75-77.
Robinson, G. S. 1976. The preparation of slides of Lepidoptera genitalia with special reference to the
Microlepidoptera. — Entomologist’s Gazette 27: 127-132.
Robinson, G. S., P. R. Ackery, I. J. Kitching, G. W. Beccaloni & L. M. Hernandez 2002. Hostplants of the
moth and butterfly caterpillars of America north of Mexico. — Memoirs of the American Entomological
Institute 69: 1 —-824. |
Rubinoff, D. Z. & K. H. Osborne 1997. Two new species of Asteraceae-feeding Bucculatrix (Bucculatrici-
dae) from California. — Journal of the Lepidopterists’ Society 51 (3): 227-236.
Seksjaeva, S. V. 1993. Review ofthe mining moths (Lepidoptera, Bucculatricidae) ofthe fauna of Russia. —
Trudy Zoologicheskogo Instituta 255: 99-120.
Solomon, J. D., F. I. McCracken, R. L. Anderson, R. Lewis Jr., F. L. Oliveria, T. H. Filer & P. J. Barry 2000.
Oak pests, a guide to major insects, diseases, air pollution and chemical injury. United States Depart-
ment of Agriculture, Forest Service, Southern Region, Southern Research Station. — http://www.fs.fed.
us/r8/foresthealth/pubs/oakpests/contents.html.
Srivathsan, A. & R. Meier 2012. On the inappropriate use of Kimura-2-parameter (K2P) divergences in
the DNA-barcoding literature. — Cladistics 28 (2): 190-194. doi: 10.1111/j.1096-0031.2011.00370.x.
Svensson, I. 1971. Scandinavian Bucculatrix Z. (Lep. Bucculatricidae). — Entomologica Scandinavica 2
(2): 99-109. doi: 10.1163/187631271x00112.
Swofford, D. L. 2003. PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods). Version 4.
Version 4.0b10. — Sinauer Associates, Sunderland, Massachusetts. Computer programme. http://paup.
csit.fsu.edu.
Turéani, M., J. Patoëka & M. Kulfan 2009. How do lepidopteran seasonal guilds differ on some oaks
(Quercus spp.) — a case study. — Journal of Forest Science 55 (12): 578-590.
Whitebread, S. E. 1990. Phyllonorycter robiniella (Clemens, 1859) in Europe (Lepidoptera, Gracillarii-
dae). — Nota Lepidopterologica 12: 344-353.
Yu, D. S. K. 2012. Home of Ichneumonoidea. — http://www.taxapad.com/index.php.
Zeller, P. C. 1848. Die Gattungen der mit Augendeckeln versehenen blattminirenden Schaben. — Linnaea
Entomologica 3: 248-344, pl. 2.
>
ee
Nota lepid. 35 (2): 161-179 161
New faunistic records for a number of Microlepidoptera,
including description of three new taxa from Agonoxenidae,
Depressariidae, and Gelechiidae (Gelechioidea)
Jan SuMPICH! & JAN SKYVA
| CZ-562 81 Ceska Béla 212, Czech Republic; [email protected]
2 Buzulucka 3, CZ-160 00 Praha 6, Dejvice, Czech Republic; [email protected]
Received 31 May 2012; reviews returned 8 August 2012; accepted 29 August 2012.
Subject Editor: Lauri Kaila.
Abstract. Faunistic data for 48 species of Microlepidoptera from Europe are provided. A total of 35 re-
cords are new for certain European countries. Four species are recorded for the first time in Europe:
Spiniphallellus desertus Bidzilya & Karsholt, 2008 (Gelechiidae), Hypsopygia almanalis (Rebel, 1917)
(Pyralidae), Pyrausta tithonialis Zeller, 1872, and Mecyna lutulentalis (Lederer, 1858) (both Crambidae).
Three new taxa are described: Agonopterix socerbi Sumpich, sp. n. (Depressariidae) from Slovenia,
Chrysoclista abchasica gabretica Sumpich, ssp. n. (Agonoxenidae) from the Czech Republic, and
Eulamprotes graecatella Sumpich & Skyva, sp. n. (Gelechiidae) from Greece. The previously unknown
female of Megacraspedus albovenata Junnilainen, 2010 (Gelechiidae) is also described. Xenopathia no-
vaki (Rebel, 1891) (Blastobasidae) is figured for the first time including genitalia of both sexes.
Introduction
Our collecting trips to various parts of Europe have yielded findings regarding a con-
siderable number of species that are noteworthy from ecological, faunistic or other
points of view. As the data available are insufficient for a detailed evaluation of the
lepidopteran fauna in the visited areas, we only provide the most interesting findings,
a number of which are first country records. Furthermore, we collected several speci-
mens that we could not identify as belonging to any known species. Based on their ex-
ternal appearance and the structure of the genitalia, these specimens differ sufficiently
from the currently known taxa that they can be considered as being new to science.
Here we describe these taxa.
Material and methods
The great majority of the material examined was collected at light. All the specimens
are deposited in our private collections, unless stated otherwise (the lıst of collections is
given below). The type material (including holotypes) is deposited in the collections of
the authors of descriptions, and in the future they will be moved to the Czech National
Museum in Prague. The nomenclature and the species distributions were taken from the
current version of Fauna Europaea (Karsholt & van Nieukerken 2011).
Nota lepidopterologica, 15.11.2012, ISSN 0342-7536
162 SumricH & Skyva: New Microlepidoptera records, with description of three new gelechioid taxa
Abbreviations
SU leg. et coll. Jan Sumpich, Ceska Béla, Czech Republic
SK leg. et coll. Jan Skyva, Prague, Czech Republic
ET leg. et coll. Jan LiSka, Prague, Czech Republic
NHMW Naturhistorisches Museum Wien, Austria
ZMUC Natural History Museum of Denmark, Copenhagen, Denmark
Results and discussion
TINEOIDEA: TINEIDAE
Elatobia fuliginosella (Lienig & Zeller, 1846)
Material. Portugal, Setubal distr., Pinhal Novo, 19 22-23.v111.1998, SU. Czech Republic, Lanzhot,
19 26.vi.2001, 19 28.v1.2006, 29 17—19.vi.2009, 19 9.vii.2011, 30 30.v—20.vi.2012, SU. Croatia, Pel-
jeSac penin., Zuljana, 10° 1-13.v11.2005, SU; OmiS env., Marusici, 30°, 29 3-17.v111.2008, SU. Russia,
Orenburg oblast, Donskoje env., Verbljushka Hill., 10° 22—24.vi1.2011, SU.
Distributed in Europe but a rare species in general. First country record for Croatia.
GELECHIOIDEA: DEPRESSARIIDAE
Agonopterix socerbi Sumpich, Sp. n. Figs 1-4
Material. Holotypus ©, Slovenia ‘Slovenia (SLO) | Crni kal — Socerb | 45°35'23"N 13°51'56"E |
6.7.2004 380m | Jan Sumpich leg.’, SU; — Paratypes: 19, same data as holotypus, SU; 29, ‘Wipach | 1854’,
‘ferulae coll Mn.’ <handwritten in black ink>, NHMW; 19, ‘Slovenija | Petrinnjski | kras | 11.8.2002 | Igt.
L. Srnka’, ‘Gen. pr. €. | 9666 | Det. I. Richter ©’, ‘Agonopterix | angelicella | det. Z. Tokar, 2006’, L. Srnka.
Description. A dul t (Figs 1, 2). Wingspan 15—17 mm. Head rust-coloured, frons ochre-
ous yellow. Antenna grey brown, filiform, in male slightly thicker at base and gradually
narrowing to apex. Labial palpi cream white, more or less mottled with brown on outer
and upper surface, segment 2 unicolourous light on inner surface. Thorax rust-coloured,
mottled with lighter and darker scales. Forewing ground colour rusty with a strong tinge
of brick-red; base of forewing and proximal half of costal area lighter, reddish; costa
lighter with irregular brown maculation; apex and outer margin of forewing darker, rusty
brown; termen with a row of indistinct darker spots; distinct distal white spot edged by
dark scales and surrounded by a large dark area; four black and white discocellular spots
that might not be obvious in some specimens. Legs yellowish, more or less dusted with
grey and brownish scales. Abdomen light, greyish. Hindwings light grey, paler basally.
Male genitalia (Fig. 3). Valva very broad at base, gradually narrowing to apex,
covered with short hair-like setae; cuiller slightly bent laterally, narrow, very long, with
mallet-like apex directed towards top of valva. Tegumen narrow and long; socii relative-
ly small, rounded; gnathos with elongate-oval culcitula. Juxta with two narrow, almost
pointed tips. Transtilla lobe very broad, square-like. Phallus narrow, slightly curved,
with pointed apex.
Nota lepid. 35 (2): 161-179 163
Figs 1-4. Agonopterix socerbi Sumpich, sp. n. 1. Male, holotype. 2. Female, paratype. 3. Male genitalia,
a: phallus. 4. Female genitalia, a: signum (enlarged).
Female genitalia (Fig. 4). Papillae anales narrow and long, as a whole large.
Ostium bursae small, circular; ductus bursae long, very narrow and only very slightly
broadening towards corpus bursae; corpus bursae very narrow, oval; signum oval with
short spines.
164 SumricH & Skyva: New Microlepidoptera records, with description of three new gelechioid taxa
Differential diagnosis. The newly described species is distinctive in having conspicu-
ous brick red colouration, and in combination with its characteristic structure of genita-
lia (especially in males having long cuiller exceeding the margin of valva) can be easily
distinguished from the hitherto known species of the genus Agonopterix Hübner, 1825.
Distribution. Only known from southwestern Slovenia.
Life history. Early stages and host plant unknown. We captured the moths at ultraviolet
light (fluorescent lamp 8W/12V) in open grassy steppes.
Derivatio nominis. Named after the type locality Socerb near Crni Kal in Slovenia.
Remarks. In the author’s (SU) collection this conspicuous species was kept among
unidentified species for a number of years as the author had not succeeded in finding
the proper name for thıs species ın the literature available. Collections of some major
European museums (e.g., London, Munich) were also examined for this species, and
two specimens were eventually found in the Vienna museum (NHMW), misidentified
as A. ferulae (Zeller, 1847).
GELECHIOIDEA: AUTOSTICHIDAE
Symmoca caliginella Mann, 1867
Material. Slovenia, 10, Osp, 26.1v.2002, SU; 39, Julijske Alpe, Mangart (1,600 m), 24.v11.1997, LI.
GELECHIOIDEA: AGONOXENIDAE
Chrysoclista abchasica gabretica Sumpich, ssp. n. Figs 5, 6
Material. Holotypus ©, Czech Republic ‘Bohemia mer.[idionalis] (CZ) | Sumava M[oun]t[ain]s. —
1195 m | Smréina — Seitz.[ova] cesta | 48°45’01”"N 13°55'41"E | 19.9.2005 | Jan Sumpich leg.’.
Description. Adult (Fig. 5). Wingspan 10.5 mm. Head and thorax grey with metal-
lic shine. Labial palpus covered with brown grey, shiny scales. Antenna filiform, grey
brown, paler at apex. Forewing ground colour light orange but with strong admixture
of brown scales. Forewing edged with dark scales that form dark areas at base, at apex
and at outer third of posterior margin of forewing. A narrow, straight and rather long
black streak, admixed with silver scales, extending from base of forewing to costal
spot. Costal spot circular, dark, with noticeable admixture of silver scales, other two
spots (with very few silver scales) evenly placed at inner margin of the wing. Hindwing
brown grey, narrow, pointed at apex. Legs light, dusted with brownish scales.
Male genitalia (Fig. 6). Very similar to those of Ch. abchasica abchasica, which
are illustrated in Sinev (1986) and Koster & Sinev (2003). Valva broad, evenly broadly
rounded at apex. Phallus narrow, moderately curved at 2/3 and ended with five thorn-
like protuberances; cornuti present, forming short row of beads. Branches of gnathos
ending with strongly sclerotised structures in the form of teeth. Anellus lobes very
well developed, shaped similarly to those of Chrysoclista zagulajevi Sinev, 1986 but
differing in apical structure — in Ch. zagulajevi the apex is irregularly toothed, in Ch.
abchasica gabretica ssp. n. with regular serrated teeth.
Nota lepid. 35 (2): 161-179 165
Figs 5-6. Chrysoclista abchasica gabretica Sumpich, ssp. n. 5. Male, holotype. 6. Male genitalia.
Female genitalıa. Unknown.
Differential diagnosis. The newly described subspecies is in habitus very similar
to Chrysoclista abchasica abchasica Sinev, 1986 described from Georgia (Western
Transcaucasia), from which it can be distinguished by features of genitalia; the easi-
est distinguishing feature is markedly different shape of anellus lobes, and also more
evenly rounded valva, bigger apical lobes of tegumen and rather different shape of
cornutus. However, as both taxa are known only from a single specimen and possible
variation within populations thus is unknown, we are hesitant to consider the new taxon
a new species at this stage.
Distribution. Known only from southern Bohemia (Czech Republic).
Life history. Unknown. The holotype was collected in a climax spruce stand in the
highest altitudes of the Bohemian Forest Mts (1,195 m a.s.l.).
Derivatio nominis. The subspecies name is derived from the Latin name of the moun-
tains where the type material was found (Gabreta = Bohemian Forest Mts).
Remarks. After having collected the holotype, an effort has been made in the same
locality to obtain further specimens but without any success. In the Czech Republic,
species of Chrysoclista are very rarely encountered in general: C. /athamella (Fletcher,
1936) and C. splendida Karsholt, 1997 have been found only as single specimens, for
C. linneella fewer than ten findings have been published. With respect to these difficul-
ties, the subspecies gabretica is thus described from this single specimen, as was the
case of the nominotypical subspecies.
GELECHIOIDEA: OECOPHORIDAE
Esperia sulphurella (Fabricius, 1775)
Material. Slovenia, 19, Crni kal, 26.iv.2002, SU.
The occurrence in Central Europe is documented only by very old records from Germany,
Austria, and Poland (Tokar et al. 2005). The present record is first for Slovenia.
166 SumricH & Skyva: New Microlepidoptera records, with description of three new gelechioid taxa
GELECHIOIDEA: COSMOPTERIGIDAE
Pyroderces klimeschi Rebel, 1938
Material. Italy, 19, Venice, Chiöggia, Rosapineta, 15-17.v.1992, SK. Czech Republic, Lanzhot,
10 29.v.2012, LI, 30° 22.v1.2012, SU. Slovakia, 19, Nova Vieska, 15.v11.1994, SK. France, 10°, Corsica,
Bastia-Poretta, Plage de Pineto, 12.v1.1993, LI.
A rare species distributed mainly in Central Europe, with very few published faunistic
data. New species for France (known only from Corsica).
GELECHIOIDEA: BLASTOBASIDAE
Xenopathia novaki (Rebel, 1891) Figs 7-10
Material. Croatia, Pirovac env., Tijesno, 29 15-17.v11.2003, 19, 19 6-12.v111.2007, SU; 10,
PeljeSac penin., Zuljana, 1 —-13.v11.2005, SU. Greece, 10°, Parga-Agia Kiriaki, 13.v111.2002, SK.
Described from a single male taken in the vicinity of Split (Rebel 1891). No further
findings have been published until now. As images of the species are not available else-
where, here we provide photographs of adults (Figs 7, 8), as well as figures of genitalia
of both sexes (Figs 9, 10). New species for Greece.
Blastobasis pannonica Sumpich & Liska, 2011
Material. Russia, 30°, Orenburg oblast, Kidriasovo, 20—21.vii.2011, SU.
Recently separated from Blastobasis phycidella (Zeller, 1839). The two species often
occur in sympatry. The distribution range of both taxa could be more exactly defined
only by a thorough review of the existing collection material. First country record.
GELECHIOIDEA: GELECHIIDAE
Megacraspedus albovenata Junnilainen, 2010 Figs 11, 12
Material. Slovakia, Stürovo env., Modry vrch Hill, 19 11.vii.1996, leg. I. Dvorak, coll. SU, 19
11—13.vii.1999, SU.
Recently described from the southern Urals (Orenburg area; in the current version of
Fauna Europaea, the area ‘Russia Central’ is incorrectly given). Soon afterwards re-
corded also in Central Europe, namely in the Czech Republic (Sumpich et al. 2011);
as the female was previously unknown and now females were found among numerous
specimens collected in the Czech locality (the vicinity of Znojmo), a description of the
female is included here. The present records are first for Slovakia.
Description. Fe male (Fig. 11). Body size and wing colour pattern agree with those
described for males in the original species description by Junnilainen & Nupponen
(2010). Females only differ in shape of forewing, which is more pointed apically and
more arc-shaped anteriorly than in males.
Nota lepid. 35 (2): 161-179 167
Figs 7-10. Xenopathia novaki (Rebel, 1891).
7. Male (12 mm). 8. Female (12 mm). 9. Male
genitalia. 10. Female genitalia, a: signum (en-
larged).
Female genitalia (Fig. 12). Papillae anales broad, large, as long as apophyses
anteriores. Apophyses anteriores strong, relatively short, approximately 2.6 times short-
er than apophyses posteriores. Ostium bursae triangular, sclerotised on sides, pointed
proximally. Ductus bursae slightly broadening towards corpus bursae. Corpus bursae
almost spherical; signum square-shaped with irregularly cut-out margins, folded diago-
nally at about 30° angle and scaly sclerotised on inner side.
168
Figs 11-12. Megacraspedus albovenata Junnilai-
nen, 2010 (Czechia, Je¢menisté near Znojmo, 11.vi.
2011, J. Sumpich leg.). 11. Female. 12. Female gen-
italia, a: signum (enlarged).
Eulamprotes graecatella Sumpich & Skyva, sp. n.
Sumpicu & Skyva: New Microlepidoptera records, with description of three new gelechioid taxa
Aristotelia decoratella (Staudinger, 1879)
Material. Slovakia, Slovensky kras, PleSivec-
Dulova, 20, 29 10.viii.2010, LI; 19 7—9.vii.2011,
LI. Croatia, 20°, Biograd, 5-12.v11.2003, SU; 5,
19, Pirovac env., Tijesno, 6—12.viii.2007, SU; 19,
19, Peljesac penin., Zuljana, 1—13.vii.2005, SU.
Greece, 19, Peloponnes penin., Chelmos, 9-10.
vili.2002, SK; 19, Peloponnes penin., Diakoft,
8-9.v111.2002, SK; 10, Kastoria distr., Vissinea,
10.v11.2005, SK. Bulgaria, 19, Sandanski, 29-31.
vill. 1978, SK.
Widespread in Southern Europe. From the
Balkan Peninsula reported from Bulgaria,
and single records from Greece and Croatia
are included in Elsner et al. (1999), where
by mistake ‘Spalato’ [= Split], a Croatian
locality, was by mistake considered to be
Italian. Considering the shortage of pub-
licly available records (the occurrence in
Greece and Croatia is not mentioned in the
current version of Fauna Europaea), we
have added a few of our own findings here.
Metzneria littorella (Douglas, 1850)
Material. Slovenia, 19, Kozina env., PreSnica,
20.vi.2011, SK; Tublje pri Hrpeljach, 19 1.vi.1998,
SK, 29, 19 24.v.1999, SK et LI; Crni kal — Socerb,
19 2.vi.1998, SK, 70°, 49 23.v.1999, SK et LI.
Distributed in Western Europe, also re-
corded in Russia and Cyprus. First country
record for Slovenia.
Monochroa palustrella (Douglas, 1850)
Material. Greece, 39, Mesangala, 6.vi.2006,
leg. J. Prochazka, coll. SK.
Previously known only from more north-
ern parts of Europe, from Great Britain
through Central and Northern Europe to
Russia. First record from the Balkans, a
new species for Greece.
Figs 13-16
Material. Holotypus ©, Greece ‘Hellas | Igoumenitsa | 5km west, 10 m | 28.6.2001 | J. Skyva lgt.’ coll.
SK. — Paratypes: 10°, 19, same data as holotypus, Q in coll. SK, © in coll. SU; 19, ‘Greece | Plataria | 12
km S Iguminitsa, 5 m | 29.vii.1977 | M. Fibiger leg.’, ZMUC; 1, ‘Greece | Evro, Kavisos, 100 m | 22.—23.
vili.1985 | M. Fibiger leg.’, “GU 86/422’ <genitalia slide P. Huemer>, ZMUC.
Nota lepid. 35 (2): 161-179 169
Figs 13-16. Eulamprotes graecatella Sumpich & Skyva, sp. n. 13. Male, holotype. 14. Female, paratype.
15. Male genitalia. 16. Female genitalia.
Description. Adult (Figs 13, 14). Wingspan 10 mm in males, 12 mm in females.
Head brown-grey. Segment 2 of labial palpus brown, with pale apex; last segment
light, on inner and outer side covered with band of brown scales. Antenna brown-grey,
filiform. Legs brown, joints paler on tips. Forewing dark grey-brown with four light,
170 Sumpicu & Skyva: New Microlepidoptera records, with description of three new gelechioid taxa
Figs 17-18. Spiniphallellus desertus Bidzilya & Karsholt, 2008 (Russia). 17. Male (17 mm). 18. Female
(18 mm).
whitish spots (without any shiny silver scales), less distinct in female. First spot con-
necting costa with hindmargin of wing near wing base, two spots placed on costa (one
in middle of wing and one near apex), last spot at inner margin of distal part of the
wing. Hindwings, as well as fringes of both wings, brown grey.
Male genitalia (Fig. 15). Uncus narrow, distinctly concave at apex, with two
long setae. Valva hammer-shaped apically, apex rounded in cranial direction, elon-
gated in caudal direction. Sacculus small, rounded, covered with tiny setae. Saccus
long, broader at base, tapering towards pointed apex. Phallus bulbous, without spines.
Bulbus ejaculatorius very long, narrow, moderately broadening to apex. Segment VIII
with pair of long coremata.
Female genitalia (Fig. 16). Apophyses posteriores long, 1.6x longer than apo-
physes anteriores. Ostium bursae narrow, membranous; antrum narrow, long, moder-
ately sclerotised, in lower part with tiny line-like sclerites. Ductus bursae membranous,
long, moderately broadening towards corpus bursae, twisted in lower half, distinctly
sclerotised at entry of ductus seminalis. Corpus bursae very slightly oval, signum as a
pointed spike hidden under half-sphere shelter.
Differential diagnosis. Eulamprotes graecatella sp. n. resembles in wing pattern some
other species of Eulamprotes Bradley, 1971 by having white spots on dark ground, e.g.,
E. wilkella (Linnaeus 1758); however, the new species differs by having a longitudinal
spot near base of forewing connecting costa with hindmargin of wing (in other species
this spot does not reach the wing margin). The unique features by which it can be dis-
tinguished from all other congeners are the shape of valvae and the apex of uncus with
two long setae in the male, and the form of antrum and signum in the female.
Distribution. Greece.
Life history. Early stages and host plant unknown. The moths were taken in a salt
marsh by the sea coast at the end of June.
Derivatio nominis. The species name is derived from the name of the country from
which it is described, i.e. Greece.
Spiniphallellus desertus Bidzilya & Karsholt, 2008 Figs 17, 18
Material. Russia, 70°, 179, Orenburg oblast, Kidriasovo, 21.vi.2009, SU; 20°, Cheliabinsk oblast,
Orenburg oblast, Donskoje env., Verbljushka Hill., 24—28.vi.2009, SU; 30°, Cheliabinsk oblast, Kizilskoye,
20.v1.2009, SU.
Nota lepid. 35 (2): 161-179 71
7
20
Figs 19-20. Males. 19. Ornativalva heluanensis (Debski, 1913) (Greece, 12 mm). 20. Gladiovalva aizpu-
ruai Vives, 1990 (Russia, 17 mm).
Recently described from Uzbekistan, Turkmenistan, and Kazakhstan (Bidzilya &
Karsholt 2008). New species for Russia as well as for Europe.
Ornativalva heluanensis (Debski, 1913) Fig. 19
Material. Spain, Alicante distr., Santa Pola, 50, 79 26-27.1x.2005, 19, 29 12.v1.2007, SU; 4¢,
Alicante distr., Salinas, 25.1x.2005, SU; 19, Almeria distr., Nijar, 13 —14.vi.2007, SU; Cabo de Gata, Retanar,
30.v11.2005, leg. V. Cervenka, coll. SK. Greece, Igoumenitsa, 70, 29 9.v.2002, 40, 119 14.v111.2002, 130°,
49 5.v11.2005, 60°, 59 14.v11.2005, 19 5.v111.2005, SK; 10°, Mesangala, 6.v1.2006, leg. J. Prochäzka, coll. SK.
Occurring from the Iberian Peninsula to Russia; from the Balkans previously known
only from the Croatian coast. New species for Greece.
Gladiovalva aizpuruai Vives, 1990 Fig. 20
Material. Czech Republic, Bohemia, Cirkvice, 20 17.v11.2004, leg. M. Zemlicka, coll. SU, 180
14.v11.2010, leg. M. Zemlicka, coll. SU; 2¢, 19, Moravia, Lanzhot, 9-23.v11.2005, SU; 19, Moravia,
Bzenec-Väte pisky, 31.v11.2003, LI. Greece, 19, Kastoria distr., Vissinea, 10.v11.2005, SK. Russia, 10,
Orenburg oblast, Kidriasovo, 20—21.v11.2011, SU; 29, Cheliabinsk oblast, Moskovo, 15—18.v11.2011, SU.
Previous published records only from Spain, from where it was described, and from
Central Europe (Czech Republic, Slovakia, and Hungary). New species for Greece and
Russia.
Xenolechia pseudovulgella Huemer & Karsholt, 1999
Material. Greece, 19, Parga, Agia Kiriaki, 13.viii.2002, SK; 19, Peloponnes penin., Diakoft6, 19—25.
vi.2001, SK.
Described from Greece and Turkey (Huemer & Karsholt 1999). Present records are the
only published data apart from the type localities.
Istrianis femoralis (Staudinger, 1876)
Material. Slovenia, Osp, 120°, 29 2.v.2002, SU, 19, 29 28.vi.2002, SU, 29 26.v.2001, LI, 39,
19 26.iv.2002, LI, 19 25.viii.2011, LI; 29, Crni kal, 24.vii.1997, LI. Croatia, 220°, 189, Island of
Pag, Novalja — Potoënica, 26—30.viii.2001, SU; 10°, 19, Omi8 env., Maruëiéi, 3—17.viii.2008, SU; 30,
Pirovac env., Tijesno, 6—12.viii.2007, SU.
Distributed in Southern and Southeastern Europe, also recorded from Ukraine. New
species for Slovenia.
172 SumpicH & Skyva: New Microlepidoptera records, with description of three new gelechioid taxa
Figs 21-22. Schneidereria pistaciella Weber,
1957. 21. Male (8 mm). 22. Female (8.5 mm).
Fig. 23. Altenia elsneriella Huemer & Karsholt,
1999, male (Croatia, Island of Pag, 11.5 mm).
Schneidereria pistaciella Weber, 1957 Figs 21, 22
Material. Croatia, 30°, 119, Omis env., MaruSici, 3— 17.v111.2008, SU; 20°, 29, Pirovac env., Tijesno,
6-12.v111.2007, SU; 19, Biograd env., Turanj, 22-27.v111.2004, SU.
Described from specimens collected ın Syria (Damascus) (Weber 1957). Recently
also recorded in Europe, namely in Ukraine, Cyprus, and Greece (Huemer & Karsholt
2001). New species for Croatia.
Altenia elsneriella Huemer & Karsholt, 1999 Fig. 23
Material. Croatia, 10, Island of Pag, Novalja — Potoënica, 26-30.v111.2001, SU; 30°, 19, Island of
Krk, Risika, 25—29.vi.2000, LI. Greece, 19, Peloponnes penin., Diakoftö, 3—6.v.2002, SK.
Previously known only from type localities in Croatia, Greece, and the Republic of
Macedonia (Huemer & Karsholt 1999), found also on the Island of Krk (Habeler 2003).
Here, additional findings from Croatia and Greece are presented.
Streyella anguinella (Herrich-Schäffer, 1861)
Material. Slovenia, 40, 19, Podgorje env., Debeli hrib, 8.vii.2006, SK; Spain, 40°, Almeria, Sierra de
los Filabres, Alto del Calar del Gallinero, 17—18.vi.2007, SU. Russia, 10°, Orenburg oblast, Kidriasovo,
21.v1.2009, SU.
Widespread mainly in Eastern and Southeastern Europe and also in Near East coun-
tries. From Western Europe only known from Spain, in Central Europe only known
from recent records in Hungary. New species for Slovenia.
Caryocolum klosi (Rebel, 1917)
Material. Slovenia, 19, Trnovski Gozd Mts, Predmeju env., 29.vi.2002, SU; 19, Nanos Mts, Podnanos
env., 7.v11.2006, SK.
Nota lepid. 35 (2): 161-179 73
24
Figs 24-25. Stomopteryx basalis Staudinger, 1876 (Croatia). 24. Male (14 mm). 25. Female (17 mm).
Distributed largely in Central Europe, also recorded from France, Romania, and Greece
(Karsholt 2005). First country record.
Stomopteryx basalis (Staudinger, 1876) Figs 24, 25
Material. Croatia, 170, 79, Omis env., Marusici, 3-17.v111.2008, SU; Pirovac env., Tijesno, 20
15-17.v11.2003, 19 23.v111.2004, 150°, 49 6-12.v111.2007, SU; 60, 29, Peljesac penin., Zuljana, 1-13.
vii.2005, SU; 19, Biograd env., PakoStane, 15- 17.v11.2003, SU.
Known from scattered localities in Southern Europe, previously reported from Croatia
only from the Island of Krk (Habeler 2001).
Nothris congressariella (Bruand, 1858)
Material. Spain, 10, Aragon, Albarracin, 19.vi.2007, SU; 10, Huelva, Coto de Donana, Matalascañas,
24.v.1999, leg. M. Dvorak, coll. SU. Croatia, 150, 119, OmiS env., MarusSici, 3-17.v111.2008, SU.
Greece, Peloponnes penin., Kamares, Ano Salmonikos, 10 6.v.2002, 19 22.x.2003, SK.
Known from Western, Southern and Southeastern Europe.
Anacampsis populella (Clerck, 1759)
Material. Greece, 19, Mesangala, 8.vi.2006, leg. J. Prochäzka, coll. SK.
Widespread throughout Europe but previously not known from Greece. First country
record.
Dichomeris rasilella (Herrich-Schäffer, 1854)
Material. Spain, Teruel distr., Albarracin, 10 4.vii.2004, leg. J. Prochäzka, coll. SK, 10 23.ix.2005,
SU; 10°, Zaragoza distr., Castej6n de Monegros, 10.vi.2007, SU. Hungary, Orkény, 19 26.vii.1983,
SK, 19 22.vi.1989, SK, 29 16—17.viii.2000, SK et LI, 19 13.vii.2002, SK, 20°, 29 16.vi.2006, SK,
15S, 29 16.1x.2005, SU, 19 16.ix.2006, SK, 49 27.vii.2007, SK. Czech Republic, 19°, Bohemia,
Mila, 27—28.v.1993, SK; 40°, Bohemia, Rana, 27.v.1993, SK; 10, 29, Bohemia, Stroupeë, 19.vi.1998,
SK; Bohemia, Bivany — Piseény vrch, 19 21.vii.1995, SK, 30° 7.vi.2003, SU, 49 26.vii.2004, SU, 10
18.v1.2005, SU; 19, Moravia, Pälava Hills, Dévin, 9.ix.2005, SU. Slovakia, 10°, Chleb, 14.ix.1994, SK;
19, Kamenin, 1 0.vii.1994, SK; 10°, Kamenica nad Hronom-Cenkov, 5.ix.1991, LI; 10, Slovensky kras
Karst, Plesivec-Dulova, 7—9.vii.2011, LI. Greece, 19, Mesangala, 8.vi.2006, leg. J. Prochazka, coll. SK.
Bulgaria, 19, Belograd£ik, 22.v.1977, SK.
Widely distributed but within Europe more common only in its western part (mainly
in Spain) and in a limited number of localities in Central Europe (Hungary, northern
174 Sumpicu & Skyva: New Microlepidoptera records, with description of three new gelechioid taxa
Bohemia). Previously not known from Southeastern Europe; new species for Greece
and Bulgaria.
TORTRICOIDEA: TORTRICIDAE
Phtheochroa reisseri (Razowski, 1970)
Material. Croatia, 19, Sen] distr., Sveti Juraj, 29.1v.2002, SU. Bulgaria, 19, Arkutino, 30.v—1.vi.
1977, SK.
Described from Crete (Omalos). Later recorded only in southern France (Briançon
env.) (Huemer & Luquet 1991) and Croatia (Island of Krk) (Habeler 1998). New spe-
cies for Bulgaria.
Cochylimorpha hilarana (Herrich-Schäffer, 1851) Figs 26, 27
Material. Greece, 20, 99, Piéria, Kalivia Varikou, 18.v111.1996, SK.
In Europe widely distributed but previously no record was published from the Balkans.
Concerning the material we examined, the collection date as well as the smaller wing-
span, which does not exceed 14 mm, indicate that they likely belong to the second gen-
eration (in Central and Northern Europe the species has only one generation). Having
compared these Greek specimens with those from the Czech Republic, the Greek moths
appear to have a paler colouration, which is particularly obvious in hindwings (they
are whitish in both sexes). No demonstrable differences were found in genitalia. New
species for Greece.
Pelatea klugiana (Freyer, 1836)
Material. Slovenia, 19, Nanos, Strmec (700 m), 25.v.2001, LI. Bulgaria, 19, Belograd£ik, 22.v.1977, SK.
Distributed from Spain through Central Europe to Russia where it was discovered only
recently (Nedoshivina & Zolotuhin 2005). Its presence in the Balkans, namely Croatia,
is mentioned only by Razowski (2003). New species for Bulgaria.
Epinotia nigristriana Budashkin & Zlatkov, 2011 Fig. 28
Material. Greece, 100°, 39, Thrakia, Kirki distr., Kassitera env., 8-9.x1.2011, SK et SU.
Very recently described from southwestern Bulgaria, where it was found on dry, rocky
steppes (Budashkin & Zlatkov 2011). Our material from Greece came from forests with
deciduous oak species (predominantly with Quercus pubescens) where the moth was
quite abundant despite very low night temperatures. This species has very likely been
overlooked due to the very late adult flight (October to November) but locally it may
be abundant; that is why a wider distribution can be expected in Southeastern Europe.
New species for Greece.
Eucosma caliacrana (Caradja, 1931)
Material. Bulgaria, Arkutino, 19 7-9.IX.1978, SK, 29, 29 16.VIII.1982, LI.
Nota lepid. 35 (2): 161-179 175
28 29
Figs 26-29. Adults of Tortricidae. 26-27. Cochylimorpha hilarana (Herrich-Schäffer, 1851) (Greece).
26. Male (15 mm). 27. Female (12 mm). Fig. 28. Epinotia nigristriana Budashkin & Zlatkov, 2011, male
(Greece, 17 mm). Fig. 29. Rhyacionia hafneri (Rebel, 1937), male (Russia, 17.5 mm).
A rare species known from Eastern Europe, with a limited number of publicly available
records.
Rhyacionia hafneri (Rebel, 1937) Fig. 29
Material. Hungary, 20, Vértes, Csäkbereny, 8.v.2003, LI. Russia, 19, Cheliabinsk oblast, Satka
env., 17.v1.2009, SU.
Very local species with limited information about its distribution range. The occurrence
was previously confirmed ın Central Europe and the Balkans but the record from the
southern Urals indicates that its range is much more wider. New species for Russia.
Rhyacionia maritimana Pröse, 1981
Material. Spain, 30, 19, Catalunya, Reus env., 29-30.v.1996, SU; 90°, Almeria, Sierra de los
Filabres, Alto del Calar del Gallinero, 17—18.vi.2007, SU; 19, Cuenca, Monteagudo de las Salinas,
6.v.2008, SU. France, 19, Toulon distr., Fort du Girardon, 11.v.1994, SK; 10, Sommiéres distr.,
Maruéjols, 17—18.v.2004, SU.
Distributed in Southwestern Europe, with published faunistic data from Corsica (the
type area) and Spain. The occurrence in continental France is mentioned only by
Razowski (2003) but without faunistic details. As the species is missing in the cur-
rent checklist of Lepidoptera for France (Karsholt & van Nieukerken 2011) we have
included our own findings from the south of the country.
176 Sumpicu & Skyva: New Microlepidoptera records, with description of three new gelechioid taxa
PTEROPHOROIDEA: PTEROPHORIDAE
Capperia polonica Adamczewski, 1951
Material. Slovenia, Osp, 19 25.v.2001, SK, 29 2.v.2002, SU, 29 3.v11.2004, SU, 20° 25.vi.2010, SK.
Previously known from Croatia, Greece, France, Corsica, and Sardinia. First records
from Slovenia.
PYRALOIDEA: PYRALIDAE
Hypsopygia almanalis (Rebel, 1917)
Material. Greece, 1, 19, Piéria, Leptokäria, 17—22.v111.1996, SK; 1 ©", Préveza, Mitikas, 27.vi.2001, SK.
Described from Turkey, known also from Cyprus (Slamka 2006). The specimens
included herein were collected in coastal dunes and represent first records from
Europe.
Stemmatophora brunnealis (Treitschke, 1829)
Material. Italia, 19, Lago di Como, Menaggio, 27.v111.2008, LI. Corsica, 19, Aullene env., Eustach,
25.11.2007, leg. A. Pavlicko, coll. SK.
Widely distributed and generally common Southern European species, which was
overlooked in Corsica. New species for this island.
Pyralis lienigialis (Zeller, 1843)
Material. Corsica, 19, Sartene, 17.vi.1993, SK; 20, Sainte Lucia di Porto Vechio, Tagliu Rossu,
18—19.vi.1993, SK et LI; 19, Bonifacio env., San Quilico, 17.v11.2011, leg. J. Majer, coll. SK; 29, 19,
Fontapone, 26—27.1x.2011, leg. V. Feik, coll. SK.
Known from scattered localities in Europe, but with no recent records from Central
Europe and the Balkans (except for Romania). New species for Corsica.
Euzophera pulchella Ragonot, 1887
Material. Croatia, 40, 59, Omis env., Maruëiéi, 3—17.vi11.2008, SU.
In Europe only known from the Balkans. The first occurrence in Croatia (Island of Krk)
was published by Habeler (2003), but this record is not included in the current version
of Fauna Europaea.
PYRALOIDEA: CRAMBIDAE
Schoenobius gigantella (Denis & Schiffermüller, 1775)
Material. Sardinia, 10, Siniscola env., Posada, 28.v1.2004, SK.
In Europe widely distributed (Slamka 2008) but previously not known from Sardinia.
Nota lepid. 35 (2): 161-179 ir
Scirpophaga praelata (Scopoli, 1763)
Material. Corsica, 20°, Ghisonaccia env., Casamozza, 25.v11.2007, leg. A. Pavlicko, coll. SK.
Known from most European countries, particularly from southern parts of continental
Europe. New species for Corsica.
Acentria ephemerella (Denis & Schiffermüller, 1775)
Material. Corsica, 40°, Sant Damiano, Lido de la Marana, 16—28.1x.2011, leg. V. Feik, coll. SK.
Widely distributed, previously not recorded from Corsica.
Euchromius bella (Hiibner, 1796)
Material. Slovenia, 19, Kostabona env., Kapeli, 10.v11.2009, SK; 19, 19, Osp, 25.vi.2010, SK.
In Europe known mainly from southern countries, sporadically found also in Central
and Eastern Europe. First country record.
Euchromius ramburiellus (Duponchel, 1836)
Material. Montenegro, 10, Budva, 4.v11.1966, SK. Greece, 10°, Igoumenitsa, 23.x.2003, SK.
Distributed largely in southern parts of Europe; in the Balkans previously recorded
from Croatia, Romania, and Bulgaria. First country records.
Chilo phragmitella (Hiibner, 1905)
Material. Greece, 29, Igoumenitsa, 28.v1.2001, SK.
In Europe widely distributed but in the Balkans previously known only from the
Republic of Macedonia and Croatia. First country record.
Friedlanderia cicatricella (Hübner, 1824)
Material. Greece, 79, Igoumenitsa, 28.v1.2001, SK.
With a scattered distribution throughout much of Europe except for Scandinavian
countries. First country record.
Thopeutis galleriellus (Ragonot, 1892)
Material. Greece, 10, Igoumenitsa, 5.viii.2005, SK.
In Europe known from its southwestern and eastern part; within the Balkan Peninsula
the only finding was previously published from Montenegro from 1917 (Slamka 2008).
New species for Greece.
Pyrausta tithonialis Zeller, 1872 Fig. 30
Material. Russia, 10°, Cheliabinsk oblast, Moskovo, 19.vi.2009, SU.
An East Palaearctic species known from Russia, China, Korea, and Japan (Shibuya
1929). In Russia previously found only in its Asian part, with most western localities in
Krasnojarsk Region and Altaj Republic [= Kpacnospcknü pernon, PecrıyOrmka Anraï]
178 Sumpicu & Skyva: New Microlepidoptera records, with description of three new gelechioid taxa
Figs 30-31. Adults of Crambidae. 30. Pyrausta tithonialis Zeller, 1872, male (Russia, 15.5 mm). 31. Me-
cyna lutulentalis (Lederer, 1858), male (Greece, 27 mm).
(Sinev 2008). This record from the southern Urals is the first one from European Russia
as well as from Europe. Genitalia of this specimen will be figured in a forthcoming edi-
tion of “Pyraloidea of Europe” (Slamka, in prep.).
Mecyna lutulentalis (Lederer, 1858) Fig. 31
Material. Greece, Peloponnes penin., Diakofté, 19, 19 19-25.v1.2001, 29, 19 8—9.vi11.2002, 19
19.x.2003, 40° 11.v1.2008, 29, 49 19.vi.2011; 10°, Peloponnes penin., Chelmos, 10.viii.2002, SK; 49,
19, Smolikas Mts, Pades, 8.v11.2005, SK.
Described from an unspecified number of specimens from Damascus (Syria) (Lederer
1858), the nearest findings being reported from Turkey (Koçak & Kemal 2009). New
species for Greece as well as for Europe. Genitalia of these specimens will be figured
in a forthcoming edition of “Pyraloidea of Europe” (Slamka, in prep.).
Acknowledgements
The authors are obliged to Mr. Jan Liëka for addition of some faunistic data; thanks belong to Mr. Gustav
Elsner and Mr. Frantisek Slamka for their assistance in determination of some lepidopteran species. We
thank G. Elsner for providing valuable information concerning some species of the family Gelechiidae,
and our warm thanks belong to Mr. Ole Karsholt, Mr. Sjaak Koster, and Mr. Zdenék LaStüvka for useful
comments on the manuscript. Mr. Petr Kapitola kindly translated the text into English.
References
Bidzilya, O. & O. Karsholt 2008. New data on Anomologini from Palaearctic Asia (Gelechiidae). — Nota
Lepidopterologica 31: 199-213.
Budashkin, Y. I. & B. Zlatkov 2011. A new species of Epinotia Hübner, 1825 [1816] from southwestern
Bulgaria (Tortricidae: Olethreutinae). — Nota Lepidopterologica 34: 33-37.
Elsner, G., P. Huemer & Z. Tokar 1999. Die Palpenmotten (Lepidoptera, Gelechiidae) Mitteleuropas. Be-
stimmung, Verbreitung, Flugstandort, Lebensweise der Raupen. FrantiSek Slamka, Bratislava, 208 pp.
Habeler, H. 1998. Neue und berkenswerte Arten für die Schmetterlingsfauna Kroatiens von der Insel Krk
(Lepidoptera). — Entomologia Croatica 3: 33—44.
Habeler, H. 2001. Lepidopterologische Nachrichten aus der Steiermark, 18 — mit Funddaten von den
Inseln Krk und Cres (Lepidoptera). — Joannea Zoologie 3: 29-36.
Habeler, H. 2003. Die Schmetterlinge der Adria-Insel Krk. Eine ökofaunistische Studie. Delta Druck —
Verlag Heinz Peks, Graz, 221 pp.
Nota lepid. 35 (2): 161-179 179
Huemer, P. & O. Karsholt 1999. Gelechiidae I (Gelechiinae: Teleiodini, Gelechiini). Pp. 1-356. — In: P.
Huemer, O. Karsholt & L. Lyneborg (eds), Microlepidoptera of Europe 3, Apollo Books, Stenstrup.
Huemer, P. & O. Karsholt 2001. Additions to the fauna of Gelechiidae (Gelechiinae: Teleiodini: Gelechiini)
of Europe. — Nota Lepidopterologica 24: 41-55.
Huemer, P. & G. C. Luquet 1991. Sur quelques Tordeuses rarement signalées de France ou nouvelles pour
la faune française. — Alexanor 17: 89-99.
Junnilainen, J. & K. Nupponen 2010. The gelechiid fauna of the southern Ural Mountains, part I: descrip-
tions of seventeen new species (Lepidoptera: Gelechiidae). — Zootaxa 2366: 1-34.
Karsholt, ©. 2005. Gelechiidae. — /n: G. Baldizzone. I Microlepidotteri del Parco Naturale Alpi Marittime
(Italia, Piemonte) (Lepidoptera). Bolletino del Museo Regionale di Scienze Naturali — Torino 22:
112-141.
Karsholt, O. & E. J. van Nieukerken (eds) 2011. Fauna Europaea: Lepidoptera, Moths. Fauna Europaea,
Version 2.4, online at http://www.faunaeur.org (accessed 13 March 2012).
Kocak, A. O. & M. Kemal 2009. Revised Checklist of the Lepidoptera of Turkey. — Centre for Entomological
Studies Ankara 17 (supplement): 1 —-253.
Koster S. & S. Yu. Sinev 2003. Momphidae s. |. Pp. 1—385. — Jn: P. Huemer, O. Karsholt & L. Lyneborg
(eds), Microlepidoptera of Europe 5, Apollo Books, Stenstrup.
Lederer, J. 1858. Noch einige syrische Schmetterlinge. — Wiener Entomologische Monatsschrift 2: 135—
152.
Nedoshivina, S. V. & V. V. Zolotuhin 2005. A new subspecies of Pelatea klugiana (Freyer, 1836) from
the Middle Volga Region of Russia with notes on its morphology and life history (Tortricidae). — Nota
Lepidopterologica 28: 3-9.
Razowski, J. 2003: Tortricidae of Europe 2. Olethreutinae. — Frantisek Slamka, Bratislava, 301 pp.
Rebel, H. 1891. Beitrag zur Microlepidopteren-Fauna Dalmatiens. — Verhandlungen der kaiserlich-könig-
lichen zoologisch-botanischen Gesellschaft in Wien 41: 610-639.
Shibuya, J. 1929. On the known and unrecorded species of the Japanese Pyraustinae (Lepid.). — Journal of
the Faculty of Agriculture, Hokkaido Imperial University 25: 151-242.
Sinev, S. Yu. 1986. A list of the narrow-winged moths (Lepidoptera, Momphidae s.l.) of the USSR fauna.
[In Russian]. — Trudy vsesoyuznogo entomologicheskogo Obshchestva 67: 19—74.
Sinev, S. Yu. 2008. Crambidae. Pp. 170-187. — In: S. Yu. Sinev (ed.), Catalogue of the Lepidoptera of
Russia. - KMK Scientific Press Ltd., St. Petersburg & Moscow.
Slamka, F. 2006. Pyraloidea of Europe (Lepidoptera) 1. Pyralinae, Galieriinae, Epipaschiinae, Cathariinae
& Odontiinae. — Frantisek Slamka, Bratislava, 138 pp.
Slamka, F. 2008. Pyraloidea of Europe (Lepidoptera) 2. Crambinae & Schoenobiinae. — Frantisek Slamka,
Bratislava, 223 pp.
Sumpich, J., J. Lika, J. Sitek, J. Marek, J. Skyva, J. Uficäf, F. Fiala, J. Jakeë, I. Dvorak, L. Marëik, P. Po-
tocky, A. LaStüvka, V. Elsner, Z. LaStivka, M. Mikat & A. Kaëirek 2011. Faunistic records from the
Czech Republic 326. — Klapalekiana 47: 281-298.
Tokar, Z., A. Lvovsky & P. Huemer 2005. Die Oecophoridae s. |. (Lepidoptera) Mitteleuropas. Bestimmung,
Verbreitung, Habitat, Bionomie. — Frantisek Slamka, Bratislava, 120 pp.
Weber, P. 1957. Schneidereria pistaciella gen. spec. nov. (Lepid. Gelechiidae), ein Schädling an Pistazien. —
Mitteilungen der Schweizerischen Entomologischen Gesellschaft 30: 68-72.
rx
:
2
» n
:
h
es
1
i}
‘ |
= —
| rf
\
mn
un
=
|
i
e
* Kate
x
as,
i
x
x
Nota lepid. 35 (2): 181-183 181
Symmoca sparsella Joannis, 1891 (Gelechioidea, Autostichidae)
new to Europe
LEIF AARVIK
Natural History Museum, University of Oslo, P.O. Box 1172 Blindern, NO-0318 Oslo, Norway;
[email protected]
Received 15 August 2012; reviews returned 19 September 2012; accepted 20 September 2012.
Subject Editor: Lauri Kaila.
Abstract. Symmoca sparsella Joannis, 1891 (Autostichidae) is reported from the Greek Island of Crete.
This represents the first European record of this species. The adult, male genitalia, and the habitat in Crete,
where this moth was found, are illustrated.
Introduction
Symmocinae is the most species-rich of the five subfamilies that make up the family
Autostichidae. The current concept of the family was introduced by Hodges (1998),
and developed further in the phylogenetic studies by Mutanen et al. (2010) and Kaila et
al. (2011). These studies have resulted in the classification applied in the recent version
of the website Fauna Europaea (Vives Moreno 2011). Most of the 131 European spe-
cies of Autostichidae occur in the Mediterranean area (Gozmany 2008; Vives Moreno
2011), 120 of which belong to the subfamily Symmocinae, whereas only 11 species
represent the smaller subfamilies Autostichinae, Deocloninae, and Holcopogoninae
(Vives Moreno 2011). Symmocinae is most diverse in the drier parts of the Palaearctic
region, from the Mediterranean area to Mongolia and southern China (Gozmany 2008).
The largest genus of the subfamily, Symmoca Hiibner, (1825), contains 85 species, 34
of which have been found in Europe (Gozmany 2008; Vives Moreno 2011). The major-
ity of Autostichidae feeds on dead plant material (Gozmany 2008; Kaila et al. 2011).
The Palaearctic members of the subfamily were monographed by Gozmany (2008),
who treated Symmocinae as the family Symmocidae. In the present article, Symmoca
sparsella Joannis, 1891 is reported from Europe for the first time.
Abbreviation
NHMO Natural History Museum, University of Oslo
Symmoca sparsella Joannis, 1891 Figs 1, 2
Material. Greece, Crete, Chania Province: 10°, Hora Sfakion [UTM WGS84] 35S KU 4031 9864,
7—13.vi.2009, leg. L. Aarvik (Fig. 1). The genitalia were mounted in euparal on a glass slide numbered
NHMO 2018 (Fig. 2). The specimen with the genitalia slide is deposited in NHMO.
Nota lepidopterologica, 15.11.2012, ISSN 0342-7536
182 AARVIK: Symmoca sparsella Joannis, 1891 new to Europe
transtilla process
sacculus
Figs 1-2. Symmoca sparsella Joannis, 1891. 1. The specimen from Crete. Wingspan 10 mm. (Photo: Kars-
ten Sund). 2. Male genitalia.
Fig. 3. South coast of Crete near Hora Sfakion from where the specimen of Symmoca sparsella was ob-
tained. (Photo: Nini Cecilie Aarvik)
Discussion
The specimen was attracted to light. The habitat from where the moth was obtained
(Fig. 3) can be characterised as garrigue, open vegetation of dwarf evergreen shrubs
and herbs. The locality is situated on the south coast of Crete and is just above sea
level. Dry and desert-like habitats are typical for numerous species of Symmocinae
(Gozmany 2008), and in this respect the locality in Crete is also typical. Symmoca spar-
sella is known from several countries in the Middle East: Syria, Iraq, Lebanon, Israel,
Jordan, and Egypt (Gozmany op. cit.).
Nota lepid. 35 (2): 181-183 183
The south coast of Crete falls into the North African climatic zone, whereas the
majority of the island falls into the Mediterranean climatic zone. The south coast thus
enjoys significantly more sunny days and higher temperature throughout the year
(Wikipedia 2012). It can be expected that the composition of the lepidopteran fauna of
the south coast is different from that of the rest of the island.
Externally, Symmoca sparsella resembles several other Symmocinae with dull grey-
brown forewing and a pattern of dark dots arranged in four transversal rows. In the
male genitalia it is easily recognisable by the presence of two rounded processes of
the transtilla and a strongly curved sacculus that reaches above the dorsal edge of the
valva, as well as the lack of a dorsal process of the valva. The latter structure was
termed appendix by Gozmäny (op. cit.), where the genitalia of both sexes are figured
as well as the adult moth in colour. Based on the appearance of the male genitalia, it
appears that the closest relative of S. sparsella is S. huri (Gozmäny, 1963), known from
Afghanistan. S. huri differs by having a longer saccus and shorter sacculus that does not
reach the dorsal edge ofthe valva (compare figures by Gozmäny op. cit.). Externally, S.
huri differs strongly from S. sparsella by the nearly pattern-less forewing.
Acknowledgements
The author wishes to thank Karsten Sund, Oslo, for taking the photograph of the moth, and Nini Cecilie
Aarvik, As, Norway, for taking the photograph of the habitat. Two anonymous referees are thanked for
constructive suggestions.
References
Gozmany, L. 2008. Symmocidae. 558 pp. — Jn: R. Gaedike (ed.), Microlepidoptera Palaearctica 13, Goecke
& Evers, Keltern.
Hodges, R.W. 1998. The Gelechioidea, Pp. 131-158. - Jn: N. P. Kristensen (ed.), Lepidoptera: Moths and
butterflies, Vol. 1, Handbuch der Zoologie 35, Walter de Gruyter GmbH. & Co., Berlin & New York,
Kaila, L., M. Mutanen & T. Nyman 2011. Phylogeny of the mega-diverse Gelechioidea (Lepidoptera):
adaptions and determinants of success. — Molecular Phylogenetics and Evolution 61: 801-809.
Mutanen, M., N. Wahlberg & L. Kaila 2010. Comprehensive gene and taxon coverage elucidates radiation
in moths and butterflies. — Proceedings of the Royal Society B 277: 2839-2848.
Vives Moreno, A. 2011. Fauna Europaea: Autostichidae. — Jn: O. Karsholt & E. J. van Nieukerken (eds),
Fauna Europaea: Lepidoptera, Moths, Fauna Europaea, version 2.4, http://www.faunaeur.org.
Wikipedia 2012. http://en.wikipedia.org/wiki/Crete#Climate. Accessed 30.v.2012.
0
a
Nota lepid. 35 (2): 185-191 185
Redescription of Nephopterygia austeritella Amsel, 1965
(Pyralidae: Phycitinae) with description of its hitherto
unknown female
HELEN ALIPANAH !, JAN ASSELBERGS? & MANSOUR SARANI
! Insect Taxonomy Research Department, Iranian Research Institute of Plant Protection (IRIPP),
P. O. Box 1454, Tehran 19395, Iran; [email protected]
2 Neerland 20, 4614 GD Bergen op Zoom, The Netherlands; jef.asselbergs(@hetnet.nl
3 Plant Protection Institute, Sistan, Iran; [email protected]
Received 18 April 2012; reviews returned 25 May 2012; accepted 13 September 2012.
Subject Editor: Bernard Landry.
Abstract. Nephopterygia austeritella Amsel, 1965 (type locality: Sudan, Nubian Desert, Wadi Halfa) is
redescribed. The hitherto unknown female is described based on four specimens collected in the south
(provinces of Hormozgan and Fars) and the southeast (province of Sistan Va Baluchestan) of Iran. The
life history of the species is described for the first time and Syrian mesquite [Prosopis farcta (Banks &
Solander) J. F. Macbride] is newly reported as its host plant. This is also the first report of this monotypic
genus from Iran.
Résumé. Nephopterygia austeritella Amsel, 1965 (localité type: Soudan, Désert de Nubie, Wadi Halfa) est
redécrite. La femelle, inconnue jusqu’à présent, est décrite d’après quatre spécimens récoltés dans les par-
ties sud (provinces d’Hormozgan et de Fars) et sud-est (province de Sistan Va Baluchestan) de l’Iran. La
biologie de l’espèce est mentionnée pour la première fois et le mesquite de Syrie [Prosopis farcta (Banks &
Solander) J. F. Macbride] est mentionné pour la première fois comme plante hôte pour l’espèce. Ce rapport
présente aussi la première mention de ce genre monotypique pour l’Iran.
Introduction
The genus Nephopterygia and its type species N. austeritella were described by Amsel
(1965) based on three males collected in Sudan (Nubian Desert: Wadi Halfa), without
information on life history. Later, Nephopterygia austeritella Amsel was reported from
the Canary Islands (Fuerteventura, Jandia, Barranco Esquinzo) and Egypt (Sinai Desert:
Sharm El Sheikh) (Asselbergs 2009). However, the female and life history of the species
remained unknown and the genus is still monotypic.
In 2011, during a survey in Sistan Va Baluchestan province (Zabol region), signs of
damage caused by pyralid larvae were detected on Prosopis farcta (Banks & Solander)
J. F. Macbride (Fabaceae), a plant with the vernacular name of Syrian mesquite. Larvae
were observed feeding in fruits and seeds, leaving tunnels through the fruit in which they
pupated. After the adult moths had emerged, the males and females were compared to the
known phycitine species which revealed a great similarity with male specimens of the type
species of the genus Nephopterygia, and finally they were identified as Nephopterygia
austeritella Amsel. Additional material was also discovered in the Hayk Mirzayans Insect
Museum (HMIM) of the Iranian Research Institute of Plant Protection (IRRIP), collected
in the Fars (Darab) and Hormozgan (Bandar Abbas) provinces. A redescription of the
species is provided below together with a description of the female genitalia.
Nota lepidopterologica, 15.11.2012, ISSN 0342-7536
186 ALIPANAH et al.: Redescription of Nephopterygia austeritella Amsel (Pyralidae)
Material and Methods
Genitalia dissections followed Robinson (1976). Photographs were taken using a digi-
tal still camera DSC-F717 and a Dino-Eye Microscope Eye-piece camera. Some im-
ages are the result of combining multiple images using the software Combine ZP. The
terminology of wing venation follows Neunzig (1986, 1990, 1997, 2003) and the re-
maining terminology follows Horak (1997) and Kristensen (2003). AII the material
examined 1s deposited in the HMIM collection.
Nephopterygia austeritella Amsel, 1965 Figs 1-5
Material. Iran: 40, 49, Sistan Va Baluchestän Prov., Zabol, Zehak (larvae on Prosopis farc-
ta), 10.vi.2011, Mansour Säräni leg.; 19, 19, Fars Prov., Darab (larvae on P farcta), vi.2008, Abbas
Mohammadi leg.; 19, Hormozgan Prov., Bandar Abbas, 16.v.1975, Hashemi, Borumand leg.
Diagnosis. The long, slightly curved and apically sharp pointed process originating
from the inner side of the valva and extending well beyond its ventral edge (Fig. 4A),
combined with the presence of only one cornutus on the vesica is characteristic for the
monotypic genus Nephopterygia Amsel.
Redescription. Wingspan 16—23 mm (male), 17—22 mm (female). Forewing length
(fringe included) 7.5—10.0 mm (male), 7.5—10.5 mm (female). Head (Fig. 1): frons
in female with slightly appressed, dirty cream-coloured scales, appearing nearly cone-
shaped (Fig. 1A), in males not clearly cone-shaped; vertex in both sexes with dirty
cream-coloured appressed scales extending beyond vertex; male vertex concave be-
tween antennal sclerites, with erect and vertically positioned scales in this area (Fig.
1D). Ocelli and chaetosemata present; patagia and tegulae dirty cream-coloured. Labial
palpi sexually dimorphic: male labial palpi upcurved, 2" segment with ventrally pro-
jecting scale tuft, 3" segment short (1/2 of second) and bare; female labial palpi porrect,
2™ segment dorsally with slightly projecting scale tuft, 3" segment longer than in male
(2/3 of second) (Figs 1A, B). Maxillary palpi short in both male and female; proboscis
normally developed and scaled basally. Antennae covered dorsally with randomly ar-
ranged cream-coloured scales; basal segments sexually dimorphic: in male with long
scapus more or less vertically positioned on top of vertex, mesal edge of segments 2—7
forming basal sinus and segments 4—6 with mesal spines growing gradually from 4" to
6" segments; entire sinus covered by developed scale tuft (Fig. 1D); flagellomeres with
short cilia in both sexes (1/4 of antennal segment diameter); female antennae unmodi-
fied. Abdomen dirty cream coloured. Wings (Fig. 2): Male and female similar in ground
colour and pattern of both fore- and hindwings; forewings elongate-subtriangular; costa
straight to 2/3 of wing length, then convex towards apex; termen oblique; ground col-
our varying from dirty-cream with scattered light brownish scales throughout to light
greyish brown; antemedian line brownish, whitish edged on the inside, extending from
1/3 on costa to middle of dorsum; postmedian line light brownish, mostly less obvious,
from costa close to apex, then slightly wavy to 5/6 on dorsum; discal spot brown; fringe
dirty cream-coloured to brown; hindwings dirty cream-coloured with darker suffusion
at all margins, especially at apex and costa; fringe dirty cream-coloured with a basal
brown line. Wing venation (Fig. 3): Forewing with R,,, and R, with long common
Nota lepid. 35 (2): 185-191 187
stalk; M, and M, with short com-
mon stalk. Hindwing characteristi-
cally of quadrifid type.
Male genitalia (Figs 4A-C).
Uncus a flat elongate trapezoid with
dense short setae dorsally, without
medial indentation at apex. Gnathos
small and oval. Valva elongate, of
moderate width, costa moderately
sclerotised; saccular side of valva
with prominent evagination; saccu-
lus prominent and sclerotised bas-
ally; cucullus rounded. Each valva
with a slightly curved and apically
pointed sclerotised process origi-
nating at middle of inner side hav-
C a | D ing slightly less than 1/2 length of
N valve (Fig. 4A). Juxta U-shaped
Fig. 1. Head, female (A) and male (B) in lateral view; fe- with a pair of small flap-like pro-
male (C) and male (D) in frontal view. cesses. Vinculum almost flat basal-
ly and slightly less than the length
of valvae. Transtilla paired. Phallus stout, broad and slightly shorter than valva; vesica
with numerous granulations and a stout cornutus of about 2/5 of the length of phallus.
Culcita with median distally bifurcated plate of variable length; ventral edge of 8"
segment flatly dish-shaped with paired tapering lateral plates; two long scale bundles
extending from each side of base to just beyond apex of plate.
Female genitalia (Figs 4D-H). Papillae anales subtriangular. Ostium broad, an-
trum sclerotised, and ductus bursae as a very well-defined, sclerotised tube. Ductus bur-
sae relatively long, as long as corpus bursae, sclerotised and folded over itself at about
2/3. 8" abdominal segment longer than broad, posterior margin straight. Apophyses
posteriores slightly longer than apophyses anteriores. Corpus bursae an inverse trap-
ezoid, with distal wall clearly invaginated and with some irregular swellings near distal
end; ductus seminalis originating from distally protruding area of corpus bursae. Signa
developed as two spiny plates, one of them an elongated oval plate with inwardly di-
rected spinules in invaginated distal wall of corpus bursae (Figs 4E, G), the other one
larger, circular, with conspicuous larger spines directed inwardly (Fig. 4G).
Life history. In both Sistan Va Baluchestan (Zabol) and Fars (Darab) provinces, the
females lay their eggs on the green fruits of Prosopis farcta in May. The eggs hatch
in June, then the larvae feed on the fruit pericarps and make tunnels within the fruit
(Fig. 5). They also feed on the seeds. The adults emerge in July. In all probability, P
farcta is the only host plant of N. austeritella in Iran although other food plants are not
excluded. As far as we know, Prosopis farcta is distributed in Algeria, Egypt, Tunisia,
Saudi Arabia, Palestine, Israel, Jordan, Lebanon, Syria, Cyprus, Turkey, Afghanistan,
188 ALIPANAH et al.: Redescription of Nephopterygia austeritella Amsel (Pyralidae)
Iran, Iraq, Azerbaijan, Georgia, Ka-
zakhstan, Kyrgyzstan, Tajikistan,
Turkmenistan, Uzbekistan, India,
and Pakistan (USDA, ARS 2012).
As N. austeritella is also known
from Sudan and the Canary Islands,
either the only known food plant
occurs there as well, or the species
is not monophagous.
Re | Fig. 2. Nephopterygia austeritella Amsel female. Scale =
Distribution. This species has a 10 mm.
disjunct distribution. It is reported
from the most western part of the
Sahara-Arabian subregion of the
Palaearctic region (Canary Islands)
and its eastern parts (Egypt) (Amsel
1965; Asselbergs 2009). It is also
reported from the East African sub-
region of the Afro-Tropical region
(Sudan) (Amsel 1965), and now
from Iran, which is positioned in
the Turanian-Persian subregion of
the Palaearctic region.
Remarks. This is the first report of
Prosopis farcta as a host plant for
Nephopterygia austeritella and this Fig. 3. Fore- and hindwing of Nephopterygia austeritella
phycitine taxon is newly reported Amsel female.
from Iran. Nephopteryx Zeller, 1839
is an incorrect subsequent spelling
and an incorrect authorship of Nephopterix Hübner, (1825) of which the type species
is Tinea (= Nephopterix) angustella Hübner, 1796 (Fletcher & Nye 1984). Most of
the information on species of Sciota has appeared in the literature under the name of
Nephopterix Hübner (or Nephopteryx, an unjustified emendation). This occurred as a
consequence of Heinrich (1956) and others, erroneously considering Phycita rhenella
Zincken to be the type species of Nephopterix (Fletcher & Nye 1984). Palm (1986),
Speidel (1996) and Leraut (1997) have moved the Palaearctic species with the fea-
tures of P rhenella to Sciota. Neunzig (2003) placed the North American species under
Sciota as well.
Discussion
The disjunct distribution of Nephopterygia austeritella is not at all uncommon as can
be illustrated by the following other phycitine examples: Caina deletella Ragonot is
Nota lepid. 35 (2): 185-191 189
Fig. 4. Male (A-C) and female genitalia (D-H), D and H frontal and dorsal views, G lateral view.
distributed in the Canary Islands, the United Arab Emirates, South Iraq, and India;
Cherchera abatesella Dumont is known from Tunisia, Malta, and the United Emirates;
and Pempeliella malacella (Staudinger) is known from South Spain, Egypt, and the
United Arab Emirates (Asselbergs 2007, 2010).
These disjunctions can be explained either by the insufficiently explored areas in
between or by the absence of proper biotopes. Nephopterygia austeritella can probably
be considered a southern Palaearctic faunal element which enters the northern parts of
the Afro-Tropical region. This distribution seems to be similar to that of its host plant,
Prosopis farcta (USDA, ARS 2012).
190 ALIPANAH et al.: Redescription of Nephopterygia austeritella Amsel (Pyralidae)
Fig. 5. Prosopis farcta (Banks & Solander) J. F. Macbride (A); damaged fruit (B).
Comparing the male genitalia of N. austeritella with those of the Old World trifine
(Roesler 1973) and quadrifine Acrobasıına (part) (Roesler 1993) and with the Nearctic
Phycitinae (Heinrich 1956), does not reveal many evident similarities. The same ap-
plies to the female genitalia. There is a certain similarity between the male genitalia of
Nephopterygia and those of a few species of the Palaearctic Sciota, such as marmorata
Alphéraky and, to a lesser degree, fumella Eversmann, because they all share a long
process originating from the inner side of the valva.
While the genus Nephopterix Hübner, (1825) (= partly Sciota Hulst, 1888) seems to
be related to Nephopterygia, it differs from the latter by the presence of two cornuti on
the vesica, the differently sclerotised and unfolded ductus bursae, the lack of a signum
in the bursa, and the presence of three scale tufts bilaterally on the 8" sternite. In addi-
tion, the 2" segment of the labial palpus in the female appears to be much broader than
in Sciota. Therefore, even including the description of the female cannot reveal a closer
relationship with any of the other known genera of the subtribe Acrobasiina. At present
it seems best to maintain the monotypic genus Nephopterygia in its rather isolated posi-
tion.
Acknowledgements
We express our gratitude to Dr W. Gerald Tremewan (Truro, U.K.) for kindly and carefully checking the
original manuscript. We also thank Mr Abbas Mohammadi for collecting some specimens in Fars province
(Darab region).
Nota lepid. 35 (2): 185-191 191
References
Amsel, H. G. 1965. Ergebnisse der Zoologischen Nubien-Expedition 1962. Teil XXIX. Lepidoptera: Pyra-
lidae, Pterophoridae. — Annalen des Naturhistorischen Museums in Wien 68: 593 - 607.
Asselbergs, J. E. F. 2007. Order Lepidoptera, superfamily Pyraloidea. Pp. 469-561. — Jn: A. van Harten
(ed.), Arthropod fauna of the UAE vol. 1, Dar Al Ummah Printing, Publishing, Distribution and Ad-
vertising, Abu Dhabi.
Asselbergs, J. E. F. 2009. New data for Pyraloidea from Fuerteventura (Spain, Canary Islands) including a
species new to science. — SHILAP Revista de Lepidopterologia 37 (148): 405-420.
Asselbergs, J. E. F. 2010. Order Lepidoptera, superfamily Pyraloidea (part 2). Pp. 554—563. — In: A. van
Harten (ed.), Arthropod fauna of the UAE vol. 3, Dar Al Ummah Printing, Publishing, Distribution
and Advertising, Abu Dhabi.
Fletcher, D. S. & W. B. Nye 1984. The generic names of moths of the world. Volume 5, Pyraloidea. —
Trustees of the British Museum (Natural History) London. xv + 185 pp.
Heinrich, C. 1956. American moths of the subfamily Phycitinae. — United States National Museum Bulle-
tin 207: i—vili + 1—581 pp., figs 1- 1135. Smithsonian Institution, Washington, DC.
Horak, M. 1997. A reassessment and review of the Australian genus Crenomeristis Meyrick (Lepidoptera:
Pyralidae: Phycitinae). — Entomologica Scandinavica 28 (4): 445-470.
Kristensen, N. P. 2003. Skeleton and muscles: Adults. Pp. 45-145. - In: N. P. Kristensen (ed.), Lepidoptera,
moths and butterflies 2, morphology, physiology and development. Handbook of Zoology, vol. IV, part
36, Walter de Gruyter, Berlin/New York.
Leraut, P. 1997. Liste systématique et synonymique des Lépidopteres de France, Belgique et Corse (deux-
ième édition). — Supplément a Alexanor, Paris: 1 —526.
Neunzig, H. H. 1986. Pyraloidea: Pyralidae (part), Phycitinae (part). 1—113 + i-xii pp., text figs 1-23,
monochrome plates A-D, colour plates 1-6. — Jn: R. B. Dominick et al. (eds), The moths of America
north of Mexico, fascicle 15.2, The Wedge Entomological Research Foundation, Washington, D.C.
Neunzig, H. H. 1990. Pyraloidea, Pyralidae (part), Phycitinae (part). 1- 165 pp., text figs 1-70, mono-
chrome plates A-B, colour plates 1-5. — /n: R. B. Dominick et al. (eds), The moths of America north
of Mexico, fascicle 15.3, The Wedge Entomological Research Foundation, Washington, D.C.
Neunzig, H. H. 1997. Pyraloidea, Pyralidae (part), Phycitinae (part). 1- 157 pp., text figs 1-59, mono-
chrome plates A-D, colour plates 1-4. - Zn: R. B. Dominick et al. (eds), The moths of America north
of Mexico, fascicle 15.4, The Wedge Entomological Research Foundation, Washington, D.C.
Neunzig, H. H. 2003. Pyraloidea, Pyralidae (part), Phycitinae (part). 1—338 pp., text figs 1-116, 1-20
plates (10 color). — Jn: R. B. Dominick et al. (eds), The moths of America north of Mexico, fascicle
15.5, The Wedge Entomological Research Foundation, Washington, D.C.
Palm, E. 1986. Nordeuropas Pyralider — med saerligt henblik pa den danske fauna (Lepidoptera: Pyrali-
dae), Danmarks Dyreliv, Bind 3: 1-287 pp., pls 1-8. —-/n: L. Lyneborg (ed.), Fauna Boger, Copenhagen.
Robinson, G. 1976. The preparation of slides of Lepidoptera genitalia with special reference to the micro-
lepidoptera. — Entomologist’s Gazette 27: 127-132.
Roesler, R. U. 1973. Phycitinae. 752 pp. — Jn: H. G. Amsel, F. Gregor & H. Reisser (eds), Microlepidoptera
Palaearctica, vol. 4, Wien, Verlag Georg Fromme & Co.
Roesler, R. U. 1993. Phycitinae. 305 pp. — Jn: H. G. Amsel, F. Gregor & H. Reisser (eds), Microlepidoptera
Palaearctica, vol. 8, Wien, Verlag Georg Fromme & Co.
Speidel, W. 1996. Pyralidae. Pp. 1 —380.—Jn: O. Karsholt & J. Razowski (eds), Checklist of the Lepidoptera
of Europe, Apollo Books, Stenstrup, Denmark.
USDA, ARS. 2012. Germplasm Resources Information Network (GRIN) Taxonomy. [online Database].
National Genetic Resources Program, National Germplasm Resources Laboratory, Agricultural Re-
search Service (ARS), United States Department of Agriculture (USDA), Beltsville, Maryland. www.
ars-grin.gov/cgi-bin/npgs/html/taxon.pl?100110. Accessed 9.viii.2012.
u”
B re
= =
> ak
! ‘i
1
v
de
fl
‘ =
Votes
1
4 I J
\ '
8 a
{
\
ons
=
\
À
~ in
Fe
= =
|
= \
-
Nota lepid. 35 (2): 193-196 193
On the distribution of /daea gelbrechti Hausmann, 2003
in the Ibero-Maghrebian region (Geometridae: Sterrhinae)
JUAN JOSE GUERRERO, ANTONIO S. Ortiz & ROSA MARIA RUBIO
Departamento de Zoologia y Antropologia Fisica. Ärea de Biologia Animal.
Facultad de Veterinaria, Universidad de Murcia. Campus de Espinardo. 30071 Murcia, Espana;
[email protected]
Received 12 July 2012; reviews returned 11 September 2012; accepted 26 September 2012.
Subject Editor: Sven Erlacher.
Abstract. /daea gelbrechti Hausmann, 2003 was described from specimens collected in Morocco, and
later on it was discovered in Spain in 2010. This species is very similar to /daea aversata (Linnaeus, 1758)
and it might be its sister species. Also, /. gelbrechti seems to be one of those species that very often remain
undetected or overlooked in public and private collections. New records in Southeastern Iberian Peninsula
confirm its Ibero-Maghrebian distribution in habitats characterised by the presence of pine and oak forest
and mountain shrubland above 1,100 m in altitude, with a meso and supramediterranean climatic biotype.
This species seems to be monovoltine with records from the beginning of July in lower altitude sites
through the end of August in Sierra Nevada at 1,700 m.
Introduction
Idaea gelbrechti Hausmann, 2003 was described from specimens collected in Ifrane
in the Middle Atlas (Morocco), at an altitude between 1,700 and 1,750 m in an area
characterized by the presence of cedar and oak mixed forest. Miiller (2010) cited its
presence in the Iberian Peninsula from material collected in Sierra Nevada near Puerto
de la Ragua above 1,840 m in an area of mountain shrubland surrounded by pine for-
est.
Hausmann (2004) indicated that /daea aversata (Linnaeus, 1758) can be confused
with /daea rubraria (Staudinger, 1901), /daea straminata (Borkhausen, 1794), and
Idaea deversaria (Herrich-Schäffer, 1847) noting that certain forms of these three spe-
cies are difficult to identify without observing the hairiness of the abdomen. From
the systematic point of view, /. gelbrechti appears to be a sister species of /. aversata.
Moreover, this species seems to be one of those that very often remain undetected or
overlooked in collections due to lack of information about North African lepidopteran
fauna.
According to Müller (2010), Z. gelbrechti and I. aversata can be separated by ob-
serving the color pattern and shape of the wings, as well as other specific features. The
background color of the wings of /. ge/brechti is paler than in J. aversata, varying from
ochre colouration in specimens of the Middle Atlas to grayer in the Sierra Nevada ones.
Also, specimens of J. gelbrechti from the Iberian Peninsula exhibit a dark area between
the medial and postmedial lines, which is often the case in Z. aversata as well. The dif-
ferences between the two species based on genital structures, as noted by Hausmann
(2003) and Miiller (2010), are more evident in male genital structures than in the fe-
male ones.
Nota lepidopterologica, 15.11.2012, ISSN 0342-7536
194 GUERRERO et al.: Distribution of Idaea gelbrechti Hausmann, 2003
The aim of the present study is to extend the recorded range of distribution of
I. gelbrechti in western Mediterranean basin with new records and to add new biologi-
cal data.
Material and Methods
Male and female genitalia were prepared using the classical method as described by
Fibiger (1997) wıth minor modifications.
Material. Spain, Prov. Albacete: Nerpio, Plantön del Cobacho, 30SWHS2, 1,100 m, 29 26.vii.2011,
leg. et coll. Palacios; Riopar, Arroyo de la Celada, 30SWHSS, 1,100 m, 10° 9.vii.2005, leg. et coll. Lencina;
Nerpio, Arroyo de Santiago, 30SWH41, 1,480 m, 20° 30.v11.2005, 19 21.vii.2007, leg. et coll. Lencina.
Prov. Granada: Puebla de don Fadrique, Sierra de la Sagra, 30SWH30, 1,380 m, 19 30.vii.2011, leg. et
coll. Abad, 19 and 29 2.viii.2011, leg. et coll. Palacios & Albaladejo. Prov. Murcia, Moratalla: Bajil,
30SWH83, 1,280 m, 19 19.v11.2009, leg. et coll. Abad; Puerto Alto, Canada de la Cruz, 30SWH61, 1,435
m, 20° 25.v11.2009, leg. et coll. Abad & Albaladejo. Prov. Almeria: Bayärcal, Posada de los Arrieros,
30SVG90, 1,700 m, 19 16.viii.2009, 10° 17.viii.2009, 19 23.viii.2009, leg. J. Gelbrecht, T. Drechsel, E.
Schwabe & D. Stadie, coll. Gelbrecht.
Results
After Müller (2010) recorded /daea gelbrechti in Spain, the specimens in private
and public collections were checked paying special attention to those identified as
Idaea aversata from southern Iberian Peninsula. /. aversata was recorded in south-
eastern Iberian Peninsula from Albacete (Lencina et al. 2009), Alicante and Castellön
(Dominguez in litt. 1991), Cuenca (Ortiz et al. 2009, 2010b) and Murcia (Ortiz et al.
2010a). Specimens of /. aversata from this Iberian area were found in private collec-
tions of C. Abad, A. Albaladejo, F. Lencina, and J. L. Palacios, but not in collections
from Museo Nacional of Ciencias Naturales in Madrid, Department of Zoology and
Physical Antrophology from Murcia University, or in other private collections. The
locations of new records are shown in Fig. 1.
Habitat preferences of /. gelbrechti are diverse but always located above 1,100 m
in altitude. The mean altitude of the recording sites is 1,400 m. The original locality
for description in Morocco is an area characterized by the presence of cedar and oak
mixed forest (Hausmann 2003). In the Iberian Peninsula all records are located in the
Baetic Mountains. The first record was cited from Sierra Nevada where the habitat is
characterized by mountain shrubland with Juniperus sabina L. and Juniperus communis
hemisphaerica (C. Presl) Nyman surrounded by Pinus sylvestris L. New records from
Subbaetic Mountains are located in areas with mixed forest of Pinus pinaster Ait., P. ni-
gra mauretanica Maire & Peyerimh, Quercus rotundifolia Lam., Q. faginea Lam., and
Acer opalus granatense (Boiss.), and riparian forest (Populus spp. and Salix spp.) with
shrubland (Genista spp., Berberis spp., Cytisus spp., Lavandula spp., Prunus spp., etc);
in Bayil there is an oak forest of Quercus rotundifolia Lam. with typical undergrowth
(Arbutus unedo L., Phillyre angustifolia L., Pistacea spp., Lonicera spp., etc). In all cas-
es no grasses or cultivated land were found in the vicinity. This Subbaetic Mountainous
region 1s characterized by meso and supramediterranean climatic biotype.
Nota lepid. 35 (2): 193-196 195
Fig. 1. Map of distribution of /daea gelbrechti in the Western Mediterranean Basin; 1. Type localitiy;
2. First record in Iberian Peninsula; 3. New records. Map source: The Earth Observatory located at NASA
Goddard Space Flight Center.
I. gelbrechti seems to be a monovoltine species with records from the beginning of
July in lower altitude sites (1,100 to 1,480 m) to the end of August in Sierra Nevada at
1,700 m, without records at the Sierra Nevada site from March to the beginning of July
and from September to November (J. Gelbrecht, pers. comm.).
Discussion
The presence of new records of /daea gelbrechti in the Baetic Mountain System con-
firms that this species has an Ibero-Maghrebian distribution as suggested by Müller
(2010).
Interestingly, I. gelbrechti has not been recorded in other mountainous areas of the
southern Iberian Peninsula, for example, the ones located in Murcia (Sierra Espuña:
196 GUERRERO et al.: Distribution of /daea gelbrechti Hausmann, 2003
Calle et al. 2007; Sierra Pila and Sierra Carrascoy: unpublished data) and Almeria
(Sierra de Maria: unpublished data), where intensive sampling has been carried out
for a long time. This absence may be due to a more thermophilus regime of these last-
mentioned regions — /. gelbrechti seems to prefer colder biotopes and is thus found in
other mountains of southern Iberian Peninsula such as Sierra Baza, Sierra de Filabres,
and Sierra de Ronda, and possibly also in Rif and Tellian Mountains, where similar
climatic conditions are met.
In relation to morphological characters, Müller (2010) notes that specimens of J.
gelbrechti from the Iberian Peninsula exhibit a dark area between the medial and post-
medial lines, although Gelbrecht (pers. comm.) bred 42 specimens of /. gelbrechti from
the locality of the first Iberian record from a single female and the result was 33 speci-
mens with this dark area between the medial and postmedial lines, whereas nine speci-
mens did not exhibit this character. This finding reinforces the necessity of using the
genital structures to differentiate specimens of /. gelbrechti as Hausmann (2003) and
Müller (2010) suggested.
Acknowledgements
Thanks are due to Carmelo Abad, Aquilino Albaladejo, Francisco Lencina, José Luis Palacios, Manuel
Garre, and Francisco Javier Pérez Lopez for allowing access to their collections, and to Mercedes Paris for
data from the Entomology collections of Museo Nacional de Ciencias Naturales in Madrid. We also thank
our colleagues Dr. José A. de la Calle, Dr. Axel Hausmann, and Dr. José Serrano for their comments and
suggestions with specials thanks to Dr. Jörg Gelbrecht for the last records, life cycle contributions, and
other comments. At the end, our colleague John Girdley provided linguistic help.
References
Calle, J. A., A. S. Ortiz, R. M. Rubio, F. Ochotorena & J. J. Guerrero 2007. Los Geometridae (Lepidoptera)
del Parque Regional de Sierra Espuña (Murcia, España). — Boletin de la Sociedad Entomolögica Ara-
gonesa 41: 337-343.
Fibiger, M. 1997. Noctuidae Europaeae. Noctuinae III. — Entomological Press, Soro. 418 pp.
Hausmann, A. 2003. New Sterrhinae from Europe, North Africa, and the Caucasus (Lepidoptera, Geome-
tridae). — Entomologische Zeitschrift 113 (11): 319-328.
Hausmann, A. 2004. The Geometrid moths of Europe. Volume 2. Sterrhinae. — Apollo Books, Stenstrup.
600 pp.
Lencina, F., F. Albert, U. Aistleitner & E. Aistleitner 2009. Fauna Lepidopterolögica de Albacete. Catalogo
de Macroheteröceros (II): Axioidea, Drepanoidea y Geometroidea. — Sabuco 7: 165-201.
Müller, B. 2010. Idaea gelbrechti Hausmann, 2003 new for Spain and Europe (Lepidoptera: Geometri-
dae). - SHILAP, Revista de lepidopterologia 38 (150): 159-163.
Ortiz, A. S., M. Garre, J. J. Guerrero, R. M. Rubio & J. A. Calle 2009. Contribuciön al conocimiento de la
familia Geometridae (Lepidoptera) del Parque Natural de la Serrania de Cuenca (Peninsula Ibérica). —
Boletin de la Asociaciön Española de Entomologia 33: 211-226.
Ortiz, A. S., M. Garre, J. J. Guerrero, R. M. Rubio & J. A. Calle 2010a. Nuevas datos sobre los macrole-
pidöpteros (Lepidoptera) del sureste de la peninsula Ibérica. — Boletin de la Asociaciön Española de
Entomologia 34: 123-143.
Ortiz, A. S., M. Garre, J. J. Guerrero, R. M. Rubio & J. A. Calle 2010b. Los Geométridos (Lepidoptera)
del Parque Natural de la Serrania de Cuenca (Peninsula Ibérica). — Boletin de la Asociaciön Española
de Entomologia 34: 395-418.
Nota lepid. 35 (2): 197-231 197
Eupithecia Curtis, 1825 of Afghanistan (Geometridae:
Larentiinae)
VLADIMIR Mironov! & ULRICH RATZEL ?
! Zoological Institute RAS, Universitetskaya nab. 1, RU-199034, Saint Petersburg, Russia;
[email protected]
2 Neureuter Hauptstraße 48A, 76149 Karlsruhe, Germany; [email protected]
(volunteer at the Staatliches Museum fiir Naturkunde Karlsruhe, Germany)
Received 28 November 2011; reviews returned 14 June 2012; accepted 9 July 2012.
Subject Editor: Sven Erlacher.
Abstract. In this paper 49 species of the genus Eupithecia Curtis, 1825 (Lepidoptera, Geometridae) are
recorded for the fauna of Afghanistan. The type specimens of the majority of these species were studied.
In case of Eupithecia ochrovittata Christoph, 1887 it was necessary to designate a lectotype. The follow-
ing three new species are described: Eupithecia tabestana sp. n., Eupithecia fredi sp. n. and Eupithecia
naumanni sp. n. Five taxa are synonymised: Eupithecia linariatoides Mironov, 1989 syn. n. is a Synonym
of Eupithecia mirificata Brandt, 1938; Eupithecia denotata f. difficilis Dietze, 1911 syn. n., synonym of
Eupithecia nigrilinea (Warren, 1896); Eupithecia eberti Vojnits, 1978 syn. n., synonym of Eupithecia ob-
tinens Brandt, 1941; Eupithecia subomnigera Vojnits, 1988 syn. n., synonym of Eupithecia tshimganica
Viidalepp, 1988; Eupithecia procera Vojnits, 1982 syn. n., synonym of Eupithecia exactata Staudinger,
1882. A total of 42 species are recorded as new for the fauna of Afghanistan.
Zusammenfassung. In dieser Arbeit werden insgesamt 49 Arten der Gattung Eupithecia Curtis, 1825
(Lepidoptera, Geometridae) für die Fauna von Afghanistan belegt. Für die überwiegende Zahl der Arten
konnten die Typen untersucht werden. Für Eupithecia ochrovittata Christoph, 1887 wurde ein Lectotypus
designiert. Drei Arten werden neu beschrieben: Eupithecia tabestana sp. n., Eupithecia fredi sp. n. und
Eupithecia naumanni sp. n. Fünf Taxa werden synonymisiert: Eupithecia linariatoides Mironov, 1989
syn. n. ist ein Synonym von Eupithecia mirificata Brandt, 1938; Eupithecia denotata f. difficilis Dietze,
1911 syn. n., Synonym von Eupithecia nigrilinea (Warren, 1896); Eupithecia eberti Vojnits, 1978 syn. n.,
Synonym von Eupithecia obtinens Brandt, 1941; Eupithecia subomnigera Vojnits, 1988 syn. n., Synonym
von Eupithecia tshimganica Viidalepp, 1988; Eupithecia procera Vojnits, 1982 syn. n., Synonym von
Eupithecia exactata Staudinger, 1882. Insgesamt werden 42 Arten als neu fiir die Fauna von Afghanistan
dokumentiert.
Introduction
The genus Eupithecia includes nearly 1400 known species distributed worldwide. It is
one of the most species-rich genera of the family Geometridae but has hardly been stud-
ied in Afghanistan until now. Only two representatives of the genus have been described
from this large Asian country by Vojnits (1988): E. convallata terricolor Vojnits, 1988
and FE. xanthomixta Vojnits, 1988, and two species, E. egregiata Mironov & Ratzel,
2008 and E. nigrilinea Warren, 1896, have recently been mentioned for Afghanistan
(Mironov et al. 2008c). However, Eupithecia of the adjacent territories has been inves-
tigated fairly well, e.g., Turkmenistan, Uzbekistan, and Tajikistan (Staudinger 1892;
Dietze 1904, 1908; Viidalepp 1988, 1996; Mironov 1990, 1991), Iran (Bytinski-Salz &
Brandt 1937; Brandt 1938, 1941; Schwingenschuss 1939; Vojnits 1978, 1982a, 1982b,
1988), northern Pakistan and Kashmir (Mironov et al. 2008a, 2008b, 2008c). For this
Nota lepidopterologica, 15.11.2012, ISSN 0342-7536
198 Mironov & RATZEL: Eupithecia of Afghanistan
Turkmenistan |
6:
| Kandahar
Fig. 1. Map of Afghanistan with the main localities of the material from the SMNK (for details see text):
1. E Afghanistan (Paghman); 2. E Afghanistan (Kabulschlucht, Khurd Kabul, Sarobi, Pol-i-Charchi);
3. E Afghanistan (Salang-Pass, Salang); 4. E Afghanistan, (Kunar, Nuristan, Barg e Matal, Kamu); 5. SE
Afghanistan (Paktia, Safed Koh, Kotkai); 6. Z-Afghanistan, Koh-i-Baba (Band-i-Amir, Panjao); 7. NE
Afghanistan, Prov. Badakshan (Baharak, Pejui, Sarekanda); 8. NE Afghanistan, Wakhan-Valley (Langar,
Zemestani Baharak, Kotal-e-Dalez, Darrah-e-Shaur, Sargaz, Sarhad); Source of map: Urutsek — Wikipedia.
area about 170 species of Eupithecia have been recorded. In Europe, for comparison,
there are 128 species (Mironov 2003).
The first time a few specimens from Afghanistan were collected in 1941 and 1942 by
Fred Brandt, whose material is now deposited in the collection of his brother Wilhelm
Brandt in NHRS (Stockholm). The greater part of Afghanistan Eupithecia was col-
lected later by FH. G. Amsel (SMNK), G. Ebert, M. Müller (SMNK), TC. Naumann
(ZFMK), +F. Kasy (NHMW) and FA. & E. Vartian (Vienna) from 1956 to 1972. The
majority of this material has remained undetermined.
The main component of the material we used for this paper comes from the large
collection of Irano-Afghanian Lepidoptera ofthe Museum of Natural History Karlsruhe
(SMNK). Unfortunately, it is still unclear where the material collected by H. G. Amsel
during the “Deutsche Afghanistan Expedition” in 1956 is deposited. After this man-
uscript was already in review, in March 2012 we found undetermined material of
Eupithecia from Afghanistan in the large collection of the ZSM, collected by G. Ebert
in 1961 and K. Omoto in 1963. From this material we included the important species;
Nota lepid. 35 (2): 197-231 199
however, 50 of about 130 of these specimens belong to the innotata-species group, and
because of their worn condition we decided to exclude them from this study.
Nearly all localities of collected Eupithecia in Afghanistan mentioned in this work
are illustrated on a map (Fig. 1). This map only provides an overview and not the exact
positions of the localities.
Methods
This paper is essentially a faunistic list and constitutes a revision of the species of Eu-
pithecia found in Afghanistan. We have been able to locate and examine almost all
of the original type material used by K. Dietze, O. Staudinger, ©. Bohatsch (MNHU,
Berlin), G. F. Hampson, W. Warren, E. P. Wiltshire, H. Inoue (BMNH, London), S. Al-
phéraky, H. Christoph (ZISP, Saint Petersburg), W. Petersen (IAET, Tartu; MNHU,
Berlin), W. Brandt (NHRS, Stockholm), E. Schütze (ZSM, Munich; SMNS, Stuttgart),
R. Pinker (NHMW, Vienna), A. M. Vojnits (HNHM, Budapest; MNHU, Berlin; ZFMK,
Bonn; SMNK, Karlsruhe; ZISP, Saint Petersburg) and J. Viidalepp (IAET, Tartu; ZISP,
Saint Petersburg). Likewise, we examined the types of 73 species-level taxa from the
87 (84%) that are mentioned in this paper. Most of the types that we did not examine
are early-described species with lost (syn)types such as, for example, E. venosata (Fa-
bricius, 1787), E. simpliciata (Haworth, 1809), E. subnotata (Hübner, 1813), E. centau-
reata (Denis & Schiffermiiller, 1775).
Space prevents the inclusion of genitalia figures for all species treated, but we have
aimed in this paper to illustrate not only the new species described, but also other spe-
cies which have not been figured in recent publications. The sequence of species in this
work follows the groups into which the genus Eupithecia is divided by different authors
(e.g., Mironov 2003).
Abbreviations
BMNH The Natural History Museum, London, United Kingdom
IAET Institute of Agriculture and Environment, Estonian Agricultural University, Tartu, Estonia
IZCAS Institute of Zoology, Chinese Academy of Sciences, Beijing, China
MNHU Museum für Naturkunde, Berlin, Germany
NHMW _ Naturhistorisches Museum Wien, Austria
NHRS Naturhistoriska Riksmuseet, Stockholm, Sweden
SMNK Staatliches Museum für Naturkunde Karlsruhe, Germany
HNHM Hungarian Natural History Museum, Budapest, Hungary
ZFMK Zoologisches Forschungsinstitut und Museum Alexander Koenig, Bonn, Germany
ZISP Zoological Institute, Russian Academy of Sciences, Saint-Petersburg, Russia
ZMMU Zoological Museum, Moscow State University, Russia
ZSM Zoologische Staatssammlung Miinchen, Germany
200 Mironov & RATZEL: Eupithecia of Afghanistan
Systematics
Eupithecia olgae Mironov, 1986
Eupithecia olgae Mironov, 1986: Trudy Vsesojuznogo Entomologicheskogo Obshchestva 67: 96, figs 2a,
b. Holotype 9 (ZISP), Kyrgyzstan: Inner Tian-Shan, Naryn, 2030 m.
Material. Holotype 9, Kyrgyzstan, Inner Tien-Shan Mts., Naryn, at light, 2030 m, 25.vii.1983,
leg. V. Mironov (ZISP). — Paratypes: 29, Kyrgyzstan, environs of Przhevalsk, at light, 1600—1650 m,
6., 22.vi.1982, leg. N. Tristan. 19, Kazakhstan, Aksu-Dzhabagly Nature Reserve, Dzhabagly village,
1300 m, 25.v11.1975, leg. E. Ishkov (ZISP). NE Afghanistan: 19, Wakhan-Tal, 3400 m, Kotal-e-Dalez,
W-Seite, 28.v11.1971, UV-Li, Ebert & Naumann, coll. Nr. 271 (SMNK).
Afghanistan is a new country for the distribution area of this Central Asian species. It
has been known from Uzbekistan, Kyrgyzstan, Tajikistan, Pakistan, and India (Jammu
& Kashmir), southeastern regions of Kazakhstan, China (Tibet, Qinghai, Gansu,
Shanxi), and Mongolia. This species is mentioned here as first because it belongs to the
haworthiata species-group with plate-like, membranous uncus in the male genitalia.
Eupithecia dalhousiensis Mironov & Galsworthy, 2008
Eupithecia dalhousiensis Mironov & Galsworthy, 2008: Transactions of the Lepidopterological Society of
Japan 59 (1): 65, figs 7, 21, 22. Holotype 9 (BMNH), [India]: Dalhousie.
Material. Holotype 9, India, Dalhousie N.W. Amalnym, Moore Coll. 94—106, Phibalapteryx inter-
rubrescens ab. dalhousiensis Strand, type 9, BM Geom. slide no. 2944 (BMNH, originally syntype of
E. interrubrescens). — Paratypes: 19, India, Simla, 7,000 ft., A. E. Jones BM 1931-101; 19, Goorais
Valley, June 1887 J. H. Leech, BM Geom. slide no. 2940; 19, Murree, 19.v.1976; 19, Snogran, 14.v.1970,
M. Anwar, BM Geom. slide no. 7705; 19, Murree, 17.v.1976; 19, Snogran, 15.v.1970, M. Anwar; 1,
Dungagali, 18.v.1970, BM Geom. slide no. 7704 (BMNH). SE Afghanistan: 29, Safed Koh, S-Seite,
Kotkai, 2350 m, 24—25.v11.1967, M. Müller leg., Ratzel slide no. GU211011/1w (SMNK).
A very large species (wingspan 24—37 mm) from the Eupithecia abietaria group (Inoue
1979), which is similar to two other allied Asian species: E. gigantea Staudinger, 1897
and E. interrubrescens (Hampson, 1902). This species was described and has hitherto
been known from Western Himalayas (northern Pakistan and northern India). It was not
previously recorded from Afghanistan.
Remarks. E. dalhousiensis was described in 1919 by Strand as “ab.” (aberration) of
interrubrescens Hampson. Later it was recognized as a separate species (Mironov et
al. 2008a).
Eupithecia mirificata Brandt, 1938
Eupithecia mirificata Brandt, 1938: Entomologische Rundchau 55 (50): 587, pl. 3, figs 291 -293. Holotype
9 (NHRS), [Iran]: Comee.
Eupithecia linariatoides Mironov, 1989 syn. n.: Vestnik Zoologii 1989 (3): 13, figs 2a—d. Holotype ©
(ZISP), Tadjikistan: Khorog, Botanical Garden, 2340 m.
Material. Holotype 9, Iran, Fars, Strasse Ardekan-Talochosroe, Comèe, ca 2600 m, 22.vii.1937, coll.
Brandt, 78/57, coll. RMS, Holotype Eupithecia mirificata Brdt. Brandt, 10, photo 18 F 80 det. A. Vojnits
(NHRS). — Paratype: 19, same locality, 16.viii.1937, coll. Brandt, coll. RMS, Allotype Eupithecia miri-
ficata Brdt. Brandt, photo 19 F 80 det. A. Vojnits (NHRS). — Holotype of E. linariatoides ©, Tajikistan,
Pamir, Horog, Hortus Botan., 2340 m, 17.vi.1963, M.L. Zaprjagaew, ex coll. Zool. Inst. Acad. Sci. St.
Petersburg, Russia (ZISP). — Paratypes of E. linariatoides: 20, 29, same locality, 2340 m, 20, 21.vii.1960,
4.vi.1961, M. Zaprjagaew; 30°, 29, same locality, 2300 m, 19.vii, 2, 4.viii.1966, 1.vi.1970, 8.vii.1971,
Nota lepid. 35 (2): 197-231 201
M. Zaprjagaew; 19, Pamir mer. occ., fl. Gunt, 2700 m, 29.v11.1962, Bundel (ZISP). Afghanistan: 10,
Pandshir Tal, Unteres Parian, 2500 m, 30.v11.1961, leg. G. Ebert (ZSM); 6 exx., Paghman, 30 km NW v.
Kabul, 2100-2500 m, 20-22.v.1963, Kasy & Vartian; 1 ex., Prov. Kadaghan, Salang Paß, Nordseite, 69°L
35°40’B, 11-12.vii.1971, leg. Vartian (HNHM); NE Afghanistan, 20°, Prov. Badakhshan, 1750 m, 12 km
NE of Baharak, Pejuj, 27.vi.1971, UV-Li, leg. Ebert & Naumann, coll. Nr. 224; 10°, Prov. Badakhshan,
3000 m, 15 km NE of Baharak, Kotal-e-Zardeu, 30.vi.1971, UV-Li, Ebert & Naumann, coll. Nr. 230
(SMNK).
In our opinion E. mirificata, described from Iran and E. linariatoides from Tajikistan
are conspecific. The male and female genitalia were illustrated in Mironov (1989b) as
E. linariatoides.
Remarks. Neither the holotype nor paratype (allotype) of this species (E. mirificata)
have an abdomen or labels with information about genitalia slides. However, there is a
series of this species from Afganistan in current material. Eupithecia mirificata appears
to be closely related to E. linariata, and therefore further investigation of the biology
of the early stages and DNA barcoding should be done in the future to clarify the status
of this species.
Eupithecia minusculata Alphéraky, 1883
Euplithecia] minusculata Alphéraky, 1883: Horae Societatis entomologicae Rossicae (1882) 17 (3/4): 225,
pl. 9, fig. 91. Holotype 9 (ZISP), [China]: Kouldja. .
Eupithecia penultimaria Wiltshire, 1985: The Entomologist’s Gazette 36 (4): 265, pl. 9, figs 2, 3, 5: a—c,
6. Holotype 6 (BMNH), Iraq: Baghdad, on a Tigris island (synonymised in Scoble et al. 1999).
Material. Holotype ©, China, Guldscha, 1.v.1879, Alph., minusculata, Origin. (ZISP). — Holotype of
E. penultimaria ©, Iraq, Baghdad, at light on a Tigris island, amongst tamarisks, 10.v.1937 (E.P.W.), BM
Geom. slide no. 2386 (BMNH). — Paratypes of E. penultimaria: 29, same data, BM Geom. slide no. 2416;
19, same data but 3.vi.1937; 19, Baghdad, west bank of Tigris, 14.v.1954 (E.P.W.), BM Geom. slide no.
2417 (BMNH). E Afghanistan: 10°, 19, Nurisan-Bashgal, vic. Barg-e-Matal, 2200 m, 3., 5.vi1.1970, Nr.
11, leg. C. Naumann, E-lep 209, Ratzel slides nos GU24408/1w, GU24408/2m (SMNK).
A widespread desert or xerophilous species, ranging from Spain in the west through
North Africa (Algeria, Tunisia, Libya) and Mid-East eastward to Mongolia; north to
the lower part of the River Volga. It is distributed in Central Asia in Turkmenistan,
Uzbekistan, Tajikistan, Afghanistan, southern Kazakhstan, and northwestern China
(Xinjiang). Not previously recorded from Afghanistan. The male and female genitalia
were described and illustrated by Wiltshire (1985) for the first time as E. penultima-
rid.
Eupithecia venosata (Fabricius, 1787)
Phalaena venosata Fabricius, 1787: Mantissa Insectorum 2: 209. Syntype(s) lost, Austria.
Eupithecia comparanda Vojnits, 1981: Annales Historico-Naturales Musei Nationalis Hungarici 73:
221, figs 1, 2. Holotype S (SMNK), Pakistan (west): Swat, Kalam Gabral-Tal, 2100 m (synonymised
in Mironov et al. 2008b).
Material. Holotype of E. comparanda I, W Pakistan, Swat, Nv. Kalam, Gabral-Tal, 2100 m,
9.v11.1969, leg. G. Ebert, Vojnits slide no. 120930 (SMNK). — Paratypes of E. comparanda: 30, 39, W
Pakistan, Swat, Kalam, 2000 m, 9.vii.1969, leg. G. Ebert, Vojnits slides nos 120940, 120950, 120969,
120990, 121009, 121029 (SMNK); 19, 19, same data, Vojnits slides nos 120970, 120989 (HNHM).
W Afghanistan: 30°, 19, Nurisan-Bashgal, vic. Barg-e-Matal, 2200 m, 3 and 5.vii.1970, Nr. 11, leg. C.
Naumann E-lep 209, prep. U. Ratzel 2008, Ratzel slides nos GU3408/1m, GU3408/3w; 10°, E Afghanistan,
Nuristan-Bashgal, vic. Barg-e-Matal, 3 km W (Seitental), 2500 m, 6.vii.1970, leg. C. Naumann, Nr. 1106,
Ratzel slide no. GU3408/2m (SMNK).
202 Mironov & RATZEL: Eupithecia of Afghanistan
A western Palaearctic species ranging from Portugal and Morocco in the west to the
Baikal Lake in Siberia in the east. A new species for the fauna of Afghanistan. The de-
tails of the male and female genitalia were described and illustrated in Petersen (1910)
for the first time and after that in many other publications of European authors, as well
as in Vojnits (1981) for the E. comparanda from Pakistan.
Eupithecia hilariata Dietze, 1908
Eupithecia hilariata Dietze, 1908: Deutsche entomologische Zeitschrift, Iris 21 (3): 180. Syntypes 20,
19 [nec 10, 29] (coll. K. Dietze and R. Piingeler in MNHU), [Tajikistan]: [Ispajran]; [China]: [Juldus-
Gebirge], [Ili Gebiet].
Material. Syntypes: 19, Tajikistan, Ispajran, Alai sept., 3400 m, August, 124., hilariata Dietze,
Jspajran Alai sept., Orig., ©, Typus, Vojnits slide no. 11780. 19, China, hilariata, Juldus, Ili, Zool. Mus.
Berlin, hilariata Dtze., präp. Nr. A 8350, det. E. Schütze, Kassel; 19, hilariata, Palpen lang, Juldus., Ii,
Zool. Mus. Berlin, Eupithecia hilariata 9, Juldus Ili, prep. Ne 1657.2 E. De Laever det. 1957 (coll. K.
Dietze in MNHU). 10, Asia centr., Kyrgyzstan, Togus-torau, Rückbeil 1901, ? Schiefereri var. © (hi-
lariata), v. R. Tancré, 2.02, hilariata, Sehr nache schiefereri; palpen spitzer u. länger (Dtze.), Eupithecia
hilariata ©, Type, Prep. Ne 1657.1 E. De Laever det. 1957 (coll. R. Püngeler in MNHU). Afghanistan:
19, Pagman-Gebirge (Kabul), ca. 3000 m, Juni—Juli 1942, coll. Brandt, 8, Paratypus Eupithecia frediata
Schüt. (undescribed) ©, E. Schütze, Kassel, photo 16 F 80 det. A. Vojnits (NHRS); 19, Paghman, 30 km
NW v. Kabul, 20-22.v11.1963, 2200 m, Kasy & Vartian, Ratzel slide no. GU12609/1w; 20°, 19, same
locality, but 2500 m, 3., 5., 12., 15.v1.1965, Kasy & Vartian, Ratzel slides nos GU2609/3m, GU31209/1m,
GU12609/2w (NHMW).
A new species for the fauna of Afghanistan. Its range ıs in Turkmenistan (Kugitang
Mts.), Uzbekistan (Karzhan Tau Mts., Chimgan Mt.), Tajikistan (Pamirs Mts.), Kyr-
gyzstan (Tien-Shan Mts.), mountains of southern and southeastern Kazakhstan, and the
northwestern province of China (Xinjiang). The male and female genitalia were de-
scribed and illustrated by De Laever (1960) and Schütze (1960) for the first time.
Eupithecia nigrilinea (Warren, 1896)
Tephroclystia nigrilinea Warren, 1896: Novitates Zoologicae. 3: 317. Holotype @ (BMNH), [India]: Ka-
sauli.
Eupithecia ?denotata f. difficilis Dietze, 1911 syn. n.: Biologie der Eupithecien 1: pl. 85, figs 905-907;
ibidem (1913), 2: 92. Holotype 9 (designated by Vojnits; coll. K. Dietze in MNHU), [Tajikistan]:
Ispajran [=Isfara], 3400 m.
Eupithecia ingrata Vojnits, 1981: Annales Historico-Naturales Musei Nationalis Hungarici 73: 224, fig.
4. Holotype Q (SMNK), Pakistan (west): Swat, N of Kalan Gabral-Tal, 2100 m (synonymised in
Mironov et al. 2008c).
Eupithecia ingrata talvei Viidalepp, 1988: Fauna pyadenits gor Srednej Azii [Geometridae fauna of the
Central Asian mountains]: 121, pl. 2, fig. 18; text-pl. 26, figs 5-10. Holotype S (IAET), Tadzh. SSR
[Tajikistan]: Gissarsky Mts, southern slope, River Khonaka, Shamol.
Material. Holotype 9, India, Kasauli aug. 1893, nigrilinea Warr. Type 9 (BMNH). — Holotype of E.
denotata difficilis 9, Tajikistan, Ispajran, Alai sept., 3400 m. August, difficilis Typ. Alai sept., Holotypus
Eupithecia difficilis Dietze [design. by Vojnits], Vojnits slide no. 10240 9 (coll. K. Dietze in MNHU). —
Paratype of E. denotata difficilis: 10°, Tajikistan, Ispajran, Alai sept., 3400 m. August, difficilis Type.,
Alai sept. (coll. K. Dietze in MNHU). — Holotype of E. ingrata, 9, Pakistan, Swat, N v. Kalam, Gabral-
Tal, 2100 m, 6-9.vii.1969, leg. G. Ebert, Vojnits slide no. 120929 (SMNK). — Holotype of E. ingrata
talvei, ©, Tajikistan, Ghissarsky Mts., southern slope, Khonaka r[iver], Shamol, 7.vi.1976, leg. Talve
(IAET). — Paratype of E. ingrata talvei: 10°, Kyrgyzstan, Mts. Tschatkalensis merid., lacus Sary-Tschilek,
1900 m, 13.vii.1964, Bundel (ZISP). Afghanistan: 19, Pagman-Gebirge (Kabul), ca. 3000 m, vi-vii
1942, coll. Brandt, R. M. Prep. 4898, 7473 E94+, Eup. centripunctata Schü., Präp. Nr. S 12119, det. E.
Schütze, Kassel, Monotypus Eup. centripunctata Schü. (undescribed), E Schütze, Kassel, Naturhistoriska
Nota lepid. 35 (2): 197-231 203
Riksmuseet, Loan no 366/06 (NHRS); 19, NE Afghanistan, Gebirge Badakschan, Sarekanda, 2800 m,
21.vii.1953, J. Klapperich, Ratzel slide no. GU24911/2w (SMNK); 19, E Afghanistan, Sarobi, 1100 m,
17.x.1961, leg. G. Ebert, Ratzel slide no. GU13312/3w; 19, Hazaradjat, Koh-i-Baba, Pandjao Umgeb.,
2500 m, 26.vi—1.vii.1961, leg. G. Ebert, Ratzel slide no. GU13312/4m (ZSM); 150°, 29, SE Afghanistan,
Safed Koh, S-Seite, Kotkai, 2350 m, 14—23.v1.1966, 21.vi-1.v11.1969, G. Ebert leg., Vojnits slides nos
169590, 169600, 169619, 169620, 169669, 175450°, 1754807, 175490, 175500, 195020, 19540,
195420, 195430, 195440, 19545 0°; 169639, 169659; 49, 39, same locality, 20 —25.vi, 4.vii, viii, 1967,
5., 28.vi, 2.vii.1968, M. Müller leg., Vojnits slides nos 169550, 169799, 175649, 175669, 169759,
169769, 195469; 10°, Prov. Paktia, same locality, 16-17.v1.1971, UV-Li, Ebert & Naumann; 10°, 29,
E Afghanistan, Salang-Pass, N-Seite (Khinjan), 2100 m, 5—11.vii.1966, G. Ebert leg., Vojnits slides
nos 195360, 178729, 194959; 10°, 49, C Afghanistan, Koh-i-Baba, S-Seite, Panjao, 2650 m, 20-22.
vii.1966, G. Ebert leg., Vojnits slides nos 177790, 177809, 194909, 195119, 195199 (SMNK); 10°, 49,
C Afghanistan, Koh-i-Baba, N-Seite, Band-i-Amir, 2900 m, 24—26.vi1.1966, G. Ebert leg., Vojnits slides
nos 195219, 194879, 195159, 195529 (SMNK;; coll. Ratzel); 29, E Afghanistan, Salang-Nord, 2100
m, vic. Khindjan, 13.vi.1970, leg. Naumann, Nr. 1067, Ratzel slides nos GU25408/3w, GU25408/4w;
19, 19, NE Afghanistan, Wakhan-Tal, 3300 m, Zemestani Baharak, 23., 24.v11.1971, UV-Li, Ebert &
Naumann, coll. Nr. 261 and 262; 19, same locality, 3450 m, Darrah-e-Shaur, 25.v11.1971, UV-Li, Ebert &
Naumann, coll. Nr. 263 (SMNK); 49, same locality, 3400 m, Kotal-e-Dalez, W-Seite, 28.v11.1971, UV-Li,
Ebert & Naumann, coll. Nr. 271 (SMNK; coll. Ratzel).
This is mainly a mountainous Central Asian species which has been recorded hitherto
from Uzbekistan, Tajikistan, Kyrgyzstan, northern Pakistan, Jammu & Kashmir, India
(Himachal Pradesh), Nepal, and was also found in the mountains of northern Thailand.
It was recorded for the fauna of Afghanistan by Mironov et al. (2008c). E. nigrilinea is
a univoltine summer species, present in habitats from about 1700 m up to about 4500
m above sea-level. The male genitalia were described and illustrated in Inoue (2000),
the female in Vojnits (1981) and Viidalepp (1988) as E. ingrata.
Eupithecia barteli Dietze, 1908
Eupithecia barteli Dietze, 1908: Deutsche entomologische Zeitschrift, Iris 21 (2): 162, pl. 2, figs 13, 14.
Syntypes 1,29 (coll. K. Dietze and R. Püngeler in MNHU), [Kazakhstan]: Uralsk.
Eupithecia artshae Viidalepp, 1988: Fauna pyadenits gor Srednej Azii [Geometridae fauna of the Cen-
tral Asian mountains]: 124, pl. 2, fig. 21; text-pl. 28, figs 2, 3, 6-8. Holotype © (ZISP), Tadzh. SSR
[Tajikistan]: SW Pamirs, Khorog, botanical garden, 2300 m (treated as subsp. of Eupithecia barteli
Dietze, 1908 in Mironov 1990).
Material. Syntypes: ©, Kazakhstan, Uralsk, 2.viii.1907 Max Bartel, Barteli, Q Type. Uralsk., Karl
Dietze, Kann dies aberrative subfulvata sein? Dietze, Zool. Mus. Berlin, Mironov slide no. 4809 (coll. K.
Dietze in MNHU); 19, Uralsk, 24.vii.1905, 4/06 von M. Bartel, n. sp. (Dietze), n. sp. (Bohatsch), Barteli
Q Type, K. Dietze (coll. R. Piingeler in MNHU). — Holotype of E. artshae ©', Tajikistan, Pamir, Chorog,
Nortes Botan., 2300 m, 29.v111.1965, M. Zaprjagaew (ZISP). — Paratypes of E. artshae: 29, same locality,
4.1x.1966, M. Zaprjagaew, Viidalepp prep. 26849, 26859 [ZISP microprep. 17087, 17088]; 19, Pamir oc-
cid., fl. Obi-Chingou, Lulicharwi, 10.viii.1959, 1750 m, A. Bundel. 19 (nec ©), Kyrgyzstan, town Naryn,
23.v11.1982, Mironov V.G. (ZISP). Afghanistan: 19, centr., Bamian, 31.vii.1963, Kasy & Vartian, Vojnits
slide no. 151399 (HNHM); 19, C Afghanistan, Koh-i-Baba, S-Seite, Panjao, 2650 m, 20 —-22.vii.1966, G.
Ebert leg., Vojnits slide no. 195209 (SMNK).
This species is found in Tajikistan, Kyrgyzstan, Jammu & Kashmir, India (Himachal
Pradesh), Nepal, and China (Shaanxi, Yunnan) from about 1300 m up to about 3000 m
above sea-level, and its range extends to the southeast of European Russia and north-
western Kazakhstan in the north. A new species for the fauna of Afghanistan. FE. barteli
is a medium-sized species with distinctive broad and obtuse wings. The presence of a
distinct and relatively large, black discal dot and light, ochreous medial area behind
this discal dot on the forewing are very good characters to distinguish this species from
204 Mironov & RATZEL: Eupithecia of Afghanistan
any other in this area. The male genitalia are very similar to those of other species of
the tripunctaria group, but the female genitalia can be easily recognized by the large
globular corpus bursae with elongated and narrow, S-shaped ductus bursae with numer-
ous longitudinal striations and a row of short spines (Mironov 2003).
Eupithecia vetula Mironov & Ratzel, 2008
Eupithecia vetula Mironov & Ratzel, 2008: Transactions of the Lepidopterological Society of Japan 59
(2): 127, figs 4, 21, 28. Holotype S (SMNK), Pakistan: Azad Jammu & Kashmir, Thunian, 2300 -
2700 m.
Material. Holotype ©, Pakistan, Azad Jammu & Kashmir, Thunian, 2300-2700 m, 25 -30.v111.2004,
leg. V. Gurko, Ratzel slide no GU18505/3m (SMNK). — Paratypes: 80°, 249, same locality, Ratzel slides
nos GU18505/1m, GU18505/2w, GU21505/1w, GU21505/2w, GU22505/2w, GU25505/1w, GU25505/3w,
GU27505/lm (SMNK, coll. Ratzel, BMNH); 19, SW Himalaja, Indus-Kohistan, Kaghantal, Naran,
3200-3400 m, 16.vii-5.v111.1977, leg. De Freina, Ratzel slide GU4507/4w (SMNS); 19, Himalaya Mts.,
Kaghan valley, Tathabaya, 73°26’E, 34°36’N, 2200 m, 1.v.1998, leg. Gy. M. Laszlo & G. Ronkay; 29,
Himalaya Mts., Valley of Indus, between Chilas and Dassu, Motel Barseen, 1100 m, 10.x.1998, leg. Gy.
M. Laszlo & G. Ronkay (HNHM). 19, India, Bhimtal, distr. Nainital, Kumaon-Himalaja, 1500 m, 10-22.
1x.1986, leg. A. Hauenstein (ZFMK). E Afghanistan: 19, Sarobi, 1100 m, 13.1v.1961, leg. G. Ebert,
Ratzel slide no. GU12312/6m (ZSM); 29, SE Afghanistan, Safed Koh, S-Seite, Kotkai, 2350 m, 27.iv. and
5.v1.1968, M. Müller leg., Vojnits slides nos 195239, 195249 (SMNK).
This species, which belongs to the /ariciata group (Bolte 1990), was not hitherto re-
corded from Afghanistan.
Eupithecia conjunctiva Hampson, 1895
Eupithecia conjunctiva Hampson, 1895: Fauna of British India (Moths) 3: 400. Holotype @ (BMNH),
[India]: Dharmsäla.
Material. Holotype 9, India, Dharmsala 87-59, Eupithecia conjunctiva Hmpsn. type 9, BM Geom.
slide no. 20315 (BMNH). SE Afghanistan: 19 Safed Koh, S-Seite, Kotkai, 2350 m, 2.viii.1967, M. Müller
leg., Vojnits slide no. 195019 (HNHM), 10°, same data, 1.vi.1968, Vojnits slide no. 175400 (SMNK).
This species of the /ariciata group is found in northern Pakistan, Jammu and Kashmir,
northern India (Punjab, Sikkim), and Nepal from about 1100 m to about 3000 m above
sea-level. A new species for the fauna of Afghanistan. The male genitalia were de-
scribed and illustrated in Inoue (2000) for the first time.
Eupithecia karnaliensis Inoue, 2000
Eupithecia karnaliensis Inoue, 2000: Tinea 16 (Suppl. 1): 34, pl. 165, fig. 21; figs 1299, 1339. Holotype ©
(coll. Owada; Tokyo), [Nepal]: [Karnali], Jullya, 2690 m.
Misidentification: Eupithecia emikoae Inoue, 1996 (part paratypes ©, 9).
Material. Holotype ©, Nepal, Karnali, Jumla Distr., Jillya, 2690 m, 29.1x.1981, M. Owada, Inoue
slide no. 141370 (NSMT). — Paratypes of E. emikoae: 10°, India, Kashmir, (Kangan-Wayul), Naranag,
2500 m, Aug. 16—18.1982, leg. H. Yoshimoto; 19, NW India, Kashmir, Pahalgam-Kolohoi, Lidderwat,
3000 m, Aug. 8-9.1982, leg. E. Yoshimoto (ZISP). E Afghanistan: 19, Nurisan-Bashgal, 19 km E of
Kamu, 1500 m, 20.x.1970, Nr. 1139, leg. C. Naumann E-lep 209, Ratzel slide no. GU25408/2w; 10°, same
locality, vic. Barg-e-Matal, 2200 m, 21.x.1970, Nr. 1140, leg. C. Naumann E-lep 209, Ratzel slide no.
GU24408/5m; 10°, same locality, 18 km E of Kamu, 1500 m, 29.x.1970, leg. C. Naumann, Coll.-Nr. 1147,
Ratzel slide no. GU24408/6m (SMNK).
A small mountainous species from the propagata group. The similarity and differences
of E. karnaliensis to and from the allied species E. caduca Vojnits, 1984 were described
Nota lepid. 35 (2): 197-231 205
in detail in Mironov et al. (2008c). The male and female genitalia were described and il-
lustrated in Inoue (2000). This little-known species had so far been recorded only from
Great Western Himalaya Mts (Jammu & Kashmir) and Nepal at an altitude of about
2200 m up to about 3200 m above sea-level. First records for Afghanistan.
Eupithecia mustangata Schütze, 1961
Eupithecia mustangata Schütze, 1961: Verôffentlichungen der zoologischen Staatssammlung München
6: 181, pl. 29, figs 4, 9; pl. 31, fig. 4; pl. 32, fig. 1. Holotype © (ZSM), [Nepal]: Mustangbhot, 29°11’N,
83°58’E, Muktinath, 3500 m.
Eupithecia emikoae Inoue, 1996: Transactions of the Lepidopterological Society of Japan 47 (4): 237,
figs 1, 2, 8, 11. Holotype © (coll. H. Inoue in BMNH), [India/Pakistan]: Kashmir, Pahalgam-Kolohoi,
Lidderwat (synonymised in Mironov et al. 2008a).
Material. Holotype ©, Nepal, Mustangbhot, 29°11’n.Br. 83°58’6.L., Muktinath, 3500 m, 5.viii.1955,
leg. F. Lobbichler, Zoolog. Staatsslg., mustangata Schü. Holotypus. Präp. Nr. A 7070 det. E. Schütze,
Kassel, ZSM G13367, photo 84 B 27 det. A. Vojnits (ZSM). — Paratype: 19, Nepal, Mustangbhot, 29°11’n.
Br. 83°58’6.L., Mustang, 3800 m, 14.v111.1955, leg. F. Lobbichler, Zoolog. Staatsslg., mustangata Schü.
Allotypus. Präp. Nr. A 7109 det. E. Schütze, Kassel, ZSM G13368, photo 84 B 28 det. A. Vojnits (ZSM). —
Holotype of E. emikoae ©’, India, Kashmir, Pahalgam-Kolohoi, Lidderwat (3000 m), Aug. 8-9.1982, leg.
E. Yoshimoto, Inoue Coll. B.M. 1992-71, Type status verified K. Buckmaster 1997, BM Geom. slide no.
22012 (coll. H. Inoue in BMNH). NE Afghanistan: 19, 19, Badachschan, Bela Kuran, 2900 m, 12-29.
vii.1963, leg. K. Omoto (ZSM); 19, E-Afghanistan, Nuristan, Bashgal, vic. Barg-e-Matal, Dandizenor,
3300 m, 13.vii.1970, Nr. 1122, leg. C. Naumann, Ratzel slide no. GU9408/5m; 19, NE Afghanistan,
Wakhan-Tal, Sarhad, 3150 m, 6.vii.1971, UV-Li, Ebert & Naumann, coll. Nr. 232; 19, 59, same locality,
3300 m, Zemestani Baharak, 23, 24.vi1.1971, UV-Li, Ebert & Naumann, coll. Nr. 261 and 262; 39, same
locality, 3450 m, Darrah-e-Shaur, 25.vii.1971, UV-Li, Ebert & Naumann, coll. Nr. 263; 80°, 289, same
locality, 3400 m, Kotal-e-Dalez, W-Seite, 27., 28., 29.vii.1971, UV-Li, Ebert & Naumann, coll. Nr. 269,
271 and 272 (SMNK).
This very variable species in size, depth of colour, and the breadth of transverse
lines was previously known only from the mountains of northern Pakistan, Jammu
& Kashmir, northern India (Himachal Pradesh), and Nepal from about 2100 m up to
about 4300 m above sea-level. It is now newly recorded from Afghanistan. The male
and female genitalia were described and illustrated in Schütze (1961a).
Eupithecia pamirica Viidalepp, 1988
Eupithecia pamirica Viidalepp, 1988: Fauna pyadenits gor Srednej Azii [Geometridae fauna of the Central
Asian mountains]: 117, pl. 2, fig. 14; text-pl. 26 (nec 25 and 32, fig. 11), figs 14-17 (nec 8-11).
Holotype 9 (IAET), Tajikistan: Mts. Darwaz, cliv. merid., fl. Wischarvi, 1800 m.
Material. Holotype 9, Tajikistan, Mts. Darwaz cliv. merid., fl. Wischarvi, 1800 m, 8.viii.1958, A.
Bundel (IAET). — Paratypes: 10°, same data (ZISP); 19, Pamir mer. occ., fl. Gunt, 2700 m, 29.vii.1952,
Bundel (ZISP); 10°, Pamir mer. occ., Chorog, 2500 m, 10.viii.1956, Hortus Botan., A. Bundel (ZISP). E
Afghanistan: 59, Salang-Pass, N-Seite, Khinjan, 2100 m, 5—11.vii.1966, G. Ebert leg., Vojnits slides
nos 178740, 178750, 178769, 178770 (SMNK; coll. Ratzel); 19, C Afghanistan, Koh-i-Baba, N-Seite,
Band-i-Amir, 2900 m, 24-26.vii.1966, G. Ebert leg., Vojnits slide no. 195220 (SMNK); 10°, 19, SE
Afghanistan, Safed Koh, S-Seite, Kotkai, 2350 m, 4.viii, 1.1x.1967, M. Müller leg., Vojnits slides nos
169770, 195279 (SMNK).
This little-known, small species, which is common in the mountainous areas of Central
Asia at altitudes from about 1800 m up to about 3500 m above sea-level, has been
recorded from Tajıkistan (Darvazsky Mts., Ghissarsky Mts., SW Pamirs), Kyrgyzstan
(Tchatkal Nature Reserve), and Pakistan (Deosai Mts., Great West. Himalaya Mts.,
206 Mironov & RATZEL: Eupithecia of Afghanistan
Karakoram Mts.). These are new records for Afghanistan. The details of the male and
female genitalia were described and illustrated by Viidalepp (1988).
Eupithecia tabestana Mironov & Ratzel, sp. n. Figs 2, 3, 17, 21
Misidentification: Eupithecia anemica: sensu Mironov et al. 2008b (nec Viidalepp 1988).
Material. Holotype 9, NE Afghanistan, Wakhan-Tal, 3450 m, Darrah-e-Shaur, 25.vii.1971, UV-Li,
Ebert & Naumann, coll. Nr. 263; Eupithecia anemica Viid., Ratzel slide no. GU9208/1w, det. U. Ratzel
(coll. Ratzel). — Paratypes: 19, SE Afghanistan, Prov. Paktia, 2350 m, Safed Koh, S-Seite, Kotkai, 16-17.
vi.1971, Ebert & Naumann, UV-Li, Ratzel slide no. GU9208/3w (SMNK); 29, 49, NE Afghanistan,
Wakhan-Tal, 3300 m, Zemestani Baharak, 23, 24.v11.1971, UV-Li, Ebert & Naumann, coll. Nr. 261 and 262,
Ratzel slides nos GU291109/7m, GU291109/2w, GU9208/2w, Mironov slide no. 8640 (SMNK; 19 and
19 in ZISP). 29, Pakistan, West, Great Himalaya Mts., Near Gabar, 3200 m, 21 —24.viii.2004, leg. Gurko,
coll. Ratzel, Ratzel slides nos GU9705/1w, GU9705/2w; 19, NE Pakistan, Az. Jammu & Kashmir, n.
Jankar, 4200—4500 m, 10-20.v111.2009; leg. Gurko (coll. Ratzel); 10, NE Pakistan, Az. Jammu & Kashmir,
Kaghan valley, n. Naran, 2800 m, 19—20.vi1i.2009, leg. Gurko (coll. Ratzel). Nepal, Dhaulagiri: 19 above
Marpha, Yak Kharka, 3850 m, 15.vi.2012, Ratzel slide no. GU24912/1w, 19 Mukthinath Himal, Lupra,
Bonpo Gompa, 3150 m, 12.v1.2012, , Ratzel slide no. GU24912/2w, leg. Balasz Benedek (coll. Ratzel).
Description. Wingspan 15.0—17.0 mm; length of forewing 8.0—9.0 mm. Labial palpi
short, about two times shorter than diameter of eye, covered with light brown scales.
Frons, vertex, and notum almost unicolorous, yellowish white. Forewing narrow, elon-
gated, with straight costal margin, almost straight, oblique termen and pointed apex;
evenly unicolorous, pale yellowish grey, irrorated by numerous light brown scales;
transverse lines invisible except very narrow, light brown, oblique ante- and postme-
dial; discal dot absent. Hindwing narrow, elongated, paler, also unicolorous yellowish
grey, irrorated with light brown scales, with more or less visible, light brown, medially
right angled onto costa postmedial transverse line only; discal dot invisible; terminal
lines on all wings brown; fringe pale, yellowish grey, almost dirty white, slightly cheq-
uered light brown. Abdomen unicolorous, yellowish white.
Male genitalia (Fig. 17). Uncus medium-length, narrow, biapical. Valve shaped
like a lemon segment, relatively small, narrow, with almost parallel dorsal and ven-
tral margins; apex rounded; sacculus weakly sclerotized. Vinculum short, medium
width, semicircular. Papillae on the anterior arms of the labides small, covered with
sparse setae at apices. Phallus small, slim, much shorter than length of valve. Vesica
armed with one small piece near ductus ejaculatorius base, one elongated and nar-
row, oblique plate-like cornutus, one heavily-sclerotized horn-like cornutus and two
apical horn-like cornuti of original shape. Sternite A8 small, elongated, with almost
parallel lateral margins, slightly asymmetrical basal lobes and two short, narrow,
spine-like, sclerotized and divering apical rods.
Female genitalia (Fig. 21). Bursa copulatrix small, ovate-oblong, membranous,
with four patches of spines: the basal patch with very small and almost invisible spi-
nules, two elongated lateral patches of larger and longer spines, and one transverse patch
of very small, short spines from base of ductus seminalis to base of colliculum. Ductus
bursae indistinguishable from corpus bursae. Ductus seminalis very broad, broadly at-
tached to the middle of corpus bursae. Colliculum collar-like, small and relatively short.
Antrum membranous. Tergite A8 small, trapezoid. Anterior and posterior apophyses
short and narrow. Papillae anales small, short, rounded, covered with short setae.
Nota lepid. 35 (2): 197-231 207
Figs 2-16. Adults of Eupithecia species (scale bar = 10 mm). 2. E. tabestana Mironov & Ratzel, sp. n.
(holotype, 9). 3. E. tabestana Mironov & Ratzel, sp. n. (paratype, ©). 4. E. obtinens Brandt, 1941 (9).
5. E. assectata Dietze, 1904 (9). 6. E. fredi Mironov & Ratzel, sp. n. (holotype, ©). 7. E. fredi Mironov
& Ratzel, sp. n. (paratype, 9). 8. E. infecunda Vojnits, 1981 (9). 9. E. xanthomixta Vojnits, 1988 (Q
from type-locality). 10. E. xanthomixta Vojnits, 1988 (Q from type-locality). 11. E. naumanni Mironov
& Ratzel, sp. n. (holotype, 9). 12. E. naumanni Mironov & Ratzel, sp. n. (paratype, 9). 13. E. nachadira
Brandt, 1941 (9). 14. E. decipiens Petersen, 1910 (©). 15. E. subpulchrata Alphéraky, 1883 (9). 16. E.
ochrovittata Christoph, 1887 (©).
Diagnosis. This species appears to belong to the fletcherata group and is externally
very similar to E. anemica Viidalepp, 1988, but clearly distinguished from it by the
complete absence of medial transverse lines and discal dots on forewings. The male
genitalia of E. tabestana have a longer uncus, longer valve with broader apex, straight
horn-like cornutus and two different apical cornuti on the vesica of phallus than in E.
208 Mironov & RATZEL: Eupithecia of Afghanistan
anemica; the apical rods of the eighth sternite are straight and divering (in E. anemica
they are pincers-like). The female genitalia of E. tabestana can be distinguished from
those of E. anemica by the broader ductus seminalis, smaller medial patches of spines
in the corpus bursae, and also trapezoid eighth tergite.
Distribution. East Afghanistan, northern Pakistan, and central Nepal.
Eupithecia obtinens Brandt, 1941 Fig. 4, 22
Eupithecia obtinens Brandt, 1941: Mitteilungen der Miinchner entomologischen Gesellschaft 31 (3): 875,
pl. 29, fig. 28. Holotype © (NHRS), [Iran]: Kouh 1 Binaloud, 2500-3300 m.
Eupithecia eberti Vojnits, 1978 syn. n.: Acta Zoologica Academiae Scientiarum Hungaricae 24 (3-4):
436, fig. 7. Holotype S (HNHM), Iran (northeast): Kuh i Mirabi, 2200 m.
Incorrect subsequent spelling: obtines: Mohammadian (2006).
Misidentification: Eupithecia sutiliata: sensu Schütze 1961b (nec Christoph 1877).
Material. Holotype ©, Iran, Khorassan, Kouh 1 Binaloud (Meched), 2800 m, 18. Juli 1938, Coll.
Brandt, 96./57, coll. RMS, Holotype Eupithecia obtinens Brdt. Brandt, R.M. prep. 4916, sutiliata Chr.
Präp. Nr. A 8980 det. E. Schütze, Kassel, photo 28 A 80 det. A. Vojnits (NHRS). — Paratypes: 19, Iran,
Khorassan, Kouh 1 Binaloud (Meched), 2500 m, 16. Aug. 1938, Coll. Brandt, coll. RMS, Allotype
Eupithecia obtinens Brdt. Brandt, 52, photo 29 A 80 det. A. Vojnits; 19, same locality, 2800 m, 15. Juli
1938, Coll. Brandt, Paratype Eupithecia obtinens Brdt. Brandt, 53; 10°, same locality, 3000 m, 25.vii.1938,
coll. Brandt, Paratype Eupithecia obtinens Brdt. Brandt, Vojnits slide no. 7440 (NHRS); 19 (?), Iran,
Khorassan, Kouh i Binaloud (Meched), 3000 m, 30.v11.1938, coll. Brandt, Brit. Mus. 1964, 454 (BMNH). —
Holotype of E. eberti ©, Iran, Kuh i Mirabi, Geröllzone, 2200 m, Juli-Anf. Aug., Exp. Wernicke, Vojnits
slide no. 113429 (HNHM). NE Afghanistan: 39, Badachschan, Bela Kuran, 2900 m, 12-29.vi1.1963,
leg. K. Omoto (ZSM); 20%, 19, C Afghanistan, Koh-i-Baba, S-Seite, Shah-tu-Pass, 3000 m, 17-19.
vii.1966, G. Ebert leg., Vojnits slides nos 175630, 195100, 175629 (SMNK); 1, centr., Band-i-Amir,
67°L / 34°25’B, 2800 m, 15-16.v11.1971, leg. Vartian, Vojnits slide no. 151060 (HNHM); 19, Salang,
2700 m, 3-6.v11.1975, leg. W. Thomas (coll. Sommerer).
Brandt has described only the habitus of this species. The male genitalia were de-
scribed and illustrated by Schütze (1961b) on the basis of slide A898S for the first time.
However, Schütze treated this species as E. sutiliata Christoph, 1877 and synonymised
the species name E. obtinens with this later in the text erroneously. In fact, two type-
specimens (lectotype male and paralectotype female) of E. sutiliata are deposited, re-
spectively, in the collections of ZISP (Saint Petersburg) and BMNH (London), from
where Schütze did not study any material. Later on, the male genitalia of £. obtinens
were described and illustrated by Vojnits (1978) again as E. eberti. The female geni-
talia of E. obtinens were previously unknown. We therefore include a description and
illustration of the female genitalia.
Female genitalia (Fig. 22). Bursa copulatrix relatively large, pouch-like, even-
ly tapered to colliculum, with characteristic heavily sclerotized, rounded protuberance
on one side near base, and with patch of longer spines in this protuberance; corpus
bursae about one half covered with slim spines. Ductus bursae not distinctly separated
from corpus, with one or two patches of small spines near base of colliculum. Ductus
seminalis narrow, slightly broadened basally, attached to medium part of corpus bur-
sae opposite of heavily sclerotized basal sack. Colliculum collar-like, rather short and
broad. Antrum short and broad, membranous. Tergite A8 rectangular, with rounded
posterior corners. Anterior and posterior apophyses very narrow, medium length, ta-
pered apically. Papillae anales narrow, short, rounded, covered with medium-sized
setae.
Nota lepid. 35 (2): 197-231 209
Eupithecia assectata Dietze, 1904 Fig. 5
Euplithecia] assectata Dietze, 1904: Deutsche entomologische Zeitschrift, Iris (1903) 16 (2): 346, pl. 3,
figs 20, 21. Syntypes 7, 0, Q (coll. K. Dietze in MNHU), Central Asia [Uzbekistan]: Tura; Samarkand;
[Kyrgyzstan]: (near lake) Issyk-Kul; Togus-torau (Kogard-tau).
Material. Syntypes: 19, Asia, Uzbekistan, Samarkand, E 1893, 21, 32, assectata n. sp., Original (K.
Dietze), 9 hat Stgr auch von Samarkand A205 Hbhr., Genital-Unters. Nr. Eu 72, Zool. Mus. Berlin. 19,
Kyrgyzstan, Togus Tjurae, Kogard Tau, assectata n. sp. Type (coll. K. Dietze in MNHU). Afghanistan:
19, Pagman-Gebirge (Kabul), ca. 3000 m, Juni—Juli 1942, coll. Brandt, R.M. prep. 4912, 7474 E94+, E.
subundata Schü., Präp. Nr. S 12080° det. E. Schütze, Kassel, Monotypus Eup. subundata Schü. (unde-
scribed), E. Schütze, Kassel, Naturhistoriska Riksmuseet Stockholm, Loan no 367/06 (NHRS); 19, SE
Afghanistan, Safed Koh, S-Seite, Kotkai, 2350 m, 14—17.viii.1966, G. Ebert leg., Vojnits slide no. 195359;
19, 29, E Afghanistan, Salang-Nord, 2100 m, vic. Khindjan, 13.v1.1970, leg. C. Naumann, Nr. 1067,
Ratzel slides nos GU25911/1m, GU1109/Sw, GU25911/2w; 69, 89, NE Afghanistan, Prov. Badakhshan,
15 km NE of Baharak, Kotal-e-Zardeu, 3000 m, 28, 30.v1.1971, UV-Li, Ebert & Naumann, coll. Nr. 226
and 230, Ratzel slides nos. GU301011/1m, GU301011/2m, GU301011/3w, GU301011/4w, GU41111/1w;
29, C Afghanistan, Koh-i-Baba, N-Seite, Band-i-Amir, 2900 m, 24—26.vii.1966, G. Ebert leg., Vojnits
slides nos 177640, 194889; 10°, E Afghanistan, Salang-Pass, N-Seite (Khinjan), 2100 m, 5—11.vii.1966,
G. Ebert leg., Vojnits slide no. 194940; 49, NE Afghanistan, Wakhan-Tal, 3300 m, Zemestani Baharak,
10, 23.vii.1971, UV-Li, Ebert & Naumann, coll. Nr. 242 and 261, Ratzel slide no. GU24911/6w; 19, same
locality, Sarhad, 3150 m, 9.vii.1971, UV-Li, Ebert & Naumann, coll. Nr. 240 (SMNK).
This is a very variable species, forewings varying from pale grey unicolorous almost
without pattern to specimens with dark grey colouration and very distinct blackish
transverse lines on the forewings. According to structure of the female and male geni-
talia, especially rows of horn-like cornuti on the vesica, this species belongs to the
fletcherata group and at least appears related to E. obtinens Brandt, 1941. The male
and female genitalia were described and illustrated in De Laever (1960) and after-
wards in Viidalepp (1988). This is a Central Asian mountainous species distributed in
Uzbekistan, Tajikistan, Kyrgyzstan, Afghanistan, and Kashmir at altitude from about
2350 m up to about 3750 m above sea-level. First records for Afghanistan.
Eupithecia fredi Mironov & Ratzel, sp. n. Figs 6, 7, 18, 23
Material. Holotype ©, Afghanistan, Pagman-Gebirge, 25 km NW of Kabul, ca. 2500 m, 17.vi.1941,
leg. Fred Brandt, Vojnits slide no. 170319 (SMNK). — Paratypes: 80°, 39, same data, Vojnits slides nos
170270, 170280, 170309, 170349, 170350, 170369, 170370, 170380, 170299, 170329, 170339
(SMNK; 19 and 19 in ZISP); 19, SE Afghanistan, Safed Koh, S-Seite, Kotkai, 2350 m, 1.ix.1967, M.
Müller leg., Vojnits slide no. 169690 (SMNK).
Description. Wingspan 18.0—22.5 mm; length of forewing 9.0—11.5 mm. Labial pal-
pi equal or shorter than diameter of eye, covered with mixture of light brown and
grey scales. Frons, vertex, patagia, and notum pale grey with scattered brown scales.
Forewing narrow, elongated, with straight costal margin, curved near apex only, almost
straight, oblique termen and pointed apex; ground colour brownish grey; transverse
lines oblique, slightly wavy posteriorly, right or sharply angled onto costa; medial line
usually more sinuate, oblique, and sharply angled onto costa, terminal area with almost
straight or slightly wavy, oblique whitish subterminal line; discal dot usually invisible.
Hindwing ovoid, almost unicolorous, brownish grey but lighter than forewing; termi-
nal area slightly darker; transverse lines indistinct except ante- and postmedial at anal
margin; discal dot invisible. Fringe on all wings distinctly chequered brownish grey
and dirty white.
210 Mironov & RATZEL: Eupithecia of Afghanistan
Figs 17-18. Male genitalia of Eupithecia species (scale bar = 1 mm: with sternite A8, and lateral view of
uncus and papillae on the anterior arms of labides enlarged). 17. E. tabestana Mironov & Ratzel, sp. n.
18. E. fredi Mironov & Ratzel, sp. n.
Male genitalia (Fig. 18). Uncus narrow, elongated, biapical. Valve medium-
sized, with almost straight and parallel costal and ventral margins; ventral margin
with obtuse process placed near apex of valva; apex of valva very narrowly round-
ed; sacculus rather sclerotized (see remarks). Vinculum short, broad, semicircular.
Papillae on the anterior arms of the labides medium-sized, covered with short setae
at apices. Phallus large, broad, almost equal to valval length. Vesica armed with
one elongated plate-like cornutus and some horn-like, heavily sclerotized cornuti,
which group into two rows (one longer than other with one much larger and longer
cornutus). Sternite A8 short and broad, with two broad, sharply tapered and slightly
apically divering arms; basal emargination relatively narrow and deep; apical hollow
membranous, narrow and deep.
Nota lepid. 35 (2): 197-231 211
Female genitalia (Fig. 23). Bursa copulatrix pouch-like, relatively small, short
and broad, sclerotized, with numerous longitudinal wrinkles, armed with two patches
of spines (one basal along anterior wall of bursa of slim spines with much larger some
lateral spines on both sides, and other smaller, oblique patch of small spines near base
of colliculum). Ductus bursae indistinct from corpus. Ductus seminalis narrow, slightly
broadened at base, attached to medium part of corpus bursae. Colliculum collar-like,
short and very broad. Antrum short and broad, membranous. Tergite A8 rectangular.
Anterior and posterior apophyses short and narrow. Papillae anales relatively small,
short and narrow, tepered apically, covered with long and medium-sized setae.
Diagnosis. This species appears to belong to the fletcherata group. It is externally
similar to E. assectata Dietze, 1904, but can be distinguished from it by the narrower
forewing with more pointed apex and more oblique termen. There are no significant
differences in the colouration and pattern of the wings between these species. The male
genitalia of the new species are most similar to those of E. assectata, but can be distin-
guished from it by the narrower basal part of uncus, with longer and narrower apical
part, very different shape of valva with straight ventral margin almost parallel to dorsal
margin, the presence of a short and obtuse process on ventral margin near the apex,
which is narrower in the new species than in E. assectata. The cornuti on the vesica of
E. fredi are larger on the whole, with one very large cornutus, which slightly shorter
than the phallus of E. assectata. The sternite A8 broader, with longer apical arms and
deeper basal and membranous apical emargination than in the male of E. assectata. The
female genitalia of E. fredi can be easily separated from those of E. assectata by the
more sclerotized corpus bursae with longer, numerous longitudinal wrinkles, broader
colliculum, the presence of two patches of much larger and longer marginal spines in
the spiniferous area and narrower anterior and posterior apophyses.
Distribution. East Afghanistan.
Etymology. This species is named in honour of the German lepidopterologist Fred
Brandt. He was one of the first collectors of Lepidoptera in Afghanistan. There is an
interesting story about his collecting of material of Eupithecia fredi. Speaking Farsi
fluently, in the 1930s F. Brandt was very active in Iran, where he found a lot of new
species of Geometridae and Noctuidae. These were described by his brother Wilhelm
Brandt, living in Helsinki, Finland. At that time the two of them had a good working re-
lationship with the well-known British lepidopterist E. P. Wiltshire CBE and they dedi-
cated several species to him (e.g. /daea wiltshirei Brandt, 1938 and Xanthorhoe wilt-
shirei Brandt, 1941). Shortly afterwards, as the political climate changed, they found
themselves standing on the opposing sides. Fred Brandt visited Afghanistan during the
Second World War in the years 1941 and 1942. He was there on an official mission of
the German Abwehr (Foreign Intelligence Service). In the night of 18/19 July 1941,
together with Dr. M. Oberdörffer, a medical doctor and specialist in tropical medicine,
they came under fire in Logar near Kabul (the so called “Logar incident”). Fred Brandt
was badly injured, and his partner died. Four weeks before this, Brandt remarkably
found time to collect moths in the Paghman area! The main part of the type series of
Eupithecia fredi was collected there in that period. Nearly all other specimens from this
collecting event were lost.
212 Mironov & RATZEL: Eupithecia of Afghanistan
Remarks. All Vojnits slides of genitalia in the type-series of this species were boiled
for too long, and unfortunately this left crucial details barely, if at all, visible.
Eupithecia nepalata Schütze, 1961
Eupithecia nepalata Schütze, 1961: Veröffentlichungen der zoologischen Staatssammlung München 6:
179, pl. 29, figs 1, 6; pl. 30, figs 1, la, 1b, 2. Holotype © (ZSM), Nepal: Mustangbhot, 29°11’n, Br.
83 58’6.L., Kehami, 3700 m.
Eupithecia abundeli Vojnits, 1988: Annales Historico-Naturales Musei Nationalis Hungarici 80: 83, pl. 2,
figs 13, 14; pl. 6, figs 41-44. Holotype Q (ZISP), [Tajikistan]: Pamir, Schach-Darensis Mts, Cliv.
Sept., Badjond-Dara River, 3500 m (synonymised in Mironov et al. 2008b).
Eupithecia petrensis Mironov, 1989: Entomologicheskoe Obozrenie 68 (2): 371, figs 9-11. Holotype ©
(ZMMU), Tajıkskaya SSR [Tajikistan]: Khorog, Botanical Garden (synonymised in Mironov et al. 2008b).
Material. Holotype ©, Nepal, Mustangbhot, 29°11’n. Br., 83°58’ 6. L., Kehami, 3700 m, 12.viii.1955,
leg. F. Lobbichler, ZSM slide no. G38929 (ZSM). — Paratype: ©, Nepal, Mustangbhot, 29°11’n.Br.,
83°58’6.L., Penga, 3800 m, 8.vin.1955, leg. F. Lobbichler (ZSM). — Holotype of E. abundeli 9, Tajikistan,
Pamir, Mts. Schach-Darensis, cliv. sept., fl. Badjond-Dara, 3500 m, 31.v1.1961, Bundel, Vojnits slide
no. 176899 (ZISP). — Holotype of E. petrensis ©, Tajikistan, Khorog, Botanical Garden, 24.vii.1958,
leg. A. Tzvetajev (ZMMU). NE Afghanistan: 20°, Badachschan, Bela Kuran, 2900 m, 12-29.v11.1963,
leg. K. Omoto (ZSM); 19, E Afghanistan, Nuristan: Bashgal, vic. Barg-e-Matal: Dandizenor, 3000 m,
13.vii.1970, Nr. 1122, leg. C. Naumann, Ratzel slide no. GU24911/8w (SMNK); 29, 159, Wakhan-Tal,
3300 m, Zemestani Baharak, 23, 24.v11.1971, UV-Li, Ebert & Naumann, coll. Nr. 261 and 262, Ratzel
slides nos GU12208/3m, GU9208/6w, GU15208/1w, GU 15208/2w, GU15208/4w, GU24911/1w (SMNK
and coll. Ratzel); 39, same locality, 3450 m, Darrah-e-Shaur, 25.vii.1971, UV-Li, Ebert & Naumann, coll.
Nr. 263, Ratzel slide no. GU14208/3w (coll. Ratzel).
A Central Asian mountainous species, which is externally similar to the common E.
relaxata Dietze, 1904. It had hitherto been recorded from Tajikistan, northern prov-
inces of Pakistan and India, and from Nepal. It has not been previously recorded from
Afghanistan.
Eupithecia thermosaria Hampson, 1903
Eupithecia thermosaria Hampson, 1903: Journal of the Bombay Natural History Society 14 (4): 644.
Holotype 9 (BMNH), [India]: Kashmir, Kokser.
Eupithecia jaani Mironov, 1989: Entomologicheskoe Obozrenie 68 (2): 370, figs 5-8, 13. Holotype ©
(ZISP), Tadzhikskaya SSR [Tajikistan]: Vanchsky Mts, Abdukagor Ravine, Dal’nee, 2900 m (syn-
onymised in Mironov et al. 2008b).
Misidentification. Eupithecia scortillata: sensu Viidalepp 1988 (nec Dietze 1904).
Material. Syntypes: 19, India, Leech Coll. 1900—64, Kashmir, Thompson, Type, Eupithecia ther-
mosaria Hmpsn. type 9, Figured in Seitz, Vol. 4, BM Geom. slide no. 11805; 19, Kokser, H McArthur
coll., July 1888 (BMNH). — Holotype of E. jaani ©, Tajikistan, Wantsch, fl. Abdukagor, loc. Dalnee, 2900
m, 9.viii.1955, A. A. Bundel, E. scortillata ?, 47, Viidalepp praep. no. 23470 (ZISP). — Paratypes of E.
jaani: 30, 19, same locality, 9, 10.viii.1955, A. A. Bundel, Viidalepp praep. no. 23489; 10°, Pamir merid.
occid., Mts. Schachdarensis cliv septr., fl. Seidj-Dara, 3250 m, 27.vii.1957, A. Bundel, Viidalepp praep.
no. 23550; 10°, same locality, fl. Schobeg, 2500 m, 5.viii.1959, A. A. Bundel; 19, Darwaz occid., Mts.
Chazreti-Scho, fl. Don Duschkan, 25.vii.1959, 2200 m, A. A. Bundel, Viidalepp praep. no. 23399; 19,
Ghissarsky Mts., Takobskoe gorge, 12.viii.1953, Potopolsky, Viidalepp praep. no. 23549; 19, Pamirian
highway, vill. Alichur, 25.vii.1980, V. Prasolov, Viidalepp praep. no. 25959 (ZISP). C Afghanistan: 19,
Koh-i-Baba, S-Seite, Panjao, 2650 m, 20—22.vii.1966, G. Ebert leg., Vojnits slide no. 195560 (SMNK);
30, 19, same locality, N-Seite, Band-i-Amir, 2900 m, 24—26.vii.1966, G. Ebert leg., Vojnits slides nos
177619, 177620, 177639, 195329 (SMNK; coll. Ratzel); 19, same data, Vojnits slide no. 195339
(HNHM); 10, E Afghanistan, Nuristan, Bashgal, vic. Bang-e-Matal, Jandizenor, 3000 m, 13.v11.1970, Nr.
1122, leg. C. Naumann; 10°, 19, NE Afghanistan, Wakhan-Tal, 3300 m, Zemestani Baharak, 10.vii.1971,
UV-Li, Ebert & Naumann, coll. Nr. 242, Ratzel slide no. GU291109/5m; 19, same locality,, 3450 m,
Darrah-e-Shaur, 25.vii.1971, UV-Li, Ebert & Naumann, coll. Nr. 263, Ratzel slide no. GU291109/3w
Nota lepid. 35 (2): 197-231 213
(SMNK); 29, same locality, 3400 m, Kotal-e-Dalez, W-Seite, 27.vii.1971, Ebert & Naumann, UV-Li, coll.
Nr. 269 (SMNK; coll. Ratzel); 10°, same locality,, Sargaz, 2930 m, 11.vi11.1971, UV-Li, Ebert & Naumann,
coll. Nr. 290 (SMNK).
This species has hitherto been recorded from Jammu & Kashmir, Kyrgyzstan, and Taji-
kistan. It had not previously been recorded from Afghanistan. It is distributed in the
mountains at altitudes from 2800 up to 4500 m above sea-level. The details of the male
(phallus, cornuti, and eighth sternite) and female (corpus bursae) genitalia of E. ther-
mosaria were described and illustrated in Viidalepp (1988) erroneously as E. scortil-
lata Dietze, 1904. Later, this species was described again as E. jaani Mironov, 1989.
Eupithecia costipicta Warren, 1893
Eupithecia costipicta Warren, 1893: Proceedings of the Zoological Society London 1893 (2): 383, pl. 30,
fig. 21. Holotype 9 (BMNH), [India]: Sikkim, 8000 ft.
Material. Holotype 9, India, Sikkim, O. Möller, 8000, 89, Eupithecia costipicta Warr. Type 9,
Collectio H. J. Elwes, BM Geom. slide no. 20130 (BMNH). SE Afghanistan: 19, Safed Koh, S-Seite,
Kotkai, 2350 m, 9.1x.1967, M. Müller leg., Vojnits slide no. 175679 (SMNK).
This is a rare Asian mountainous species, which belongs to the subfuscata group and
is distributed in Jammu & Kashmir, Nepal, India (Sikkim), and Central China (Hubei,
Hunan) from about 2300 m up to about 3500 m above sea-level. Not hitherto known
from Afghanistan.
Eupithecia vivida Vojnits & De Laever, 1978
Eupithecia vivida Vojnits & De Laever, 1978: Acta Zoologica Academiae Scientarum Hungaricae 24
(1-2): 238, figs 18, 20. Holotype 9 (ZFMK), China: North Yunnan, Li-kiang.
Eupithecia producta Vojnits, 1981: Annales Historico-Naturales Musei Nationalis Hungarici 73: 222, fig.
3. Holotype 9 (SMNK), India (north): Kumaon Bhimtal (Nainital), 1450 m. [Junior primary homonym
of Eupithecia producta Bastelberger, 1911; Peru.]
Eupithecia wolfi Vojnits, 1985: Acta Zoologica Hungarica 31 (1-3): 272. [Replacement name for Eupi-
thecia producta Vojnits, 1981] (synonymised in Mironov et al. 2008b).
Material. Holotype 9, China, Provinz Nord-Yuennan, Li-kiang [Lijiang], X, 17.111.1935, H. Hone,
Vojnits slide no. 110579 (ZFMK). — Paratypes: 130°, 129, same locality, 26-27, 30.viii, 24.1x.1934, 9., 11.,
13-14., 17-19., 21-25., 28., 31.111, 2—3, 5, 20.1v.1935, H. Höne, Vojnits slides respectively nos 10901,
108840, 110129, 110119, 110109, 10996, 110259, 108819, 109950, 110569, 109049, 110589,
110249, 110039, 110519, 110509, De Laever slides respectively nos 2129, 3710, 2220, 2289, 3440,
2210, 3459, 2109, 2090 (ZFMK); 119, 129, same locality, 8-9., 11—14., 19-21., 23—25., 28.111, 3.1v,
6.1x.1935, H. Hone, Vojnits slides nos 108859, 10929, 10961, 10985¢,, 109869, 109879, 109889,
109939, 109949, 110059, 110069, 110089, 110099, 110139, 110189, 110200, 110269, 110520,
11053, 110549, 110550 (two specimens without abdomens, HNHM); 29, Tibet, Batang, Im Tal des
Yangtze (ca. 2800 m), 5, 6.1v.1936, H. Hone, Vojnits slides nos 108789, 109029 (HNHM). — Holotype
of E. producta 9, N India, Kumaon Bhimtal (Nainital), 1450 m, 23.ix.1973, Lichtfang, leg. S. Richter,
Vojnits slide no. 121249 (SMNK). — Paratype of E. producta: 19, same locality, 6.ix.1973, Lichtfang,
leg. S. Richter, Vojnits slide no. 121279 (HNHM). E Afghanistan: 10°, Nurisan-Bashgal, 19 km E of
Kamu, 1500 m, 20.x.1970, Nr. 1139, leg. C. Naumann E-lep 209 (SMNK).
A single small Afghanian specimen of the second or third generation is damaged (with-
out right hindwing and abdomen). The pattern on the forewings is characteristic for
E. vivida. It is a new species for the fauna of this country.
214 Mironov & RATZEL: Eupithecia of Afghanistan
Eupithecia infecunda Vojnits, 1981 Fig. 8
Eupithecia infecunda Vojnits, 1981: Annales Historico-Naturales Musei Nationalis Hungarici 73: 225, fig.
5. Holotype @ (SMNK), Pakistan (west): Swat, Kalam, 2000 m.
Material. Holotype 9, W Pakistan, Swat, Kalam, 2000 m, 9.vii.1969, leg. G. Ebert, Vojnits slide no.
120919 (SMNK). SE Afghanistan: 29, Safed Koh, S-Seite, Kotkai, 2350 m, 1—10.viii.1966, 5.1x.1967,
M. Müller leg., Vojnits slides respectively nos 169789, 195269 (SMNK).
This little-known and rare Asian species was described on the basis of a single female
from the western Pakistanian province Swat. Two Afghanian specimens are worn but
with well-visible distinctive postmedial transverse lines on all wings. The male of E.
infecunda 1s unknown.
Eupithecia incurvaria Hampson, 1903 Fig. 24
Eupithecia incurvaria Hampson, 1903: Journal of the Bombay Natural History Society 14 (4): 643.
Syntypes 29 (BMNH), [India]: Kashmir: Goorais Valley.
Eupithecia propoxydata Schütze, 1961: Veröffentlichungen der zoologischen Staatssammlung München
6: 182, pl. 29, fig. 5; pl. 32, figs 2, 2a, 2b. Holotype © (ZSM), Nepal: Manangbhot, 28°40’N, 84°01’E,
Sabzi-Chu, 3500 m (synonymised in Mironov et al. 2008b).
Material. Syntypes: 29, India, Goorais Valley, June 1887, J. H. Leech, Leech Coll. 1900-64, one
(without abdomen) labeled Eupithecia incurvaria Hmpsn. type © (sic) (BMNH). — Holotype of E. pro-
poxydata ©, Nepal, Manangbhot, 28°40’n.Br. 84°1’ö.L., Sabzi-Chu, 3500 m, 9.vii.1955, leg. F. Lob-
bichler, Zoolog. Staatsslg., propoxydata Schü. Holotypus. Präp. Ne A7040 det. E. Schütze, Kassel, ZSM
G13366, photo 84 B 30 det. A. Vojnits (ZSM). SE Afghanistan: 3, 49, Safed Koh, S-Seite, Kotkai,
2350 m, 14-23.v1.1966, 21.vi—1.vii.1969, G. Ebert leg., Vojnits slides nos 16958, 17547¢, 175520,
175469, 175519, 175539, 194919; 49, same locality, 20—25.vi.1967, 16.v1.1968, M. Müller leg., Vojnits
slides nos 175599, 175609; 19, E Afghanistan, Nurisan-Bashgal, vic. Barg-e-Matal, 2200 m, Flussaue,
16.vi1.1970, Nr. 1125, leg. C. Naumann E-lep 209, Ratzel slide no. GU24911/7m (SMNK).
This species was originally described by Hampson on the basis of two females from
Kashmir. It is found in northern Pakistan, Jammu & Kashmir, Nepal, and India (Sikkim)
ranging from about 1400 m up to about 3500 m above sea-level. A new species for the
fauna of Afghanistan. The male genitalia were described and illustrated in Schütze
(1961a) as E. propoxydata. The female genitalia are described and illustrated for the
first time here.
Female genitalia (Fig. 24). Bursa copulatrix small, rounded, almost completely
covered with slim spines; marginal spines longer than other. Ductus bursae broad, scle-
rotized, sharply tapering to colliculum, spineless, but with longitudinal wrinkles. Ductus
seminalis broad, membranous, with some small dentates on the inside. Colliculum
collar-like, short and narrow. Antrum bowl-shaped, heavily sclerotized, broad and rel-
atively short. Tergite A8 broad, rectangular. Anterior apophyses very short, slightly
broadened and flattened at apices; posterior apophyses narrow, medium-sized. Papillae
anales relatively small, short, rounded.
Eupithecia innotata (Hufnafel, 1767)
Phalaena innotata Hufnagel, 1767: Berliner Magazin 4 (6): 616. Syntype(s) lost, [Germany]: Berlin
region.
Material. Afghanistan: 19, 39, Kabul, K.-e.-char, 30.iv.1970, leg. C. Naumann E-lep 209, prep.
Ratzel 2008, Ratzel slides nos GU9408/1w, GU9408/2w, GU9408/3w (SMNK).
Nota lepid. 35 (2): 197-231 215
A very common West Palaearctic species ranging from Spain in the west to western
Siberia in the east. However, it has not been previously recorded from Afghanistan or
Central Asia on the whole.
Eupithecia parallelaria Bohatsch, 1893
[Eupithecia] unedonata var. parallelaria Bohatsch, 1893: Deutsche entomologische Zeitschrift, Iris 6 (1):
22. Lectotype Q (designated by Vojnits, coll. R. Püngeler in MNHU), locality not designated for lecto-
type.
Misidentification: Eupithecia unedonata f. famelica Dietze, 1910 (19 paralectotype in coll. K. Dietze in
MNHU); Eupithecia mystica Vojnits, 1988 (nec Eupithecia gemellata f. mystica Dietze, 1910) (at least
3Q paratypes from Turkmenistan in ZISP).
Material. Lectotype (designated by Vojnits) 9, Type 9: Iris 1893, v. parallelaria Bohatsch, Origin.,
Zool. Mus. Berlin, Vojnits slide no. 135749 (coll. R. Püngeler in MNHU). E Afghanistan: 19, Nuristan,
Bashgal, 18 km E of Kamu, 1500 m, 29.70[sic!].1970, leg. C. Naumann, Coll. Nr. 1147, Ratzel slide no.
GU25408/5m; 10°, Sarobi, 18.x.1957, Frau Dr. Wegner leg.; 30°, 29, same locality, 15., 22.x, 5., 13.x1.1961,
ML, Ratzel slides nos GU13408/2m, GU13408/3m (SMNK); 19, same locality, 19.x.1961 (ZSM).
There is a series of small specimens of the second generation in the Afghanıan material
in SMNK and ZSM. A new species for the fauna of Afghanıstan. The male and female
genitalia were described and illustrated by Vojnits (1988).
Eupithecia praesignata Bohatsch, 1893
[Eupithecia] praesignata Bohatsch, 1893: Deutsche entomologische Zeitschrift, Iris 6 (1): 21. Lectotype
Q (designated by Vojnits, coll. O. Staudinger in MNHU), [Central Asia]: type locality not designated
[Replacement name for Eupithecia insignata Bohatsch, 1893].
[Eupithecia] insignata Bohatsch, 1893: Deutsche entomologische Zeitschrift, Iris 6 (1): 21 [Junior second
ary homonym of Phalaena Geometra insignata Hübner, 1789].
Misidentification: Eupithecia parallelaria Bohatsch, 1893 (29 paralectotypes in coll. ©. Staudinger in
MNHU).
Material. Lectotype (designated by Vojnits) 9, Type 9, Iris 93 praesignata Btoch, 55., Origin., Zool.
Mus. Berlin, Vojnits slide no. 135719 (coll. O. Staudinger in MNHU). — Paralectotype: 19, Kyrgyzstan,
Jssyk-Kul, innotata form: praesignata Boh., Jssyk-Kul (In Coll. Staudgr. Typen unter sich verschie-
ben), Zool. Mus. Berlin, Vojnits slide no. 135450 (coll. K. Dietze in MNHU). NE Afghanistan: 5,
590, Wakhan-Tal, 3300 m, Zemestani Baharak, 10, 23, 24.vii.1971, UV-Li, Ebert & Naumann, coll. Nr.
242, 261, 262, Ratzel slides nos GU 13408/5m, GU18208/5w; 49, same locality, 3450 m, Darrah-e-Shaur,
25.v11.1971, UV-Li, Ebert & Naumann, coll. Nr. 263; 29, same locality, 3400 m, Kotal-e-Dalez, W-Seite,
27.v11.1971, UV-Li, Ebert & Naumann, coll. Nr. 269 (SMNK).
This Central Asian species was previously known from Uzbekistan, Tajikistan, Kyr-
gyzstan, north-western China (Xinjiang), Jammu & Kashmir, and India (Ladakh Mts.),
and ıs new for Afghanistan. The habitus was illustrated in Dietze (1910). The male and
female genitalia were described and illustrated in Vojnits (1982b).
Eupithecia mitigata Dietze, 1906
[Eupithecia] mitigata Dietze, 1906: Deutsche entomologische Zeitschrift, Iris 19 (2): pl. 2, figs 18, 19;
ibidem (1908), 21 (2): 168. Lectotype © (designated by Vojnits, coll. R. Püngeler in MNHU), [China]:
Lob-Noor.
Misidentification: Eupithecia omnigera: sensu Vojnits 1988 (nec Vojnits 1982b) (at least 19 in ZISP).
Material. Lectotype (designated by Vojnits) ©, Asia centr., China, Lob-Noor, E. Mai 1904 Rückbeil
sen. 4/05 v. Tancré, mitigata cotype, K. Dietze, Zool. Mus. Berlin, Vojnits slide no. 135870 (coll. R.
216 Mironov & RATZEL: Eupithecia of Afghanistan
Püngeler in MNHU). — Paralectotypes: 20°, same data, mitigata cotype, K. Dietze (coll. R. Püngeler in
MNHU); 19, mitigata n. sp. ©, Type, Lob-noor, Asia centr. (Ende Mai 1904. Rückbeil), K. Dietze, 6.,
mitigata Dtze, präp. Nr. A 8270, det. E. Schütze, Kassel; 19 (nec Q), mitigata 9, Type, Lob-noor, Asia
centr., Rückbeil, Ende Mai 1901t., Original., K. Dietze (coll. K. Dietze in MNHU). SE Afghanistan: 19,
Prov. Paktia, 2350 m, Safed Koh, S-Seite, Kotkai, 16—17.vi.1971, UV-Li, Ebert & Naumann; 10°, 39, NE
Afghanistan, Wakhan-Tal, 3300 m, Zemestani Baharak, 10., 23.v11.1971, UV-Li, Ebert & Naumann, coll.
Nr. 242 and 261, Ratzel slide no. GU13408/4m (SMNK).
A distinctive unicolorous, dark grey species of the innotata group, often wings almost
without a clear pattern, but usually with light costal blotch between medial and termi-
nal areas. Hitherto recorded from Tajıkistan, Kyrgyzstan, southern Kazakhstan, and
north-western China (Xinjiang). New species for the fauna of Afghanistan. Adults were
illustrated by Dietze (1906, 1910). The male genitalia were described and illustrated by
Vojnits (1982b).
Eupithecia tshimganica Viidalepp, 1988
Eupithecia tshimganica Viidalepp, 1988: Fauna pyadenits gor Srednej Azii [Geometridae fauna of the
Central Asian mountains]: 113, pl. 2, fig. 12; text-pl. 24, figs 5-8. Holotype 9 (IAET), Uzbeksk. SSR
[Uzbekistan]: Chimgan.
Eupithecia subomnigera Vojnits, 1988 syn. n.: Annales Historico-Naturales Musei Nationalis Hungarici
80: 80, (nec pl. 1: 1-2); pl. 3, figs 21-24. Holotype © (ZISP), [Tajikistan]: Pamirs, Schugnanensis
Mts, fl. Akmamed dara, 3500 m.
Material. Holotype 9, Uzbekistan, Chimgan, 7 juuni 1979a valguspüük, leg. T. Marnot, Viidalepp
slide no. 26219 (IAET). — Holotype of E. subomnigera ©’, Tajikistan, Pamir merid. occid., Mts. Schug-
nanensis cl. sept., fl. Akmamed Dara, 3600 m, 12.vii.1957, A. Bundel, Vojnits slide no. 17731¢ (ZISP). —
Paratype of E. subomnigera: 19, Tajikistan, vic. Stalinabad, Takobskoe gorge, 15.vi.1952, Potopolsky,
Vojnits slide no. 177299 (ZISP). NE Afghanistan: 19, Prov. Badakshan, 3000 m, 15 km NE of Baharak,
Kotal-e-Zardeu, 30.v1.1971, UV-Li, Ebert & Naumann, coll. Nr. 230 (SMNK).
A distinctive, pale, yellowish or yellow-grey species from the innotata group. Some
known specimens of this species are without a distinct wing pattern. E. tshimganica
was previously known from Uzbekistan and Tajikistan. First records for Afghanistan.
E. subomnigera was synonymised here on the basis of the external similarity of the
holotype. There are also additional specimens (males and females) of this species in the
collection of ZISP from Tien-Shan Mts.
Eupithecia relaxata Dietze, 1904
[Eupithecia] unedonata var. relaxata Dietze, 1904: Deutsche entomologische Zeitschrift, Iris (1903) 16
(2): 367, pl. 5, fig. 17. Holotype Q (coll. K. Dietze in MNHU), Central Asia [Iran]: Schakuh.
[Eupithecia] costisignata Dietze, 1904: Deutsche entomologische Zeitschrift, Iris (1903) 16 (2): 367, pl. 5,
figs 18, 19. Syntypes 11, at least 40°, 39 (coll. K. Dietze and R. Püngeler in MNHU), Central Asia
[Iran]: Schakuh; [China]: Korla (synonymised in Mironov et al. 2008c).
Eupithecia pamiri Vojnits, 1988: Annales Historico-Naturales Musei Nationalis Hungarici 80: 81, pl. 1,
figs 3-5; pl. 4, figs 25-28. Holotype © (ZISP), [Tajikistan]: Pamir merid. occid., Schach-Darensis
Mts, Seiojdara River, 3250 m (synonymised in Mironov et al. 2008c).
Material. Syntype: 9, Iran, Schakuh, 31.vii.1898, Funke, costisignata form. relaxata, Typ, Schahkuh
9, 31.vii.1898, Zool. Mus. Berlin, Typus, Gen.-Unters. Nr. [Schmidt slide no.] Eu 104, Zool. Mus. Berlin
(coll. K. Dietze in MNHU). — Syntypes of E. costisignata: 10, China, costisignata, costisignata Korla,
Type ©, Zool. Mus. Berlin, Typus, Eupithecia costisignata ©, Korea, Type, Prep. Ne 1659.1 E. De Laever
det. 1957; 19, costisignata Korla, costisignata 9 Typ., Korla, Eupithecia costisignata 9, Kor(e)a, Type,
Prep. Ne 1659.2 E. De Laever det. 1957 (coll. K. Dietze in MNHU). — Syntypes of E. relaxata var. costisig-
nata: 19, China, Korla, Sai-chin, 372, costisignata [hand writing by Dietze] (coll. K. Dietze in MNHU);
Nota lepid. 35 (2): 197-231 247
30, Asia centr., Saichin-Kette nördl. v. Korla, Rückbeil 1902, relaxata var. costisignata Dietze, Type (v.
R. Tancre 11.02), subspec: relaxata var. costisignata Original (Dietze), Zool. Mus. Berlin, Vojnits slide no.
135840 (coll. R. Püngeler in MNHU). — Holotype of E. pamiri ©, Tajikistan, Pamir merid. occid., Mts.
Schach-Darensis, Cliv septr., fl. Seidj-Dara, 3250 m, 27.v11.1957, A. Bundel leg., Vojnits slide no. 176860
(ZISP). C Afghanistan: 20, Koh-i-Baba, S-Seite, Panjao, 2650 m, 20—22.vii.1966, G. Ebert leg., Vojnits
slides nos 177740, 195170; 40, 39, same locality, N-Seite, Band-i-Amir, 2900 m, 24—26.vii.1966,
Vojnits slides nos 177670, 177860, 194990, 195169 177659, 177709, 177879; 19,19, E Afghanistan,
Salang-Pass, N-Seite (Khinjan), 2100 m, 5—11.vii.1966, G. Ebert leg., Vojnits slides nos 178730", 194969;
69, SE Afghanistan, Safed Koh, S-Seite, Kotkai, 2350 m, 1-3., 6, 9.1x.1967, M. Müller leg., Vojnits slides
nos 169719, 169739, 169749, 169919, 195139; 19, E Afghanistan, Pr. Kunar, Nuristan, ob(eres) Lindai
Sin-Tal, vic. Barg e Matal, Dandizenor Mts., 3100 m, 13-14.v11.1970, leg. Naumann, Coll.-Nr. ZMK
93 (SMNK); 1 ex., Prov. Kadaghan, Salang Paß, Nordseite, 69°L 35°40’B, 11—12.vii.1971, leg. Vartian
(HNHM); 60°, 30 9, NE Afghanistan, Wakhan-Tal, 3300 m, Zemestani Baharak, 10, 23, 24.v11.1971, UV-
Li, Ebert & Naumann, coll. Nr. 242, 261, 262, Ratzel slide no. GU31209/3w; 19, 99, same locality, 3450
m, Darrah-e-Shaur, 25.vii.1971, UV-Li, Ebert & Naumann, coll. Nr. 263; 30°, 199, same locality, 3400 m,
Kotal-e-Dalez, W-Seite, 27., 29.vii.1971, UV-Li, Ebert & Naumann, coll. Nr. 269 and 272; 70°, 19, same
locality, Sargaz, 2930 m, 11.vii.1971, UV-Li, Ebert & Naumann, coll. Nr. 290 (SMNK).
This handsome, distinctive and common Central Asian species of the innotata group is dis-
tributed in Turkmenistan (Kopet-Dagh Mts.), Iran, Tajikistan (Pamirs Mts.), Kazakhstan,
Kyrgyzstan (Tien-Shan Mts.), Pakistan (Baltistan), Jammu & Kashmir, India (Ladakh
Range), north-western China (Xinjiang), and Mongolia (Mongol Altai Mts.). First re-
cords for Afghanistan. It is a bivoltine species with the second generation being smaller
than the first. The larvae of E. relaxata have been found in scrub woodland on Amygdalus
spartioides (Rosaceae) in Iran (Wiltshire 1952). The male and female genitalia were
described and illustrated in De Laever (1960) for the first time as E. costisignata. Later
on, Vojnits (1982b) described and illustrated the male and female genitalia of this spe-
cies also under the name E. costisignata but without the eighth sternite of the males. He
described this species as a new one under the name pamiri again in another publication
(Vojnits 1988).
Eupithecia lindti Viidalepp, 1988
Eupithecia lindti Viidalepp, 1988: Fauna pyadenits gor Srednej Azii [Geometridae fauna of the Central
Asian mountains]: 113, pl. 1, fig. 16; text-pl. 24, figs 1-4. Holotype S (IAET), Uzb. SSR [Uzbekistan]:
Chimgan spa.
Eupithecia hangayorum Vojnits, 1988: Annales Historico-Naturales Musei Nationalis Hungarici 80: 84,
pl. 1, figs 1-2 (nec pl. 2, figs 15-16); pl. 6, figs 45-48. Holotype S (ZISP), [Tajikistan]: Darwaz
occid., Chazret-scho Mts, fl. Don Duschlan, 2200 m (synonymised in Mironov et al. 2008c).
Material. Holotype ©, Uzbekistan, kur. Chimgan, 26.vi—1.vii.1981, at light, leg. A. Lindt (IAET). —
Holotype of E. hangayorum |hangayae on the label] ©, Tajikistan, Darwaz occid., Mts, Chazreti-Scho,
fl. Don Duschkan, 25.vii.1959, 2200 m, leg. A. A. Bundel, Vojnits slide no. 177480 (ZISP). — Paratypes
of E. hangayorum [hangayae on the label]: 19, Tajikistan, Mts. Darwaz, cliv. Merid., fl. Wischarvi,
1800 m, 3.viii.1958, A. Bundel, Vojnits slide no. 176919; 19, Pamir occid., fl. Obi-Chingou, Mionadu,
6.viii.1959, 2200 m, A. Bundel, Vojnits slide no. 176749; 19, 19, vic. Stalinabad, Khorangonskoe
gorge, 12.vili.1951, Vojnits slides nos 176299, 176380°; 10°, vic. Dzhirgatal, Dzhul-Terek Pass, 2400 m,
13.vii.1953, Bundel, Vojnits slide no. 176710 (ZISP). Afghanistan: 19, Pagman-Gebirge (Kabul), ca.
3000 m, Juni-Juli 1942, coll. Brandt, R. M. prep. 4914, 7467 E94+, Eup. afghanata Schü., Präp. Nr. S
12050 det. E. Schütze, Kassel, Holotypus Eup. afghanata Schütze (undescribed), ©, E. Schütze, Kassel,
Naturhistoriska Riksmuseet Stockholm, Loan no 361/06; 10°, same data, R. M. prep. 4915, 7468 E94+,
E. afghanata Schü., Präp. Nr. S 1222¢ det. E. Schütze, Kassel, Paratypus Eupith. afghanata Schütze, ©,
E. Schütze, Kassel, Naturhistoriska Riksmuseet Stockholm, Loan no 362/06 (NHRS); 19, same data,
100/57, R. M. prep. 4905, 7469 E94+, spec. ?, Eup. kabulata Schü., Präp. Nr. S 12040 det. E. Schütze,
Kassel, Holotypus Eupith. kabulata Schü. (undescribed), E. Schiitze, Kassel, Naturhistoriska Riksmuseet
218 Mironov & RATZEL: Eupithecia of Afghanistan
Stockholm, Loan no 363/06; 10°, same data, R. M. prep. 4906, 7470 E94+, Eup. kabulata Schü., Präp. Nr.
S 12060 det. E. Schütze, Kassel, Paratypus Eup. kabulata Schütze, E. Schütze, Kassel, Naturhistoriska
Riksmuseet Stockholm, Loan no 364/06; 10°, same data, R. M. prep. 4904, 7472 E94+, E. pagmanata
Schü., Präp. Nr. S 12070° det. E. Schütze, Kassel, Monotypus Eup. pagmanata Schü. (undescribed),
Kassel, Naturhistoriska Riksmuseet Stockholm, Loan no 365/06 (NHRS); 19, 39, Hazaradjat, Koh-i-
Baba, Pandjao Umgeb., 2500 m, 26.vi—1.vii.1961, leg. G. Ebert (ZSM); 40°, 149, E Afghanistan, Salang-
Pass, N-Seite (Khinjan), 2100 m, 5—11.vii.1966, G. Ebert leg., Vojnits slides nos 175320, 175370,
175399, 195070, 175339, 175349, 175359, 175369, 175389, 175419,.175429, 1523027524
194939, 194979, 194989, 195089, 195099; 19, Kabulfluss, Tamarix-Alhasi-Steppe, 14.vii.1966,
Vojnits slide no. 195009; 20°, C Afghanistan, Koh-i-Baba, S-Seite, Panjao, 2650 m, 20—22.vii.1966, G.
Ebert leg., Vojnits slides nos 195120, 195340°; 10°, same locality, N-Seite, Band-i-Amir, 2900 m, 24-26.
vii.1966, G. Ebert leg., Vojnits slide no. 195490; 19, Salang-Nord, 2100 m, vic. Khindjan, 13.vi.1970,
leg. Naumann, Nr. 1067, Ratzel slide no. GU25408/6w; 10°, E Afghanistan, Nuristan, Bashgal, vic. Barg-
e-Matal, 3 km W (Seitental), 2500 m, 6.vii.1970, leg. Naumann, Nr. 1106, prep. Ratzel 2008 E-lep 209
(SMNK).
This large species is very similar to the Iranian E. mahomedana Brandt, 1938, but is
smaller and darker on the whole. Forewings with more pointed apex and almost straight
oblique termen; all wings with transverse lines more distinct, almost straight and more
oblique, discal dots usually larger and more conspicuous than in E. mahomedana. The
male genitalia are very similar to those of E. mahomedana without any obvious di-
agnostic differences. The female genitalia can be distinguished from those of E. ma-
homedana by the absence of longitudinal membranous gap dividing in half the main
spiniferous area. E. lindti was previously known from the mountains of Uzbekistan,
Tajikistan, and northern provinces of Pakistan and India. It is a new species for the
fauna of Afghanistan.
Eupithecia convallata terricolor Vojnits, 1988
Eupithecia convallata terricolor Vojnits, 1988: Acta Zoologica Hungarica 34 (4): 423, pl. 1, figs 5, 6; text-
figs 9-12. Holotype © (coll. Vartian, Vienna), Afgh[anistan]: 10 km NW of Kabul, 1900 m.
Material. Paratype: 10°, Afghanistan, 10 km NW v. Kabul, 1900 m, 29.v.1965, Kasy & Vartian, Voj-
nits slide no. 156279 (HNHM). 90°, 49, E Afghanistan, Sarobi, 1100 m, 7., 15—16., 19., 21., 24—25., 27.,
29.iv.1961, leg. G. Ebert, Ratzel slides nos 12312/3m, 12312/6w, 12312/7w, 13312/1w (ZSM).
This species was originally described from Iran by W. Brandt (1938). Later, Vojnits
(1988) described a new subspecies terricolor from Afghanistan, which can be distin-
guished from the nominate subspecies by the less developed wing pattern, broader and
less wavy basal, ante- and postmedial transverse lines in the forewing, and the presence
of a large light blotch along the anal margin in the medial area between ante- and post-
medial lines, also a broader and more distinct oblique postmedial transverse line in the
hindwing. One female is externally different from the others. It is larger, with distinct
discal dots in both pairs of wings and a dark basal area in the forewing. The holotype
of this Afghanian subspecies is deposited in the collection Vartian (Vienna) and, unfor-
tunately, we did not have a chance to study it. We have not seeen current material of £.
convallata terricolor from Afghanistan.
Eupithecia xanthomixta Vojnits, 1988 Figs 9, 10
Eupithecia xanthomixta Vojnits, 1988: Acta Zoologica Hungarica 34 (4): 428, pl. 2, figs 11, 12; text-figs
21-24. Holotype S (coll. Vartian, Vienna), Afghanistan (east): Khinju, Salang Pass, 2100 m.
Nota lepid. 35 (2): 197-231 219
Material. Paratypes: 19, Afghanistan, Khurd-Kabul SE v. Kabul, 1900 m, 26.vi.1965, Kasy &
Vartian, Vojnits slide no. 156230; 19, same locality, 19.vi.1969, leg. Vartian, Vojnits slide no. 156829
(HNHM); 30°, same data, G. Ebert leg., Vojnits slides nos 169670, 169689, 195300; 19, same local-
ity, 3.vii.1965, Kasy & Vartian (SMNK); 19, E Afghanistan, s. v. Khinjan, Salang Pass, N-Seite, 2100
m, 9.vii.1969, leg. Vartian, Vojnits slide no. 151509 (HNHM). 19, 29, same locality, 5—11.vii.1966,
G. Ebert leg., Vojnits slides nos 195290, 178709, 178719; 19, Salang-Nord, 2100 m, vic. Khindjan,
13.vi.1970, leg. C. Naumann, Nr. 1067 (SMNK).
A dark, motley, originally coloured and variable species from the graphata group which
was described on the basis of a relatively large series of specimens. The male and fe-
male genitalia were briefly described and badly illustrated (especially the phallus and
female genitalia) in Vojnits (1988).
Eupithecia naumanni Mironov & Ratzel, sp. n. Figs 11, 12, 19, 25
Material. Holotype 9, E Afghanistan, Nuristan, Bashgal, vic. Barg-e-Matal, 3 km W (Seitental),
2500 m, 6.vii.1970, leg. C. Naumann, Nr. 1106, Ratzel slide no. GU8408/1w (SMNK). — Paratypes: 69,
same data, Ratzel slide no. GU8408/2w; 19, same locality, Dandizenor, 3000 m, 13.vi1.1970, Nr. 1122,
leg. C. Naumann (SMNK); 29, 129, same locality, 2200 m, 3—5., 16.v11.1970, Nr. 11 and 1125, leg. C.
Naumann E-lep 209, Ratzel slide no. GU9408/6w (SMNK, 49 in ZISP); 19, Badakhshan, 3500 m, Bala-
Kuran loc., 10.vii.2003, local collector leg., Mironov slide no. 8639 (coll. Skou).
Description. Wingspan 20.5—25.0 mm; length of forewing 11.5—13.5 mm. Labial pal-
pi short and obtuse, length about one half of diameter of eye, covered with light brown
scales with grey tips. Frons and vertex covered with mixture of brown and light grey
scales. Notum and abdomen with dominant ash grey scales. Forewing rather elongate,
with straight costal margin curving near apex, oblique termen and pointed apex; ground
colour brownish grey; transverse lines brown; basal and antemedial oblique, sharply
angled onto costa; medial line usually oblique, touching discal dot and sharply or right
angled from discal dot onto costa; medial area between antemedial and medial lines
usually darker than the rest of the wing; postmedial line slightly wavy, evenly curved
onto costa; terminal area often darker, especially in apical part; discal dot relatively
small, black, rounded or slightly elongated. Hindwing ovoid, similar in colour, trans-
verse lines distinct only along anal margin; terminal area usually slightly darker, with
wavy inner border and a series of dark dashes on the veins; discal dot paler, brownish,
rounded or slightly elongated and more or less distinct; fringe on all wings chequered
pale grey and brownish grey.
Male genitalia (Fig. 19). Uncus medium-sized, rather narrow, biapical. Valve
shaped like a segment of orange fruit; dorsal margin slightly arched near base; ventral
margin parallel to dorsal at basal half and evenly curved and tapering to apex; apex nar-
rowly rounded; sacculus lightly sclerotized. Vinculum rather narrow and short, tapering
anteriorly. Papillae on the anterior arms of the labides medium length and width, slight-
ly curved, covered with short setae at apices. Phallus stout, large and broad, shorter
than length of valve. Vesica covered with numerous denticules, larger on one side and
armed with a long and narrow, V-shaped, plate-like cornutus typical for the males of the
“graphata” species-group. Sternite A8 peg-like, elongated, with stronger sclerotized
margins near apex; basal emargination relatively broad and deep.
Female genitalia (Fig. 25). Bursa copulatrix large, ovoid-oblong, membranous,
about one half covered with slim spines, which are larger posteriorly; the border of
220 Mironov & RATZEL: Eupithecia of Afghanistan
Figs 19-20. Male genitalia of Eupithecia species (scale bar = 1 mm: with sternite A8, and papillae on the
anterior arms of labides enlarged). 19. E. naumanni Mironov & Ratzel, sp. n. 20. E. ochrovittata Christoph,
1887.
spiniferous area oblique. Ductus bursae tapering to colliculum, heavily sclerotized,
with distinct oblique border from corpus bursae and chain of small spines along this
border between base of ductus bursae and colliculum. Ductus seminalis broadened in
basal part; attached to the middle of corpus bursae at right side. Colliculum collar-like,
rather medium-sized, slightly elongated and inclined to one side. Antrum short and
broad, membranous. Tergite A8 rectangular, broader than long, with rounded posterior
corners. Anterior and posterior apophyses medium length and thickness, tapering to
apices. Papillae anales relatively large, broad, rounded, covered with short setae.
Diagnosis. This species belongs to the graphata group. It is similar to E. xanthomixta
Vojnits, 1988, but the new species is usually larger, ground colour pale greyish brown,
Nota lepid. 35 (2): 197-231 221
wing pattern less distinct, postmedial transverse line more evenly curved near costa
and not bordered by blackish shading, hindwing darker with indistinct transverse lines.
The male and female genitalia are very similar to those of E. xanthomixta. The male
genitalia can be distinguished by the larger valva with more arched dorsal margin and
broader apex than in E. xanthomixta. The female genitalia of these two species appear
identical.
Distribution. East Afghanistan.
Etymology. This species is named in honour of the German zoologist and lepidopterol-
ogist Prof. Dr. Clas Naumann (1939—2004), the former Director of the “Zoologisches
Forschungsinstitut und Museum Alexander Koenig”, Bonn, Germany (ZFMK). Many
times he visited Afghanistan and collected most part of the type series of this new spe-
cies Eupithecia naumanni.
Remarks. Unfortunately, the majority of paratypes of this species are very worn. We
believe that the graphata group includs mainly recently-diverged species because the
male and female genitalia of many species in this group are very similar. Some species
of the graphata group can be distinguished from each other by external features only,
such as ground colour and wing pattern (Schütze 1958).
Eupithecia simpliciata (Haworth, 1809)
Phalaena simpliciata Haworth, 1809: Lepidoptera Britannica (2): 359. Syntype(s) (BMNH ?), [Great
Britain].
[Geometra] subnotata Hübner, 1813: Sammlung Europäischer Schmetterlinge 5 Geometrae (2), pl. 89,
fig. 458. Syntype(s) lost, [Europe] (synonymised in Herrich-Schäffer 1848; as Eupithecia subnotataria
[sic] (Hübner, 1813).
Eupithecia subnotata f. collustrata Dietze, 1911: Biologie der Eupithecien 1: pl. 85, fig. 947; ibidem
(1913) 2: 107. Syntypes 29, 39 (coll. K. Dietze in MNHU), [Kyrgyzstan]: Karagai-tau; Naryn;
[China]: Altyn-dagh.
Misidentification: Eupithecia inculta: sensu Viidalepp 1988 (nec Vojnits 1975).
Material. Syntype of Eupithecia subnotata f. collustrata: 19, Kyrgyzstan, Karagai tau, subnotata
v. collustrata v. issyka Bang-Hs., Karagai tau (coll. K. Dietze in MNHU). Afghanistan: 19, Nuristan,
25 km N. v. Barikot, 1800 m, 12—17.vii.1963, Kasy & Vartian (HNHM); 20°, NE Afghanistan, Wakhan-
Tal, 3300 m, Zemestani Baharak, 24.vii.1971, UV-Li, Ebert & Naumann, coll. Nr. 262 (SMNK).
This is a widespread species, ranging from Western Europe to northwestern China
(Xinjiang) from close to sea level to about 3300—3400 m above sea-level in Tajikistan
(Viidalepp 1988, as E. inculta) and Afghanistan from where it was not hitherto known
until now.
Remarks. The widely used names for this species (E. simpliciata and E. subnotata)
were used as two bona species in “Geometrid Moths of the World: A catalogue (Lepi-
doptera, Geometridae)” by Scoble et al. (1999) despite the very old synonymisation of
these taxa by Herrich-Schäffer (1848).
Eupithecia centaureata (Denis & Schiffermiiller, 1775)
Geometra centaureata Denis & Schiffermiiller, 1775: Systematisches Verzeichnis Schmetterlinge, Wien:
114. Syntype(s) lost, [Austria]: Vienna district.
Eupithecia oblongata var. centralisata Staudinger, 1892: Deutsche entomologische Zeitschrift , Iris 5 (1):
250. Syntypes 13, at least 50°, 69 (coll. O. Staudinger in MNHU), Central Asia: [Uzbekistan]: Mar-
gelan; Namangan; Samarkand; [Kyrgyzstan]: Alexander Mts.; [Kazakhstan]: Saisan.
222 Mironov & RATZEL: Eupithecia of Afghanistan
Euplithecia] oblongata f. obscura Dietze, 1910: Biologie der Eupithecien 1: pl. 70, fig. 132; ibidem
(1913), 2: 63. Syntypes 6, at least 49 (coll. K. Dietze in MNHU), [Kyrgyzstan]: Alai Mts.; [Kazakhstan]:
Uralsk; [Italy]: southern Tyrol.
Eupithecia centaureata dagestani Vojnits, 1977: Acta Zoologica Academiae Scientiarum Hungaricae 23
(1-2): 229, fig. 2. Holotype © (ZFMK), [Russia]: Dag(h)estan, Petrovsk-port [= Makhachkala].
Eupithecia centaureata dsharkendi Vojnits, 1977: Acta Zoologica Academiae Scientiarum Hungaricae 23
(1-2): 230, fig. 3. Holotype @ (ZFMK), [Kazakhstan]: Dsharkend, Semiretschensk.
Eupithecia chinae Vojnits, 1977: Acta Zoologica Academiae Scientiarum Hungaricae 23 (1-2): 231, figs
4, 5b.
Holotype © (ZFMK, now in HNHM), China: Shantung Province, Tai-shan, 1550 m (synonymised in Mi-
ronov & Galsworthy 2007).
Material. Syntypes of E. centaureata f. obscura: 19, Kyrgyzstan, oblongata forma: obscura typ,
Alai mont.; 19, Alai mont. 1905 Korb, 25.vii.1905, oblongata ab. obscur. Dietze (coll. K. Dietze in
MNHU). — Holotype of E. centaureata dagestani ©, Russia, Dagestan, Petrovsk-port, 29.v.1926, M.
Rjabov, Vojnits slide no. 7430 (ZFMK). — Holotype of E. centaureata dsharkendi 9, Kazakhstan,
Dsharkend, Semiretschensk, Vojnits slide no. 11109 (ZFMK). — Holotype of E. chinae ©, China, Tai-
shan (1550 m), Prov. Shantung, 16.v111.1934, H. Höne, Vojnits slide no. 11030 (ZFMK). — Paratypes of E.
chinae: 19, same locality, 11.v111.1934, H. Höne, De Laever slide no. 4249; 19, Harbin, (Manchuria), Juni
1923, V. Tolmachov, Vojnits slide no. 11019 (HNHM). E Afghanistan: 19, Nurisan-Bashgal, vic. Barg-e-
Matal, 2200 m, Flussaue, 16.v11.1970, Nr. 1125, leg. C. Naumann, E-lep 209; 10, NE Afghanistan, Prov.
Badakhshan, 1750 m, 12 km NE of Baharak, Pejuj, 27.v1.1971, UV-Li, Ebert & Naumann, coll. Nr. 224;
19", same locality, 3000 m, 15 km NE of Baharak, Kotal-e-Zardeu, 30.vi.1971, UV-Li, Ebert & Naumann,
coll. Nr. 230 (SMNK).
è
This ıs one of the most easily recognizable species among the Palaearctic representa-
tives of the genus. The male and female genitalia were described and illustrated in
Petersen (1910) for the first time and in many other publications later.
E. centaureata 1s a widespread and relatively common species, it ranges from the
Atlantic coast of Ireland, Portugal, and Morocco across Europe and the greater part of
Asia to the Far East of Russia (Priamurje) and the Pacific coast of the Chinese province
Guangdong, as well as Taiwan. It had not been recorded for the fauna of Afghanistan
until now.
Eupithecia nachadira Brandt, 1941 Fig. 13
Eupithecia nachadira Brandt, 1941: Mitteilungen der Münchner entomologischen Gesellchaft 31 (3): 877,
pl. 29, fig. 23. Lectotype © (designated in Mironov 2003; NHRS), [Iran]: Kouh 1 Taftan, 2500-2800 m.
Material. Lectotype ©, Iran, Baloutchistan, Kouch 1 Taftan (Khach), 2800 m, 30 Mai 1938, Coll.
Brandt, 32/88, Riksmuseum Stockholm, Mironov slide no. 869, Illustrated in GME vol. 4, Mironov:
Larentiinae II (NHRS). — Paralectotypes: 30°, 19, same data, Schmidt slide no. Eu 1339 (in ZFMK),
Vojnits slides nos. 6250, 6370 (in HNHM), Mironov slide no. 871% (in NHRS) (NHRS); 19, same
locality, 1 Juni 1938, Coll. Brandt, 35, E. nachadira Brdt.; 10°, same locality, 2500 m, 30 Apr. 1938,
Coll. Brandt, 94/57, nachadira Brdt., 34, photo 25 F 80 det. A. Vojnits [without abdomen] (NHRS); 1%,
same locality, 12 Mai 1938, Coll. Brandt, 43c, Eupithecia nachadira Brandt, det. D. S. Fletcher, see W.B.
XII list, L.B. Prout Coll., B.M. 1939-643 (BMNH). C Afghanistan: 79, Koh-i-Baba, S-Seite, Panjao,
2650 m, 20-22.vii.1966, G. Ebert leg., Vojnits slides nos 177769, 177779, 177789, 177819, 177829,
177839, 195559 (SMNK).
E. nachadira was described and hitherto only recorded from Iran. It belongs to the cen-
taureata group and was not previously recorded from Afghanistan. The male genitalia
were described and illustrated in Mironov (2003) for the first time.
Remarks. The type specimens of E. nachadira were not designated by Brandt with la-
bels “holotype” and “paratype”. In addition, all syntypes mentioned above are without
abdomens and only two have information about genitalia slides made by Vojnits.
Nota lepid. 35 (2): 197-231 225
Eupithecia repetita Vojnits, 1981
Eupithecia repetita Vojnits, 1981: Annales Historico-Naturales Musei Nationalis Hungarici 73: 225, figs 7,
8. Holotype S (SMNK), Pakistan (west): Swat, Kalam, 2000 m.
Material. Holotype ©, W Pakistan, Swat, Kalam, 2000 m, 9.vii.1969, leg. G. Ebert, Vojnits slide no.
121050 (SMNK). — Paratypes: 10°, 29, same data, Vojnits slides nos 121140, 121079, 121189 (SMNK);
19, 19, same data, Vojnits slides nos 121169, 121099 (HNHM); 10°, 59, same locality, N. v. Kalam,
Gabral-Tal, 2100 m, 6—9.vii.1969, leg. G. Ebert, Vojnits slides nos 121040, 121129, 121069, 121119,
121159, 121179 (SMNK). SE Afghanistan: 29, Safed Koh, S-Seite, Kotkai, 2350 m, 9.vii, 13.viii.1968,
M. Müller leg., Vojnits slides nos 195549, 169549 (SMNK).
It was not surprising that this species occurs in Afghanistan, because it was described
from the western provinces of Pakistan. According to the structure of the male and fe-
male genitalia (Vojnits 1981), it is a representative of the centaureata group with strik-
ing external appearance. The holotype of E. repetita was illustrated by Mironov et al.
(2008c) for the first time.
Eupithecia subtilis Dietze, 1910
Euplithecia] staudingeri f. subtilis Dietze, 1910: Biologie der Eupithecien 1: pl. 79, figs 870, 871; pl. 80,
fig. 900. Lectotype 9 (designated in Mironov et al. 2008c, coll. K. Dietze in MNHU), Hyrcan(ia)
[Iran]: Schahkuh.
Eupithecia tonu Viidalepp, 1988: Fauna pyadenits gor Srednej Azii [Geometridae fauna of the Central
Asian mountains]: 118, pl. 2, fig. 16; text-pl. 26, fig. 1. Holotype 9 (IAET), Tadzh. SSR [Tajikistan]:
South-western Alai, Dzhirgatal, 1700 m (synonymised in Mironov et al. 2008c).
Material. Lectotype 9, Iran, subtilis Dietze ?staudingeri-Form., Schahkuh Typ., 105., n. spec. 9,
cf. Dietze Iris 19. T. 1, Iris XIX, Taf. 1, fig.15, durch Petersen (coll. Dietze in MNHU). — Paratypes of
E. tonu [toenui on the label]. 19, Uzbekistan, Usbeki NSU, TSimgan, 29.v1.1981 (IAET). 19 (nec 9),
Tajikistan, Ferghana, Schakhimardan, 1550 m, 17.v11.1952, Bundel, 29. 19, Kyrgyzstan, Alajsky Mts.,
northern slope, vic. Sufi-Kurgan, Terek, 2300 m, 15.v11.1968, Bundel, 60, Viidalepp slide no. 23629,
ZISP microprep. Ne 17091 (ZISP). Afghanistan: 19, Paghman, 30 km NW v. Kabul, 2100 m, 20-30.
vii. 1962, E. & A. Vartian leg., Vojnits slide no. 174289; 19, same locality, 2200 m, 29.vi-—8.vi1.1963, Kasy
& Vartian, Vojnits slide no. 173879 (HNHM); 39, C Afghanistan, Koh-i-Baba, N-Seite, Band-i-Amir,
2900 m, 24—26.vi1.1966, G. Ebert leg., Vojnits slides nos 195479, 195480, 195509; 19, E Afghanistan,
Nurisan-Bashgal, vic. Barg-e-Matal, 2200 m, prep. Ratzel 2008, E-lep 209 (SMNK).
This is a representative of the centaureata species-group. E. subtilis is known from
Iran, Uzbekistan, Kyrgyzstan, Tajikistan, and Pakistan. It occurs in from about 1500 m
up to about 3500 m above sea-level. A new species for the fauna of Afghanistan. The
female genitalia were described and illustrated in Viidalepp (1988) as E. tonu. The male
genitalia of E. subtilis will be described in our forthcoming paper treating material from
Tajikistan and Iran.
Eupithecia egregiata Mironov & Ratzel, 2008
Eupithecia egregiata Mironov & Ratzel, 2008: Transactions of the Lepidopterological Society of Japan
59 (3): 214, figs 10, 18, 22. Holotype © (HNHM), Pakistan (north-west): Prov. Swat, Gabral-Tal,
15 km northern Kalam, 2100 m.
Material. Holotype ©, NW Pakistan, Prov. Swat, Gabral-Tal, 15 km N of Kalam, 2100 m, 6-9.
v11.1969, leg. Vartian, Vojnits slide no. 156740 (HNHM). — Paratypes: 19, same data, Vojnits slide no.
151329; 19, same data, but leg. G. Ebert, Vojnits slide no. 121089 (HNHM); 19, Great West. Himalaya
Mts., near Gabar, 3200 m, 21 —24.viii.2004, leg. V. Gurko, Ratzel slide no. GU1905/5w (coll. Ratzel).
SE Afghanistan: 19, Safed Koh, S-Seite, Kotkai, 2350 m, 25.vii.1968, M. Miiller leg., Vojnits slide no.
193689 (HNHM).
224 Mironov & RATZEL: Eupithecia of Afghanistan
This species from the centaureata group was described on the base of a small se-
ries of specimens (one male holotype and four female paratypes) from Pakistan and
Afghanistan (one female). We have not seen additional material of this species from
Afghanistan.
Eupithecia decipiens Petersen, 1910 Fig. 14
Eupithecia] decipiens Petersen, 1910: Deutsche entomologische Zeitschrift, Iris 22 (4): 279, pl. 26, fig.
104. Syntypes ©, © (coll. K. Dietze in MNHU), [Iran]: Schahkuh.
Material. Syntype | ex. [without antennae and abdomen]: Iran, decipiens Peters., Schahkuh. Typ.,
K. Dietze, decipiens, Zool. Mus. Berlin (coll. K. Dietze in MNHU). C Afghanistan: 10°, Koh-i-Baba,
N-Seite, Band-i-Amir, 2900 m, 24—26.vii.1966, G. Ebert leg., Vojnits slide no. 195310 (SMNK).
E. decipiens is a little-known and rare Asian species which was described from northern
Iran and previously known only from Iran, Uzbekistan (coll. IAET), and Kyrgyzstan
(Viidalepp 1988), occuring from about 1500 m up to about 2900 m above sea-level.
This is a new species for the fauna of Afghanistan.
This species is unlikely to be confused with any other Asian representative of the
genus. The triangular forewings with almost straight margins, narrow apex and dis-
tinctive dark, oblique, narrow medial band between antemedial and medial transverse
lines, which is sharply angled from R vein onto costa, make this an easy species to iden-
tify. According to the structure of the male and female genitalia this species belongs to
the centaureata group. The details of the male and female genitalia were described and
illustrated in Petersen (1910).
Eupithecia mekrana Brandt, 1941
Eupithecia mekrana Brandt, 1941: Mitteilungen der Miinchner entomologischen Gesellchaft 31 (3):
877, pl. 29, fig. 24. Lectotype © (designated in Mironov 2003, NHRS), [Iran]: Baloutchistan, Bender
Tchahbahar.
Eupithecia mekrana khorassana Brandt, 1941: Mitteilungen der Miinchner entomologischen Gesellchaft
31 (3): 877. Lectotype © (designated in Mironov 2003, NHRS), [Iran]: Khorassan, Kouh i Binaloud
(Meched), 2500 m.
Eupithecia idonea Vojnits, 1982: Acta Zoologica Academiae Scientiarum Hungaricae 28 (3-4): 412, figs
12, 13. Holotype S (HNHM), Armenia: Migry near Araks (synonymised in Mironov 1991).
Eupithecia stulta Vojnits, 1982: Acta Zoologica Academiae Scientiarum Hungaricae 28 (3-4): 413, fig.
14. Holotype S (HNHM), Armen(ia): St(ation) Negram near Araks (synonymised in Mironov 1991).
Eupithecia commenticia Vojnits, 1982: Acta Zoologica Academiae Scientiarum Hungaricae 28 (3-4):
414, figs 15, 17. Holotype © (HNHM), Armenia: Migry near Araks (synonymised in Mironov 1991).
Eupithecia mekrana amiralis Wiltshire, 1986: in Biittiker & Krupp, Fauna of Saudi Arabia 8: 280, fig. 102,
gen. figs 18, 19. Holotype © (BMNH), [Saudi Arabia]: UAE (“Trucial Oman”), Masafi.
Material. Lectotype ©, Iran, Baloutchistan, Bender Tchahbahar, 3 Februar 1938, Coll. Brandt, 82/57,
graciliata Dtze., mekrana Brdt., 30/88, Riksmuseum Stockholm, Mironov slide no. 8670 (NHRS). —
Paralectotypes: 19, same locality, 22 Januar 1938, Coll. Brandt, graciliata Dtze., 29/88, Riksmuseum
Stockholm, Mironov slide no. 8680 (NHRS); 20°, same locality, 24 Januar 1938, Coll. Brandt, graciliata
Dtze., 42 and 16, photo 24 F 80 det. A. Vojnits (both specimens without abdomens, NHRS); 10°, same
locality, Januar 1938, Coll. Brandt, Eupithecia graciliata Dietze S ?, W.B. XI 33A, Preparation W.B. M.
416 (BMNH). — Lectotype of E. mekrana khorassana ©, Iran, Khorassan, Kouh 1 Binaloud (Meched),
2500 m, 5 Aug. 1938, Coll. Brandt (NHRS). — Paralectotype of E. mekrana khorassana: 19, same data,
Coll. Brandt, 40, 25 (NHRS). — Holotype of E. idonea ©, Armenia, Megry na Araxe, Rjabov, 29.vii1.1932,
39/77, Vojnits slide no. 136560 (HNHM). — Paratype of E. idonea: 19, Armenia, Transkauk., fl. Arax,
st. Darasham I, 25.viii.932, Rjabov, 39/70, Vojnits slide no. 136639 (HNHM). — Holotype of E. stulta ©,
Armenia, St. Negram na Araxe, Rjabov, 19.v.1934, 39/81, Vojnits slide no. 136570 (HNHM). — Holotype
Nota lepid. 35 (2): 197-231 225
of E. commenticia ©, Armenia, Megry na Araxe, Rjabov, 29.vi11.1932, 39/74, Vojnits slide no. 136550
(HNHM). — Paratype of E. commenticia: 19, Armenia, Russ. Armen., Migry, M. Rjabov, 29.viii.1932,
39/68, Vojnits slide no. 136509 (HNHM). — Paratype of E. mekrana amiralis: 19, Trucial Oman, Masafı,
22-24.11.1971, M. D. Gallagher, Eupithecia mekrana Brdt. amiralis Wts. paratype ©, Paratype, Brit. Mus.
1971-158 (BMNH). E Afghanistan: 20, 39, Sarobi, 1100 m, 25.iv, 7, 10, 10, 11.x.1961, leg. G. Ebert,
Ratzel slides nos GU12208/1w, GU12208/2w, GU9208/5m (SMNK).
This small yellowish or pale ochreous species is distributed from steppen chalk hills in
Orenburg province in the southeastern European Russia in the north (Mironov 2003) to
Saudi Arabia in the south (Wiltshire 1986). It is known also in the eastern provinces of
Turkey, in Armenia, Azerbaijan, and Iran. A new species for the fauna of Afghanistan.
The male and female genitalia were described and illustrated by Vojnits (1982a) under
names E. idonea, E. stulta, and E. commenticia — three synonyms of the same species
in one publication.
Remarks. The full type series of this species was not marked by Brandt with original
labels “holotype”, “paratype” or “syntype”. There are additional labels only with in-
scription “mekrana” by pencil.
Eupithecia variostrigata Alphéraky, 1876
Eupithecia variostrigata Alphéraky, 1876: Horae Societatis entomologicae Rossicae 10: 40. Holotype ©
(not traced), Russia: Taganrog. |
Eupithecia albosparsata Joannis, 1891: Bulletin de la Société entomologique de France 6: 81. Syntypes 2,
including S (MNHN), Turkey: Césarée (synonymised in Mironov 2003).
[Eupithecia] variostrigata f. designata Dietze, 1913: Biologie der Eupithecien 2: 49; ibidem (1910), 1:
taf. 73, figs 339, 340 (without name of form). Syntypes, including © (coll. K. Dietze in MNHU),
Caucasus [Azerbaijan]: Ordubad.
Incorrect subsequent spelling: artemesiata: Scoble & al. (1999).
Material. Syntypes of E. albosparsata: 10°, Turkey, Césarée, albosparsata L. de Joann., Syntype,
variostrigata Alph. (t-Halict.), 1920-1932 coll. L. & J. De Joannis, Muséum Paris, Fig. par J. Culot,
Noct. et Géom. d’Europe, Pl. 41, fig. 849, P. Leraut det. prép. n° 11850, Eupithecia albosparsata 3; 10
?, Césarée, Eupithecia albosparsata De Joannis, 1891, Syntype, 1920-1932 coll. L. & J. De Joannis,
Muséum Paris (MNHN). E Afghanistan: 19, Nurisan-Bashgal, vic. Barg-e-Matal, 2000 m, 21 km S,
25.x.1970, Nr. 1144, leg. C. Naumann E-lep 209, prep. Ratzel 2008 (SMNK).
A new species for the fauna of Afghanistan. It is a widespread western Palaearctic spe-
cies occurring from Spain in the west to western Pamirs in the east. The holotype of E.
variostrigata, which was illustrated by Dietze (1906, 1910), could not be found ın any
of the studied museum collections.
Eupithecia subpulchrata Alpheraky, 1883 Fig. 15
Euplithecia] subpulchrata Alphéraky, 1883: Horae Societatis entomologicae Rossicae 17 (3/4): 221, pl. 8,
fig. 75. Holotype © (not traced), [China]: Ili (region), Kouldja [= Kuldja] [Yining (Gulja)].
Material. Afghanistan: 19, Salang-Pass, N-Seite, (Khinjan), 2100 m, 5—11.vii.1966, G. Ebert leg.,
Vojnits slide no. 195539; 19, NE Afghanistan, Prov. Badakhshan, 1750 m, 12 km NE of Baharak: Pejuj,
27.v1.1971, UV-Li, Ebert & Naumann, coll. Nr. 224, Ratzel slide no. GU25408/1w (SMNK).
This handsome species from the gueneata group was described on the basis of a sin-
gle male specimen from northwestern China. It was also known from Turkmenistan,
Uzbekistan, and southern Kazakhstan. Not previously recorded from Afghanistan. The
details of the male genitalia were described and illustrated by Petersen (1910) for the
226 Mironov & RATZEL: Eupithecia of Afghanistan
first time on the basis of one specimen from the Dietze collection. Habitus of the type
specimen of E. subpulchrata from Saint-Petersburg Museum was illustrated by Dietze
(1906, 1910). However, Alphéraky’s type was not found in the Dietze collection in
MNHU nor some other European museums, such as ZISP and BMNH. The details of
the bursa copulatrıx were described and illustrated in Viidalepp (1988) from a speci-
men from southern Kazakhstan.
Eupithecia vulgata (Haworth, 1809)
Phalaena vulgata Haworth, 1809: Lepidoptera Britannica (2): 359. Syntype(s) (BMNH), [Great Britain].
Eupithecia lepsaria Staudinger, 1882: Stettiner Entomologische Zeitschrift 43 (1-3): 74. Syntypes 20
(coll. O. Staudinger in MNHU), [Kazakhstan]: Lepsa (treated as subsp. of Eupithecia vulgata in Mironov
1989a).
Material. Syntypes of E. lepsaria: 10°, Kazakhstan, Lepsa Hbhr., /epsaria ©, Origin., Gen. vérifiés
1454/1 Eupithecia lepsaria Stgr. ©, Lepsa, det. E. De Laever 1954 (coll. ©. Staudinger in MNHU); 1,
lepsaria © Lepsa, Origin., bon. sp. bei Vulgata nicht gueneata (Boh.), Vojnits slide no. 190340 (coll. O.
Staudinger in MNHU). Afghanistan: 4 exx., Paghman, 30 km NW v. Kabul, 2500 m, 29.vi-8.v11.1963,
20. u 28.v1.1965, 5.v11.1965, Kasy & Vartian (HNHM); 80, 19, SE Afghanistan, Safed Koh, S-Seite,
Kotkai, 2350 m, 14—23.vi.1966, 21.vi-1.v11.1969, G. Ebert leg., Vojnits slides nos 175540, 175550,
175560, 175570, 17558 0°, 195280, 195380, 195390, 195259 (SMNK); 4 exx., same locality, 21.vi-1.
v11.1969, leg. Vartian (HNHM); 10°, same locality, 4.v11.1967, M. Müller leg.; 19, 3 exx. (all destroyed), E
Afghanistan, Prov. Bamian, vic. Panjao, 2300 m, 27.v1.1970, Nr. 1083, leg. C. Naumann E-lep 209, prep.
Ratzel, Ratzel slide no. GU24408/3w; 19, NE Afghanistan, Wakhan-Tal, 3300 m, Zemestani Baharak,
10.v11.1971, UV-Li, Ebert & Naumann, coll. Nr. 242 (SMNK).
This is a widespread and common Palaearctic species ranging from the Atlantic coast
of Ireland and Portugal in the west across Europe, Mid-East and Central Asia to the Far
East of Russia (Priamurje) and Korea in the east. Not hitherto known from Afghanistan.
The specimens from Central Asıa externally do not differ from European specimens
except that they are usually darker, blackish grey or brown coloured. Both male and
female genitalia of adults from Afghanistan and adjacent areas are very similar to those
from European specimens. The details ofthe male and female genitalia were described
and illustrated in Petersen (1910) for the first time and after that in many other publica-
tions of European authors.
Eupithecia ochrovittata Christoph, 1887 Figs 16, 20
Eupithecia ochrovittata Christoph, 1887: in N. M. Romanoff, Mémoires sur les Lépidoptères 3: 7, pl. 1,
fig. 3. Lectotype 9, herewith designated to stabilize nomenclature (ZISP), [Armenia]: Erivan.
Material. Lectotype (abdomen lost) 9, Armenia, Erivan 9, 12.vii.1881 Chr., 16, Coll. Vel. Knjazja
Nikolaja Mikhailovicha, Lectotypus 9 Eupithecia ochrovittata Christoph, 1887, design. V.G. Mironov,
2011 (ZISP). E Afghanistan: 10, Pol-i-Charchi, 18 km E of Kabul, 1700 m, 25.vi-3.vu1.1966, H. G.
Amsel leg., Vojnits slide no. 195510 (SMNK).
This rare species of Eupithecia was previously only recorded from Transcaucasus (Ge-
orgia and Armenia). The finding of E. ochrovittata in Afghanistan was quite unexpect-
ed. The single Afghanian specimen is smaller (wingspan 17.5 mm) than the transcauca-
sian specimens. It is worn but with visible distinctive dark costal margins, distinct small
discal dots and the rest of the surface colour in the forewings, as well as with pale, dirty
white hindwings. The type specimen of this species was figured in the third volume of
Romanoff’s series of book (1887) and afterwards illustrated by Dietze (1906, 1910)
Nota lepid. 35 (2): 197-231 224
Figs 21-25. Female genitalia of Eupithecia species (scale bar = 1 mm). 21. E. tabestana Mironov & Ratzel,
Sp. n. 22. E. obtinens Brandt, 1941.23. E. fredi Mironov & Ratzel, sp. n. 24. E. incurvaria Hampson, 1903.
25. E. naumanni Mironov & Ratzel, sp. n.
as well. The male of E. ochrovittata was previously unknown. We therefore include a
description and illustration of the male genitalia.
Male genitalia (Fig. 20). Uncus relatively small, short and narrow, biapical. Valva
shaped like a lemon segment slightly arched near base of dorsal margin, with evenly
curved ventral margin and broadly rounded, rather obtuse apex; sacculus slightly scle-
rotized. Vinculum short and narrow, tapering anteriorly. Papillae on the anterior arms
of the labides medium-sized, covered with short setae at apices. Phallus slim, short and
narrow, narrowing anteriorly, shorter than valval length. Vesica covered with numer-
ous denticules and armed with one horse-shoe-shaped cornutus. Sternite A8 peg-like,
evenly tapered to apex and sclerotized near it; basal emargination relatively shallow.
228 Mironov & RATZEL: Eupithecia of Afghanistan
Eupithecia exactata Staudinger, 1882
Eupithecia exactata Staudinger, 1882: Entomologische Zeitschrift, Stettin 43 (1-3): 78. Syntypes 10°, 29
(coll. ©. Staudinger in MNHU), [Kazakhstan]: Saisan.
Eupithecia exactata f. modesta Dietze, 1910: Biologie der Eupithecien 1, pl. 73, fig. 380. Holotype © (coll.
K. Dietze in MNHU), [China]: Aksu, Makan-Wiiste [Korla, Sai-chin on the label].
Eupithecia procera Vojnits, 1982: Acta Zoologica Academiae Scientiarum Hungaricae 28 (3-4): 418,
fig. 20. Holotype S (HNHM), East Turkestan [Kyrgyzstan]: Prov. Semirechgensee, Fort-Naryne. Syn. n.
Eupithecia opulenta Vojnits, 1982: Acta Zoologica Academiae Scientiarum Hungaricae 28 (3-4): 420,
fig. 21. Holotype @ (HNHM), East Turkestan [Kyrgyzstan]: Prov. Semirechgensee, Fort-Naryne (syn-
onymised in Mironov 1991).
Eupithecia subolivacea Inoue, 1996: Transactions of the Lepidopterological Society of Japan 47 (4): 241,
figs 7, 14. Holotype 9 (coll. H. Inoue in BMNH), Pakistan: Gilgit (synonymised in Mironov et al. 2008b).
Material. Syntypes: 19, Kazakhstan, exactata © Saisan, Origin., Gen. vérifiés 1456/1 Eupithecia ex-
actata Stgr. ©, Saisan, det. E. De Laever 1954 (coll. O. Staudinger in MNHU); 19, Saisan, Origin., gehört
ui den Nähe der Gratiosata HS. Boh., exactata Stgr. det. E. Schütze, Kassel (coll. O. Staudinger in MNHU);
19, Saisan Hbhr., Origin., Exactata Stgr 9, Boh. Schakuh, exactata Stgr. det. E. Schütze, Kassel (coll. O.
Staudinger in MNHU). — Holotype of E. exactata f. modesta ©, China, Korla, Sai-chin, ? exactata forma:
modesta Typ., Korla. (380), Zool. Mus. Berlin, Typus exactata Stgr. det. E. Schütze, Kassel, Gen.-Unters.
Nr. [Schmidt slide no.] Eu 113a, Zool. Mus. Berlin (coll. K. Dietze in MNHU). — Holotype of E. procera
©, Kyrgyzstan, Turkestan Oriental, Fort Naryne, Prov. Semirechgensee, S. Akulin 1910-1911, Holotypus
Eupithecia procera Vojnits, 1981, Gen. 892 det. Vojnits A. (HNHM). — Holotype of E. opulenta 9,
Kyrgyzstan, Turkestan Oriental, Fort Naryne, Prov. Semirechgensee, S. Akulin 1910-1911, Holotypus
Eupithecia opulenta Vojnits, 1981, Gen. 8919 det. Vojnits A. (HNHM). — Holotype of E. subolivacea 9,
Pakistan, Gilgit, Alt. 1600 m, 17.v11.1990, F. Aulombard et J. Plante leg., BM Geom. slide no. 19217 (coll.
H. Inoue in BMNH). NE Afghanistan: 10°, Badachschan, Anjuman Dorf, 3000 m, 20-27.v11.1961, Ratzel
slide no. GU13312/2m; 10°, Anjuman Pass, 3990-4300 m, 10.v11.1963, leg. K. Omoto; 19, Badakshan
m., Bela Kuran, 2900 m, 12—29.vi1.1961, leg. K. Omoto, Ratzel slide no. GU12312/2w (ZSM); 19, 29,
Wakhan-Tal, 3300 m, Zamestani Baharak, 10.vii.1971, UV-Li, Ebert & Naumann, coll. Nr. 242, Ratzel
slide no. GU14208/1 (SMNK, coll. Ratzel); 19, same locality, 23.v11.1971, UV-Li, Ebert & Naumann, coll.
Nr. 261, Ratzel slide no. GU9208/4w; 119, 79, same locality, Sargaz, 2930 m, 11.v111.1971, UV-Li, Ebert
& Naumann, coll. Nr. 290 (SMNK); 30°, 19, C Afghanistan, Koh-i-Baba, S-Seite, Panjao, 2650 m, 20-22.
vil. 1966, G. Ebert leg., Vojnits slides nos 177720, 177730, 195180, 177759 (SMNK)
This is a common Asian mountainous species, widespread in northern Iran (Shahkuh
Mts.), Kyrgyzstan, Tajikistan, Pakistan/India (Jammu & Kashmir), southeastern regions
of Kazakhstan, northwestern provinces of China (Xinjiang), and in Mongolia. Not pre-
viously recorded from Afghanistan. The male and female genitalia were described and
illustrated in De Laever (1956) for the first time.
Eupithecia nephelata Staudinger, 1897
Eupithecia nephelata Staudinger, 1897: Deutsche entomologische Zeitschrift, Iris 9 (2): 282. Syntypes
19,19 (coll. O. Staudinger in MNHU), [Mongolia]: Uliassutai, Tumartin-Gol.
Material. Syntypes: 19, Mongolia, Uliassutai, 94, Led., Nephelata Stgr., Origin., Gen. vérifiés
1441/4 Eupithecia nephalata Stgr. [sic.] ©, det. E. De Laever 1954; 19, Uliassutai, 94, Led., nephelata
9, Origin., Gen. vérifiés 1441/5 Eup. nephalata Stgr. [sic.] 9, det. E. De Laever 1954 (coll. O. Staudinger
in MNHU). NE Afghanistan: 19, Wakhan-Tal, Langar, 3500 m, 11.vii.1971, UV-Li, Ebert & Naumann,
coll. Nr. 243; 19, same locality, 3300 m, Zemestani Baharak, 10.vii.1971, UV-Li, Ebert & Naumann, coll.
Nr. 242, Ratzel slide no. GU14208/2w (SMNK).
This pale-coloured Central Asian species has previously been recorded from Kyrgyzs-
tan, Tajikistan, Pakistan/India (Jammu and Kashmir), western China (Xinjiang), and
Mongolia. It is a new species for the fauna of Afghanistan. The moth is externally
rather similar to the preceding species and was illustrated in Dietze (1910) and later in
Nota lepid. 35 (2): 197-231 229
Mironov et al. (2008c). The male and female genitalia were described and illustrated
by De Laever (1956) for the first time.
Eupithecia marginata Staudinger, 1892
Eup{ithecia] marginata Staudinger, 1892: Deutsche entomologische Zeitschrift, Iris 5 (1): 257. Syntypes
20°, 49 (coll. O. Staudinger and K. Dietze in MNHU), [China]: Kuldja-Gebiet.
Incorrect subsequent spelling: marginita: De Laever (1956).
Material. Syntypes: 19, China, Kuldja Rkbl. 84, marginata Stgr., Origin., Gen. vérifiés 1451/3
Eupithecia marginata Stgr. S, Kuldja 84, det. E. De Laever 1954; 19, marginata 9 Kuldja, Origin., Gen.
vérifiés 1451/4 Eupithecia marginata 9, Kuldja, det. E. De Laever 1954; 39, [small brownish circular label],
Origin. (coll. O. Staudinger in MNHU). Afghanistan: 40, Paghman, 30 km NW v. Kabul, 2100-2200 m,
20-30.vi1.1962, E. & A. Vartian leg., Vojnits slide no. 151109 (HNHM); 19, SE Afghanistan, Safed Koh,
S-Seite, Kotkai, 2350 m, 4.v111.1967, M. Müller leg., Vojnits slide no. 195379 (SMNK).
E. marginata is a western Asian species ranging from Cyprus in the west through
North Caucasus (Daghestan), Armenia, Azerbaijan, Iran, Uzbekistan, Tajikistan, and
Kyrgyzstan to southeastern Kazakhstan (Tien-Shan Mts.) and northwestern province of
China (Xinjiang) in the east. Not previously recorded from Afghanistan.
This species is externally very similar to the British nominate subspecies of E. vul-
gata (Haworth, 1809). Based on the structure of the male and female genitalia, it be-
longs to the semigraphata group (Schütze 1956). The female genitalia were described
and illustrated in Petersen (1910) for the first time, and after that the genitalia of both
sexes were pictured in the publications of De Laever (1956) and Viidalepp (1988).
Eupithecia exicterata Mironov & Ratzel, 2008
Eupithecia exicterata Mironov & Ratzel, 2008: Transactions of the Lepidopterological Society of Japan
59 (3): 220, figs 16, 24, 25. Holotype © (ZFMK), Pakistan: Hindukush Mts., 5 km E of Shandur pass,
72°38’E, 36°07’N, 3250 m.
Material. Holotype ©, Pakistan, Hindukush Mts., 5 km E of Shandur pass, 72°38’E, 36°07’N, 3250
m, 24—25.vi.2000, leg. Z. Varga & G. Ronkay (ZFMK). — Paratypes: 30°, same data (ZFMK, ZISP). 29,
India, J & K, Kashmir, vic. Sonamarg, 2900 m, 13.vin.1988, leg. W. Thomas (ZFMK, ZISP); 19, Indien
Uttar Pradesh, Gangotri, ca 3000 m, 6—9.vi1i.1993, Kautt & Weisz, Ratzel slide no. GU12905/1w (SMNS).
19, Pakistan, Karakoram Mts., Naltar valley, 74°09’22”E, 36°11’08”N, 2900 m, 20.vii.1998, leg. G.
Csorba & L. Ronkay (HNHM); 10°, 19, same data, 2800 m, 74°12’E, 36°09.6’N, respectively 18.vii.1998,
leg. G. Csorba & L. Ronkay, slide ACG GL37 and 14.viii.1998, leg. Z. Varga & G. Ronkay, slide ACG
GL16 (coll. Laszlo); 30°, 39, Pakistan-West, Great Himalaya Mts., near Gabar, 3200 m, 21 —24.vi1i1.2004,
leg. V. Gurko, Ratzel slides nos GU8705/1w, GU8705/2m, GU8705/3w (coll. Ratzel). SE Afghanistan:
19, Safed Koh, S-Seite, Kotkai, 2350 m, 20.vii.1968, M. Müller leg., Vojnits slide no. 195069 (SMNK).
This species, which is similar externally to E. icterata f. subfulvata (Haworth, 1809),
was recently described on the basis of a large series, including 16 specimens from
the western Himalayas (Pakistan and India). A single worn female was found in the
Afghanian material of Eupithecia in SMNK.
Acknowledgements
We are grateful to Dr. R. Trusch, M. Falkenberg and G. Ebert (SMNK, Karlsruhe), Dr. A. Hausmann (ZSM,
Munich) and Dr. W. Mey (MNHU, Berlin) for their always kind support of both authors when visiting
respectively the Staatliches Museum fiir Naturkunde Karlsruhe, Germany, Zoologische Staatssammlung
230 Mironov & RATZEL: Eupithecia of Afghanistan
München, Germany and Museum für Naturkunde, Zentralinstitut der Humboldt-Universitat zu Berlin,
Germany. We are grateful also to Dr. L. Ronkay (HNHM, Budapest), Dr. J. Viidalepp (IAET, Tartu) and
Dr. D. Stüning (ZFMK, Bonn) for kind support of the first author when visiting respectively the Termes-
zettudomanyi Muzeum Allattara (Hungarian Natural History Museum), Budapest, Hungary, Institute of
Agriculture and Environment, Estonian Agricultural University, Tartu, Estonia, Zoologisches Forschungs-
institut und Museum Alexander Koenig, Bonn, Germany. We are grateful to Dr. B. Gustafsson (NHRS,
Stockholm) for geneorous loan of type-material and to Dr. A. Hausmann (ZSM, Munich), Dr. S. Gaal-
Haszler (NHMW, Vienna) and Dr. L. Ronkay (HNHM, Budapest) for loan of material. Thanks are also
due to the Deutsche Forschung Gemeinschaft (DFG grants nos 436 RUS 17/99/02; STU 498/2-1 and TR
1086/1—1) which enabled Dr. V. Mironov to do extensive studies on Asian Eupitheciini in ZFMK (Bonn),
MNHU (Berlin) and SMNK (Karlsruhe) in 2003, 2009 and 2011, and to the Royal Society, London, who
provided a grant to enable Dr. V. Mironov to work in BMNH (London) in 2006. We acknowledge Dr. L.
Kaila (Finnish Museum of Natural History, Helsinki) and an anonymous reviewer for helpful comments
on the manuscript.
References
Bolte, K. B. 1990. Guide to the Geometridae of Canada (Lepidoptera). VI. Subfamily Larentiinae. 1. Re-
vision of the genus Eupithecia. — Memoirs of the Entomological Society of Canada 151: 1—253.
Brandt, W., 1938. Beitrag zur Lepidopteren-Fauna von Iran. Neue Gattungen, Arten und Formen (Macro-
lepidoptera.). — Entomologische Rundschau 55: 497—702 (nc).
Brandt, W. 191. Beitrag zur Lepidopteren-Fauna von Iran (4). Einige neue Geometriden. — Mitteilungen
der Münchner Entomologischen Gesellschaft 31 (3): 864-886, pl. xxvili— xxx.
Bytinski-Salz, H. & W. Brandt 1937. New Lepidoptera from Iran. — The Entomologist’s Record and
Journal of Variation 49 (suppl.): 1-15.
Christoph, H. 1877. Sammelergebnisse aus Nordpersien, Krasnowodsk in Turkmenien und dem Daghe-
stan. — Horae Societatis Entomologicae Rossicae, 12 (1876-1877): 181—299, pls. v-viii.
Dietze, K. 1904. Beitrage zur Kenntnis der Eupithecien. — Deutsche entomologische Zeitschrift, Iris [1903]
16 (2): 331-387, pls. 111—v.
Dietze, K. 1906. Beiträge zur Kenntnis der Eupithecien. — Deutsche entomologische Zeitschrift, Iris 19 (2):
55-67, pls. 1—1v.
Dietze, K. 1908. Beiträge zur Kenntnis der Eupithecien. — Deutsche entomologische Zeitschrift, Iris 21
Dietze, K. 1910. Biologie der Eupithecien. I. Berlin, pls. 1-82.
Herrich-Schäffer, G.A.W. 1848 [1847]. Systematische Bearbeitung der Schmetterlinge von Europa, zu-
gleich als Text, Revision und Supplement. Die Spanner 3: 1- 184, 91 pls. Regensburg, 1847.
Inoue, H. 1979. Revision of the genus Eupithecia of Japan, Part 1 (Lepidoptera, Geometridae). — Bulletin
of the Faculty of domestic Sciences, Otsuma Womens’ University 15: 157-224.
Inoue, H. 2000. Eupithecia Curtis (Geometridae, Larentiinae) from Nepal. — /n: T. Haruta (ed.), Moths of
Nepal, part 6. — Tinea 16 (Supplement 1): 27-44.
Laever, de E. 1956. Etudes sur le Genre Eupithecia Curtis. — Bonner zoologische Beiträge 7 (1-3): 237—
247, pls. 1-iv.
Laever, de E. 1960. Études sur le genre Eupithecia Curtis. — Bonner zoologische Beiträge 11 (1): 114-123,
pls. v—vil.
Mironov, V. G. 1989a. Eupithecia (Lepidoptera, Geometridae) from Southern Siberia, with description of
a new species. — Annales Entomologici Fennici 55: 145-152.
Mironov, V. G. 1989b. New Eupithecia species (Lepidoptera, Geometridae) from the Middle Asia and
Mongolia. — Vestnik zoologii 1989 (3): 12-19 (in Russian).
Mironov, V. G. 1990. A Systematic Catalogue of tribe Eupitheciini (Lepidoptera, Geometridae) of the
USSR, I. — Entomologicheskoe Obozrenie 69 (3): 656-670 (in Russian).
Mironov, V. G. 1991. A Systematic Catalogue of tribe Eupitheciini (Lepidoptera, Geometridae) of the
USSR, II. — Entomologicheskoe Obozrenie 70 (1): 157-167 (in Russian).
Mironov, V. G. 2003. Larentiinae II (Perizomini and Eupitheciini). — /n: A. Hausmann (ed.), The Geometrid
Moths of Europe 4: 463 pp.
Mironov, V. G. & A. C. Galsworthy 2007. The genus Eupithecia (Lepidoptera, Geometridae) in Taiwan: an
updated survey. — Transactions of the Lepidopterological Society of Japan 58 (3): 341-363.
Nota lepid. 35 (2): 197-231 251
Mironov, V. G., A. C. Galsworthy & U. Ratzel 2008a. A survey of the Eupithecia fauna (Lepidoptera,
Geometridae) of the Western Himalayas: Part I. — Transactions of the Lepidopterological Society of
Japan 59 (1): 55-77.
Mironov, V. G., A. C. Galsworthy & U. Ratzel 2008b. A survey of the Eupithecia fauna (Lepidoptera,
Geometridae) of the Western Himalayas: Part II. — Transactions of the Lepidopterological Society of
Japan 59 (2): 117-143.
Mironov, V. G., A. C. Galsworthy & U. Ratzel 2008c. A survey of the Eupithecia fauna (Lepidoptera,
Geometridae) of the Western Himalayas: Part III. — Transactions of the Lepidopterological Society of
Japan 59 (3): 201-224.
Mohammadian, H. 2006. Biological Diversity of Lepidoptera in Iran (Geographic Distribution of 2200
species). Shabpareh Publ.: Iran, Tehran, 392 pp.
Petersen, W. 1910. Ein Beitrag zur Kenntnis der Gattung Eupithecia Curt. — Deutsche entomologische
Zeitschrift, Iris (1909) 22 (4): 203-314, 28 pls.
Romanoff, N. M. 1887. Les Lépidoptères de la Transcaucasie. Troisième partie. — Mémoires sur les Lépi-
dopteres 3: 1-49, pls. I-1.
Schütze, E. 1956. Eupithecia-Studien VII und VIII. Die semigraphata-Gruppe (Lepidoptera, Geometri-
dae). — Zeitschrift der Wiener Entomologischen Gesellschaft 41 (Bd 67) (11): 306-320; (12): 328—
339, pls. 33-35.
Schütze, E. 1958. Eupithecien-Studien X. Die graphata-Gruppe (Lep. Geometr.). — Entomologische Zeit-
schrift, Frankfurt am Main 68 (5): 49-64, (6): 71-72, (7): 82-88, pl. 1.
Schütze, E. 1960. Alte und neue Eupithecien aus Iran (Lep. Geom.). Eupithecien-Studien XV. — Mittei-
lungen der Münchner Entomologischen Gesellschaft 50: 1-23, pls. i—xiu1.
Schütze, E. 1961a. Lepidoptera der Deutschen Nepal-Expedition 1955. Gattung Eupithecia Curtis. — Ver-
öffentlichungen der Zoologischen Staatssammlung München 6: 179-183.
Schütze, E. 1961b. Weitere Eupithecien aus Iran and Arabien (Lep. Geom.) (Eupithecien-Studien XVII). —
Mitteilungen der Münchner Entomologischen Gesellschaft 51: 58-71, pls. 1—viil.
Schwingenschuss, L. 1939. Beitrag zur Lepidopterenfauna von Iran (Persien) insbesondere des Elbursge-
birges in Nordiran. — Entomologische Zeitschrift 53 (25): 200-210.
Scoble, M. J. (ed.), Pitkin, L. M., Parsons, M. S., Honey, M. R. & B. R. Pitkin 1999. Geometrid Moths
of the World: A catalogue (Lepidoptera, Geometridae). Vol. 1 and 2. CSIRO Publishing and Apollo
Books, Stenstrup. 1016 pp. (+ 129 pp. of Index).
Staudinger, O. 1892. Neue Arten und Varietäten von paläarktischen Geometriden. — Deutsche entomolo-
gische Zeitschrift, Iris 5 (1): 141-260.
Viidalepp, J. 1988. The fauna of Geometrid Moths of the mountains of Central Asia. Moscow, Publ. “Na-
uka”, 240 pp. (in Russian).
Viidalepp, J. 1996. Checklist of the Geometridae (Lepidoptera) of the former U.S.S.R. Apollo Books Aps.,
Stenstrup, Denmark. 111 pp.
Vojnits, A. M., 1975. Geometridae: Eupithecini II. (Lepidoptera). — Acta Zoologica Academiae Scientia-
rum Hungaricae 21 (3-4): 447-453.
Vojnits, A. M. 1978. Investigations in the “Eupithecia scalptata-syriacata” group (Lepidoptera: Geome-
tridae). — Acta Zoologica Academiae Scientiarum Hungaricae 24 (3-4): 431—438.
Vojnits, A. M. 1981. Data to the Eupithecia fauna of Asia (Lepidoptera, Geometridae). [Studies on Palae-
arctic Eupithecia species XV]. — Annales Historico-Naturales Musei Nationalis Hungarici 73: 221 —
231.
Vojnits, A. M. 1982a. New Eupithecia species from the Asiatic regions of the Soviet Union and Iran. —
Acta Zoologica Academiae Scientiarum Hungaricae 28 (3-4): 403-420.
Vojnits, A. M. 1982b. A revision of the “Eupithecia innotata group”, I. (Lepidoptera, Geometridae). [Stu-
dies on Palaearctic Eupithecia species XV]. — Annales Historico-Naturales Musei Nationalis Hunga-
rici 74: 217-239.
Vojnits, A. M. 1988. Studies on the Afghano-Iranian Eupitheciini fauna I. (Lepidoptera: Geometridae). —
Acta Zoologica Hungarica 34 (4): 419-433.
Wiltshire, E. P. 1952. Early stages of Palearctic Lepidoptera, X. — Bulletin de la Société Fouad Ier d’Ento-
mologie 36: 175-185, 1 pl.
Wiltshire, E. P. 1985. Middle East Lepidoptera XLIV. Eupithecia penultimaria sp. n. (Geometridae) from
central Iraq. — The Entomologist’s Gazette 36 (4): 263-267.
Wiltshire, E. P. 1986. Lepidoptera of Saudi Arabia: Fam. Cossidae, Sesiidae, Metarbelidae, Lasiocampidae,
Sphingidae, Geometridae, Lymantriidae, Arctiidae, Nolidae, Noctuidae (Heterocera); Fam. Satyridae
(Rhopalocera) (Part 5). — Jn: W. Büttiker & F. Krupp (eds.), Fauna of Saudi Arabia 8: 262-323.
“ms
Nota lepidopterologica index to volume 35 by taxon and
author names, with publication dates
Publication dates
No. 1: p. 1—108: 25.04.2012; No. 2: p. 109-231: 15.11.2012
Contents
Aarvik, L. 2012 (15.xi.). Symmoca sparsella Joannis, 1891 (Gelechioidea, Autostichidae) new to Europe.
35(2): 181-183.
Alipanah, H.; Asselbergs, J. & Sarani, M. 2012 (15.x1.). Redescription of Nephopterygia austeritella Am-
sel, 1965 (Pyralidae: Phycitinae) with description of its hitherto unknown female. 35(2): 185-191.
Bartsch, D. 2012 (15.xi.). Revision of types of several species of Bembecia Hübner, 1819 from northern
Africa and southwestern Europe (Sesiidae). 35(2): 125-133.
Guerrero, J. J.; Ortiz, A. S. & Rubio, R. M. 2012 (15.x1.). On the distribution of /daea gelbrechti Hausmann,
2003 in the Ibero-Maghrebian region (Geometridae: Sterrhinae). 35(2): 193-196.
Hernändez-Roldan, J. L., Vicente, J. C. & Munguira, M. L. 2012 (25.iv.). Natural history, immature stage
morphology, and taxonomic status of the threatened skipper Pyrgus cinariae (Rambur, 1839) in the
Iberian Peninsula. 35(1): 3-18.
Mironov, V. & Ratzel, U. 2012 (25.iv.). New species of Eupithecia Curtis (Geometridae: Larentiinae) from
Syria. 35(1): 19-26.
Mironov, V. & Ratzel, U. 2012 (15.x1.). Eupithecia Curtis, 1825 of Afghanistan (Geometridae: Larentiinae).
35(2): 197 = 231.
Nel, J. & Varenne, T. 2012 (25.iv.). Description d’ Apatetris (s. I.) mediterranella sp. n. du littoral méditer-
ranéen de France et d’ Italie (Gelechiidae, Glechiinae, Apatetrini). 35(1): 27—32.
Nieukerken, E. J. van; Doorenweerd, C.; Ellis, W. N.; Huisman, K. J. (Hans); Koster, J. C. (Sjaak); Mey,
W.; Muus, T. S. T. & Schreurs, A. 2012 (15.x1.). Bucculatrix ainsliella Murtfeldt, a new North Ameri-
can invader already widespread on northern red oaks (Quercus rubra) in Western Europe (Buccula-
tricidae). 35(2): 135-159.
Nupponen, K. 2012 (15.x1.). Redescription of Pelochrista maculiferana (Kennel, 1900), bona sp., with
notes on eight poorly known species of leafrollers from the Volgo-Ural region (Lepidoptera: Tortrici-
dae). 35(2): 115-124.
Nupponen, K. & Fibiger, M. 2012 (25.iv.). Additions to the checklist of Bombycoidea and Noctuoidea of
the Volgo-Ural region. Part II. (Lepidoptera: Lasiocampidae, Erebidae, Molidae, Noctuidae). 35(1):
33-50.
Pyrcz, T. W. 2012 (15.x1.). Obituary: Janusz Wojtusiak (1942-2012). 35(2): 111-113.
Rota, J. 2012 (25.iv.). Editorial. 35(1): 2.
Sumpich, J. & Skyva, J. 2012 (15.xi.). New faunistic records for a number of Microlepidoptera, including
description of three new taxa from Agonoxenidae, Depressariidae, and Gelechiidae (Gelechioidea).
35(2): 161-179.
Yakovlev, R. V. 2012 (25.iv.). Checklist of Butterflies (Papilionoidea) of the Mongolian Altai Mountains,
including descriptions of new taxa. 35(1): 51-96.
Zlatkov, B. & Budashkin, Y. 2012 (25.iv.). Taxonomic and distributional remarks on some Palaearctic Cy-
dia of the succedana-group with descriptions of two new species (Tortricidae). 35(1): 97-107.
Book reviews. 35(1) (25.iv.): 108; 35(2) (15.xi.): 134.
Index of taxonomical changes
anikini sp. n. (Plebejus) — Yakovlev 2012 (25.iv.): 35(1): 74
astragali (Joannis, 1909) (Bembecia), stat. rev. — Bartsch 2012 (15.xi.): 35(2): 129
centralasiae (Obraztsov, 1949)(ssp. of Laspeyresia pamira), stat. n., bona sp. — Zlatkov & Budashkin
2012 (25.iv.): 35(1): 103
chastilovi Churkin, 2003 (ssp. of Erebia callias Edwards), stat. n.: now: Erebia chastilovi — Yakovlev 2012
(25.1v.): 35(1): 81
dmitrievae ssp. n. (Hyponephele lycaon) — Yakovlev 2012 (25.iv.): 35(1): 83
eberti Vojnits, 1978 (Eupithecia), syn. n. of Eupithecia obtinens Brandt, 1941 — Mironov & Ratzel 2012
(15.x1.)°35(2): 208
elegantana Budashkin & Zlatkov (Cydia centralasiae), ssp. n. — Zlatkov & Budashkin 2012 (25.iv.): 35(1):
104
fredi sp. n. (Eupithecia) — Mironov & Ratzel 2012 (15.x1.): 35(2): 209
gabretica Sumpich ssp. n. (Chrysoclista abchasica) — Sumpich, J. & Skyva 2012 (15.xi.): 35(2): 164
germani Sp. n. (Plebejus) — Yakovlev 2012 (25.iv.): 35(1): 75
graecatella sp. n. (Eulamprotes) — Sumpich, J. & Skyva 2012 (15.xi.): 35(2): 168
igueri Bettag & Bläsius, 1998 (Bembecia), syn. n. of Bembecia astragali (Joannis, 1909) — Bartsch 2012
(15.xi.): 35(2): 129 |
intexta Kuznetsov, 1962 (Laspeyresia), syn. n. of Cydia centralasiae (Obraztsov, 1949) — Zlatkov & Bu-
dashkin 2012 (25.iv.): 35(1): 103
kerzhneri ssp. n. (Hyponephele lycaon) — Yakovlev 2012 (25.iv.): 35(1): 83
linariatoides Mironov, 1989 (Eupithecia), syn. n. of Eupithecia mirificata Brandt, 1938 — Mironov &
Ratzel 2012 (15.x1.): 35(2): 200
maculiferana (Kennel, 1900) (Epiblema), bona sp., comb. n., now: Pelochrista — Nupponen 2012 (15.x1.):
35(2): 117
major Caradja, 1916 (G[rapholitha] succedana var. major), stat. rev.: now: Cydia major. — Zlatkov & Bu-
dashkin 2012 (25.iv.): 35(1): 98
mediterranella sp. n. (Apatetris (s. 1.)) — Nel & Varenne 2012 (25.1v.): 35(1): 28
naumanni sp. n. (Eupithecia) — Mironov & Ratzel 2012 (15.x1.): 35(2): 219
nomada ssp. n. (Erebia chastilovi) — Yakovlev 2012 (25.iv.): 35(1): 82
ochrovittata Christoph, 1887 (Eupithecia), LT — Mironov & Ratzel 2012 (15.x1.): 35(2): 226
pamira Obraztsov, 1943 (Laspeyresia), syn. n., LT of Cydia major (Caradja, 1916) — Zlatkov & Budashkin
2012 (25.iv.): 35(1): 98
przhevalskii sp. n. (Erebia) — Yakovlev 2012 (25.1v.): 35(1): 80
sapozhnikovi sp. n. (Neolycaena) — Yakovlev 2012 (25.1v.): 35(1): 65
shadzgat ssp. n. (Plebejus idas) — Yakovlev 2012 (25.1v.): 35(1): 72
socerbi Sumpich sp. n. (Agonopterix) — Sumpich, J. & Skyva 2012 (15.xi.): 35(2): 162
subomnigera Vojnits, 1988 (Eupithecia) syn. n. of Eupithecia tshimganica Viidalepp, 1988 — Mironov &
Ratzel 2012 (15.x1.): 35(2): 200
suffuscana Zlatkov & Budashkin, sp. n. (Cydia) — Zlatkov & Budashkin 2012 (25.iv.): 35(1): 101
tabestana sp. n. (Eupithecia) — Mironov & Ratzel 2012 (15.x1.): 35(2): 206
transcaucasica Budashkin & Zlatkov, sp. n. (Cydia) — Zlatkov & Budashkin 2012 (25.iv.): 35(1): 100
tunetana Le Cerf, 1920 (var. of Dipsosphecia megillaeformis), syn. n. of Bembecia sirphiformis (Lucas,
1849) — Bartsch 2012 (15.x1.): 35(2): 126
weigti sp. n. (Eupithecia) — Mironov & Ratzel 2012 (25.iv.): 35(1): 20
; [
|
SOCIETAS EUROPAEA LEPIDOPTEROLOGICA e.V.
Nota lepidopterologica wird als wissenschaftliche Zeitschrift von der Societas Europaea Lepidoptero-
logica (SEL) herausgegeben und den Mitgliedern der SEL zugesandt. Autoren, die Manuskripte für die
Publikation in der Nota lepidopterologica einreichen möchten, finden die jeweils gültigen Autoren-
richtlinien auf der Homepage der SEL unter http://www.soceurlep.eu. Der Verkauf von Einzelheften
und älteren Jahrgängen von Nota lepidopterologica erfolgt durch das Antiquariat Goecke & Evers (Inh.
Erich Bauer), Sportplatzweg 5, 75210 Keltern, Deutschland, E-Mail: [email protected] (www.insecta.de,
www.goeckeevers.de); der Buchhandelspreis beträgt € 100,00 pro Band. Die Mitgliedschaft bei der SEL
steht Einzelpersonen und Vereinen nach Maßgabe der Satzung offen. Der Aufnahmeantrag ist an den Mit-
gliedssekretär Willy De Prins, Dorpstraat 401 B,3061 Leefdaal, Belgien; e-mail: willy.de.prins @telenet.be
zu richten. Das Antragsformular ist im Internet auf der Homepage der SEL erhältlich. Der Mitglieds-
beitrag ist jährlich am Jahresanfang zu entrichten. Er beträgt für Einzelpersonen € 35,00 bzw. für Ver-
eine € 45,00. Die Aufnahmegebühr beträgt € 2,50. Die Zahlung wird auf das SEL-Konto 19 56 50 507
bei der Postbank Köln (BLZ 370 100 50) erbeten (IBAN: DE63 3701 0050 0195 6505 07; BIC: PBNKDEFF).
Mitteilungen in Beitragsangelegenheiten werden an den Schatzmeister Dr. Robert Trusch, Staatliches
Museum für Naturkunde, Erbprinzenstr. 13, 76133 Karlsruhe, Germany; e-mail: [email protected] erbeten.
Adressenänderungen sollten umgehend dem Mitgliedssekretär oder dem Schatzmeister mitgeteilt werden.
Published by the Societas Europaea Lepidopterologica (SEL), Nota lepidopterologica is a scientific Journal
that members of SEL receive as part of their membership. Authors who would like to submit papers for
publication in Nota lepidopterologica are asked to take into consideration the relevant instructions for authors
available on the SELhomepage at http://www.soceurlep.eu. Single and back issues of Nota lepidopterologica
can be obtained from Antiquariat Goecke & Evers (Prop. Erich Bauer), Sportplatzweg 5, 75210 Keltern,
Germany, E-Mail: books @insecta.de (www. insecta.de, www.goeckeevers.de); price € 100,00 per volume.
The membership is open to individuals and associations as provided for by the statutes of SEL. Applications
for membership are to be addressed to the Membership Secretary Willy De Prins, Dorpstraat 401 B,
3061 Leefdaal, Belgium; e-mail: [email protected]. The application form is available on the SEL
homepage. The annual subscription is to be paid at the beginning of the year. It is 35.00 € for individ-
uals or 45.00 € for associations. The admission fee is 2.50 €. Dues should be paid to SEL account no.
19 56 50 507 at Postbank Köln [Cologne] (bank code 370 100 50; IBAN: DE63 3701 0050 0195 6505 07;
BIC: PBNKDEFF) or to local treasures as mentioned on the website. Communications related to member-
ship contributions should be sent to the Treasurer Dr Robert Trusch, Staatliches Museum fiir Naturkunde,
Erbprinzenstr. 13, 76133 Karlsruhe, Germany; e-mail: [email protected]. Changes of addresses should be
immediately communicated to the Membership Secretary or the Treasurer.
Publié par la Societas Europaea Lepidopterologica (SEL), Nota lepidopterologica est un périodique scien-
tifique envoyé à tous les membres de la SEL. Les auteurs qui désirent publier des manuscrits dans la revue
sont priés de tenir compte des Instructions aux auteurs disponibles sur le site Web de la SEL: http://www.
soceurlep.eu. Les ventes de numéros supplémentaires ou d’anciens numéros de Nota lepidopterologica.
ainsi que les ventes de numéros aux personnes n’étant pas membres de la SEL sont sous la responsabilité
de Antiquariat Goecke & Evers (Erich Bauer, prop.), Sportplatzweg 5, 75210 Keltern, Allemagne, courriel:
[email protected] (www.insecta.de, www.goeckeevers.de); en librairie, le prix est de € 100,00 le volume.
Tel que prévu dans ses statuts, les individus de même que les associations peuvent devenir membres de
la SEL. Les demandes d'adhésion doivent être envoyées au Secrétaire responsable des adhésions, Willy
De Prins, Dorpstraat 401 B, 3061 Leefdaal, Belgique; courriel: [email protected]. Le formulaire
d’adhésion est disponible sur le site Web de la SEL. L’adhésion se paie au début de l’année. Eile est
de 35 € pour les indi vidus et de 45 € pour les associations. Les frais d’admission sont de 2,50 €. Les
paiements peuvent être envoyés au compte de la SEL: no. 19 56 50 507, Postbank Köln [Cologne] (code
bancaire 370 100 50; IBAN: DE63 3701 0050 0195 6505 07; BIC: PBNKDEFF) ou au trésorier local tel
que mentionné sur le site Web. Toute question en rapport avec l'adhésion doit être envoyée au Trésorier,
Dr. Robert Trusch, Staatliches Museum für Naturkunde, Erbprinzenstr. 13, 76133 Karlsruhe, Germany:
courriel: [email protected]. Tout changement d‘adresse doit être mentionné immédiatement au Secrétaire
responsable des adhésions ou au Trésorier.
N IN
TT
3 908 704 7093
8 01