Volume 10 Number 4 1 May 2022
The Taxonomic Report
OF THE INTERNATIONAL LEPIDOPTERA SURVEY
ISSN 2643-4776 (print) / ISSN 2643-4806 (online)
Genomic DNA sequencing reveals two new North American
species of Staphylus (Hesperiidae: Pyrginae: Carcharodini)
Jing Zhang'’, Qian Cong'”, Jinhui Shen’, Leina Song’, and Nick V. Grishin?**
'Eugene McDermott Center For Human Growth & Development, Departments of “Biophysics and *Biochemistry, and
“Howard Hughes Medical Institute, University of Texas Southwestern Medical Center, 5323 Harry Hines Blvd., Dallas, TX
75390-9050, USA; “Corresponding author: [email protected]
ABSTRACT. Two new skipper butterfly (Hesperiidae) species are described from the United States: Staphylus
floridus Grishin, sp. n. (type locality in Florida, Volusia Co.) and Staphylus ecos Grishin, sp. n. (type locality in Texas,
Brewster Co.). They are cryptic and hence escaped recognition. They differ from their sister species by the relative size and
morphology of genitalia and by genotype—including and beyond the COI barcode—thus suggesting genetic isolation that
argues for their species-level status. A lectotype is designated for Helias ascalaphus Staudinger, 1876. Staphylus opites
(Godman & Salvin, 1896), stat. rest. is a species-level taxon and not a synonym of Staphylus vincula (Plotz, 1886), while
Pholisora iguala Williams & Bell, 1940, syn. n. is a junior subjective synonym of S. vincula.
Additional key words: biodiversity, cryptic species, suture zones, genomics, phylogeny.
ZooBank registration: http://zoobank.org/CCFO18F4-01 88-45 1 A-BE75-006F64938595
INTRODUCTION
New methods bring new insights and reveal aspects not previously apparent. For centuries,
zoology relied on phenotype-based research and classification. New species were traditionally discovered
via phenotypic differences. Phenotypes are encoded by genotypes, and direct investigation of genotypes
by the analysis of DNA sequences may be a more direct and powerful approach to classifying nature.
Even short segments of DNA, such as COI barcodes, have been insightful in revealing species diversity
not readily evident from phenotypes (Hebert et al. 2004).
Genome-scale phylogenetic approaches show promise in revolutionizing our understanding of
butterfly evolution and refining their taxonomy (Toussaint et al. 2018; Allio et al. 2019; Li et al. 2019;
Zhang et al. 2019a; Zhang et al. 2019b; Toussaint et al. 2021; Robbins et al. 2022; Toussaint et al. 2022).
Accurate phylogenetic trees constructed from millions of base pairs give better confidence in the results
and frequently reveal inconsistencies with the current classification (Cong et al. 2019b; Zhang et al. 2021;
Toussaint et al. 2022; Zhang et al. 2022). While this approach is instrumental for higher classification and
taxonomy above species level, its application to species discovery and description has been limited
(Janzen et al. 2017; Cong et al. 2020). Even for COI barcodes, a major obstacle is the DNA analysis of
extant primary type specimens which is required to properly place discovered new species in the context
of previously named taxa (Pfeiler 2018).
Next-generation sequencing technology allows us to obtain whole genome shotgun sequences of
some of the oldest type specimens, thus resolving this impediment (Cong et al. 2021). Sequencing of
primary types is essential to confidently address nomenclatural questions. Imperative for cryptic species
1
complexes, it could also be helpful in seemingly less difficult cases. Oftentimes type localities were
incompletely documented or type specimens may have been mislabeled. Genomic comparison across a
Species’ range places type specimens among them and clarifies type localities (Cong et al. 2021).
Sequencing of primary types on a large scale (Zhang et al. 2022) offers unprecedented opportunities for
species-level taxonomy, both in correcting previous mistakes and new species discovery.
Our research group carries out large-scale butterfly genomic sequencing across taxonomic groups
and continents. As a result, specimens currently assigned to one species sometimes partition into distinct
and strongly supported clades in phylogenetic trees. We construct three maximum likelihood trees from
all protein coding genes encoded by: nuclear genome partitioned into (1) autosomes and (2) the Z
chromosome, and (2) mitochondrial genome. The Z chromosome holds a special place in the evolution of
Lepidoptera (Sahara et al. 2012; Mongue and Walters 2018; Cong et al. 2019a; Mongue et al. 2022) and
its phylogeny frequently agrees best with how species boundaries are defined based on previous work.
Well-supported clades observed in all three trees within "species" prompts a more detailed investigation.
Here, we analyze two such cases dealing with North American species of Staphylus Godman &
Salvin, 1896 (type species Helias ascalaphus Staudinger, 1876). Genomic trees that include primary type
specimens of the relevant names reveal a split into two clades in each of the two current species of
Staphylus. Following up on these results with morphological analyses, two new species are proposed.
MATERIALS AND METHODS
The specimens were inspected and photographed/sampled for DNA in the following collections:
American Museum of Natural History, New York, NY, USA (AMNH), Natural History Museum,
London, UK (BMNH), Carnegie Museum of Natural History, Pittsburgh, PA, USA (CMNH), Museum
fir Naturkunde, Berlin, Germany (MFNB), Texas A&M University Insect Collection, College Station,
TX, USA (TAMU), National Museum of Natural History, Smithsonian Institution, Washington, DC, USA
(USNM), Zoologische Staatssammlung Miinchen, Germany (ZSMC), and the personal collection of John
V. Calhoun, Palm Harbor, FL, USA. Historical documents, such as unpublished drawings, were inspected
in the Natural History Museum, London, UK and National Museum of Natural History, Smithsonian
Institution, Washington, DC, USA. Photographs of specimens and illustrations were taken with Nikon
D800 camera through 105 mm macro lens; dissected genitalia were photographed in glycerol with the
Nikon D200 camera without a lens and through a microscope at 4.5x magnification. Images were
assembled and edited in Photoshop CS5. Genitalia photographs were taken in several focus slices and
stacked in Photoshop to increase depth of field. Genomic DNA was extracted from a leg, libraries were
prepared, and sequenced as previously reported (Li et al. 2019). The details of phylogenetic tree
construction were given in Zhang et al. (2022). In brief, the maximum-likelihood tree was constructed
from protein-coding regions in the Z chromosome using IQ-tree v1.6.12 under GIR+GAMMA model
(Nguyen et al. 2015). To estimate the confidence of each node, we generated 100 replicates of 10,000
codons randomly sampled from the total set of codons in the Z chromosome and constructed maximum-
likelihood trees for each replicate. The support values of each node were summarized from these replicate
trees using sumtrees routine in dendropy package (Sukumaran and Holder 2010). The method to find
diagnostic DNA characters is described in Cong et al. (Cong et al. 2019b). Sequence datasets obtained in
this work are deposited in the NCBI database <https://www.ncbi.nlm.nih.gov/> as BioProject
PRJNA831579 (BioSample entries of the project contain the locality and collection data of the sequenced
Specimens shown in the trees), and COI barcodes have GenBank accessions ON351018—ON351022.
Exon sequences with diagnostic characters highlighted are also available from <https://osf.io/tygxc/>.
DNA characters are given as abbreviations, e.g., aly728.44.1:G672C means position 672 in exon | of
gene 44 from scaffold 728 of Cecropterus lyciades (formerly in Achalarus Scudder, 1872, thus aly)
reference genome (Shen et al. 2017) is C, changed from G in the ancestor. Similar notations are used for
the COI barcode characters, e.g., A78G means position 78 is G, changed from A in the ancestor, or
T264T(not C) means position 264 is T, unchanged from the ancestor, and not C as in sister taxon.
2
RESULTS
All three phylogenetic trees—based on nuclear genome: (1) autosomes and (2) Z chromosome, and (3)
mitochondrial genome—consistently reveal a well-supported split into two clades in each of the two
North American species of Staphylus: S. hayhurstii (W. H. Edwards, 1870) and S. ceos (W. H. Edwards,
1882). These two names have no known synonyms (Pelham 2008; Pelham 2022), and therefore one of the
clades in each species is likely to represent a new taxon. A combination of genomic and morphological
analyses suggests that these unnamed taxa are new species, which are herein described. In the first case,
nuclear genome diverged stronger than the mitogenome. In the second case, the opposite occurred.
Furthermore, genomic comparison of old primary type specimens placed among more recently collected
Specimens suggests a number of taxonomic changes that are detailed below.
Staphylus floridus Grishin, new species
http://zoobank.org/B7CE2D54-7EOF-4FBD-96B6-4A 96BCE02C6D
Definition and diagnosis. Genomic
analysis of specimens identified as
Staphylus hayhurstii (W.H. Edwards,
1870) (type locality USA: Missouri,
possibly in Pettis Co.) from across
its range, including the lectotype
(NVG-15096HO5), reveals their split
into two prominent clades with
100% statistical support in all three
trees (Fig. 1 red and blue clades).
The red clade consists of specimens
from Florida, and the blue clade
includes the rest, where the lectotype
of S. hayhurstii belongs. Genetic
differentiation between the two
clades is more pronounced in the
nuclear genome than in_ the
mitogenome: Fst/Gmin computed on
the Z chromosome are 0.49/0.02,
suggesting that the two clades are
two distinct species (Cong et al.
2019a); but mitogenomes of the two
species diverged less, e.g., their COI
barcodes differ by 1.1% (7 bp), a
value by itself insufficient to
substantiate species-level distinction.
Comparison of male and female
genitalia offers additional support for
the species-level status of the new
taxon, and we conclude that the red
clade (Fig. 1) represents a new
species. This species (Fig. 2)
superficially similar to its sister S.
hayhurstii, and we were not able to
find wing pattern characters that
(Figs. 1 part, 2, 3a, b, e)
Staphylus floridus| 18058E06|PT|M|USA:FL,Alachua Co.|1987
Staphylus floridus|20049A08|PT|F|USA:FL,Sumter Co.|1993
Staphylus floridus|20049A05|PT|M|USA:FL,Lee Co.|1983
Staphylus floridus|20049A06|PT|M|USA:FL,Volusia Co.|1994
Staphylus floridus|20049A04|PT|M|USA:FL,Volusia Co.|1987
Staphylus floridus]20049A03|PT|M|USA:FL,Volusia Co.|1993
a_sionuciear genome:
autosomes
Staphylus hayhurstii]15096A03|PLT|M|USA:MO|1869
Staphylus hayhurstii|18058E07|M|USA:TX,Comal Co.|1967
Staphylus hayhurstii|18058E08|M|USA:IL,Mason Co.|1985
Staphylus hayhurstii|20048F11|M|USA:MD,Montgomery Co.|1999
Staphylus hayhurstii|20048F12|F|USA:MD,Montgomery Co.|1999
Staphylus hayhurstii]4383|F]USA:TX,Dallas Co.|2015
Staphylus hayhurstii|4577|M|USA:TX,Dallas Co.|2015
Staphylus pag LE Ee TX, Delta Co.|2016
StpRente mararel 18058E10|M|Mexico: Veracruz|1979
Staphylus mazans|10068|M|USA:TX,Cameron Co.|2017
Staphylus mazans|18058E09|M|USA:TX,Comal Co.|1967
Staphylus ascalaphus|18011HO05|Panama|1983
0.004 Staphylus ascalaphus|18013G06|Costa Rica|2008
b nuclear genome:
Z chromosome
Staphylus floridus|20049A05|PT|M|USA:FL,Lee Co.|1983
Staphylus floridus|18058E06|PT|M|USA:FL,Alachua Co.|1987
Staphylus floridus|20049A06|PT|M|USA:FL,Volusia Co.|1994
Staphylus floridus|20049A04|PT|M|USA:FL,Volusia Co.|1987
Staphylus floridus|20049A08|PT|F|USA:FL,Sumter Co.|1993
“ Staphylus floridus|20049A03|PT|M|USA:FL, Volusia Co.|1993
9
Staphylus hayhurstii|15096A03|PLT|M|USA:MO|1869
}15096! |USA:M
Staphylus hayhurstii|20048F12|F|USA:MD,Montgomery Co.|1999
Staphylus hayhurstii|20048F11|M|USA:MD,Montgomery Co.|1999
, Staphylus hayhurstii|18058E07|M|USA:TX,Comal Co.|1967
Staphylus hayhurstii|7039|F|USA:TX,Delta Co.|2016
Staphylus hayhurstii|4383|F|USA:TX, Dallas Co.|2015
“ Staphylus hayhurstii|4577|M|USA:TX,Dallas Co.|2015
Staphylus hayhurstii|18058E08|M|USA: IL,Mason Co.|1985
Staphylus mazans|18058E10|M|Mexico:Veracruz| 1979
t Staphylus mazans|10068|M|USA:TX,Cameron Co.|2017
Staphylus mazans|18058E09|M|USA:TX,Comal Co.|1967
-Staphylus ascalaphus|15033F12|LT|M|Panama
oan pean mt 1 Staphylus ascalaphus|18011H0O5|Panama|1983
0.003 Staphylus ascalaphus|18013G06|Costa Rica|2008
Staphylus floridus|20049A05|PT|M|USA:FL,Lee Co.|1983
oStaphylus floridus|20049A06|PT|M|USA:FL,Volusia Co.|1994
aphylus floridus]20049A08|PT|F|USA:FL,Sumter Co. |1993
taphylus floridus| 18058E06|PT|M|USA:FL,Alachua Co.|1987
taphylus floridus|20049A03|PT|M|USA:FL,Volusia Co.|1993
aphylus floridus|20049A04|PT|M|USA:FL,Volusia Co. |1987
C_ mitochondrial genome
Staphylus hayhurstii|15096A03|PLT|M|USA:MO|1869
sgotaphylus hayhurstii|18058E07|M|USA:TX,Comal Co.|1967
Staphylus hayhurstii|7039|F|USA:TX, Delta Co.|2016
sgitaphylus hayhurstii|4383|F|USA:TX, Dallas Co.[2015
taphylus ea Tes crea NES TX, Dallas Co. RAR
lus ha stii| 15096 S|LTIMIL SA:MO,Pettis Co.|1869
Geprvice hayhurstii|18058E08|M|USA: Iv; Meron Co. /1985
taphylus hayhurstii|20048F11|M|USA:MD,Montgomery Co.|1999
taphylus hayhurstii|20048F12|F|USA:MD,Montgomery Co.|1999
Staphylus mazans|18058E09|M|USA:TX,Comal Co.|1967
Staphylus mazans|10068|M|USA:TX,Cameron Co.|2017
Staphylus mazans|18058E10|M|Mexico:Veracruz|1979
| 62 Staphylus ascalaphus|15033F12|LT|M|Panama —
0.007 5 Staphylus ascalaphus|18013G06|Costa Rica|2008
Staphylus ascalaphus|18011H05|Panama|1983
Fig. 1. Phylogenetic analysis of Staphylus floridus sp. n. and S. hayhurstii.
The trees are constructed from protein-coding regions in: a. autosomes, b. Z
chromosome, ¢. mitochondrial genome. Different species are shown in
different colors. Names of primary type specimens are highlighted in yellow.
3
Se ee ee a ee acm
Fig. 2. Staphylus floridus sp. n. holotype, male, NVG-18058E05 (a, b), USA: Florida, Volusia Co. and a female paratype
NVG-20049A08 (c, d), USA: Florida, Sumter Co., in dorsal (a, c) and ventral (b, d) views. Other data are in text.
b Fd ale,
Fig. 3. Genitalia of Staphylus floridus sp. n. paratypes (a, b. NVG-20049A03 and e. NVG-20049A07, data in text) and S.
hayhurstii from USA: Texas (e, d. NVG-12597, Dallas Co. and f. NVG-7042, Delta Co.), males (a—d) and females (e, f), in
left lateral (a, c), dorsal (b, d), and ventral (e, f) views. Whole genitalic capsule is shown for males and sterigma for females.
4
distinguish them. This is hardly surprising for Staphylus, a genus that includes dozens of species nearly
impossible to identify by facies even for more distant relatives, such as Staphylus mazans (Reakirt,
[1867]) (type locality in Mexico: Veracruz) (Fig. | green), which is sympatric with S. hayhurstii in central
Texas (e.g., in Comal Co., Fig. 1).
The new species differs from S. hayhurstii by less robust and relatively smaller genitalia, in both
males (Fig. 3a—d) and females (Fig. 3e, f): illustrated genitalia are of specimens with similar forewing
length. In male genitalia, tegumen longer and narrower, vs. more compact but broader tegumen in S.
hayhurstii; harpe narrower (in lateral view), straighter, and bent less from the body of valva at its junction
(best seen in dorsal view). In female genitalia, lamella postvaginalis less sculptured, typically with fewer
and shorter ridges; lamella antevaginalis with comparatively smaller tooth on each side and more
expanded middle section protruding caudad, with a central notch, vs. nearly crescent-shaped (tooth to
tooth) lamella with irregular middle margin in S. hayhurstii. These genitalic characters are rather subtle,
and due to individual variation the most confident identification can be achieved using DNA sequences.
Combinations of the following DNA characters are diagnostic: in COI barcode: C271T, T322A, C401T,
and T613C, and in the nuclear genome: aly1849.21.2:G3621A, aly1849.21.2:G3078A, aly1113.5.4:
T1282A, aly1849.21.2:A702G, aly1656.10.4:T414G. Each of the barcode characters taken individually
distinguishes the new species from S. hayhurstii in a sample of specimens we sequenced.
Barcode sequence of the holotype: Sample NVG-18058E05, GenBank ON351018, 658 base pairs:
AACTTTATATTTTATTTTTGGTATTTGAT gaccn TAGTAGGAACTTCTTTAAGTATTCTTATTCGTTCTGAATTAGGAACACCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT
ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAAT TGGAGGATTCGGAAATTGACTTGTTCCTCTTATAT TAGGAGCCCCTGATATAGCTTTTCCTCGAA
TAAATAATATAAGATTTTGATTATTACCTCCATCTTTAATACTTTTAATTT CAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGAT GAACAGTT TACCCCCCCCTTTCAGCCAATATTGC
TCATCAAGGTTCTTCTGTAGATTTAGCTATTTTTTCCTTACATTTAGCAGGTATTTCTTCTATTTTAGGAGCAATTAATTTTATTACAACTATTATTAATATACGAATTAATAATTTATCA
TTTGATCAAATACCTTTATTTGTTTGAGCTGTTGGAATTACAGCATTACTTTTACTTTTATCTTTACCAGTATTAGCAGGTGCTATTACTATACTTTTAACAGATCGAAATCTTAATACAT
CATTCTTCGATCCTGCTGGTGGAGGAGATCCTATTTTATATCAACATCTATTC
Type material. Holotype: @ (Fig. 2a, b), deposited in the National Museum of Natural History,
Smithsonian Institution, Washington, DC, USA (USNM), bears the following three rectangular white
printed (date partly handprinted) labels: [| FLORIDA | Volusia Co, | New Smyrna Beach | 13 June 1969 |
G. W. Rawson leg. ], [| DNA sample ID: | NVG-18058E05 | c/o Nick V. Grishin |], [ USNMENT | {QR
Code! | 01466715 |] and one red printed [HOLOTYPE < | Staphylus | floridus Grishin ]. Paratypes:
544 and 299, all from USA: Florida: 1d’ NVG-18058E06, Alachua Co., Alachua, leg. Scott W. Gross,
29-Aug-1987; others leg. John V. Calhoun: 34’ Volusia Co.: NVG-20049A04, New Smyrna Beach,
2495 N Dixie Fwy, 5-Mar-1987; NVG-20049A03, W side of USI, 1 mi N of Brevard Co. line, 7-Mar-
1993; and NVG-20049A06, Reed Grove Rd. N of Stacey Grove Rd., SW of Oak Hill, 20-Mar-1994; 14
NVG-20049A05 & 12 NVG-20049A07, Lee Co., W of IH75, off Carrell Rd. nr. Bonita Springs, 25-Mar-
1983; 12 NVG-20049A08, Sumter Co., E side SR301, N side of Shady Brook, 14-May-1993 (coll. J. V.
Calhoun, Palm Harbor, FL, USA).
Type locality. USA: Florida, Volusia County, New Smyrna Beach.
Distribution. Currently known only from USA: Florida with specimens sequenced from Alachua,
Sumter, Volusia, and Lee Counties. This species may be allopatric with S. hayhurstii, and geographically
separated from it by the lack of records in northern Florida and nearby parts of other states. This apparent
gap in the distribution of Staphylus would be interesting to investigate further.
Etymology. Being a reference to Florida, the state from which the type series is known, a Latin word
translated as flowery or blooming was chosen as the name for this not so garish species from Florida that
nevertheless flaunts rather elaborate pattern of browns, nearly as flamboyant as gothic styles. The name is
a masculine adjective.
Suggested English name. Florida Sootywing.
Lectotype designation for Helias ascalaphus Staudinger, 1876
Helias ascalaphus Staudinger, 1876 (type locality in Panama), the type species of Staphylus, was
described from a series of specimens (Staudinger 1876), and several syntypes are in the MFNB collection.
5
We sequenced a male syntype already bearing a red "Lectotypus" label (designation unpublished), and the
results agreed with the current application of this name (Fig. 1). To stabilize nomenclature, N.V.G. hereby
designates this sequenced syntype, in the Museum fiir Naturkunde, Berlin, Germany bearing the
following 8 rectangular labels [ Lectotypus |, | Origin. |, | Panama | Ribbe |, | ascalaphus |, | Ascalaphus |
Stdgr. |, | GEN.PREP., | MIELKE | 1996 ], [ {QR Code} http://coll.mfn-berlin.de/u/ | 908619 |, and
| DNA sample ID: | NVG-15033F12 | c/o Nick V. Grishin | as the lectotype of Helias ascalaphus
pisUeeer: 1876. The COI barcode sequence of the lectotype (GenBank ON351019) is:
TAAGTATTCTTATTCGTTCTGAATTAGGAACTCCTGGATCTTTAATTGGAGATGAT
TTGGAGGTTTTGGAAAT Tene) Gea Cane ma ties eae Se [GATAT
TAGGAACTTCTT
AACTTTATATTTTATCTTTGGTATTTGATCT oa TAG
T AGTTAT
[GTAACAGCTCATGCTTTTATTATAATTTTTTTTAT
TAAATAATAT
AAGAT ™mm GAT TATT
m7 q ny
TACCCTIATTICTT TTGGAAT
TGGAGGAGATCCTATTTTAT
momm TAATAC Mmmm
nmamm TACAT m™
TAGCAGGTATTTCTTCTATTT
TACAGCAT
ATCAACATTTATTC
TAGAATCGTAGAAAAT TGAACAGTTTATCCCCCCCTTT 1
TAGGAGCAATTAATTTTATTACAACTATTATCAATATACGAATTAATAATTTATCC
TAGCAGGTGCTATTACTATACTTTTAACAGATCGAAATCTTAAT
TATTATTACTTTTATCTTTACCAGTAT
Staphylus ecos Grishin, new species
http://zoobank. org/33 FF40E5-1E83-4E3E-8A0F-C85A81A0521A
Definition and diagnosis. Genomic
analysis of specimens identified as
Staphylus ceos (W. H. Edwards,
1882) (type locality in USA:
Arizona, Graham Co.) from across
its range, including the lectotype
(NVG-15096H06), reveals their split
into two prominent clades with
100% _ statistical support in the
mitochondrial genome tree (Fig. 4c
red and blue clades), substantiated
by a shallow but consistent split in
both nuclear genome trees (Fig, 4a,
b). The red clade consists of
Specimens from the eastern part of
the range and the blue clade includes
the rest, where the lectotype of S.
ceos belongs. Genetic differentiation
between the two clades is limited in
the nuclear genome, but is substantial
in the mitogenome. Fst/Gmin
computed on the Z chromosome are
0.08/0.15, well within the range of
one species (Cong et al. 2019a).
Mitogenomes of the two groups of
Specimens (red and blue) diverged
strongly, e.g., their COI barcodes
differ by 2.7% (18 bp), a value
typically sufficient to support
species-level distinction (Hebert et
al. 2003), but only in the presence of
phenotypic differences. Comparison
of male genitalia reveals the
differences that are typical of closely
(Figs. 4 part, 5, 6a, b)
Staphylus ecos|19125H12|PT|F|USA:TX,Val Verde Co.|1949
Staphylus ecos|19125HO08|PT|M|USA:TX,Bexar Co.|1966
Staphylus ecos|18058B05|PT|F|USA:TX,Bexar Co. |old
Staphylus ecos|19126A07|PT|F|USA:TX,Jeff Davis Co.|1969
Staphylus ecos|19126A06|PT|F|USA:TX,Brewster Co.|1971
Staphylus ecos|19126A01|PT|M|Mexico:Coahuila|1977
Staphylus ecos|19125H09|PT|M|USA:TX,Brewster Co.|1971
Staphylus ecos|19125H11|PT|M|USA:TX, Jeff pe Co.|1969
a ° Staphylus ecos|11137|PT|M|USA:TX,Jeff Davis Co.|2018
Staphylus ceos|10898|M|USA:AZ,Pinal Co.|2018
ews SSUES AZ, Pima Co. PAY
a__sinucilear genome:
autosomes
0.046
Staphyils ceos|9694]F|USA: AZ, Santa Cruz Co. 12017
Staphylus ceos|10988|M|USA: TX,El Paso Co.|2018
Staphylus ceos| 12119|F]USA:AZ,Pinal Co.|2019
Staphylus ceos|10941|M|USA:TX,El Paso Co.|2018
Staphylus opites|18011H0O7|Mexico:Oaxaca|1991
Staphylus opites| 18011H08|Mexico:Oaxaca|1988
Staphylus vincula (=iguala)|18059A11|M|Mexico:Oaxaca|1989
ae Staphylus cartagoa|18071A08|F|Costa Rica|2005
Staphylus ecos|19125H08|PT|M|USA:TX,Bexar Co.|1966
Staphylus ecos|19125H0O9|PT|M|USA:TX,Brewster Co.|1971
b nuclear genome:
Z chromosome
a Staphylus ecos|18058B05|PT|F|USA:TX, Bexar Co. |old
*Staphylus ecos|11137|PT|M|USA:TX,Jeff Davis Co.|2018
Staphylus ecos|19125H11|PT|M|USA: TX,Jeff Davis Co.|1969
Staphylus ecos]19126A06|PT| F|USA: TX, Brewster Co.|1971
Staphylus ecos|19126A07|PT|F|USA:TX, Jeff Davis Co.|1969
Staphylus ecos|19125H12|PT|F|USA:TX,Val Verde Co.|1949
Staphylus ecos|19126A01|PT|M|Mexico: aa eed
3 Staphylus ceos|10898|M|USA:AZ,Pinal Co.|20
: Staphylus ceos|10988|M|USA:TX, El Paso Co. rae
Staphylus ceos|10941|M|USA: TX,El Paso Co.|2018
Staphylus SRA REA a ae AZ, Pinal Co. [2019
1° 9H I j af = a
° Staphylus ceos|9694|F|USA: AZ, earita Cre Co, |2017
Staphylus ceos|8257|M|USA: AZ, Pima Co.|2017
[Sa Staphylus opites|18011H07|Mexico :Oaxaca [1991
Staphylus opites|18011H08|Mexico:Oaxaca|1988
Staphylus vincula (=iguala)|18059A11|M|Mexico:Oaxaca|1989
Staphylus cartagoa|18071A08|F|Costa Rica|2005
0.008 staphylus cartagoa|15097C04|HT|M|C : Rica
gg staphylus ecos|18058B05|PT|F|USA:TX, Bexar Co. |old
t ’ Staphylus ecos|19125HO8|PT|M|USA:TX, Bexar Co.|1966
eas ecos|19126A01|PT|M|Mexico: Coahuila | 1977
taphylus ecos|11137|PT|M|USA:TX,Jeff Davis Co.|2018
1@taphylus ecos|19126A06|PT|F|USA:TX,Brewster Co.|1971
,Staphylus ecos|19125H11|PT|M|USA:TX, eff Davis Co.|1969
Staphylus ecos|19125H09|PT|M|USA:TX, Brewster Co.|1971
‘Staphylus ecos|19125H12|PT|F|USA:TX Nal Verde Co.|1949
Staphylus ecos|19126A07|PT|F|USA:TX,Jeff Davis Co.|1969
Staphylus ceos|10898|M|USA:AZ, Pinal Co.|2018
7Staphylus ceos|12119|F|USA:AZ Pinal Co.|2019
-7Staphylus ceos|9694|F|USA:AZ, Santa Cruz Co.|2017
taphylus ceos|10988|M|USA: TX, El Paso Co.|2018
Staphylus ceos|8257|M|USA:AZ, Pima Co.|2017
°Staphylus ceos|10941|M|USA: uES El Paso Co. ars
A , 0 118 82
C_ mitochondrial genome
Staphyl aham
taphylus opites|18011H07|Mexico: Caracal 1991
taphylus opites| 18011H0O8|Mexico:Oaxaca|1988
*’Staphylus vincula (=iguala)|18059A11|M|Mexico:Oaxaca|1989
taphylus cartagoa|18071A08|F|Costa Rica|2005
0.02
Fig. 4. Phylogenetic analysis of Staphylus ecos sp. n. and S. ceos. The trees
are constructed from protein-coding regions in: a. autosomes, b. Z
chromosome, ¢. mitochondrial genome. Different species are shown in
different colors. Names of primary type specimens are highlighted in yellow.
6
| ICM
Fig. 5. Staphylus ecos sp. n. holotype, male, NVG-21113E02 (a, b) and a female paratype NVG-21113E03 (ce, d), from USA:
Texas, Brewster Co., Big Bend National Park, Chisos Mountains, in dorsal (a, c) and ventral (b, d) views. Other data are in text.
related but distinct species, and
therefore we conclude that the red
clade (Fig. 4) represents a new
species. This species (Fig. 5) is
superficially similar to its sister S. Yue
ceos, and we were not able to find tL x
meaningful wing pattern characters ra
to differentiate them. This is typical
for Staphylus, a genus that includes
a number of species with similar
appearance, even for more distant
relatives.
The new species differs from = ¢
S. ceos by more robust and relatively
larger male genitalia (Fig. 6):
illustrated genitalia are of specimens
with similar forewing _ length.
; Fig. 6. Male genitalia of Staphylus ecos sp. n. (a, b), paratype NVG-11137,
Ampulla of valva with nearly Ug. Texas, Jeff Davis Co. and S. ceos (ec, d), NVG-10941, USA: Texas, El
straight distal margin (in lateral — paso Co. in left lateral (a, c) and dorsal (b, d) views, whole genitalic capsule.
view), not concave as in typical S.
7
ceos; harpe longer relatively to its height (in lateral view), less curved dorsad, with longer dorsal ridge
that projects farther anteriad (towards vinculum) connecting to valva at several points that look like
"teeth" in lateral view, and with thicker short spines at the distal end, vs. S. ceos, which has a shorter,
more square-shaped harpe that is terminally more curved dorsad, the dorsal ridge that connects to valva
closer to the ampulla and well before the anterior portion of valva along ventral margin, the "teeth"
formed by connecting points of the ridge with valva that appear smaller, and distal spines that are more
minute. These genitalic characters are rather subtle, and due to individual variation, the most confident
identification can be achieved using DNA sequences. Combinations of the following DNA characters are
diagnostic: in COI barcode: T67C, T205C, T337A, T478C, and T514C, and in the nuclear genome:
aly1113.5.4:A1684G, aly1849.21.2:A8067G, aly1849.21.2:A8055G, aly1113.5.4:A1338C. Each of the
barcode characters taken individually distinguishes the new species from S. ceos in a sample of specimens
we sequenced.
Barcode sequence of a paratype: Sample NVG-19126A06, GenBank ON351020, 658 base pairs:
AACTTTATATTTTATTTTTGGTATTTGATCT oon TAGTAGGAACTTCTTTAAGTATTCTTATTCGCTCAGAATTAGGAACCCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT
ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATCGGAGGTTTTGGAAATTGATTAGTACCCCTAATATTAGGAGCCCCAGATATAGCTTTCCCTCGAA
TAAATAATATAAGTTTCTGATTATTACCCCCCTCTCTTATACTTTTAATTTCAAGTAGTATTGTAGAAAATGGAGCAGGTACAGGATGAACTGTATACCCCCCTCTTTCAGCTAATATTGC
TCATCAAGGATCATCTGTAGATTTAGCTATTTTTTCCCTTCATTTAGCCGGAATTTCTTCAATTTTAGGGGCAATTAATTTTATTACAACTATTATTAATATACGAATTAATAACTTATCA
TTTGATCAAATACCTTTATTTGTTTGAGCCGTAGGTATTACAGCATTACTTTTACTTTTATCTCTCCCAGTATTAGCTGGTGCTATTACTATACTTTTAACAGATCGAAATCTTAATACAT
CATTTTTTGACCCTGCAGGAGGTGGAGATCCTATTTTATACCAACATTTATTT
Type material. Holotype: @ (Fig. 5a, b), deposited in the National Museum of Natural History,
Smithsonian Institution, Washington, DC, USA (USNM), bears the following two rectangular white
printed labels: [ Green Gulch | Big Bend Nat. Park | Brewster Co. TX | 12-Jun-2004 USA | leg. Grishin N.
V. ], [| DNA sample ID: | NVG-21113E02 | c/o Nick V. Grishin ], and one red printed [ HOLOTYPE ¢ |
Staphylus | ecos Grishin ]. Paratypes: 84:4 and 59 2, most collected by Roy O. Kendall & C. A. Kendall
(ROK) and Nick V. Grishin (NVG), from USA: Texas: 14 NVG-19125H10, Comal Co., New Braunfels,
Panther Canyon, leg. W. W. McGuire, 6-May-1972; Bexar Co.: 14 NVG-19125H08, USH281 north at
Salado Creek, ROK, 4-Jun-1966; 12 NVG-18058B05, O. C. Poling, no date, estimated around 1900; 19°
NVG-19125H12, Val Verde Co., Del Rio, leg. Hugh Avery Freeman, 12-Jul-1949; Brewster Co., Big
Bend National Park: 1d NVG-19125H09, 22-Sep-1971 & 12 NVG-19126A06, 14-Sep-1971, K-Bar
Research Station, ROK; 12 NVG-21113E03, Chisos Basin Campground, NVG, 29-May-2004; Jeff Davis
o.: Io NVG-19125HI11, 10-Jul-1969 & 192 NVG-19126A07, 7-Jul-1969, Musquiz Canyon, SH118,
ROK; 14 NVG-11137, Jeff Davis Co., Fort Davis city limits, NVG, 18-May-2018; 2¢¢ NVG-21113E04
& 5, Jeff Davis Co., Davis Mts. State Park, nr. Indian Lodge, NVG, 25-Mar-2005; and 14 NVG-
19126A01, Mexico: Coahuila, Hwy 57 ca. 18 mi S of Monclova, ROK, 14-Sep-1977.
Type locality. USA: Texas, Brewster County, Big Bend National Park, Green Gulch, elevation 1960 m,
GPS 29.2769, —103.2836.
Distribution. Confirmed from USA: Texas, in the following counties: Jeff Davis, Brewster, Val Verde,
Bexar, and Comal; and from Mexico: Coahuila, ca. 18 mi S of Monclova. Specimens we sequenced from
El Paso County Texas were S. ceos (Fig. 4). The two sister species are currently allopatric, and the
boundary between them in the USA lies somewhere between the Davis Mountains and the Franklin
Mountains in Texas with no known intervening populations. Further studies of these species may be
productive in Chihuahua, Mexico, where they may closely approach one another.
Etymology. The species that ec[h|o[e]s ceos with distortion and the name is its anagram. For a simple
mnemonic, think of "e" for "east" for this more eastern species. The name is a noun in apposition.
Suggested English name. Texas Sootywing.
Staphylus opites (Godman & Salvin, 1896), reinstated status
Scantilla opites Godman & Salvin, 1896 (type locality in Guatemala) was placed as a junior subjective
synonym of Staphylus vincula (Plotz, 1886) (type locality in Panama) by Evans (1953). Genomic
sequencing of Tagiades vincula Plétz, 1886 syntype in ZSMC (NVG-18056G01, Fig. 7a—c) reveals that it
8
is in a different clade from the two specimens of S. opites from Mexico: Oaxaca (Fig. 4). This syntype, a
female (Fig. 7a—c), agrees with the original description of 7. vincula. It is close in appearance to the
Specimen from Costa Rica in BMNH that Godman considered to be similar to the original Pl6tz
illustration (Godman 1907), and is curated as a type in ZSMC. Therefore, we accept it as a true syntype,
and due to significant genetic differentiation between the two taxa, reinstate species-level status for
Staphylus opites (Godman & Salvin, 1896), stat. rest. The COI barcode sequence of the 7. vincula
syntype (GenBank ON351021) is:
AACTTTATATTTTATTTTTGGTATTTGATCCGGTATAGTAGGAACTTCTTTAAGTATTCTTATTCGTTCAGAACTAGGAACTCCTGGATCTTTAATTGGAGATGATCAAATTTACAATACT
ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAAT TGGAGGATTTGGAAATTGATTAGTACCTTTAATAT TAGGAGCTCCTGATATAGCTTTCCCTCGAA
TAAATAATATAAGTTTTTGATTATTACCCCCTTCTCTTATACTTTTAATTTCAAGTAGTATTGTAGAAAATGGAGCAGGTACAGGAT GAACTGTT TACCCACCTCTTTCAGCCAATATTGC
TCATCAAGGAGCATCTGTAGATTTAGCTATTTTTTCCCTTCATTTAGCAGGAATTTCTTCAATT TTAGGAGCAATTAATTTTATTACAACTATTATTAATATACGAATTAATAATTTATCA
TTTGATCAAAT Wane Phage hae ee Tatas arte ee Guam oe We ee ee gee aes ge ee [GCTATTACTATACTTTTAACTGATCGAAATCTTAATACAT
CATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATT
Additionally, we found an illustration of 7. vincula (Fig. 7d) pinned in a Staphylus drawer in
USNM. This color illustration depicts the left dorsal surface and is rather similar to a Costa Rican
specimen from the Godman & Salvin collection in BMNH, which lacks the abdomen and is spread in a
similar manner. Furthermore, the illustration shows three subapical hyaline spots, as the BMNH
specimen, but the syntype has two, as stated in the original description. Hence, this illustration is possibly
of the BMNH specimen, rather than a copy of the original Pl6étz's drawing.
1 ZSM eo
Genitalprp.
_| | Samettea | Noh PIS
} — DNAsamole ID:
relate * - NVG-18056G01
Tag fades vineula , Pletz. - c/o Nick V. Grishin
iS9o0. Panama. d —_ a
Fig. 7. Staphylus vincula syntype, female, NVG-18056G01 in ZSMC: a. dorsal and b. ventral views, c. labels (lectotype
designation was not published and the specimen remains a syntype); d. an illustration pinned in a Staphylus drawer in USNM,
possibly of a specimen from Costa Rica in BMNH, which Godman (1907) considered to be similar to the original illustration
of Tagiades vincula by Plotz. Larger scale bar refers to the specimen and illustration and smaller scale bar refers to labels
(reduced compared to the specimen).
9
Pholisora iguala Williams & Bell, 1940 is a junior subjective synonym
of Staphylus vincula (Plotz, 1886)
As we have shown above, Staphylus opites (Godman & Salvin, 1896), stat. rest. (type locality in
Guatemala) and Staphylus vincula (Pl6tz, 1886) (type locality in Panama) are distinct, non-sister species
(Fig. 4). While S. vincula is sister to Staphylus cartagoa (Williams & Bell, 1940) (type locality in Costa
Rica), S. opites is sister to the clade consisting of Staphylus ceos (W. H. Edwards, 1882) (type locality in
USA: Arizona, Graham Co.) and Staphylus ecos sp. n. (type locality in USA: Texas, Brewster Co.).
Genomic sequencing of the holotype of Pholisora iguala Williams & Bell, 1940 (type locality in Mexico:
Guerrero) in the AMNH (NVG-18024G11), together with a more recently collected specimen identified
as S. iguala (NVG-18059A11), reveals that they are genetically close to the syntype of S. vincula, in both
nuclear and mitochondrial genomes. Moreover, their COI barcodes differ by only 0.3% (2 bp). Therefore,
we propose that Pholisora iguala Williams & Bell, 1940 syn. n. is a junior subjective synonym of
Staphylus vincula (Pl6tz, 1886). As a result of this change, current synonyms of P. iguala become junior
subjective synonyms of S. vincula. This genetic similarity with Mexican specimens casts certain doubt on
the Panamanian origin of the only known S. vincula syntype, and this question should be investigated
further by sequencing of additional specimens. Furthermore, the syntype bears two conflicting locality
labels: "Panama" and "S[outh] America" (Fig. 7d), but the original description gives Panama as the
locality, where it was supposedly collected by Ribbe. Ribbe is not mentioned on the labels of the syntype.
Genomic sequencing suggests that its South American (and maybe even Panamanian) origin is unlikely,
and therefore the specimen was possibly mislabeled. For these reasons, we refrain from designating it a
lectotype (it already bears a lectotype label, but this designation remains unpublished) waiting for further
research. However, this is the only credible syntype we located thus far, and we are using it to define the
identity of S. vincula. The COI barcode sequence of the P. iguala holotype (GenBank ON351022) is:
AACTTTATATTTTATTTTTGGTATTTGAT CCGGTATAG! TAGGAACTTCTTTAAGTATTCTTATTCGTTCAGAACTAGGAACTCCTGGATCTTTAATTGGAGATGATCAAATTTACAATACT
ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCTCGAA
TAAATAATATAAGTTTTTGATTATTACCTCCTTCTCTTATACTTTTAATTTCAAGTAGTATTGTAGAAAATGGAGCAGGTACAGGATGAACTGTTTACCCACCCCTTTCAGCCAATATTGC
TCATCAAGGAGCATCTGTAGATTTAGCTATTTTTTCCCTTCATTTAGCAGGAATTTCTTCAATTTTAGGAGCAATTAATTTTATTACAACTATTATTAATATACGAATTAATAATTTATCA
TTTGATCAAATACCTTTATTCGTTTGAGCTGTAGGAATTACAGCTTTACTTTTACTTTTATCTTTACCAGTATTAGCAGGTGCTATTACTATACTTTTAACTGATCGAAATCTTAATACAT
CATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
DISCUSSION
Screening of butterfly populations across their distribution ranges by genomic sequencing to probe
genetic diversification is productive in revealing new taxa. Addition of primary type specimens to these
datasets puts this genetic approach on a solid nomenclatural footing. Traditionally done using only COI
barcodes, such screens have been insightful (Hebert et al. 2004; Burns and Janzen 2005; Burns et al.
2007; Burns et al. 2008), but total genomic coverage alleviates the problems with introgression and other
irregularities of COI barcodes. Here, we applied the genomic approach that led to the discovery of two
new, partly cryptic butterfly species in the United States. Genetic differences are reflected in genitalic
differences, although these are rather subtle and therefore difficult to evaluate without genetic
differentiation.
Geographically, the two allopatric species in each Staphylus pair are separated by well-
documented suture zones (Remington 1968; Rising 1983), which form known boundaries for other
butterfly taxa. For instance, the North Florida suture zone separates Erynnis somnus (Lintner, 1881) from
Erynnis brizo (Boisduval & Le Conte, [1837]) (Burns 2020), as well as Staphylus floridus sp. n. from S.
hayhurstii, among many subspecies-level taxa (Warren et al. 2016). The Central New Mexico suture zone
separates a number of species pairs, such as Megathymus violae D. Stallings & Turner, 1956 from
Megathymus ursus Poling, 1902 (Zhang et al. 2020), Poladryas minuta (W. H. Edwards, 1861) from
Poladryas arachne (W. H. Edwards, 1869), Microtia elada (Hewitson, 1868) from Microtia perse (W. H.
Edwards, 1882), and Junonia coenia Hiibner, [1822] from Junonia grisea Austin & J. Emmel, 1998
(Lalonde and Marcus 2019), among others, together with Staphylus ecos sp. n. from S. ceos. Notably, in
10
this case, the exact geographic position of the boundary between the two species in every pair varies
somewhat: it could be to the west (as for Megathymus) or to the east (as for Staphylus) of El Paso.
Textbooks can be written about species delimitation and its practice. For practical applications, we
reason that genetic differentiation is by itself sufficient to substantiate species-level status of a taxon
under certain conditions. This differentiation should be: 1) strongly supported by statistics, e.g., bootstrap-
like values near 100%; 2) consistent throughout the genomes, both nuclear and mitochondrial, e.g., Fig. 1
red and blue clades; and 3) of a magnitude documented for well-studied species (Cong et al. 2019a). This
is even more meaningful when coupled with differences in genitalia, although these differences would
necessarily be subtle for closely related species. The second case (Fig. 4 red and blue clades) provides
more food for thought. Although mitochondrial genome differentiation is prominent (Fig. 4c), and agrees
with that of closely related but distinct species (2.7% COI barcode difference), nuclear genomes did not
diverge much, and this divergence does not pass our conservative criteria for speciation. However,
nuclear genomic differences are consistent between autosomes and the Z chromosome (Fig. 4a, b) and
therefore are a reflection of distinct evolutionary paths of these clades. Due to the small divergence, we
considered proposing S. ecos sp. n. as a subspecies of S. ceos. However, this opinion changed after
genitalic comparison. The differences in male genitalia are consistent in magnitude with those used to
support new species even in the absence of DNA evidence. Further studies of S. ceos species complex in
Mexico are likely to enrich our understanding of speciation.
ACKNOWLEDGMENTS
We acknowledge Ping Chen and Ming Tang for excellent technical assistance. We are grateful to David
Grimaldi and Courtney Richenbacher (AMNH: American Museum of Natural History, New York, NY,
USA), Blanca Huertas, David Lees, and Geoff Martin (BMNH: Natural History Museum, London, UK),
Jim Fetzner, Bob Androw, Vanessa Verdecia, Cat Giles, and the late John Rawlins (CMNH: Carnegie
Museum of Natural History, Pittsburgh, PA, USA), Wolfram Mey, Viola Richter, and Theo Leger
(MFNB: Museum fiir Naturkunde, Berlin, Germany), Edward G. Riley, Karen Wright, and John Oswald
(TAMU: Texas A&M University Insect Collection, College Station, TX, USA), Robert K. Robbins, John
M. Burns, and Brian Harris (USNM: National Museum of Natural History, Smithsonian Institution,
Washington, DC, USA), and Axel Hausmann and Ulf Buchsbaum (ZSMC: Zoologische Staatssammlung
Miinchen, Germany) for granting access to the collections under their care and for stimulating
discussions; to Bernard Hermier for exchange of opinions, to John V. Calhoun for the loan of specimens,
suggestions, and critical review of the manuscript. We are indebted to Texas Parks and Wildlife
Department (Natural Resources Program Director David H. Riskind) for the research permit 08-02Rev, to
U. S. National Park Service for the research permits: Big Bend (Raymond Skiles) for BIBE-2004-SCI-
0011. We acknowledge the Texas Advanced Computing Center (TACC) at The University of Texas at
Austin for providing HPC resources. The study has been supported in part by grants from the National
Institutes of Health GM127390 and the Welch Foundation I-1505.
LITERATURE CITED
Allio, R., C. Scornavacca, N. Benoit, A. L. Clamens, F. A. H. Sperling, and F. L. Condamine. 2019.
Whole genome shotgun phylogenomics resolves the pattern and timing of swallowtail butterfly
evolution. Systematic Biology 69(1): 38-60.
Burns, J. M. 2020. Taxonomic status of a Florida differentiate in the Erynnis brizo species group:
classical evidence (Lepidoptera: Hesperiidae: Pyrginae). Proceedings of the Entomological
Society of Washington 122(1): 25-41.
11
Burns, J. M. and D. H. Janzen. 2005. Pan-neotropical genus Venada (Hesperiidae: Pyrginae) is not
monotypic: Four new species occur on one volcano in the Area de Conservaci6n Guanacaste,
Costa Rica. Journal of the Lepidopterists' Society 59(1): 19-34.
Burns, J. M., D. H. Janzen, M. Hajibabaei, W. Hallwachs, and P. D. Hebert. 2008. DNA barcodes
and cryptic species of skipper butterflies in the genus Perichares in Area de Conservacion
Guanacaste, Costa Rica. Proceedings of the National Academy of Sciences of the United States of
America 105(17): 6350-6355.
Burns, J. M., D. H. Janzen, M. Hajibabaei, W. Hallwachs, and P. D. N. Hebert. 2007. DNA barcodes
of closely related (but morphologically and ecologically distinct) species of skipper butterflies
(Hesperiidae) can differ by only one to three nucleotides. Journal of the Lepidopterists' Society
61(3): 138-153.
Cong, Q., J. Shen, J. Zhang, W. Li, L. N. Kinch, J. V. Calhoun, A. D. Warren, and N. V. Grishin.
2021. Genomics reveals the origins of historical specimens. Molecular Biology and Evolution
38(5): 2166-2176.
Cong, Q., J. Zhang, and N. V. Grishin. 2019a. Genomic determinants of speciation. bioRxiv BIORXIV/
2019/837666.
Cong, Q., J. Zhang, J. Shen, X. Cao, C. Brevignon, and N. V. Grishin. 2020. Speciation in North
American Junonia from a genomic perspective. Systematic Entomology 45(4): 803-837.
Cong, Q., J. Zhang, J. Shen, and N. V. Grishin. 2019b. Fifty new genera of Hesperiidae (Lepidoptera).
Insecta Mundi 0731: 1—56.
Evans, W. H. 1953. A catalogue of the American Hesperiidae indicating the classification and
nomenclature adopted in the British Museum (Natural History). Part III. Pyrginae. Section 2. The
Trustees of the British Museum (Natural History); London. v + 246 pp., pls. 26—53.
Godman, F. D. 1907. Notes on the American species of Hesperiidae described by Plétz. Annals and
Magazine of natural History (7)20(16): 132-155.
Hebert, P. D., A. Cywinska, S. L. Ball, and J. R. deWaard. 2003. Biological identifications through
DNA barcodes. Proceedings of the Royal Society B: Biological Sciences 270(1512): 313-321.
Hebert, P. D., E. H. Penton, J. M. Burns, D. H. Janzen, and W. Hallwachs. 2004. Ten species in one:
DNA barcoding reveals cryptic species in the neotropical skipper butterfly Astraptes fulgerator.
Proceedings of the National Academy of Sciences of the United States of America 101(41):
14812-14817.
Janzen, D. H., J. M. Burns, Q. Cong, W. Hallwachs, T. Dapkey, R. Manjunath, M. Hajibabaei, P. D.
N. Hebert, and N. V. Grishin. 2017. Nuclear genomes distinguish cryptic species suggested by
their DNA barcodes and ecology. Proceedings of the National Academy of Sciences of the United
States of America 114(31): 8313-8318.
Lalonde, M. M. L. and J. M. Marcus. 2019. Getting western: biogeographical analysis of
morphological variation, mitochondrial haplotypes and nuclear markers reveals cryptic species
and hybrid zones in the Junonia butterflies of the American southwest and Mexico. Systematic
Entomology 44(3): 465-489.
Li, W., Q. Cong, J. Shen, J. Zhang, W. Hallwachs, D. H. Janzen, and N. V. Grishin. 2019. Genomes
of skipper butterflies reveal extensive convergence of wing patterns. Proceedings of the National
Academy of Sciences of the United States of America 116(13): 6232-6237.
Mongue, A. J.. M. E. Hansen, and J. R. Walters. 2022. Support for faster and more adaptive Z
chromosome evolution in two divergent lepidopteran lineages. Evolution 76(2): 332-345.
Mongue, A. J. and J. R. Walters. 2018. The Z chromosome is enriched for sperm proteins in two
divergent species of Lepidoptera. Genome 61(4): 248-253.
Nguyen, L. T., H. A. Schmidt, A. von Haeseler, and B. Q. Minh. 2015. IQ-TREE: a fast and effective
stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular Biology and
Evolution 32(1): 268-274.
Pelham, J. P. 2008. Catalogue of the Butterflies of the United States and Canada. Journal of Research on
the Lepidoptera 40: 1-658.
12
Pelham, J. P. 2022. Catalogue of the Butterflies of the United States and Canada. Revised 2 February
2022. <http://www. butterfliesofamerica.com/US-Can-Cat.htm> Accessed 24 April 2022.
Pfeiler, E. 2018. DNA barcoding and taxonomic challenges in describing new putative species: examples
from sootywing and cloudywing butterflies (Lepidoptera: Hesperiidae). Diversity 10(4): 111.
Remington, C. L. 1968. Suture-zones of hybrid interaction between recently joined biotas. Jn:
Dobzhansky, T., M. K. Hecht, and W. C. Steere (Eds.). Evolutionary Biology. Springer; Boston,
pp. 321-428.
Rising, J. D. 1983. The great plains hybrid zones. /n: Johnston, R. (Ed.). Current Ornithology. pp. 131-
158.
Robbins, R. K., Q. Cong, J. Zhang, J. Shen, R. C. Busby, C. Faynel, M. Duarte, A. R. P. Martins, C.
Prieto, G. Lamas, and N. V. Grishin. 2022. Genomics-based higher classification of the species-
rich hairstreaks (Lepidoptera: Lycaenidae: Eumaeini). Systematic Entomology syen.12541, Early
View: 1-25.
Sahara, K., A. Yoshido, and W. Traut. 2012. Sex chromosome evolution in moths and butterflies.
Chromosome Research 20(1): 83-94.
Shen, J., Q. Cong, D. Borek, Z. Otwinowski, and N. V. Grishin. 2017. Complete genome of Achalarus
lyciades, the first representative of the Eudaminae subfamily of skippers. Current Genomics 18(4):
366-374.
Staudinger, O. 1876. Neue Lepidopteren des siidamerikanischen Faunengebiets. Verhandlungen der
kaiserlich-koniglichen zoologisch-botanischen Gesellschaft in Wien 25(1): 89-124.
Sukumaran, J. and M. T. Holder. 2010. DendroPy: a Python library for phylogenetic computing.
Bioinformatics 26(12): 1569-1571.
Toussaint, E. F. A., M. F. Braby, C. J. Miiller, E. A. Petrie, and A. Y. Kawahara. 2022. Molecular
phylogeny, systematics and generic classification of the butterfly subfamily Trapezitinae
(Lepidoptera: Papilionoidea: Hesperiidae). Zoological Journal of the Linnean Society zlab086,
ahead of print: I-15.
Toussaint, E. F. A., J. W. Breinholt, C. Earl, A. D. Warren, A. V. Z. Brower, M. Yago, K. M.
Dexter, M. Espeland, N. E. Pierce, D. J. Lohman, and A. Y. Kawahara. 2018. Anchored
phylogenomics illuminates the skipper butterfly tree of life. BMC Evolutionary Biology 18(1):
101.
Toussaint, E. F. A., H. Chiba, M. Yago, K. M. Dexter, A. D. Warren, C. Storer, D. J. Lohman, and
A. Y. Kawahara. 2021. Afrotropics on the wing: phylogenomics and historical biogeography of
awl and policeman skippers. Systematic Entomology 46(1): 172-185.
Warren, A. D., K. J. Davis, E. M. Stangeland, J. P. Pelham, K. R. Willmott, and N. V. Grishin.
2016. Illustrated Lists of American Butterflies. [21-XI-2017].
Zhang, J., Q. Cong, J. Shen, E. Brockmann, and N. V. Grishin. 2019a. Genomes reveal drastic and
recurrent phenotypic divergence in firetip skipper butterflies (Hesperiidae: Pyrrhopyginae).
Proceedings of the Royal Society B: Biological Sciences 286(1903): 20190609.
Zhang, J., Q. Cong, J. Shen, E. Brockmann, and N. V. Grishin. 2019b. Three new subfamilies of
skipper butterflies (Lepidoptera, Hesperiidae). Zookeys 861: 91-105.
Zhang, J., Q. Cong, J. Shen, and N. V. Grishin. 2022. Taxonomic changes suggested by the genomic
analysis of Hesperiidae (Lepidoptera). Insecta Mundi 0921: 1-135.
Zhang, J., Q. Cong, J. Shen, P. A. Opler, and N. V. Grishin. 2020. Genomic evidence suggests further
changes of butterfly names. The Taxonomic Report of the International Lepidoptera Survey 8(7):
1—40.
Zhang, J., Q. Cong, J. Shen, P. A. Opler, and N. V. Grishin. 2021. Genomics-guided refinement of
butterfly taxonomy. The Taxonomic Report of the International Lepidoptera Survey 9(3): 1—54.
13
The Taxonomic Report
is a publication of
The International Lepidoptera Survey (TILS)
The International Lepidoptera Survey is registered as a non-profit Limited Liability Company (LLC) in
the state of Virginia, U.S.A. The Taxonomic Report (TTR) is published for the purpose of providing a
public and permanent scientific record. Contents are peer-reviewed but not necessarily through the
anonymous review and comment process preferred by some publishers of serial literature. It appears in
digital, open-access form, is regularly disseminated in hardcopy form to select institutional repositories
and is also available as printed copy upon request at the discretion of authors and/or the editor. Printing
and postage costs may apply. An initial run of 25 copies is printed on paper to meet ICZN
recommendation 8B. Copies of all TTR papers are available at the archival TTR website:
(http://lepsurvey.carolinanature.com/report.html) and via the following digital repositories:
Internet Archive (https://archive.org/)
Biodiversity Heritage Library (https://www.biodiversitylibrary.org)
Zobodat (https://www.zobodat.at/)
Zenodo (https://zenodo.org)
TILS Purpose
TILS is devoted to the worldwide collection of Lepidoptera for the purpose of scientific discovery,
determination, and documentation, without which there can be no preservation.
TILS Motto
“As a world community, we cannot protect that which we do not know”
Articles for publication are sought
They may deal with any area of research on Lepidoptera, including faunal surveys, conservation topics,
methods, etc. Taxonomic papers are especially welcome. There are no page charges for authors. Before
sending a manuscript, simply write to TTR editor, Harry Pavulaan, 606 Hunton Place NE, Leesburg,
VA, 20176, USA to initiate discussion on how to best handle your material for publication, and to discuss
peer review options; or email to [email protected] (cc: to [email protected] if you do not
receive a reply within one week).
Visit The International Lepidoptera Survey on the World Wide Web at:
http://lepsurvey.carolinanature.com
&
Join the discussion at our list serve on Groups.1io at:
https://groups.io/g/TILS
You can subscribe by sending an email to: [email protected]
&
Join The International Lepidoptera Survey on Facebook at:
https://www.facebook.com/groups/1072292259768446
14