Volume 10 Number 7 7 October 2022
ae pf
The Taxonomic Report
OF THE INTERNATIONAL LEPIDOPTERA SURVEY
ISSN 2643-4776 (print) / ISSN 2643-4806 (online)
Taxonomic discoveries enabled by genomic analysis of butterflies
Jing Zhang'’°, Qian Cong'’, Jinhui Shen'’, Leina Song!”, Riley J. Gott’, Pierre Boyer’,
Crispin S. Guppy’®, Steve Kohler’, Gerardo Lamas’, Paul A. Opler’, and Nick V. Grishin?*
Departments of ‘Biophysics, 7Biochemistry, and 7Eugene McDermott Center For Human Growth & Development, University
of Texas Southwestern Medical Center, 5323 Harry Hines Blvd., Dallas, TX 75390, USA; *McGuire Center for Lepidoptera
and Biodiversity, University of Florida, 3215 Hull Rd., Gainesville, Florida 32611; °7, Lotissement I'Horizon, 13610 Le Puy
Sainte Réparade, France; °5 Boss Road, Whitehorse, YT Y1A 5S9; 72617 Glen Drive, Missoula, MT 59804, USA; ’Museo de
Historia Natural, Universidad Nacional Mayor de San Marcos, Lima, Peru; 7Department of Agricultural Biology, Colorado
State University, Fort Collins, CO 80523, USA; “Corresponding author:
[email protected]
ABSTRACT. The comparative genomics of butterflies yields additional insights into their phylogeny and classification
that are compiled here. As a result, 3 genera, 5 subgenera, 5 species, and 3 subspecies are proposed as new, 1.e., 1n Hesperiidae:
Antina Grishin, gen. n. (type species Antigonus minor O. Mielke, 1980), Pompe Grishin and Lamas, gen. n. (type species
Lerema postpuncta Draudt, 1923), and Curva Grishin, gen. n. (type species Moeris hyvagnis Godman, 1900); in Lycaenidae:
Fussia Grishin, subgen. n. (type species Polyommatus standfussi Grum-Grshimailo, 1891) and Pava Grishin, subgen. n. (type
species Thecla panava Westwood, 1852); in Hesperiidae: Monoca Grishin, subgen. n. (type species Tagiades monophthalma
Plotz, 1884), Putuma Grishin, subgen. n. (type species 7isias putumayo Constantino and Salazar, 2013), and Rayia Grishin,
subgen. n. (type species Mastor perigenes Godman, 1900); Cissia wahala Grishin, sp. n. (Nymphalidae; type locality in
Mexico: Oaxaca); in Hesperiidae: Hedone mira Grishin and Lamas, sp. n. (type locality in Peru: Apurimac), Vidius
pompeoides Grishin, sp. n. (type locality in Brazil: Amazonas), Parphorus hermieri Grishin, sp. n. (Hesperiidae; type locality
in Brazil: Rond6nia), and Zenis par Grishin, sp. n. (Hesperiidae; type locality in Peru: Cuzco); in Pieridae: Glutophrissa
drusilla noroesta Grishin, ssp. n. (type locality in USA: Texas, Cameron Co.) and Pieris marginalis siblanca Grishin, ssp. n.
(type locality in USA: New Mexico, Lincoln Co.), and Argynnis cybele neomexicana Grishin, ssp. n. (Nymphalidae; type
locality in USA: New Mexico, Sandoval Co.). Acidalia leto valesinoides-alba Reuss, [1926] and Acidalia nokomis
valesinoides-alba Reuss, [1926] are unavailable names. Neotypes are designated for Mylothris margarita Hubner, [1825] (type
locality in Brazil) and Papilio coras Cramer, 1775 (type locality becomes USA: Pennsylvania, Montgomery Co., Flourtown).
Mylothris margarita Hubner, [1825] becomes a junior objective synonym of Pieris ilaire Godart, 1819, currently a junior
subjective synonym of Glutophrissa drusilla (Cramer, 1777). Lectotypes are designated for Hesperia ceramica Pl6tz, 1886
(type locality in Indonesia: Seram Island), Pamphila trebius Mabille, 1891 (type locality Colombia: Bogota), Methionopsis
modestus Godman, 1901 and Papias microsema Godman, 1900 (type locality in Mexico: Tabasco), Hesperia fusca Grote &
Robinson, 1867 (type locality in USA: Georgia), Goniloba corusca Herrich-Schaffer, 1869, and Goniloba devanes Herrich-
Schaffer, 1869; the type localities of the last two species, together with Pamphila stigma Skinner, 1896 and Carystus (Argon)
lota (Hewitson, 1877), are deduced to be in South America. Type locality of Junonia pacoma Grishin, 2020 is in Sinaloa, not
Sonora (Mexico). Abdomen is excluded from the holotype of Staphylus ascalon (Staudinger, 1876). Furthermore, a number of
taxonomic changes are proposed. Alciphronia Kocak, 1992 is treated as a subgenus, not a synonym of Heodes Dalman, 1816.
The following genera are treated as subgenera: Lafron Grishin, 2020 of Lycaena [Fabricius], 1807, Aremfoxia Real, 1971 of
Epityches D'Almeida, 1938, Placidina D'Almeida, 1928 of Pagyris Boisduval, 1870, and Methionopsis Godman, 1901 of
Mnasinous Godman, 1900. Polites (Polites) coras (Cramer, 1775) is not a nomen dubium but a valid species. The following are
species-level taxa (not subspecies or synonyms of taxa given in parenthesis): Lycaena pseudophlaeas (Lucas, 1866) and
Lycaena hypophlaeas (Boisduval, 1852) (not Lycaena phlaeas (Linnaeus, 1761), Satvrium dryope (W. H. Edwards, 1870) (not
Satyrium sylvinus (Boisduval, 1852)), Apodemia cleis (W. H. Edwards, 1882) (not Apodemia zela (Butler, 1870)), Epityches
thyridiana (Haensch, 1909), comb. nov. (not Epityches ferra Haensch, 1909, comb. nov.), Argynnis bischoffii W. H. Edwards,
1870 (not Argynnis mormonia Boisduval, 1869), Argynnis leto Behr, 1862 (not Argynnis cybele (Fabricius, 1775)), Boloria
myrina (Cramer, 1777) (not Boloria selene ({Denis & Schiffermuller], 1775)), Phyciodes jalapeno J. Scott, 1998 (not
Phyciodes phaon (W. H. Edwards, 1864)), Phyciodes incognitus Gatrelle, 2004 and Phyciodes diminutor J. Scott, 1998 (not
Phyciodes cocyta (Cramer, 1777)), Phyciodes orantain J. Scott, 1998 (not Phyciodes tharos (Drury, 1773)), Phyciodes anasazi
J. Scott, 1994 (not Phyciodes batesii (Reakirt, [1866])), Cercyonis silvestris (W. H. Edwards, 1861) (not Cercyonis sthenele
(Boisduval, 1852)), Paramacera allyni L. Miller, 1972 and Paramacera rubrosuffusa L. Miller, 1972 (not Paramacera xicaque
1
(Reakirt, [1867])), Cissia cheneyorum (R. Chermock, 1949), Cissia pseudocleophes (L. Miller, 1976), and Cissia anabelae (L.
Miller, 1976) (not Cissia rubricata (W. H. Edwards, 1871)), Tarsoctenus gaudialis (Hewitson, 1876) (not Tarsoctenus corytus
(Cramer, 1777)), Nisoniades inca (Lindsey, 1925) (not Nisoniades mimas (Cramer, 1775), Xenophanes ruatanensis Godman &
Salvin, 1895 (not Xenophanes tryxus (Stoll, 1780)), Lotongus shigeoi Treadaway & Nuyda, 1994, Lotongus balta Evans, 1949,
Lotongus zalates (Mabille, 1893), and Lotongus taprobanus (Pl6tz, 1885) (not Lotongus calathus (Hewitson, 1876)), Oxynthes
martius (Mabille, 1889) (not Oxynthes corusca (Herrich-Schaffer, 1869)), Notamblyscirtes durango J. Scott, 2017 (not
Notamblyscirtes simius W. H. Edwards, 1881), Hedone praeceps Scudder, 1872, Hedone catilina (Plotz, 1886), and Hedone
calla (Evans, 1955) (not Hedone vibex (Geyer, 1832)), Atalopedes huron (W. H. Edwards, 1863) (not Atalopedes campestris
(Boisduval, 1852)), Papias microsema Godman, 1900 (not Mnasinous phaeomelas (Hubner, [1829]), comb. nov.), Papias
unicolor (Hayward, 1938) and Papias monus Bell, 1942 (not Papias phainis Godman, 1900), Nastra leuconoides (Lindsey,
1925) (not Nastra leucone (Godman, 1900)), Nastra fusca (Grote & Robinson, 1867) (not Nastra lherminier (Latreille,
[1824])), Zenis hemizona (Dyar, 1918) and Zenis janka Evans, 1955 (not Zenis jebus (Plotz, 1882)), Carystus (Argon) argus
Moschler, 1879 (not Carystus (Argon) lota Hewitson, 1877), and Lycas devanes (Herrich-Schaffer, 1869) (not Lycas argentea
(Hewitson, 1866)). Borbo impar ceramica (Pl6tz, 1886), comb. nov. is not a synonym of Pelopidas agna larika (Pagenstecher,
1884) but a valid subspecies. Parnassius smintheus behrii W. H. Edwards, 1870 and Cercyonis silvestris incognita J. Emmel,
T. Emmel & Mattoon, 2012 are subspecies, not species. The following are junior subjective synonyms: Shijimiaeoides Beuret,
1958 of Glaucopsyche Scudder, 1872, Micropsyche Mattoni, 1981 of Turanana Bethune-Baker, 1916, Cyclyrius Butler, 1897
of Leptotes Scudder, 1876, Mesenopsis Godman & Salvin, 1886 of Xynias Hewitson, 1874, Carystus tetragraphus Mabille,
1891 of Lotongus calathus parthenope (P\6tz, 1886), Parnara bipunctata Elwes & J. Edwards, 1897 of Borbo impar ceramica
(Plotz, 1886), Hesperia peckius W. Kirby, 1837 of Polites (Polites) coras (Cramer, 1775), and Lerodea neamathla Skinner &
R. Williams, 1923 of Nastra fusca (Grote & Robinson, 1867). The following transfers are proposed: of species between genera
(i.e., revised genus-species combinations): Nervia niveostriga (Trimen, 1864) (not Kedestes Watson, 1893), Leona lota Evans,
1937 (not Lennia Grishin, 2022), Leona pruna (Evans, 1937) and Leona reali (Berger, 1962) (not Pteroteinon Watson, 1893),
Mnasinous phaeomelas (Hubner, [1829]) (not Papias Godman, 1900), Saturnus jaguar (Steinhauser, 2008) (not Parphorus
Godman, 1900), Parphorus harpe (Steinhauser, 2008) (not Saturnus Evans, 1955), Parphorus kadeni (Evans, 1955) (not Lento
Evans, 1955), and Calpodes chocoensis (Salazar & Constantino, 2013) (not Megaleas Godman, 1901); of subspecies between
Species (1.e., revised species-subspecies combinations): Melitaea sterope W. H. Edwards, 1870 of Chlosyne palla (Boisduval,
1852) (not Chlosyne acastus (W. H. Edwards, 1874)) and Panoquina ocola distipuncta Johnson & Matusik, 1988 of
Panoquina lucas (Fabricius, 1793); and junior subjective synonym transferred between species: Rhinthon zaba Strand, 1921 of
Conga chydaea (A. Butler, 1877), not Cynea cynea (Hewitson, 1876), Pamphila stigma Skinner, 1896 of Hedone catilina
(Plotz, 1886), not Hedone praeceps Scudder, 1872, and Pamphila ortygia Moschler, 1883 of Panoquina hecebolus (Scudder,
1872), not Panoquina ocola (W. H. Edwards, 1863). Proposed taxonomic changes result in additional revised species-
subspecies combinations: Lycaena pseudophlaeas abbottii (Holland, 1892), Satyrium dryope putnami (Hy. Edwards, 1877),
Satyrium dryope megapallidum Austin, 1998, Satyrium dryope itys (W. H. Edwards, 1882), Satyrium dryope desertorum (F.
Grinnell, 1917), Argynnis bischoffi opis W. H. Edwards, 1874, Argynnis bischoffi washingtonia W. Barnes & McDunnough,
1913, Argynnis bischoffi erinna W. H. Edwards, 1883, Argynnis bischoffi kimimela Marrone, Spomer & J. Scott, 2008,
Argynnis bischoffi eurynome W. H. Edwards, 1872, Argynnis bischoffi artonis W. H. Edwards, 1881, Argynnis bischoffi luski
W. Barnes & McDunnough, 1913, Argynnis leto letona (dos Passos & Grey, 1945), Argynnis leto pugetensis (F. Chermock &
Frechin, 1947), Argynnis leto eileenae (J. Emmel, T. Emmel & Mattoon, 1998), Boloria myrina nebraskensis (W. Holland,
1928), Boloria myrina sabulocollis Kohler, 1977, Boloria myrina tollandensis (W. Barnes & Benjamin, 1925), Boloria myrina
albequina (W. Holland, 1928), Boloria myrina atrocostalis (Huard, 1927), Boloria myrina terraenovae (W. Holland, 1928),
Phyciodes anasazi apsaalooke J. Scott, 1994, Polites coras surllano J. Scott, 2006, and Curva darienensis (Gaviria, Siewert,
Mielke & Casagrande, 2018). Specimen curated as the holotype of Acidalia leto valesinoides-alba Reuss, [1926] is Argynnis
leto letona (dos Passos & Grey, 1945) (not A. /eto leto Behr, 1862) from USA: Utah, Provo. A synonymic list of available
genus-group names for Lycaeninae [Leach], [1815] 1s given. Unless stated otherwise, all subgenera, species, subspecies and
synonyms of mentioned genera and species are transferred with their parent taxa, and others remain as previously classified.
Key words: nomenclature, taxonomy, classification, genomics, phylogeny, biodiversity.
ZooBank registration: http://zoobank.org/4EBE18FC-3018-49F4-8E2D-C6019918FF33
INTRODUCTION
In this study, we continue the exploration of the phylogenetic classification of butterflies aided by
genomic sequencing. The general philosophy, strategy, and details of the methods follow our previous
publications (Cong et al. 2019a, b; Li et al. 2019; Zhang et al. 2019a, b, c, d; Cong et al. 2020; Zhang et
al. 2020; Cong et al. 2021; Zhang et al. 2021; Robbins et al. 2022; Zhang et al. 2022b, c). Here, we report
further findings that are encountered as whole genomic shotgun datasets for additional specimens are
being assembled and comparatively analyzed. We place emphasis on the sequencing of primary type
specimens that provide objective references for the names (Zhang et al. 2022a). When type localities are
unknown, we deduce them by genomic comparison of the type specimens with specimens from known
2
localities (Cong et al. 2021). Criteria used for genera, subgenera, species, and subspecies are the same as
we employed and discussed previously (Cong et al. 2019a, b; Li et al. 2019; Zhang et al. 2019b, d; Cong
et al. 2020; Zhang et al. 2020; Zhang et al. 2021; Zhang et al. 2022b).
Because speciation and extinction patterns are linked to geological events simultaneously affecting
many phylogenetic lineages, we observe levels in phylogenetic trees, 1.e., periods of rapid diversification
followed by the reduced number of splits that result in longer internal branches at about the same distance
from the root (or the leaves). Genera are defined as the most prominent level in genomic trees between
tribes and species that mostly corresponds to the current classification into genera. Subgenera form a
rather prominent level between genera and species. Species are delineated by a combination of criteria
that include genetic differentiation in the Z chromosome measured by Fst (0.25 typically corresponds to
distinct species) and gene exchange Gmin (<0.7 for distinct species) (Cong et al. 2019a), COI barcode
difference (usually >2% for distinct species) (Hebert et al. 2003) and its correlation with phenotypic
differences (Lukhtanov et al. 2016), and the prominence of species-level clades (Zhang et al. 2022c).
Diagnostic DNA characters are given as abbreviations for either of the three reference genomes:
Pieris rapae (Linnaeus, 1758) (pra) (Shen et al. 2016), Calycopis cecrops (Fabricius, 1793) (cce) (Cong et
al. 2016), or Cecropterus lyciades (Geyer, 1832) (aly) (Shen et al. 2017), and for the COI barcode: e.g.,
aly728.44.1:G672C means position 672 in exon | of gene 44 from scaffold 728 of C. lyciades (formerly
in Achalarus Scudder, 1872, thus aly; cce would be for C. cecrops; no prefix and : for COI barcode)
reference genome is C, changed from G in the ancestor.
The sections below follow the standardized format. Taxonomic act is given as the title. For cited
genera and subgenera, type species are listed in parenthesis. Type localities are specified. Sections are
illustrated by a segment of a nuclear genomic tree (or the Z chromosome tree when specified) with
Species necessary to support the conclusion. Currently employed names and combinations (Lamas 2004;
Mielke 2005; Pelham 2008) are used in the figures, including recently proposed changes (Cong et al.
2019b; Zhang et al. 2019b; Zhang et al. 2020; Zhang et al. 2021; Pelham 2022; Zhang et al. 2022b). New
combinations and taxonomic changes are given in the text and figure legends. The sections are ordered by
family and generally in their taxonomic order deduced from genome-scale phylogeny complemented by
phenotypic considerations. Whole genome shotgun datasets we obtained and used in this work are
available from the NCBI database <https://www.ncbi.nlm.nih.gov/> as BioProject PRJNA883758, and
BioSample entries of the project contain the locality and other collection data of the sequenced specimens
shown in the trees. COI barcode sequences have been deposited in GenBank with accessions OP23 1464—
OP23 1472, OP323110—OP323113, and OP381659-OP381661. Exon sequences with diagnostic characters
highlighted are also available from <https://osf.10/zy38s/>.
Family Papilionidae Latreille, [1802]
Parnassius smintheus behrii W. H. Edwards, 1870, revised status
Genomic sequencing of Parnassius phoebus (Fabricius, 1793) (type locality in Russia: Altai) and
relatives reveals that Parnassius behrii W. H. Edwards, 1870 (type locality USA: California, Tioga Pass)
is placed among subspecies of Parnassius smintheus E. Doubleday, 1847 (type locality Canada: Alberta,
nr. Rock Lake), rendering P. smintheus paraphyletic (Fig. 1, the Z chromosome tree). Moreover, P. behrii
is not strongly differentiated genetically from various subspecies of P. smintheus. E.g., COI barcodes of
P. behrii neotype (NVG-20125E02) and P. smintheus smintheus from Canada: Alberta (NVG-19083G08)
differ by 0.6% (4 bp). We see that the two northwestern subspecies of P. smintheus 1.e., P. s. sternitzkyi
McDunnough, 1937 (type locality in USA: California, Siskiyou Co.) and P. s. olympianna Burdick, 1941
(type locality in USA: Washington, Clallam Co.), are more differentiated from the nominotypical
subspecies in nuclear DNA than the nominotypical P. smintheus from P. behrii (Fig. 1). Therefore, we
propose to treat P. behrii as a subspecies of P. smintheus: Parnassius smintheus behrii W. H. Edwards,
1870, stat. rev., which appears to be a more isolated geographically and genetically bottlenecked (e.,
comparatively longer branch leading to the last common ancestor of sequenced P. s. behrii specimens in
3
Fig. 1) group of populations rather than a reproductively isolated species.
Furthermore, barcodes of P. smintheus (NVG-19083G08) and Parnassius phoebus (Fabricius,
1793) male “neotype” in MFNB (NVG-21128G07) differ by 2.1% (14 bp), which is consistent with them
being distinct species in the presence of phenotypic differences. Finally, the status of Parnassius sacerdos
Stichel, 1906 (type locality in the Alps) Parnassius phoebus golovinus|19083G01|USA:AK, Semidi Ids|1885
: l : l P. phoebus golovinus|21018C12|LT|USA:AK, Golovin Bay|1903|CMNH
aS a Species alSO appears questionab c Parnassius phoebus pues 1058B06|Canada:YT|2005
: “oo ib] h Parnassius phoebus apricatus (=elias)|22022C04|Canada:YT|2015
(Fig. 1), and it is possib e that P. 28 Parnassius phoebus phoebus|21128G07|invalid NT|M|Russia:Siberia|MFNB
: f Parnassius sacerdos|22022E09|France|1982
sacerdos may be a subspecies of P. — Parnassius sacerdos|PAOE 12|Switzerland
hoch diti ll d. Th : Parnassius smintheus sternitzkyi|19083G03|USA:CA, Siskiyou Co.|1983
Phoebus as traditionally treated. € Parnassius smintheus sternitzkyi]19083G05|USA:CA, Siskiyou Co.|1990
: f : 1 4 Parnassius smintheus olympianna|19083G07|USA:WA,Challam Co.|1970
specimens Irom Switzerland (PAOE12) Parnassius ST Bee ere. coe Secs
: “Le: P. smintheus olympianna (=guppyi)|22022E 12|Canada:BC, Vancouver Id.|1978
and Altai (NVG-21128G07)_ exhibit — Parmassius behsiZ01Z3EDOINTIUSA‘CA Tog Pass|1916|CMNH
: — Parnassius behrii|19083G11|USA:CA,Mono Co.|1961
COI barcode difference of 0.9% (6 bp), ("for Pamnassius behril19083612|USA:CA Alpine Co 1961
: ; Parnassius behrii|[21077A04|USA:CA, Tuolumne Co.|1991
which drops to 0.3% (2 bp) between P. r—_— Parnassius sis etn 668 A:CA, Alpine Co.|1990
Parnassius behrii|J6662|USA:CA,Alpine Co.}2015
sacerdos (PAOE12) and the lectotype = Parnassius smintheus smint euis|19083G08|Canada:Albertal2003
f : haob Pace |<, Parnassius smintheus magnus|9361|USA:WY,Park Co.|2017
of Parnassius phoebus golovinus W. a, P. smintheus magnus (=xanthus)/21018C 10|ST|USA\ID Latah Co.|CMNH
ll l li . u13 Parnassius smintheus magnus|9359|USA:WY,Park Co.|2017
Ho and, 1930 (type Oca ity USA: Parnassius smintheus ST SneS aveSED IISA Co.|2016 2016
: 0-56 Parnassius smintheus sayii|6592|USA:CO, Pitkin Co.|201
Alaska, Golovin Bay, NVG-21018C12) o44p-4—_Parnassius smintheus BeeMnoretaeulntia USA:CO,Hinsdale Co.|2018
individual — Parnassius smintheus pseudorotgeri|M15|USA:CO, Hinsdale Co.|2018
and appears to represent individua Parnassius smintheus yukonensis|16107B01|Canada:Y1|2016
. us . . hondrial ar Parnassius smintheus yukonensis|16107A10|Canada:YT|2016
variation in mitochondrial genome Parnassius smintheus yukonensis|16107A12|Canada:YT|2016
rather than to stem from reproductive | Fig. 1. Parnassius phoebus (blue, above) and Parnassius smintheus (red
isolation. Genomic sequencing of larger and magenta, below) including Parnassius smintheus behrii (magenta).
sample of specimens throughout the ranges of these taxa is needed to confidently address these questions.
Family Pieridae Swainson, 1820
Glutophrissa drusilla noroesta Grishin, new subspecies
http://zoobank.org/3F7989B4-DB04-402D-9D82-1DAAAC62F377
(Figs. 2 part, 3, 4)
Definition and diagnosis. Genomic sequencing G. drusilla noroestal171 16G07|HT|USATX,Cameron Co.|1976|TAMU
; ; 1 Glutophrissa drusilla noroesta|17116G06|PT|USA:TX,Bexar Co.|1996
of Glutophrissa drusilla (Cramer, 1777) (type s glutophissa drusilla woroestal21088811|P Mexico Sinaioa[1a74
locality likely in Suriname) specimens across the SE OSEGISe Oa
range reveals that those from Texas and Mexico 'Glutophrissa drusilla boydij22045E04|St. Croix
: Glutophrissa drusilla castalia|10512|Jamaica|2017
form a separate clade in the Z chromosome tree ‘qaptopinissa drusilla castalia]10318|Jamaica]2017
. ; . i utophrissa drusilla castalia}10510|Jamaica}2017
(Fig. 2) sister to eastern US (Glutophrissa drusilla a uloprisa drusita poeyl sla eal 944
neumoegenii (Skinner, 1894), type locality USA: 1 Glutophrissa drusilla poeyi 190685 02\Ca man Islands|1981
; : ; A ogg nopmiesa drusilla neumoegenii|20067 FC a Dade ee ea
Florida, Indian River) and Caribbean Islands > dglutophrissa drusilla neumoegenil|20067H05|USA:FL,Monroe Co.|1973
: , : .gelutophrissa drusilla neumoegenii]22045E07|USA:FL|1935|CUIC
subspecies, rather than grouping with South Glutophrissa drusilla neumoegenii|20067H04|USA:FL, Miami Dade Co.|1957
: ; : + ; Glutophrissa drusilla|21075D08|Ecuador:Rio Negro Region|1985
American specimens that include similar in -'Glutophrissa drusilla]22045F04|Peru:Tingo Maria|1947
] bie a ii eee 3 _Glutophrissa drusilla|22045F12|Peru, El Campamento|1920
appearance Glutophrissa drusilla tenuis (Lamas, Glutophrissa drusilla|21075D09|F eru‘Madre de Dios|1981
. . utopnrissa drusilla olombia
1981) (type locality in Peru), the name currently 2-°2Glutophrissa drusilla 22043 06) rnidad
. . Glutophrissa SL aR A eta eru:Tingo Maria|1980
applied to these northwesternmost populations. vaalutophrissa drusilla|22045E 12|Venezuela|1899_
: ’ utophrissa drusilla eru,Satipo
Therefore, the northwestern populations are not Glutophrissa drusila 22048 fi Berube riage
. : “Lo: utophrissa drusilla razil:
G. d. tenuis (they are not monophyletic with it) *iglutophissa ee
: : utopnrissa drusilla uriname
and, because no available name applies to them, *Glutophnsse crusilal2g043° 10 Perio Ouray & R. Napo|1920
y : 7 utopnrissa drusilla razii:
are a new subspecies defined by its own clade in * {Glutophissa drusila!22046FO7|Uraauay pt
1 : utopnrissa drusilla razil:
the Z chromosome tree. Typical males are ‘Ghtoprnsa drusta|22048F 02 raz A } 936
1 1 1 utopnrissa drusilla uriname
spotless (Fig. 3), similar to eastern US and : Glutophrissa drusillal22045F01|Paraquay|1920
Caribbean subspecies, without an area covered in : SOE muney eli sae
utophrissa Susie os42C01 !
22045G01|Peru:Lower Rio Pachitea|1920
black scales by forewing apex characteristic of G. | Fig. 2. Glutophrissa drusilla noroesta (red) among relatives
d. tenuis (Lamas, 1981) or more extensive patch labeled in different colors: G. d. neumoegenii (green),
Glutophrissa drusilla
of most South American populations, but with specimens from Suriname (magenta), and Peru (purple).
narrowly brown costal margin and outer margin from apex to about and at times a little beyond vein
CuA., frequently missing in eastern populations. More extensively colored females develop hindwing
marginal border unlike eastern subspecies, and discal forewing cell rarely dark, if so, then only in part
(Fig. 4). Due to extensive individual and seasonal variation, best identified by DNA sequences with the
following characters in the nuclear genome: pra547.4.1:G270A, pra54.2.5:A63G, pra4.54.3:A63G,
pra547.4.2: A276G, and pra828.50.5:G57A. COI barcodes do not distinguish this subspecies from others.
a
Ha SS ~
\ J OE | AQ
\ é Be f
\ he }
\
YN i,
KS
be 1 CM
Fig. 3. Glutophrissa drusilla noroesta ssp. n. holotype &, dorsal (left) and ventral (right) views, NVG-17116G07, data in text.
Barcode sequence of the holotype: Sample NVG-17116G07, GenBank OP381659, 658 base pairs:
AACTCTTTATTTTATTTTTGGAATTTGATCTGGAATAGTAGGAACATCTCTAAGTTTATTAATTCGAACAGAATTAGGAAACCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT
ATTGTTACTGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAACTGATTAGTTCCTTTAATACTTGGAGCCCCTGATATAGCTTTCCCTCGAA
TAAATAATATAAGATTTTGATTACTTCCCCCTTCTTTAACATTATTAATT TCAAGAAGAATTGTTGAAAATGGAGCT GGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGC
CCATAGTGGTTCTTCTGTTGACTTAGCTATTTTTTCTTTACACTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACTACTATTATTAATATACGAATTAATAATATATCA
TTTGATCAAATACCTCTTTTTGTTTGAGCTGTTGGTATTACTGCTCTTCTTCTTCTTCTTTCTTTACCAGTATTAGCTGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTT
CCTTCTTTGATCCCGCTGGAGGAGGAGATCCTATTTTATACCAACATTTATTT
Type material. Holotype: 3 deposited in the Texas A&M University Insect
Collection, College Station, Texas, USA (TAMU), bears five rectangular
printed labels, four white: [| TEXAS: | Cameron County | Brownsville ],
[ coll. | 18 Oct 1976 | Roy O. Kendall | & C. A. Kendall ], [| PIERIDAE:
Pierinae | Appias drusilla neumoegeni | (Skinner, 1894) | det. Roy O. Kendall
| M. & B. No. 331b |, and [ DNA sample ID: | NVG-17116G07 | c/o Nick V.
Grishin ], and one red [ HOLOTYPE < | Glutophrissa drusilla | noroesta
Grishin ]. Paratypes: 12 NVG-17116G06, USA: Texas, Bexar Co., San
Antonio, 31-Oct-1996, R. O. Kendall [TAMU] and Mexico: 14 NVG-
21058B10 Sonora, Aduana, 21-Aug-1997, J. P. Brock and 12 NVG-
21058B11 Sinaloa, Mazatlan, 2-Jan-1974, J. P. Brock.
Type locality. USA: Texas, Cameron County, Brownsville.
Fig. 4. Glutophrissa drusilla
noroesta ssp. n. ° from USA:
Etymology. This subspecies occupies the northwestern part of the species | AZ, Cochise Co., Hereford.
if : es ‘ . iNaturalist observation 7516603.
range, hence the name, which is a feminine adjective formed from “noroeste” © Bob Behrstock, CC BY-NC 4.0
https://creativecommons.org/licenses/by-nc/4.0/
for “northwest” in Spanish and Portuguese.
Distribution. USA: Texas through Mexico and Central America.
Neotype designation for Mylothris margarita Hiibner, [1825]
Out of available names, only one, Mylothris margarita Hiibner, [1825], was published without specifying
type locality (Htibner [1825]), which still remains undefined. We searched for M. margarita syntypes in
the collections of the Muséum National d’Histoire Naturelle, Paris, France, the Natural History Museum,
London, and the Museum fiir Naturkunde, Berlin, Germany, but none were found, and we believe they
5
were lost, together with most other type material of Hiibner names (Hemming 1937; Calhoun 2018).
Therefore, we proceeded with the neotype designation, because there is an exceptional need to define
margarita objectively: a new subspecies proposed above and others are similar to M. margarita, and,
without the type locality defined for it, potential for destabilization of nomenclature exists. According to
its original illustrations, M. margarita is mostly white with dark forewing apex, some dark overscaling at
forewing base by costal margin, pale-yellowish ventral forewing, and orange humeral area of ventral
hindwing. It is currently regarded as a junior subjective synonym of Glutophrissa drusilla (Cramer, 1777)
(type locality likely in Suriname), together with very similar to it Pieris ilaire Godart, 1819 (type locality
in Brazil). To stabilize this treatment, N.V.G. designates the lectotype of Pieris ilaire Godart, 1819 as the
neotype of Mylothris margarita Hiibner, [1825]. As a result, the type locality of M. margarita is in
Brazil, and the latter name becomes a junior objective synonym of the former.
Our neotype of M. margarita satisfies all requirements set forth by the ICZN Article 75.3, namely:
75.3.1. It is designated to clarify the taxonomic identity of Mylothris margarita Hiibner, [1825], which
has been in question due to similarities of the original illustrations with other named taxa in this complex,
and to define its type locality that was not specified when the name was proposed; 75.3.2. The characters
for the taxon include white wings with dark forewing apex and orange humeral area of ventral hindwing;
75.3.3. The neotype specimen is a male bearing four labels [ SYN- | TYPE ], [| TYPE ], [ MUSEUM
PARIS | Brésil |, and [ [aire Goda | Bresil ]; 75.3.4. Our search for syntypes is described above, it was
unsuccessful, and therefore we believe that they were lost; 75.3.5. The neotype is consistent with the
original drawings in the characters given above and differs only in less yellow ventral forewing; 75.3.6.
The neotype is from Brazil, which becomes the type locality of . margarita. The type locality was not
specified when the name was proposed and remained unknown; 75.3.7. The neotype is in the collection of
the Muséum National d'Histoire Naturelle, Paris, France (MNHP).
Pieris marginalis sitblanca Grishin, new subspecies
http://zoobank. org/97C700CF-A822-4A7F-A 12C- 1 DAF12F30D57
(Figs. 5 part, 6, 7)
Pieris marginalis guppyi|20129B10|HT|USA:AK, Skagway|CMNH
Pieris marginalis guppyi|16107B09|Canada:Yukon Territory|2016
Pieris marginalis reicheli|17103F01|PT|Canada:British Columbia|1964
Pieris marginalis reicheli|17103F12|PT|Canada:British Columbia|1964
Pieris marginalis marginalis|15116B10|USA:WA,Mason Co,|1983
Pieris marginalis marginalis|15116B06|USA:OR, Clatsop Co.|1983
Pieris marginalis sequoia|17109B11|HT|USA:CA,Humboldt Co.|1979|LACM
Pieris marginalis sequoia]16105C04|PT|USA:CA, Humboldt Co.|1980
Definition and diagnosis. Sequencing
of Pieris marginalis Scudder, 1861
(type locality in USA: Washington,
Jefferson Co.) specimens across the
range reveals genetic distinction of the
population from the Sacramento
mountains (Fig. 5 red), that is more
different from Pieris marginalis
mogollon Burdick, 1942 (type locality
USA: New Mexico, Catron Co.,
Mogollon Range) (Fig. 5 blue) than P.
m. mogollon from Pieris marginalis
macdunnoughii C. Remington, 1954
(type locality USA: Colorado, San Juan
Co. Silverton) (Fig. 5 green) or from
Pieris marginalis pallidissima W.
Barnes & McDunnough, 1916 (type
locality USA: Utah, Provo) (Fig. 5
olive). Currently, the Sacramento Mts.
populations that according to their
genomics represent a distinct taxon, are
associated with P. m. mogollon and no
name is available for them. Hence,
Pieris marginalis castoria]15116B11|USA:CA, Sierra Co.|2005
Pieris marginalis castoria|16104H10|USA:CA,Madera Co.|1992
Pieris marginalis castoria]16104H11|USA:CA,Madera Co.|2002
Pieris marginalis venosa|PAO411|USA:CA,Mendocino Co.|2017
Pieris marginalis venosa|16105CO09|USA:CA,Monterey Co.|1983
Pieris marginalis ziegleri|9483|USA:WY,Park Co.|2017
op Pieris marginalis ziegleri|17104D02|PT|USA:WY, Teton Co.|1946
" Pieris marginalis pallidissima|15116CO9|USA:NV, Elko Co.|2010
; Pieris marginalis ziegleri|9452|USA:WY, Park Co.|2017
Pieris marginalis pallidissima|15116C11|USA:UT,Sevier Co.|2009
Pieris marginalis pallidissima|16105C11|USA:UT, Wasatch Co.|1978
5 af ieris marginalis mogollon|15116CO7|USA:AZ,Apache Co.|1994
Pieris marginalis mogollon|16105B02|USA:AZ,Apache Co.|1986
*s—— Pieris marginalis mogollon|20102G05|USA:NM, Catron Co.|1966
saz Pieris marginalis mogollon|20102G06|USA:NM, Catron Co.|1966
Pieris marginalis mogollon|20102G07|USA:NM,Catron Co.|1966
Pieris marginalis macdunnoughii|6361|USA:CO,Grand Co.|2016
, Pieris marginalis macdunnoughii|11330|/USA:NM, Santa Fe Co.|2018
* Pieris marginalis macdunnoughii|15116C05|USA:NM, Colfax Co.|1997
Pieris marginalis macdunnoughii|15116C08|USA:NM, Bernalillo Co.|1980
Pieris marginalis siblanca|15116C06|HT|USA:NM, Lincoln Co,.|1995|CSUC
Pieris marginalis siblanca|20102G08|PT|USA:NM, Otero Co.|1972
Pieris marginalis siblanca|20102G11|PT|USA:NM, Lincoln Co.|1974
Pieris marginalis siblanca|20102H01|PT|USA:NM, Lincoln Co.|1974
Pieris marginalis siblanca|20102H02|PT|USA:NM, Lincoln Co.|1974
Pieris marginalis siblanca|20102G10|PT|USA:NM, Otero Co.|1995
Pieris marginalis siblanca|20102G12|PT|USA:NM, Lincoln Co.|1995
Pieris marginalis siblanca|20102G09|PT|USA:NM, Otero Co.|1974
Pieris virginiensis virginiensis|6138|USA:WV,Pendleton Co.|2016
Pieris virginiensis virginiensis|6148|USA:WV,Pendleton Co.|2016
0.09
0.02
0.03
00069
Fig. 5. Pieris marginalis marginalis (magenta) with its southeastern
subspecies P. m. ziegleri with P. m. pallidissima (olive), P. m. mogollon
(blue), P. m. macdunnoughii (green), and P. m. siblanca ssp. n. (red).
these populations represent a new subspecies, because other taxa of comparable genetic differentiation are
treated as subspecies of P. marginalis. Phenotypically, this new subspecies differs from others by absent
or less developed dark spots, especially at the forewing apex, and most females are spotless, only veins
are outlined by dark scales, both dorsally and ventrally (Figs. 6, 7), but this dark overscaling of veins is
typically more extensive than even in P. m. mogollon. In typical females (Figs. 6, 7f-h), continuous apical
dark area is absent, but veins are heavily overscaled with dark-brown towards the apex, both dorsally and
ventrally. Males (Fig. 7a—e) are whiter than yellower females and additionally differ from females by
reduced dark overscaling on the dorsal side, in particular in the discal area of dorsal forewing, but possess
more extensive overscaling at the apex, which in some specimens merges into a continuous dark apical
patch towards the outer margin. Because females are easier to distinguish from other populations than
males, a female is chosen as the holotype. Due to individual variation, these differences are expected to be
statistical, and the new subspecies can be confidently diagnosed by a combination of the following DNA
characters in the COI barcode: G34A, C64T, C1LI5T, A415G, and 634T(not C).
1 cm
Fig. 6. Pieris marginalis siblanca ssp. n. holotype, dorsal (left) and ventral (right) views, NVG-15116C06, data in text.
Barcode sequence of the holotype: Sample NVG-15116C06, GenBank OP23 1464, 658 base pairs:
AACTTTATATTTTATCTTCGGAATTTGATCAGGAATAGTAGGAACATCTTTAAGTTTACTTATTCGAACTGAATTAGGAAATCCAGGATTTTTAATTGGTGATGACCAAATTTATAATACT
ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTCCCATTAATACTAGGAGCTCCAGATATAGCTTTCCCCCGAA
TAAATAATATAAGATTTTGATTATTACCTCCTTCTTTGACTCTTCTTATTTCAAGCAGAATCGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTCTCATCAAATATTGC
TCATAGAGGCTCATCAGTAGATTTAGCTATTTTTTCTTTACATTTAGCTGGGATTTCTTCAATTTTAGGAGCAATTAATTTTATTACAACTATTATTAATATACGTATTAGAAATATATCT
TTTGATCAAATACCATTATTTGTATGATCAGTAGGAAT TACTGCTTTACTTTTACTTCTTTCTTTACCAGTACTTGCAGGTGCAATTACAATACTTTTAACAGATCGAAATTTAAATACAT
CATTTTTTGATCCTGCTGGAGGAGGTGATCCAATTCTTTATCAACATCTATTT
Type material. Holotype: 9 deposited in the C. P. Gillette Museum of Arthropod Diversity, Colorado
State University, Fort Collins, CO, USA (CSUC), bears five rectangular labels: four white [ 2-VI-95
10,000’ RWH & SJC | Sierra Blanca Ski Area HQ | E slope, Sacramento Mts. | Lincoln Co., NM ], [ 19180
RWH | P. napi | mogollon |, [ DNA sample ID: | NVG-15116C06 | c/o Nick V. Grishin ], [ CSU_ENT |
1049135 ], and one red [ HOLOTYPE 9 | Pieris marginalis | siblanca Grishin ]. Paratypes: 244 and
22° from Lincoln County, Sierra Blanca Mts.: 4 NVG-20102G12, CSU_ENT1049153, from the type
locality with the same data; 4 NVG-20102H01, CSU_ENT1049145, from the type locality, 13-May-
1974; 2 NVG-20102G11, CSU_ENT1049142, Nogal Canyon, 7000', 5-May-1974; 2 Philadelphia Cyn.,
below Bonito Lake, 6700', 18-Apr-1974; and 3¢¢ from Otero County, Sacramento Mts.: NVG-
20102G08, CSU_ENT1049157, Five Spring, 7500', 28-Apr-1972; NVG-20102G09, CSU_ENT1049139,
1 mi E Head Springs, 7000', 19-Apr-1974; NVG-20102G10, CSU_ENT1049158, Mescalero Apache
Reservation, Head Springs, 7000", 9-Apr-1995 in New Mexico, USA (Figs. 5, 7), all collected by Richard
W. Holland (NVG-20102G10 and NVG-20102G12 together with Steve J. Cary) and are in CSUC.
Type locality. USA: New Mexico, Lincoln County, E slope of Sierra Blanca Mountains, Ski Apache
Resort Headquarters, elevation 10,000".
Etymology. The name refers to the type locality in the Sierra Blanca Mountains, to the white color of this
subspecies, to the “blank” appearance without characteristic spotting present in many Pieris marginalis
7
populations. The name is a feminine adjective.
Distribution. Sierra Blanca and Sacramento Mountains in southern New Mexico.
Comments. This new subspecies is unexpectedly different genetically from nearby populations. It is
likely that the white colors with only a few elements of wing pattern present and significant variation
across and within Pieris marginalis populations hindered the discovery of this taxon.
Fig. 7. The type series of Pieris marginalis siblanca ssp. n. from USA: New Mexico, Sierra Blanca and Sacramento Mountains
(Lincoln and Otero Cos). The holotype is shown in g and g', others are paratypes. a. NVG-20102H01; b. NVG-20102G08; c.
NVG-20102G12; d. NVG-20102G09; e. NVG-20102G10; f NVG-20102G11; g. NVG-15116C06; h. NVG-20102H02; a—e
are males and f-g are females, dorsal (left t1mage) and ventral (right image, labels with prime, e.g., a') views; data in text.
Specimens were photographed together as a single image on a slightly greenish background, not assembled in Photoshop.
Family Lycaenidae [Leach], [1815]
Lafron Grishin, 2020 is a subgenus of Lycaena [Fabricius], 1807
Genomic analysis of Papilio orus Stoll, 1780, the type species of Lafron Grishin, 2020, reveals that it
originates within the rapid radiation at the origin of the genus Lycaena [Fabricius], 1807 (type species
Papilio phlaeas Linnaeus, 1761), and therefore belongs to it (Fig. 8). It forms a long branch in the
phylogenetic trees, reflecting its phenotypic uniqueness, and distinctness of the COI barcode, but is a
taxon of equivalent rank to subgenera within Lycaena, and therefore we propose that Lafron Grishin,
2020, stat. nov. be treated as a subgenus of Lycaena [Fabricius], 1807.
Alciphronia Kogak, 1992 is a subgenus of Lycaena |Fabricius], 1807
Frequently regarded as a synonym, Alciphronia Kogak, 1992 (type species Papilio alciphron Rottemburg,
1775) stands out in genomic trees as a clade at the subgenus level (Fig. 8, see next section). Hence, we
propose that Alciphronia Kogak, 1992, stat. rest. be treated as a subgenus of Lycaena [Fabricius], 1807.
8
Genera and subgenera of Lycaeninae [Leach], [1815]
Genomic sequencing of representative species of Lycaeninae [Leach], [1815], including the type species
of all available genus group names, gives a comprehensive overview of the subfamily phylogeny (Fig. 8).
The tree is similar to the one we reported previously (Zhang et al. 2020), but now includes more taxa.
Unscaled Z chromosome tree Scaled Z chromosome tree
Genera: Subgenera: Subgenera: Genera:
Boldenaria Boldenaria boldenarum|19079D11|New Zealand|1979 Boldenaria
1 sz, Boldenaria salustius|2006 Een ney. ealand|1971
Boldenaria rauparaha|21079A10|New Zealand|1985
1 Boldenaria feredayi|21079A08|New Zealand|1986
1018F04|PT/New Guinea[1961
: elanolycaena timmontsna[21018E04 PT |New Guinea]1958
9D12|Malaya|1991
Melanolycaena Melanolycaena altimontana Melanolycaena
Heliophorus
Heliophorus (Heliophorus) tamu|22026A05|Nepal|1967
_Heliophorus (Heliophorus) saphir|21018A06|China:Szechuan|1924
Heliophorus pe lennons) EU Yel teabalece als 199
Heliophorus (Heliophorus) kiana|21018F01|Malaysia:Borneo| 1916
py a lll (Nesa) sena|21078D09|India:Kumaon|1990
or Apangea tseng|20039B08|China|2000
1 Apangea pang|21078F07|China:Yunnan|1995
1 Apangea li|2 OES alice HOTA eD 5
Apangea ouang|21078F03|China:Sechuan =,
: Lean (Heodes) aoelides Peery Ve LES Da 998
caena (Heodes) aeolus|21018A10|Afghanistan|1953
ycaena (Heodes) kasyapa|21078 OgtIndia:NE Kashmir|1956
: Lycaena pacers leusei|20039B03|Spain|2003
: Ly€aena (Heodes) tityrus|P are ae es
= Lycaena (Heodes) ottomanus|21078G06|Greece|1996
Heodes Lycaena (Heodes) virgaureae|PAOE09|Switzerland|2017 Heodes
pale Lycaena (Heodes) phoebe|20039B06|Morocco|1992
rs Lycaena (Heodes) thersamon|20039D06|Iran|2004
Lycaena (Heodes) alaica|21078G08|Afganistan|1957
Lycaena (Heodes ochimus|>1078 ssias 4
Heliophorus
Apangea
Lycaena (Heodes) ochimus|21078H05/Iran|2000
Lycaena (Heodes) thetis]21078H04|Turkey|2001
Lycaena (Heodes) lampon|21078H02|Iran
vidal Mt fed solsk b pA SI elt jisia]1992
LyCaena (Heodes) aditya|21078G05|T adjikistan|1992
, Lycaena (Heodes) candens|21078E05|Georgia|1986
Lycaena (Fie0de3) Uy Sold ata ea witzerland|2017
Lycaena Soll ronia) alciphron|20039B10|2000
Lycaena (Alciphronia) cupreus|PAO475|USA:CA,Mono Co.|2017 Tyeden
‘ Puccene tb yea ane) eet 711 21078E1 1 Kavaktist 7972000
caena——. Lycaena (Thersamolycaena) dispar azakhstan —Thersam
Thersamolycaena Lycaena eae moneacie d Slendens|o1G78HOy |Kasakhetan|9987 Thersamolycaena
1
Alciphronia Alciphronia
1
caena
Lycaena . L. (Thersamolycaena) a AME UA CBA, region|1995
Lycaena (Thersamolycaena) odbayar|21078H10|PT|Mongolia|2002
Lycaena (Fussia) standfussi|20039B04|China|2010
ycaena (Fussia) Se eeraea (ee aarp eter 1982
, Lycaena
Lafron) orus|2101 peoy cues Africa|1962 Lafro.
: caena (Lafron) orus|21015G11|South Africa j
al ; Lycaena (Pava) panava|21018B04|India:Shimla|1922
Helleia Lycaéna (Pava) panava|21078F 12|India|1999
~ Helleia Spt ERE Russia:Siberia, Sayans|1970
Helleia helle|21078E10| Eee anand 987
1 Tharsalea (Hyrcanana) caspius|19079E06|Iran
a2) harsalea eanates transiens|20039D03]}Uzbekistan|1999
Hyrcanana ““Tharsalea (Hyrcanana) sarthus|20039D04|Tajikistan|2004 Hyrcanana
Tharsalea ( Cn anS) pamira|21077B10 Hi cron 1991
Tharsalea (Hyrcanana) evansil|21077BO te anistan|2004 _
Tharsalea (Phoenicurusi} margelanica|20 716803) issua:Tien-Shan|1997
Lycaena
Tharsalea (Phoenicurusia) phoenicurus]21016B03}|Iran
Te
T. (Phoenicurusia) dimorphus grea IU 07 jet lcbestoe 8 990 Phoenicurusia
Tharsalea eal eeallpeld cas eitschbergeri|21075CO9|AT|Kyrgyzstan|1992
Tharsalea ( 1997
Tharsalea f
Tharsalea
1
hoenicurusia) Se eet te eo teporenn
PecAcuniey alexandra|21075F11|Kazakhstan|1992
Phoenicurusia) dilutior|21 ils sehr Me iE
Tharsalea (Epidemia) dospassosil17114D1 |Ganada:NB|1983 Tharsalea
Tharsalea Pian) dorcas|190 ei ae
Tharsalea (Epidemia) helloides|19077B11|CA,San Benito Co.|1991
Tharsalea (Epidemia) mariposa|9440|USA:WY,Park Co.|2017
Epidemia
ae pee, nivalis|}6459|USA:CO,Grand Co.|2016
Tharsalea (Epidemia) epixanthe|6686 Paeoa yc cod
Tharsalea {Epiderta) heteronea|9348/USA:WY, Park Co.|2017
Tharsalea (Epidemia) gorgon|PAO346|USA:CA, Santa Cruz Co.|2017
Tharsalea (Epidemia) hyllus|PAO286|USA:CO,Adams Co.|2016
Tharsalea (Chalceria) Pes ear vat 26|USA:WY,Laramie Co.|2016
Tharsalea ee dione|10599|USA:TX,Hemphill Co.|1977
3,1 harsalea (Chalceria) xanthoides|17114D11|USA:CA,Santa Clara Co.|2007
“Tharsalea (Chalceria) editha|PAO60|USA:CA, Sierra Co.|2016 __ Hermelycaena
Tharsalea (Hermelycaena) ene A,San Diego Co.|2011
Tharsalea (Tharsalea) arofa|PAO449|USA:CA,Plumas Co.|2017 Tharsala
, lophanus pyrrhias|2 eeoH ssarpetepts MSS ’
lophanus pyrrhias|17066G11|Guatemala| 1967 lophanus
Chalceria
9.83! Hermelycaena
0.45
Tharsalea
lophanus
Fig. 8. The phylogenetic classification of Lycaeninae. Z chromosome-based tree is shown as unscaled (left, branch lengths
proportional to the estimated number of accepted mutations) and scaled (right, branch lengths adjusted uniformly and with the
same proportion throughout the tree so that the tips are placed at the same level). Specimens are in the same order in both trees
and only one set of names is shown. The subfamily is divided into eight genera: Boldenaria (cyan), Melanolycaena (orange),
Heliophorus (olive), Apangea (purple), Lycaena (blue), Helleia (magenta), Tharsalea (green), and Jophanus (red). Subgenera
are labeled in different shades of colors used for genera. Names of new subgenera are highlighted in orange.
9
We take the lowest (close to the root)
level of most prominent (i.e., longer
compared to others nearby) branches as
the genus level, and the clades
supported by these prominent branches
(at about the same level) are defined as
genera. This approach partitions the
subfamily into eight genera (Fig. 8 and
see the synonymic list below). The next
(closer to the leaves) level of more
prominent branches is taken as the
subgenus level with 12 additional
subgenera defined. Two subgenera are
new (Fig. 8, their names highlighted in
orange) and are described below.
Similar results are obtained by “slicing”
the scaled tree (Fig. 8 right, green line),
except the curious irregularity with
Apangea illustrated in Fig. 9. Apangea
clade (purple) is characterized by
reduced evolutionary rate, nearly two
times slower than that of Heliophorus
(Figs. 8 and 9 olive, the length of “level
of” lines from the root to leaves of each
clade is proportional to the average
evolutionary rate of the clade). Genetic
differentiations within the subgenus
Heliophorus and the genus Apangea are
approximately equal (Fig. 9 unscaled
tree, yellow and magenta shading,
respectively, and “differentiation in”
lines, from the base of each clade to its
leaves). When the tree is proportionally
Apangea
Unscaled Z chromosome tree
Subgenera: Heliophorus (Heliophorus) epicles|19079D12|Malaya|1991
Heliophorus (Hetlophorus) indicus|21078D01|Myanmar]1997
Heliophorus (Heliophorus) kohimensis|21078C stats 1987
Heliophorus (Heliophorus) ila matsumurae|21078D 12|Talwan|1985
Heliophorus (Heliophorus) gional 9079E01|Myanmar|1994
Heliophorus (Heliophorus) oda|21078E02|Nepal|1985
22,,Heliophorus (Heliophorus) eventa|20039B05|China|1006_
1 Heliophorus (Heliophorus) brahma Pr A ea Hills|1987
Heliophorus (Heliophorus) tamu|22026A05|Nepal|1967
_ Heliophorus (Heliophorus) saphir|21018A06|China:Szechuan|1924
Heliophorus M eliophorus) oe TSC OTR Ete ett 199
Heliophorus (Heliophorus) kiana|21018F01 LAG Mele cults 916
09|India:Kumaon|1990
0.78
ale les (Nesa) sena|21078
Apangea tseng|20039B08|China|2000
Apangea pang|21078F07|China:Yunnan|1995
Apangea li|2 Ee eee 5
Apangea ouang|21078F03|China:Sechuan
level of Apangea
level of Heliophorus
@——————_ differentiation in Apangea
SSS SSE
Proportional “stretching”
differentiation in Heliophorus
Scaled Z chromosome trees
Heliophorus (Heliophorus
Heliophorus (Heliophorus
Heliophorus (Heliophorus
Heliophorus (Heliophorus
Heliophorus (Heliophorus
Heliophorus (Heliophorus
Heliophorus (Heliophorus 1a]1006
Heliophorus (Heliophorus |India:Khasi Hills]1987
Heliophorus (Heliophorus) tamu|2 era esl Aaa
Heliophorus (Heliophorus) saphir|21018A0 atc ina:Szechuan|1924
Heliophorus (Heliophorus) yunnani|19079E05|China: Yunnan] 1996
Heliophorus (Heliophorus SE ree ee
Heliophorus Nesa) sena 21078D09|India:Kumaon|1990
Apangea Bane 20039B08|China
2000
Apangea pang/21078F07| hina Vunnan|1995
Apangea |i|21078F09|China:Yunnan|2005
Apangea ouang|21078F03|China:Sechuan
—_———————————__ differentiation in Apangea
@—————_ differentiation in Heliophorus
Preserving the two differentiations
Heliophorus (Heliophorus) epicles]19079D12|Malaya|1991
Heliophorus (Heliophorus) indicus}21078D01 SSL ee
Heliophorus (Heliophorus) kohimensis|21078C etal 1987
Heliophorus (Heliophorus) ila matsumurae|21078D12]T aiwan|1985
Heliophorus (Heliophorus nmar|1994
Heliophorus (Heliophorus | 1985
Heliophorus (Heliophorus) eventa| |1006
Heliophorus (Heliophorus) brahma i
Heliophorus (Heliophorus 1
Heliophorus (Heliophorus
Heliophorus (Heliophorus
Heliophorus (Heliophorus ;
Heliophorus (Nesa 78D09|India:
Apangea tsen oT China|2000
Apangea pang| 1078F07|China: Yunnan|1995
Apangea |i|21078F09|China:Yunnan|2005
Apangea ouang|21078F03|China:Sechuan
e—————_ differentiation in Apangea
e———————_ differentiation in Heliophorus
Fig. 9. Unequal evolutionary rates create obstacles for tree scaling. The
two clades of interest in the Z chr. tree are highlighted in yellow (evolving
faster) and magenta (evolving slower) and marked with green dots.
scaled, i.e., each segment is stretched equally (assuming evolutionary changes were slow all the time,
from the last common ancestor of Apangea with Heliophorus, to the present (=leaves)), genetic
differentiation in Apangea is nearly two times larger than in Heliophorus (Fig. 9, “differentiation in” lines
in “Proportional stretching” tree with yellow and magenta shading highlighted). However, if we assume
that evolution in Apangea was slower only along the branch before the diversification of the genus (from
the last common ancestor of Apangea with Heliophorus to the green point on the purple branch), and
therefore only this branch should be stretched, the result preserves about equal genetic differentiation in
Apangea and Heliophorus (Fig. 9 “differentiation in” lines in “Preserving the two differentiations” tree
with yellow and magenta shading highlighted). If proportional scaling reflects evolutionary events better,
then Apangea may need divisions into subgenera, because genetic differentiation within it (Fig. 9,
highlighted in magenta in the trees) is twice as large as in the subgenus Heliophorus, (Fig. 9, highlighted
in yellow in the trees), and is about the same as the genetic differentiation within the genus Heliophorus
that also includes Heliophorus sena, placed in subgenus Nesa. However, if slower evolution was only
along the basal branch of the Apangea clade, and after the genus started diversifying, evolutionary rates of
Apangea and Heliophorus became approximately equal, then the diversification in Apangea and subgenus
Heliophorus started at about the same time, and there is no need to divide Apangea into subgenera.
We are not able to tell which scenario better corresponds to reality. However, phenotypic
assessment of differentiation would likely follow the unscaled tree, because the number of accepted
10
mutations is loosely correlated with phenotypic change. In the unscaled tree (Fig. 9 top), genetic
differentiation in Apangea is approximately the same as in the subgenus Heliophorus, and visual
phenotypic assessment of Apangea indeed gives an impression of a rather compact genus, not warranting
definition of subgenera. Therefore, we favor the scaling approach that preserves differentiation (Fig. 9
bottom tree) and do not define subgenera in Apangea.
Fussia Grishin, new subgenus
http://zoobank. org/O9D04BA7-B1F0-454A-84A9-087247757B99
Type species. Polyommatus standfussi Grum-Grshimailo, 1891.
Definition. Originates within Lycaena [Fabricius], 1807 (type species
Papilio phlaeas Linnaeus, 1761) as a likely sister of Thersamolycaena
Verity, 1957 (type species Papilio dispar Haworth, 1802), however, is
distant from it, forming a taxon of the same rank (Fig. 8). Distinguished
from its relatives by the following combination of characters: hindwing Oe
rounded, no tail, ventrally overscaled with cream scales, without dark- |)7 em
brown spots present on ventral forewing, but instead with pale-brown spots Fi
. : : ‘ ; : . } ig. 10. Lycaena standfussi from
encircled with white (Fig. 10), dorsal hindwing typically with purple | China: Qinghai, Gyégu Tibetan.
submarginal spots or band, or broadly purple with dark postdiscal spots and Soe oe eee
dark margin. In DNA, a combination of the following base pairs is |_xups:/icreativecommons.orgilicenses/by-ne/4.0/
diagnostic in nuclear genome: cce2291.12.2:A1548G, cce3368.6.2:A816C, cce303125.12.1:A5073G,
cce9657.10.14:G7956A, cce9657.10.31:A51G, and COI barcode: G86A, T232C, T259C, A430T, GS554A.
ge; A lars
Etymology. The name is a feminine noun in the nominative singular, formed from the type species name.
Species included. Only the type species.
Parent taxon. Genus Lycaena [Fabricius], 1807.
Pava Grishin, new subgenus
http://zoobank. org/3A950654-D595-460C-9E02-0E7B40B46B0C
Type species. 7hecla panava Westwood, 1852.
Definition. Originates within Lycaena [Fabricius], 1807 (type species
Papilio phlaeas Linnaeus, 1761) as a likely sister of Lafron Grishin, 2020
(type species of Papilio orus Stoll, 1780), but is distant from it, forming a
taxon of the same rank (Fig. 8). Distinguished from its relatives by nearly
straight contrasting white postdiscal band from costa to inner margin of
gray, black-spotted ventral hindwing (spots encircled by white) between
postdiscal row of black spots and submarginal dark lunules, well-developed
and connected by orange lunules with submarginal row of black spots lined
with brown and then cream-white towards outer margin (Fig. 11). In DNA,
a combination of the following base pairs is diagnostic in nuclear genome:
cce8519.3.3:C297T, cce349.2.3:A1L11G, cce320.8.1:GIS56A, cce2297.24.1: | India: Uttarakhand, Nainital.
T1437C, cce3074.1.4:T202C, and COI barcode: T13C, G77A, G78A, A474G, | cNstratistabservation 67405185.
T 5 6 2€: an d T 5 9 5 C ; https://creativecommons.org/licenses/by-nc/4.0/
Etymology. The name is a feminine noun in the nominative singular, formed from the type species name:
Pa|na]va, or the first two syllables of its unavailable synonym Polyommatus pavana Kollar, [1844].
Species included. Only the type species.
Parent taxon. Genus Lycaena [Fabricius], 1807.
11
Lycaena pseudophlaeas (Lucas, 1866) is a species distinct from Lycaena phlaeas
(Linnaeus, 1761), and Chrysophanus abbottii Holland, 1892 is its subspecies
Genomic tree reveals that the two African
taxa Chrysophanus pseudophlaeas Lucas,
1866 (type locality in Abyssinia) and
Chrysophanus abbottii Holland, 1892 (type
locality in East Africa) currently treated as
subspecies of Lycaena phlaeas (Linnaeus,
1761) (type locality in Sweden) (Fig. 12
red) form a well-differentiated clade sister
to all others (Fig. 12 green). Fst/Gmin
statistics between L. p. pseudophlaeas and
European L. phlaeas are 0.48/0.015, and
their barcodes differ by 2.4% (16 bp).
Therefore, we propose that Lycaena
pseudophlaeas (Lucas, 1866), stat. rest. is
a species distinct from L. phlaeas, and
place C. abbottii as its subspecies forming
Lycaena pseudophlaeas abbottii (Holland,
1892), comb. nov. due to a smaller genetic
differentiation between them: Fs/Gmin of
0.29/0.06, and COI barcode difference of
only 0.3% (2 bp). Nevertheless, as revealed
by Fst/Gmin, divergence in nuclear genomes
between these subspecies is non-trivial, and
additional studies will clarify their status.
— Lycaena phlaeas feildeni|21032D10|Canada:NWT|1950
{is— Lycaena phlaeas feildeni|21032D09|Canada:NWT|1950
Lycaena phlaeas feildeni|20061F05|USA:AK,N Slope Bgh.|1978
Lycaena phlaeas arethusa|20127F03|ST|Canada:Alberta|1903|CMNH
Lycaena phlaeas arethusa|21032D07|Canada:Alberta|2003
Lycaena phlaeas arethusa|17115H04|Canada:Alberta|1987
Lycaena phlaeas weberi|201 ede ME paced Co,|2004
Lycaena phlaeas weberi|20119A06|PT|USA:MT,Liberty Co.|2005
Lycaena phlaeas weberi|20119A04|AT|USA:MT, Liberty Co.|2003
L. phlaeas arctodon|21036A02|HT|USA:MT,Carbon Co.|1973|MGCL
Lycaena phlaeas arctodon|21032D05|USA:WY,Park Co.|1994
Lycaena phlaeas arctodon|20061 Breet heat Co.|1966
1— L. phlaeas shields (& =falpestris)|19062A11|HT|CA,Mono Co.|1960|LACM
sa; Lycaena phlaeas shields|17115HO2|USA:CA,Mono Co.|1994
Lycaena phlaeas shields|20053E01|USA:CA, Inyo Co.|1965
: Lycaena phlaeas hypophlaeas|20061E08|USA:MA,Middlesex Co.|1964
i Lycaena phlaeas hypophlaeas|21032E04|USA:ME,Hancock Co.|1975
UL 0.43
-01
Lycaena phlaeas hypophlaeas|21032C12|Canada:Nova Scotia|1978
Lycaena phlaeas hypophlaeas|20061E11|USA:PA, Butler Co.|1967
Lycaena phlaeas hypophlaeas|21032E01|USA:NJ,Ocean Co.|1982
Lycaena phlaeas hypophlaeas|20061F02|Canada:Quebec|1955
Lycaena phlaeas hypophlaeas|21032E08|USA:KS,Johnson Co.|1958
Lycaena phlaeas hypophlaeas|21032E10|USA:MI,Allegan Co.|1958
-oi_Lycaena phlaeas hypophlaeas|21032D12|USA:MO, Taney Co.|1983
are Lycaena phlaeas hypophlaeas|21032E02|USA:WI,Chippewa Co.|1969
—— Lycaena phlaeas hypophlaeas|21032E06|USA:AR,Madison Co.|1969
= Lycaena phlaeas hypophlaeas|21032E03|USA:TN,Carter Co.|1977
Lycaena phlaeas hypophlaeas|21032E07|USA:OH, Hancock Co.|1989
Lycaena phlaeas hypophlaeas|21032D11|USA:VA,Grayson Co.|1990
Lycaena phlaeas phlaeas|20058E09|Sweden|2007
Lycaena phlaeas phlaeas|PAOE01|France|2017
Lycaena phlaeas phlaeas|17115HO1|Sweden|1984
Lycaena phlaeas phlaeas|20039D02|Spain|1977
Lycaena phlaeas phlaeas|19079D09|Albania|1991
Lycaena phlaeas phlaeas|20055A11 Gieec|2018
Lycaena phlaeas phlaeas|20055E11|Greece|2018
Lycaena phlaeas pseudophlaeas|21079B05|Abyssinia
Lycaena phlaeas pseudophlaeas|21079B06|Abyssinia
Lycaena phlaeas pseudophlaeas|21015G05|Eritrea
Lycaena phlaeas pseudophlaeas|21015G06|Eritrea
Lycaena phlaeas acre 28B11|ST|Tanzania|CMNH
Lycaena phlaeas abbottii]21079B03|Malawi|2005
Lycaena phlaeas abbottii]21015G07|Kenya|1950
Lycaena phlaeas abbottii|21015G08|Kenya|1942
Lycaena phlaeas abbottii]21079B02|Kenya|1981
Fig. 12. Lycaena hypophlaeas (blue), L. phlaeas (red) and L.
pseudophlaeas (green). Name references are labeled in magenta.
Lycaena hypophlaeas (Boisduval, 1852) is a species
distinct from Lycaena phlaeas (Linnaeus, 1761)
The Old (Fig. 12 red) and the New World (Fig. 12 blue) populations currently considered conspecific
under the name Lycaena phlaeas (Linnaeus, 1761) (type locality in Sweden) form two distinct clades and
are genetically differentiated with Fst/Gmin of 0.30/0.065. Although the COI barcodes differ little between
them (0.8%, 5 bp), which is not unusual for species of Lycaenidae, we reinstate Lycaena hypophlaeas
(Boisduval, 1852) (type locality USA: Massachusetts, vic. Boston), stat. rest., which is the oldest name
for the New World populations, as a species, due to its nuclear genomic differentiation. As a result (Fig.
12), the phlaeas group consists of three species: L. phlaeas, L. hypophlaeas, and L. pseudophlaeas.
Revised Lycaeninae genera and subgenera and their available synonyms
Here, we update our previous version (Zhang et al. 2020), refining the placement of Lafron Grishin, 2020
and confirming the placement and synonymy of Phoenicurusia Verity, 1943 by genomic data. Lycaeninae
are classified into eight genera and additional 12 subgenera. Changes to the previous version, except
adjustment to the order of taxa, are in red font. Junior subjective synonyms are preceded by :
unavailable names are not listed. Type species are given in parenthesis with their original genus names.
Genus Boldenaria Zhdanko, 1995 (Lycaena boldenarum White, 1862)
Genus Melanolycaena Sibatani, 1974 (Melanolycaena altimontana Sibatani, 1974)
Genus Heliophorus Geyer, [1832] (=H. belenus Geyer, [1832], which is Polyommatus epicles Godart, [1824])
Subgenus Heliophorus Geyer, [1832] (=H. belenus Geyer, [1832], which is Polyommatus epicles Godart, [1824])
=llerda E. Doubleday, 1847 (Polyommatus epicles Godart, [1824])
12
=Kulua Zhdanko, 1995 (Polyommatus tamu Kollar, 1844)
Subgenus Nesa Zhdanko, 1995 (Polyommatus sena Kollar, 1844)
Genus Apangea Zhdanko, 1995 (Chrysophanus pang Oberthtr, 1886)
Genus Lycaena [Fabricius], 1807 (Papilio phlaeas Linnaeus, 1760)
Subgenus Lafron Grishin, 2020, stat. nov. (Papilio orus Stoll, [1780])
Subgenus Pava Grishin, subgen. n. (Thecla panava Westwood, 1852)
Subgenus Fussia Grishin, subgen. n. (Polyommatus standfussi Grum-Grshimailo, 1891)
Subgenus 7hersamolycaena Verity, 1957 (Papilio dispar Haworth, 1802)
Subgenus Heodes Dalman, 1816 (Papilio virgaureae Linnaeus, 1758)
=Loweia Tutt, 1906 (Papilio dorilis Hufnagel, 1766, which is Papilio tityrus Poda, 1761)
=Thersamonia Verity, 1919 (Papilio thersamon Esper, 1784)
=Palaeochrysophanus Verity, 1943 (Papilio hippothoe Linnaeus, 1760)
=Mirzakhania Kogak, 1996 (Chrysophanus kasyapa F. Moore, 1865)
Subgenus Alciphronia Kogak, 1992 (Papilio alciphron Rottemburg, 1775)
Subgenus Lycaena [Fabricius], 1807 (Papilio phlaeas Linnaeus, 1760)
Genus Helleia Verity, 1943 (Papilio helle Denis & Schiffermiller, 1775)
Genus Tharsalea Scudder, 1876 (Polyommatus arota Boisduval, 1852)
Subgenus Hyrcanana Bethune-Baker, 1914 (Polyommatus caspius Lederer, 1870)
=Sarthusia Verity, 1943 (Polyommatus sarthus Staudinger, 1866)
Subgenus Phoenicurusia Verity, 1943, confirmed status (Polyommatus phoenicurus var. margelanica Staudinger, 1881)
=Athamanthia Zhdanko, 1983, confirmed synonymy (Polyommatus athamantis Eversmann, 1854)
Subgenus Epidemia Scudder, 1876 (Polyommatus epixanthe Boisduval & Le Conte, [1835])
=Hyllolycaena L. Miller & F. Brown, 1979 (Papilio hyllus Cramer, 1775)
=Hellolycaena Kocak, 1983 (=Polvommatus thoe Guérin-Méneville, [1832], which is Papilio hyllus Cramer, 1775)
Subgenus Chalceria Scudder, 1876 (Chrysophanus rubidus Behr, 1866)
=Gaeides Scudder, 1876 (Chrysophanus dione Scudder, 1868)
Subgenus 7harsalea Scudder, 1876 (Polyommatus arota Boisduval, 1852)
Subgenus Hermelycaena L. Miller & F. Brown, 1979 (Chrysophanus hermes W. H. Edwards, 1870)
Genus Jophanus Draudt, 1920 (Chrysophanus (?) pyrrhias Godman & Salvin, 1887)
Satyrium dryope (W. H. Edwards, 1870) is a species distinct from
Satyrium sylvinus (Boisduval, 1852)
Genomic tree of the subgenus Satyrium Scudder, 1876 (type species Lycaena fuliginosa W. H. Edwards,
1861) reveals that Satyrium sylvinus
(Boisduval, 1852) (type locality in
USA: California, Plumas Co.) may be
paraphyletic with respect to Satyrium
californica (W. H. Edwards, 1862)
(type locality in USA: California,
Satyrium sylvinus sylvinus|PAO453|USA:CA, Plumas Co.|2017
Satyrium sylvinus sylvinus|PAO809|USA:CA, Sierra Co.|2018
atyrium sylvinus sylvinus|20069E08|USA:NV, Storey Co.|1981|CSUC
Satyrium sylvinus sylvinus|20069F07|USA:CA,Colusa Co.|1976
atyrium sylvinus nootka|19083E07|HT|Canada:British Columbia|1969|CSUC
Satyrium sylvinus nootka|20069F04|Canada:British Columbia|1972
Napa Co.) (Fig. 13 blue), and the
clade of S. sylvinus with S. californica
consists of three lineages of likely
equivalent taxonomic status (Fig. 13
red, blue, and green), not two. The
divergence of COI barcodes among
the three taxa is low, 0.5—0.6% (3-4
bp). However, it is not uncommon for
closely related Lycaenidae species to
have similar barcodes. For instance,
barcodes of all American Celastrina
Tutt, 1906 (type species Papilio
argiolus Linnaeus, 1758) are identical
to each other, no variation. There is
little doubt that S. californica is a
species distinct from S. sylvinus, and a
similar level of genetic differentiation
Satyrium californica obscurafacies|21035F12|HT|NV,White Pine Co.|1986|MGCL
Satyrium californica obscurafacies|21035G01|AT|USA:NV,White Pine Co.|1983
S. californica obscurafacies (=brashor)|20069G03|USA:WA Kittitas Co.|2010
Satyrium californica californica|21011 i tater be Co.|1966|CMNH
Satyrium californica californica] PAO93|USA:CA, Sierra Co.|2016
atyrium californica cygnus|21011FO1|NT|USA:NV, Storey Co.|1964|CMNH
Satyrium californica cygnus|PAO510|USA:NV,Esmeralda Co.|2017
Satyrium sylvinus putnami|20039H12|USA:UT,San Juan Co.|/2020
22Satyrum sylvinus putnami|20069F 10|USA:CO,Mesa Co.|1991
Free Sic dom sylvinus putnami|20069F 12|USA:NM, Taos Co.|1995
10.41
atyrium sylvinus putnami|20069G02|USA:CO,Chaffee/Lake Cos.|1996
'—— Satyrium sylvinus putnami|20069G01|USA:UT, Uinta Co.|2001
" ym Satyrium sylvinus itys|18036H11|USA:AZ, Yavapai Co.|2007
sg. Satyrium sylvinus itys|201 lates NO tele i Co.|CMNH
Satyrium sylvinus itys|20069F 11|USA:AZ,Coconino Co.|1984
Satyrium sylvinus itys|1 Sota see te rr Co.|1985
laa Dat rium sylvinus dryope|20069F02|USA:CA,Contra Costa Co.|2002
68 atyrium sylvinus dryope|20069E11|USA:CA, Kern Co.|2012
Satyrium sylvinus desertorum|20069F08|USA:CA, Kern Co.|2014
ree Satvraim le HeceereRDOOES FOSJUSA‘CA. Kern Co.|2008
a Satyrium sylvinus megapallidum|21035G04|HT|USA:NV,Elko Co.|1980|MGCL
[hese Satyrium sylvinus megapallidum|21035GO5|AT|USA:NV,Elko Co.|1980
atyrium sylvinus Is rate tt oa 0|USA:CA,Mono Co.|2013
Satyrium fuliginosa|17114E01|USA:CA, Plumas Co.|2012
Satyrium semiluna|PAO89|USA:CA, Sierra Co.|2016
atyrium acadica|17114E02|USA:OH, Portage Co.|1998
Satyrium edwardsii|17114E03|USA:NJ ,Sussex Co.|1971
Satyrium at rare 8014C09|USA:0H,Guemsey Co.|1982
Satyrium calanus|8691|USA:TX,Denton Co.|2017
Fig. 13. Satyrium sylvinus (red), Satyrium californica (blue), and Satyrium
dryope (green). Reference specimens for the names are labeled in magenta.
between northwestern (Fig. 13 red, includes nominal S. sy/vinus) and southeastern (Fig. 13 red) groups of
13
populations currently associated with S. sy/vinus as that between S. californica and either of these groups
of populations suggests that they represent two species, not one, with S. californica being the third. The
oldest available name for the southeastern group of populations is Thecla dryope W. H. Edwards, 1870
(type locality in USA: California, Santa Clara Co.). Therefore, we propose it is a species-level taxon
Satyrium dryope (W. H. Edwards, 1870), stat. rest. We sequenced representatives of all valid names
associated with the S. sy/vinus complex (Fig. 13, reference specimens labeled in magenta), and on the
basis of genomic analysis assign the following taxa to S. dryope as its subspecies: Thecla putnami Hy.
Edwards, 1877 (type locality USA: Utah, Mt. Nebo), Satyrium sylvinus megapallidum Austin, 1998 (type
locality USA: Nevada: Elko Co., Elko), Thecla itys W. H. Edwards, 1882 (type locality USA: Arizona,
Yavapai Co., Prescott), and Strymon sylvinus desertorum F. Grinnell, 1917 (type locality USA:
California, Kern Co., Oak Creek). Only Satyrium sylvinus nootka M. Fisher, 1998 (type locality in
Canada: British Columbia, Vancouver Island) remains a subspecies of S. sylvinus.
Shijimiaeoides Beuret, 1958 is a junior subjective synonym
of Glaucopsyche Scudder, 1872
The phylogenetic tree constructed from protein-coding regions of autosomes in the nuclear genome places
Shijimiaeoides Beuret, 1958 (type species Lycaena barine Leech, 1893, which is a synonym or subspecies
of Lycaena divina Fixsen, 1887) (Fig. 14 magenta) deep within Glaucopsyche Scudder, 1872 (type
species Polyommatus lygdamus E. Doubleday, 1841) (Fig. 14 red) and near the type species of the genus
and its closest relatives. COI barcodes of S. divina and G. lygdamus are only 2.4% (16 bp) different, the
difference characteristic of species most closely related to each other. Therefore, we most confidently
place Shijimiaeoides Beuret, 1958 as a junior subjective synonym of Glaucopsyche Scudder, 1872.
' i‘ . : ‘ = Glaucopsyche lygdamus|16106E04|USA:MN,Lake Co.|2016
Micropsyche Mattoni, 1981 is a junior x3 Glaucopsyche alexis|20058D08|Sweden|2007
é . Shijimiaeoides divina|22027G10|Japan|1972
subj ective synonym of Turanana Glaucopsyche melanops|22027G11|Spain|1983
Glaucopsyche piasus|9559|USA:UT, Davis Co.|2017
Bethune-Baker, 1916 Scoiitantides seeacipia lie aaa race
Praephilotes anthracias|22027F07|Turkmenistan|1965
Philotes sonorensis|17114F05|USA:CA, Tulare Co.|2015
lolana iolas|22027F08|Greece|1959
Turanana cytis|22027F01|Afghanistan|1963
Micropsyche ariana|22027F03|Afghanistan|1973
Genomic phylogeny places monotypic genus
Micropsyche Mattoni, 1981 (type species
Micropsyche ariana Mattoni, 1981) as sister to
Turanana Bethune-Baker, 1916 (type species
Lycaena cytis Christoph, 1877) (Fig. 14 olive and
blue). COI barcodes of M. ariana and Turanana
cytis differ by only 3.2% (21 bp), the difference
typical for closely related species. Therefore, we
propose to treat Micropsyche Mattoni, 1981, syn.
nov. as a junior subjective synonym of Turanana
Bethune-Baker, 1916.
Pseudophilotes baton|22028A12|Germany|1975
Maculinea alcon|22028C12|Italy|1972
Euphilotes enoptes enoptes|PAO65|USA:CA , Sierra Co.|2016
Uranothauma nubifer|22027B08}Tanzania|1952
Cacyreus marshalli|20055B06|Greece|2018
Lampides boeticus|20055G01|Greece|2018
Cyclyrius webbianus|22027C03|Spain|1967
Leptotes pirithous|20035A12|France|2018
Leptotes cassius theonus|10266|Jamaica|2017
Leptotes marina|8703|USA:TX,Randall Co.|2017
Fig. 14. Genera Glaucopsyche (red, includes Shijimiaeoides,
magenta), Turanana (blue, includes Micropsyche, olive) and
Leptotes (green, includes Cyclyrius, orange).
Cyclyrius Butler, 1897 is a junior subjective synonym
of Leptotes Scudder, 1876
Despite its unusual wing patterns, Cyclyrius Butler, 1897 (type species Polyommatus webbianus Brullé,
1839) clusters closely with Leptotes Scudder, 1876 (type species Lycaena theonus Lucas, 1856, which is a
subspecies of Papilio cassius Cramer, 1775) (Mérit et al. 2017), and together they form a longer branch in
the tree, indicating elevated evolutionary rates compared to their relatives (Fig. 14 orange and green). COI
barcodes of Cyclyrius webbianus and Leptotes cassius theonus differ by 4.6% (30 bp), which is not an
uncommon difference for closely related congeners. Therefore, we confirm Cyclyrius Butler, 1897 as a
junior subjective synonym of Leptotes Scudder, 1876, as it was treated by Eliot (1973).
14
Family Riodinidae Grote, 1895 (1827)
Apodemia cleis (W. H. Edwards, 1882), reinstated status
A genomic comparison of specimens from Arizona that includes the lectotype of Lemonias cleis W. H.
Edwards, 1882 (type locality in USA: Arizona, Graham Co.) currently considered a subspecies of
Apodemia zela (Butler, 1870) (type , Apodemia zeta cleis/8217|USA'AZ Santa CruzCo[2017
locality “Venezuela” and Mexico) with Sy at cere a
specimens from Mexico that includes a |p): Pearle i cero eat
syntype of Emesis zela aureola Stichel, a apodemia arnacis|18043E07 S| |Mexico:Colima|MENB
1926 (type locality in Mexico: Vera- Apademia ares|1/1 14H01]USA.NM Hidalgo Co, [1991
cruz), currently considered a junior Fig. 15. Apodemia cleis (red, above) and Apodemia zela (blue, below).
subjective synonym of Apodemia zela Primary type specimens are labeled in corresponding colors.
zela, reveales particularly strong genetic differentiation between the two groups (Fig. 15): Fst/Gmin
statistics are 0.6/0.003 and the COI barcodes between the primary type specimens differ by 6.2% (41 bp).
Therefore, we reinstate the US taxon as a species Apodemia cleis (W. H. Edwards, 1882), stat. rest.
Mesenopsis Godman & Salvin, 1886 is a junior subjective synonym
of Xynias Hewitson, 1874
Correcting a mistake made in Zhang et al. (2021), we state that Mesenopsis Godman & Salvin, 1886 is a
junior subjective synonym of Xynias Hewitson, 1874. These two names were swapped in Zhang et al.
(2021), and this error is corrected here to follow the priority of the two names (1874 vs. 1886). The
arguments for their synonymy are the same as presented previously (Zhang et al. 2021). We are grateful
to Gerardo Lamas for kindly informing us about this error.
Family Nymphalidae Rafinesque, 1815
Aremfoxia Real, 1971 is a subgenus of Epityches D'Almeida, 1938
Genomic analysis of rarely encountered Aremfoxia Real, 1971 (type and the only species Leucothyris
ferra Haensch, 1909, but see below) in the
Aremfoxia ferra ferra|21063B08|Peru:Junin|2002
Genera:
: : : : Aremfoxia ferra thyridiana|21113H04|Peru:Marcapata
context of its relatives (Fig. 16, the tree built Epityches *‘Aremfoxia ferra thyridiana|21063B10|Bolivia:La Paz|2002
from 7, chromosome-encoded genes) reveals Aremfoxia ferra thyridiana|21063B09|Bolivia:La Paz|2002
A i : ; . Epityches eupompe|19098A12|Brazil:RJ|1995
close relationship with Epityches d'Almeida, Napeogenes rhezia adulta|19098B04|Guyana|2000
: : : Napeogenes peridia hemimelaena|19098B03|Panama|1976
1938 (type and the only species Tritonia Hypothyris ninonia pellucida|19098B07|Guyana|2000
eupompe Geyer, 1832). COI barcodes of the Sidr eames Cae a aac
Aremfoxia ferra and Epityches eupompe ; Pagyris priscilla|21017D12|PT|Bolivia|1955
. 0 . : Pagyris cymothoe|19097H07|Peru|2000
differ by 4.6% (30 bp), which is rather small Placidina euryanassa|19097HO9|Brazil:RJ|1995
Ithomia drymo|19097H05|Brazil:RJ|1996
Ithomia lthomia iphianassa|19097H06|Colombia|1972
provided that these closely related genera are Fig. 16. Genera Epityches (red, includes Aremfoxia) and Pagyris
monotypic (but see below), we feel that it is (blue, includes Placidina) among others, shown in different colors.
difference even for congeners. Furthermore,
Yellow highlight illustrates genetic differentiation in some genera.
more informative for the users of taxonomic
classification to reflect the close evolutionary connection between them through the common genus name,
rather than keeping them in separate genera. However, taking into account phenotypic differences
between these two species (A. ferra and E. eupompe), e.g., in wing shape and venation, instead of
synonymizing Aremfoxia, we propose to treat it as a subgenus of Epityches.
Placidina D' Almeida, 1928 is a subgenus of Pagyris Boisduval, 1870
Genomic phylogeny reveals that a monotypic genus Placidula d'Almeida, 1922 (type species /thomia
euryanassa C. Felder & R. Felder, 1860) is closely related to Pagyris Boisduval, 1870 (type species
15
Ithomia ulla Hewitson, 1857) (Fig. 16, Z chromosome tree). COI barcodes of Placidula euryanassa differ
from those of Pagyris cymothoe (Hewitson, 1855) and Pagyris ulla by 8.2% (56 bp) and 9% (59 bp),
respectively. This is a moderately large difference for congeners that is more than expected from their
nuclear genome differentiation (Fig. 16 blue). This differentiation between Placidula and Pagyris (Fig. 16
yellow highlight on the blue clade) is smaller than that of other related genera such as /thomia Hiibner,
1816 (type species /thomia drymo Hiner, 1816) (Fig. 16 yellow highlight on the green clade) and
Hypothyris Hiibner, 1821 (type species Neréis ninonia Hiibner, [1806]) (Fig. 16 yellow highlight on the
magenta clade). We believe that monotypic genera should be reserved for species that are particularly
distinct from others genetically and do not have phenotypically apparent relatives, thus stressing
uniqueness of such species. Therefore, we propose that Placidina D'Almeida, 1928 is a subgenus of
Pagyris Boisduval, 1870. We do not consider them synonymous due to phenotypic differences, most
notably more extensively scaled wings in Placidina. However, it is not unprecedented for congeners to
differ in the amount of scaling, e.g., in Olyras Doubleday, 1847 (type species Olyras crathis Doubleday,
1847) and Hyalyris Boisduval, 1870 (type species /thomia coeno Doubleday, 1847).
Epityches thyridiana (Haensch, 1909), new combination and new status
Proposed by Haensch as a form (i.e., subspecies) from Bolivia of concurrently described Leucothyris
ferra Haensch, 1909 (type locality in southern Peru) and kept at this status since, thyridiana exhibits 2.4%
(16 bp) difference in COI barcode from the nominotypical subspecies. Augmented with clear phenotypic
differences between ferra and thyridiana mentioned by Haensch (1909) that likely stem from nuclear
genome differentiation (Fig. 16), this barcode difference suggests that it is a species-level taxon Epityches
thyridiana (Haensch, 1909), comb. nov., stat. nov.
-Argynnis mormonia washingtonia|18069B11 Seaver ‘WA, ei Co.|USNM
° ° ° Argynnis mormonia artonis|21096CO9|LT|USA:NV,Elko Co.|C
Argynnis bischoffii W. H. sd sae Soda et euro 20 czscory USALCO Par — Co. ae
7 \ rgynnis mormonia luski ac
A. mormonia opis (=jesmondensis)|O1 506C06|H canada C|1937|CNC
Edwards, 1870 is a species ae Argynnis sel ennna|21023b02|SA.OR, Crook Co. i984 on
sae . rgynnis mormonia opis anada:British Colombia
distinct from Ar gynnis Aarne mormonia washington 1034E 05154 WA,Okanagan Co.|2001
° ° G76 Argynnis mormonia o Sie ater el LT|Canada: eh eget ekee
mormonia Boisduval, 1869 20 Argynnis mormonia bischoffi20126B08)NT|USA:AK|CMN
a. Argynnis mormonia bischoffii|21057D01|USA:AK, Tal eotnal1974
gy |
lace coe mormonia aie tela’! 907 2603| tes Pact testa Coj1984
i rgynnis mormonia kimimela ennington Co.
We obtained whole genome shotgun = Argynnis Hae kimimela/21081 B02 StoWT|SSA WY ra 87 on
i bot mormonia eurynome (=clio eton Co.
ee ee aed = hs mormon caz 102400 USA GR ook oi
available names currently associated ra ll ston) 2102 SCS NV,Eko Co1959
; : : ; rgynnis mormonia kimimela ioux Co
Te SC a saa 2 — yp emanate evCzsCTIUSANY EROCOFNEG
1869 (type locality probably in USA: i A.m. rank ral C franverensi) 1GO44B02 es ec aenens: |AMNH
rgynnis mormonia luski ite Mtns
Dee Oe ger Wee Sy mee ecete ae
. ae rgynnis edwardsii ear Creek Co
mormonia kimimela Marrone, "ita > argynn er zraescn2 USA:CO.Las eae \1997
; ; 0 O26 rgynnis edwardsii adison Co
Spomer & J. Scott, 2008, which 1S f o " Argyis edwards A 218/USA: CO.Lanmer Co, (20 a ion
: on a dwardsii|19069B08|
represented by a specimen within 10 «== argynnis edwardsil 9000809 1USA:MT.Stilwater Co.|1985
: : : ; aa Argynnis mormonia mormonia|18069B04|LT|USA:?NV,Washoe Co.|USNM
miles from its type locality USA: : Argynnis mormonia mormonia (-arge)/18041808]L T|USA. ieee
Argynnis mormonia mormonia ulare Co
South Dakota, Lawrence Co., Terry == V equine icenonia i eoeale i aa JUSA:CA Mono Co/1985|LACM
: ; 7—7— Argynnis mormonia obsidiana ono Co
Peak—complemented with at least a Argyinis mormoria cbiana| 1057004 TUSA :CA,Mono Co. 2011
5 Argynnis diana|9190|USA:AR, Polk Co.|2017
one specimen collected more 3 Argynnis nokomis|18062B01 |USA:NM, avn Co.|1978
a Argynnis cybele cott Co
recently for each name that is : Astonnis ayes 9433|USA:WY, Park Co.|2017
. . Argynnis adiaste|/19051HO9|USA:CA, Santa Cruz Co.|1959
considered valid by Pelham (2022). - Argynnis faseae US ai ars oo 2017
: nf ¢ rgynnis egleis avis Co
A phylogenetic tree constructed from 68 ae ig nnis irene|21068C08|USA:CA, Sierra Co.|1987
t 4 di . f th 7 } _Argynnis espris T8301) ae pee ae Co.|1973
r In- in region 7 rgynnis atlantis anada:Ontario
Sega iad 8 Gone ea ¢ ; Arynis roa AOQ143 Usa WY,Goshen Co. ‘ak
chromosome reveals. that Argynnis Pe abe zerene|9626|USA:OR,Umatilla Co.|201
Argynnis aphrodite|PAO220|USA: CO,Larimer Co.|2016
; 1 Argynnis nausicaa|11628|USA:AZ, Greenlee Co.|2018
ME eA (Fig. 17 red and blue) May. oh pa idole) 7115A 04|USA:CO, kit ante Co.|1987
be paraphyletic with respect to Fig. 17. Argynnis bischoffii (blue), A. mormonia (red), and A. edwardsii
Argynnis edwardsii Reakirt, 1866 | (green). Specimens used as references for the names are labeled in magenta.
16
(type locality in USA: Colorado) (Fig. 17 green), and if not (the support values are low, suggesting
incomplete lineage sorting and/or gene exchange), then simply partitions this complex into three lineages
of comparable genetic differentiation (Fig. 17 blue, green, and red) with Fs/Gmin statistics of 0.32-
0.4/0.02—0.04. Therefore, these three lineages are likely to be species-level taxa: A. edwardsii (hardly
anyone would question its distinctness), A. mormonia, and the third is Argynnis bischoffii W. H. Edwards,
1870, stat. rest. (type locality USA: Alaska, Kodiak), which is the oldest name in the blue clade (Fig. 17).
Because our genetic analysis included primary types of nearly all available names, we are able to
confidently assign the synonymy in the A. mormonia complex (Fig. 17) and place the following 7 taxa
treated as valid by Pelham (2022) as subspecies of A. bischoffii: Argynnis opis W. H. Edwards, 1874 (type
locality in Canada: British Columbia), Argynnis bischoffi [sic] washingtonia W. Barnes & McDunnough,
1913 (type locality in USA: Washington, Pierce Co.), Argynnis eurynome var. erinna W. H. Edwards,
1883 (type locality USA: Washington, Spokane Co.), Argynnis (Speyeria) mormonia kimimela Marrone,
Spomer & J. Scott, 2008 (type locality in USA: South Dakota, Lawrence Co.), Argynnis eurynome W. H.
Edwards, 1872 (type locality in USA: Colorado, Park Co.), Argynnis artonis W. H. Edwards, 1881 (type
locality in USA: Nevada, Elko Co.), Argynnis eurynome luski W. Barnes & McDunnough, 1913 (type
locality in USA: Arizona, White Mts.). Only Speyeria mormonia obsidiana J. Emmel, T. Emmel &
Mattoon, 1998 (type locality in USA: California, Mono Co.) remains a subspecies of A. mormonia.
Argynnis leto Behr, 1862 is a species distinct from Argynnis cybele (Fabricius, 1775)
Genomic comparison strongly supports monophyly of taxa currently placed as subspecies of Argynnis
cybele (Fabricius, 1775) (type locality USA: New York City), but partitions them into two distinct groups:
western and eastern (Fig. 18 red and blue). Fst/Gmin statistics of 0.34/0.068 suggest species-level status of
these groups. Specimens that have the appearance of “intergrades” between the two groups (Fig. 18
labeled in cyan) from the localities where the two species may meet, are confidently assigned to one of
the clades and do not fall between the clades as hybrids would. Nevertheless, the “cybele leto intergrades”
from USA: MT, Liberty Co. are — Argynnis cybele pugetensis|19044A12|HT|USA:WA, Mason Co.|AMNH
placed near the base of the red re aynnia cybele Gugetensis|2 1082HOQ]USA:WA. Thurstan Co,|1984
clade (Fig. 18). While they 7 Argyns cybeleeieenae| 180 : MAT USACA Humboldt 6.|1967|LACM
confidently belong to this clade as “RXynnis-cybele elleenae|2 10576 1OJUSA.CA Humboldt Co,|1965
(statistical support of 1, the most 15 Argynits cybele letol9691USA-OR Umatila Co|2017
Argynnis cybele leto|PAO463|/USA:CA,Plumas Co.|2017
confident value), they appear to “Argynnis cybele donaltoG4gAOSINTIUSACUT alt Lake Co,|AMNH
Qj.1
|
: : 0.98f | 2 cybele letona (=valesinoidesalba)|18055C12|HT|UT, Utah Co.|1912|MFNB
have some genome regions »-23'“Argynnis cybele ctona|961S]USAUT Dans Co. 5011
introgressed from the blue clade. _ Ay ynnis cybele tote |2 1036 FOVUSA'MT Raval Co|2017
Due to genetic differentiation of 3 AM a als ee en rade! SAM Lincoln Co 2018 Co.|2009
MISO), BEOU Bs AN GatllcAa OILY tO mM Argyhns cybele Ito intergrade|21095H02|USAIMT Blaine Co|2018
SORMIG CHU eee steHas Dec UMEDSEOL | eS Argynrie cybele pseudocarpenter|21022"01|CanadaMantoba| 1967
intermediate phenotype to one Argynnis cybele pseudocarpenteri|2 1095F 12|Canada:Saskatchewan|1980
rgynnis eyDe e pseudocarpenteri|21095G02|USA:MT, Daniels Co.|1985
of the groups, we propose to Argynnis cybele pseudocar eel 1095G03|USA:MT,Roosevelt Co.|1985
vie Argynnis cybele krautwurmi|19072E11|USA:MI,Baraga Souler
treat these groups as distinct t— Argynnis cybele novascotiae|21022A01|Canada:Quebec|1965
A : Argynnis cybele novascotiae|01506 eee S|1934|CNC
species. The blue clade (Fig. 18) Argynnis cybele novascotiae|21022A02|USA:ME. roostook Co.|1965
; Argynnis cybele carpenterii|20126C08|LT|USA:NM, Taos Co.|CMNH
retains the name A. cybele, and Argynnis cybele krautwurmil|19072E07|USA:MI,Mackinac Co.|2018
rgynnis cybele krautwurmi|21017E07|HT|USA:MI,Mackinac Co.|1905|CMNH
the oldest name for the red clade Argynnis cybele cybele|4277|USA:IN, Montgomery Co.|2015
: ’ Argynnis cybele cybele|4298|USA:IN, Newton cara
is Argynnis leto Behr, 1862, 3 Argynnis cybele cybele|9191|FUSA:AR, Scott Co.|2017
; Argynnis cybele cybele|9192|USA:AR, Polk Co.|2017
stat. rest. that we consider a Argynnis cybele charlottii|1 8069A08|HT|USA:CO, Garfield Co.|USNM
: Argynnis cybele charlottii|19072HO9|USA:CO, Delta Co.|1968
species-level taxon. Due to Argynnis cybele charlotti{19072HO5|USA-UT San Juan Co,|2015
h : f ire: Argynnis cybele charlottii|20045H10|USA:UT,San Juan Co.|2020
comprenensive coverage oO Argynnis epee charlottii Faeroe Beane One eines neste
: : : : Argynnis cybele carpenterii|21 1 :NM,Sandoval Co.|1
valid taxa in this complex (Fig. B covnnic cytele ca pentert 21022611 |USA.NM Sandoval Co.|1983
18), we confidently assign the Fig. 18. Argynnis leto (red) and Argynnis cybele (blue). Specimens used as
following as subspecies of A. | references for the names and those that look like intergrades are labeled in magenta
leto: Speyeria cybele letona dos and cyan, respectively. A. cybele neomexicana ssp. n. is shown 1n olive color.
Passos & Grey, 1945 (type locality USA: Utah, Salt Lake City, City Creek Canyon), Speyeria cybele
pugetensis F. Chermock & Frechin, 1947 (type locality USA: Washington, Mason Co.), and Speyeria
cybele eileenae J. Emmel, T. Emmel & Mattoon, 1998 (type locality in USA: California: Humboldt Co.).
All other subspecies considered valid by Pelham remain with A. cybele. Interestingly, New Mexican and
Colorado populations are A. cybele, although they are separated from eastern populations by a larger gap
in the distribution than from A. /eto.
Acidalia leto valesinoides-alba Reuss, [1926] and Acidalia nokomis valesinoides-alba
Reuss, [1926] are infrasubspecific names and are unavailable
Acidalia leto valesinoides-alba Reuss, [1926] and Acidalia nokomis valesinoides-alba Reuss, [1926] were
proposed in the following sentence by Reuss ([1926]): “Die 99 gehéren zu den extremsten valesina -
Formen, und benenne ich die weiBen bis gelblichweiBen und schwarzen 29 als leto valesinoides-alba m.
und nokomis valesinoides-alba m., Typen im Berliner Museum”, which we translate as: “The 299 belong
to the most extreme valesina - forms, and I name the white to yellowish-white and black 99 as leto
valesinoides-alba m|ihi] and nokomis valesinoides-alba mihi], types in the Berlin Museum.” No other
mention of these names was made. Reuss states explicitly that he names females of a particular color
variation that spans species boundaries, and names them using the same epithet (would be homonyms if
available) for both species (/eto and nokomis), like the name “alba” that applies to white form females of
various Colias [Fabricius], 1807 species. Reuss refers to individual variation in females, not to
subspecies. In the same work, Reuss ([1926]) also named a subspecies, listing it as “castetsoides n. ssp. T.
R&.”, and referred to “valesina-Formen der Weibchen” [valesina-forms of females] in contrast to that.
The content of Reuss’ work unambiguously reveals that these female form names were proposed for
infrasubspecific entities, and, according to the Art. 45.6.4. of ICZN Code (1999), may be unavailable.
These two names were not adopted as valid for species or subspecies, and were only listed in synonymy,
so Art. 45.6.4.1. does not apply. Therefore, Acidalia leto valesinoides-alba Reuss, [1926] and Acidalia
nokomis valesinoides-alba Reuss, [1926] are infrasubspecific names and are unavailable.
Acidalia leto valesinoides-alba Reuss, [1926] is Argynnis leto letona (dos Passos &
Grey, 1945) and not Argynnis leto leto Behr, 1862
Genomic analysis of the specimen selected as the “holotype” Acidalia (Semnopsyche) leto valesinoides-
alba Reuss, [1926] (type locality not stated, NVG-18055C12 2 in MFNB labeled from Provo, Fig. 19)
ae a aor oe DNA sample ID
VOTES HOES | AVICy sample ID:
9b 7 Reuss fi NVG-18055C12
$26. Type c/o Nick V. Grishin
Fig. 19. “Holotype” of Acidalia leto valesinoides-alba Reuss, [1926], NVG-18055C12, dorsal (left) and ventral (right) views
with labels. All images are to scale except the locality label (with “Provo”) that 1s reduced, and its scale is shown above it.
18
places it among specimens of Argynnis leto letona (dos Passos & Grey, 1945) (type locality USA: Utah,
Salt Lake City, City Creek Canyon) (Fig. 18) in agreement with its label data and implying that it is not
synonymous with Argynnis leto Behr, 1862 (type locality Nevada, nr. Carson City) as currently treated.
Therefore, infrasubspecific name A. /. valesinoides-alba Reuss, [1926] should be listed among unavailable
names associated with Speyeria leto letona dos Passos & Grey, 1945. The “type locality” of A. 1
valesinoides-alba is USA: Utah, Utah County, Provo according to the label of its “holotype”. Quotes are
used here because unavailable names do not formally have holotypes or type localities.
Argynnis cybele neomexicana Grishin, new subspecies
http://zoobank.org/DBD207B7-4FC2-4A 90-B42E-5ED6ECS58A 1E0
(Figs. 18 part, 20 part, 21, 22)
Definition and diagnosis. Sequencing of the lectotype
of Argynnis cybele carpenterii W. H. Edwards, 1876
(NVG-20126C08, labeled from “top Taos Mtn NM”)
reveals that it is not grouping in the tree (Fig. 18) or eee
PCA analysis (Fig. 20) with the specimens we °
sequenced from New Mexico or even Colorado and anf?” krautwurmi
Utah, and therefore does not belong to the north-central oe tee
New Mexican populations, contrary to the current . -
: - Fig. 20. PCA analysis of Argynnis cybele: carpenterii
understanding. Instead, the Argynnis cybele carpenterit Icetatspestniaeeniaancomencanncapeny (olive).
lectotype is placed within more eastern specimens from | charlottii (green), cybele (purple), and others (shades of
the US and Canada, and we hypothesize that it was | blue), carried out as described in Cong et al. (2021).
either mislabeled, or the Taos Peak population (which we have not sequenced) is the southernmost
remnant of northeastern A. cybele. In either case, the New Mexican subspecies referred to as A. c.
carpenterii (Fig. 18 olive) is left without a name, which is proposed here. This new subspecies is similar
in appearance to Argynnis cybele charlottii W. Barnes, 1897 (type locality USA: Colorado, Garfield Co.,
Glenwood Springs) but is genetically distinct from it, and can be distinguished by typically larger silver
spots on ventral hindwing (especially in males compared to typical males of A. c. charlottii), narrower
cream band between postdiscal and submarginal rows of silver spots, silver spots at forewing apex
beneath (usually), and less prominent dark overscaling at wing basal halves above (Figs. 21, 22).
®¢ charlottii
pseudocarpenteri @ @ carpenterii |lectotype
Barcode sequence of the holotype: Sample NVG-21022E12, GenBank OP23 1465, 658 base pairs:
GACTTTATATTTTATTTTTGGGATTTGAGCAGGAATAGTAGGAACATCATTAAGTTTATTAATTCGAACTGAATTAGGTAACCCAGGGT CACTAATTGGAGATGATCAAATTTACAATACT
ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAACTGATTAGTCCCCCTAATATTAGGAGCTCCAGATATAGCTTTCCCCCGTA
TAAACAATATAAGATTTTGACTTTTACCCCCATCCTTAATTTTACTTATTTCTAGAAGAATT GTAGAAAATGGAGCAGGAACAGGATGAACAGTATACCCCCCTCTTTCTTCTAATATTGC
CCATAGAGGTTCTTCAGTAGATTTAGCAATTTTCTCTTTACATTTAGCAGGAATTTCTTCTATTT TAGGAGCAATTAACTTTATTACAACAATTATTAATATACGAATTAATAGAATATCT
TTTGATCAAATACCATTATTTGTGTGAGCAGTAGGAATCACAGCCTTACTTCTTTTACTATCTTTACCAGTTTTAGCAGGAGCTATTACAATACTTTTAACTGATCGTAATTTAAATACTT
CTTTTTTTGACCCTGCAGGAGGAGGAGACCCTATTTTATACCAACATTTATTT
Fig. 21. Holotype of Argynnis cybele neomexicana ssp. n. dorsal (left) and ventral (right) views, data in text.
19
Type material. Holotype: ¢ in the C.P. Gillette Museum of Arthropod Diversity, Colorado State
University, Fort Collins, CO, USA (CSUC), bears four rectangular printed labels: three white [ 9-VII-83
leg. RWH 8900’ | Dome Lookout,St.Peter’s | Dome, E. slope, Jemez | Mts., Sandoval Co., NM ], [ 14877
RWH | S. cybele | carpenteri |, [ DNA sample ID: | NVG-21022E12)| c/o Nick V. Grishin ], and one red
[ HOLOTYPE < | Argynnis cybele | neomexicana Grishin ]. It was collected by Richard W. Holland.
Paratype: 6 NVG-21022E11 USA: New Mexico, Sandoval Co., S slope of Jemez Mts., 4 mi down
Bland Canyon from Bland, elevation 6500", 9-Jul-1983, leg. Richard W. Holland.
Type locality. USA:
New Mexico, Sandoval
Co., E slope of Jemez
Mts., Saint Peter's Dome,
Dome Lookout, elevation
8900".
Etymology. The name is
given for the type
locality that is in New
Mexico. The name is a
feminine adjective.
Distribution. North-
central New Mexico and Fig. 22. Argynnis cybele neomexicana ssp. n. from USA: New Mexico, Sandoval Co.
southwestern Colorado. iNaturalist observations 73138385 (left), 73138564 (right). © Ken Kertel, CC BY-NC 4.0 https://creativecommons.org/licenses/by-ne/4.0/
Argynnis cybele carpenterti W. H. Edwards, 1876 is from northeastern populations
“Taxonomists should not name anything pseudo-. Nearly every one of those named
recently [also in Callophrys & Colias| has become embroiled in_ disputes.”
James A. Scott (2014)
The genomic analysis reveals that the lectotype of Argynnis cybele carpenterii W. H. Edwards, 1876 (type
locality USA: New Mexico, Taos Co., Taos Peak, possibly mislabeled) is close to the three closely related
and therefore questionably distinct subspecies: Argynnis cybele krautwurmi W. Holland, 1931 (type
locality in USA: Michigan, Mackinac Co.), Argynnis cybele novascotiae McDunnough, 1935 (type
locality in Canada: Nova Scotia), and Argynnis cybele pseudocarpenteri F. Chermock & R. Chermock,
1940 (type locality Canada: Manitoba, Sand Ridge), but is somewhat distant from each of them (Figs. 18,
20). Sequencing of specimens from additional localities will clarify the origins of A. c. carpenterii, which
we presently regard as subspecies distinct from the other three due to genetic differences.
Boloria myrina (Cramer, 1777) is a species distinct from
Boloria selene ({Denis & Schiffermiiller], 1775)
Genomic sequencing of Boloria selene ({Denis & Schiffermiiller], 1775) (type locality Austria: Vienna)
Specimens from across its range reveals two Boloria selene myrina|20053F05|USA:NH, Gratton Co.|2001
Odd ; Boloria selene atrocostalis|21022E08|Canada:Manitoba|1976
distinct clades, which correspond to the Old Boloria selene albequina|21068A1 1|Canada:NWT|1964
and the New World groups of populations Boloria selene terraenovae|21068B05|Canada:Newfoundland|197$
: : ‘ Boloria selene nebraskensis|21057A06|USA:NE, Douglas Co.|1984
(Fig. 23, Z chromosome). The high genetic #8 Boloria selene sabulocollis|21057A05|USA:NE, Sheridan Co.|1984
: Tots Boloria selene tollandensis|21022E03|USA:CO,Larimer Co.|1973
differentiation between the clades, low gene Boloria selene selene|21062E 10|Hungary|1979
exchange (Fst/Gmin of 0.48/0.01), and COI Bone oor deed tet weep aa ee
‘ oloria selene selene|21062E11|Hungary|1979
barcode difference of 3.3% (22 bp) suggest Boloria selene selene|19093H10|Austria
that the two clades represent two species The Boloria selene selene|PAOE44|Germany:Bavaria|2017
Fig. 23. Boloria myrina (red, top), and B. selene (blue, bottom).
oldest available name for the New World
species is Boloria myrina (Cramer, 1777), stat. rest. (type locality in USA, probably southeastern New
York) and all North American taxa currently attributed to B. selene become subspecies of B. myrina.
20
Melitaea sterope W. H. Edwards, 1870 is a subspecies of Chlosyne palla (Boisduval,
1852) and is not conspecific with Chlosyne acastus (W. H. Edwards, 1874)
The genomic tree constructed from specimens of Chlosyne Butler, 1870 (type species Papilio janais
Drury, 1782) reveals that Melitaea sterope W. H. Edwards, 1870 (type locality in USA: Oregon, Wasco
Co.) (Fig. 24 magenta) currently considered conspecific with Chlosyne acastus (W. H. Edwards, 1874)
(type locality in USA: Utah, probably Utah Co.) (Fig. 24 red) is not monophyletic with it, and instead
originates within Chlosyne palla Chlosyne palla palla;|PAO335|USA:CA, Stanislaus Co.|2017
1 1 1 Chlosyne palla palla|18069B09|LT|USA:CA,Plumas Co.|USNM
(Boisduval, 1852) (type locality To Chlosyne palla altasierra|17109C08|HT|USA:CA,El Dorado Co.|1961|LACM
USA: California, Plumas Co.) (Fig. fs— Chlosyne palla altasierra|PAO970|USA:CA, El Dorado Co.|2019
“ F 7 . Chlosyne acastus sterope|21011C01|LT|USA:OR|CMNH
24 blue). This conclusion is solid, wed ob Chlosyne acastus sterope|21026A09|USA:WA, Adams Co.|1986
b d th . i Chlosyne acastus sterope|21026A10|USA:WA,Adams Co.|1986
ecause we sequence e@ primar Chlosyne acastus sterope|21026A11|USA:WA, Adams Co.|1986
types of all mise taxa in eee C. palla australomontana|17109C07|HT|CA, Tulare Co.|1977|LACM
. Chlosyne palla australomontana|21026B03|USA:CA, Tulare Co.|2013
Chlosyne whitneyi (=malcolmi)|17109D05|HT|CA,Mono Co.|1921|LACM
M. sterope, C. palla, and C. acastus . Chios itneyi
. . . : yne whitneyi|21084G06|F|USA:CA,Mono Co.|1974
‘ : Ps Chlosyne damoetas|21096E07|LT|USA:CO,South Park|1902|CMNH
to provide the ultimate reference for | na
Chlosyne damoetas|17115C02|USA:CO, Gilpin Co.|1997
these names Therefore, Melitaea Chlosyne acastus acastus|21011A04|LT|USA:UT,Utah Co.?|CMNH
° Chlosyne acastus acastus|21026B08|USA:UT,Juab Co.|2008
1 Chlosyne acastus acastus|21026B10|USA:NV,Humboldt Co.|2006
sterope W. H. Edwards, 1870 is not Chlosyne gabbii|PAO375|USA:CA, San Benito Co.|2017
conspecific with Chlosyne acastus Chlosyne gabbii|21026C05|USA:CA,Monterey Co.|2003
; : Chlosyne hoffmanni|PAO795|USA:CA,Plumas Co.|2018
(W. H. Edwards, 1874) and is a Chlosyne hoffmanni|PAOQ971|USA:CA, El Dorado Co.|2019
A Chlosyne harrisii]21025G12|USA:ME,Cumberland Co.|1982
subspecies of Chlosyne palla Chlosyne harrisii[21067F10|USA:NH, Belknap Co.|1957
(Boisduval, 1852): Chlosyne palla Fig. 24. Chlosyne acastus (red) and C. palla (blue and magenta) with sterope
sterope (W. H. Edwards, 1870) (magenta) as its subspecies. Primary types are labeled in their species’ colors.
comb. rev., which may be a welcome development for preserving the name acastus.
1
Phyciodes jalapeno J. Scott, 1998 is a species distinct from
Phyciodes phaon (W. H. Edwards, 1864)
Originally proposed and kept since aS a Phyciodes phaon jalapeno|21027A01|USA:CA,San Diego Co.|1968
A ‘ : Phyciodes phaon jalapeno|21056C02|Mexico:Sonora|1991
subspecies, Phyciodes phaon jalapeno J. 5b Phyciodes phaon jalapeno|21056C03|Mexico:Sonora|1991
: , : Phyciodes phaon jalapeno|21056B12|USA:AZ,Graham Co.|1995
Scott, 1998 (type locality USA: Arizona, a Phyciodes phaon jalapeno|21056C01|USA:AZ,Graham Co.|1995
: : icall Phyciodes phaon jalapeno|21027A02|USA:NM, Eddy Co.|1986
Maricopa Co., Mesa) is genetically pee Phyciodes phaon jalapeno|21027A03|USA:NM, Eddy Co.|1987
se . a Phyciodes phaon jalapeno|3405|USA:TX, Hidalgo Co.|2015
distinct from the nominotypical Ei phaon : Phyciodes phaon jalapeno|3493|USA:TX, Hardin Co.|2015
: Phyciodes phaon Jalapeno|4449|USA:TX, Wise Co.|2015
(W. H. Edwards, 1864) (type locality Phyciodes phaon jalapeno|4480|USA:TX,San Patricio Co.|2015
. : : = Phyciodes phaon jalapeno|5093|USA:TX,Cameron Co.|2015
USA: Georgia, Glynn Co., San Simon — Phyciodes phaon jalapeno|5099|USA:TX, Starr Co.|2015
= Phyciodes phaon jalapeno|3870|USA:TX,Dallas Co.|2015
Isl., neotype NVG-20129GI11 sequenced) Phyciodes phaon phaon|20129G11|NT|USA:GA,Glynn Co.|1965|CMNH
: : ? 1ot] = Phyciodes phaon phaon|4718|USA:FL,Levy Co.|2015
(Fig. 25): Fst/Gmin statistics are 0.37/0.04 Phyciodes phaon phaon|8204|USA:FL.Collier Co.|2017
and COI barcode difference is 1.8% (12 : Phyciodes phaon phaon|4891|USA:FL,Miami-Dade Co.|2015
bp). Therefore, we propose that it is a Fig. 25. Phyciodes jalapeno (red, above) and P. phaon (blue, below).
species-level taxon Phyciodes jalapeno J. Scott, 1998, stat. nov.
Phyciodes incognitus Gatrelle, 2004, Phyciodes orantain J. Scott, 1998,
Phyciodes anasazi J. Scott, 1994 (including P. batesii apsaalooke J. Scott, 1994
as a subspecies), and Phyciodes diminutor J. Scott, 1998 are species-level taxa
Genomic comparison of the four Phyciodes Hubner, [1819] (type species Papilio cocyta Cramer, 1777)
that constitute the tharos species group, which are closely related and difficult to identify: Phyciodes
tharos (Drury, 1773) (type locality USA: New York City), Phyciodes cocyta (Cramer, 1777) (type
locality in Canada: Nova Scotia), Phyciodes batesii (Reakirt, [1866]) (type locality USA: Virginia,
Winchester) and Phyciodes pulchella (Boisduval, 1852) (type locality USA: San Francisco), reveals more
complex speciation scenarios than currently recognized (Fig. 26) (Scott 1994; Scott 1998; Scott 2006;
Pelham 2022). While these four taxa are indeed species according to our genomics-based criteria, four
other lineages are of the same rank as these four. First, Phyciodes cocyta incognitus Gatrelle, 2004 (type
21
Z chromosome
Phyciodes tharos Ue ee A at A WONT ua
puta tharos tharos|6100|USA:VA, Rockingham Co.|201
es tharos a Lea erase ps a el ee noe 5
hyciodes tharos riocolorado|21026F06|USA:CO, Delta Co.
Phyciodes tharos tharos|13562|USA:AZ,Santa Cruz Co.|20
Phyciodes tharos tharos/471 SS AS! Co,|2015
Phyciodes tharos tharos|5205|USA aT
P. tharos tharos|210 2|PT of or
Phyciodes tharos tharo
2
Phyciodes tharos tharos >
0.007
8 species: yee
tharos "1a
ams CO
2004
Oe SA:MI,Emmet Co.|1978
026E08|USA:NH, Carroll Co.|1985
eee
We
pe le
yciodes Btesi Bpaaalooke 21067004
Phyciodes batesii apsaalooke|21026GO :
Phyciodes batesii anasazi|22041G01|PT :
—3 Phyciodes batesii anasazi ne al iC
.6Phyciodes batesii anasazi|2 Uae A:UT,San Juan Co.|2020
Phyciodes batesii anasazi|17115C06|USA:AZ,Coconino Co.|1991
Phyciodes tharos orantain|22041 ae T|USA:CO,Adams Sate
PhyCiodes tharos orantain| 2|PTIUSA:CO, Adams Co.|1985
U
U
anasazi Usa CO,Mesa Co.|1993
0.34
orantain
21026F04|USA:CO, Denver|1972
AO0130|USA:WY,Goshen fo ave
n Co.|1994
1994
2
Alberta|1989
ra CO
o
yciodes pulchella camillus|PA\ SU
Fig. 26. Trees constructed from protein-coding regions in Z-ch
mitochondrial genome
Phyciodes tharos riocolorado|21026F06|USA:CO, Delta Co.|1969
ee cocyta incognitus|21067A06|PT|USA:NC,Clay Co.|2003
hyciodes tharos tharos|13562|USA:AZ,Santa Cruz Co.[2021
ciodes tharos tharos|6100 ne Ry eae Co.|2016
so hyciodes tharos tharos|3887|USA:AR,Montgomery Co.|2015
35 hyciodes tharos tharos|21067B01|USA:GA,Union Co.|2003
USA:TX,Starr Co.|2015
05|USA:NC,Macon Co.|2002
T MeO Kee Co.|2003
0.02
dams
004
ty|1932|AMNH
|(Canada:Alberta 1989
6E08|USA:NH, Carroll Co.|1985
5 pena ei ore ;
037C01|HT|USA:GA, Union Co.|2004
A:GA,Union Co,|20
6E10|USA:WY Converse Co,.|1984
0 [USA-CO.Adams Co,|1988
‘WY, Alban
hyciodes cocyta diminutor|210
Ph ciodes tharos tharos|471
yyciodes cocyta incognitus|21
ciodes cocyta incognitus|21037C02|AT|US
MGCL
4
106
4
n|2102
af; Phyciodes tharos orantain|21067D05|P
Phyciodes tharos orantain|PAO1268|USA Co.|2020
9PhyCciodes tharos peel A0130|USA:WY,Goshen oe 16
Phyciodes tharos orantain|21026F04|USA:CO, Denver|1972
Phyciodes tharos orantain|21026E11|USA:CO, Larimer Co.|1984
Phyciodes batesii apsaalooke|22041G03|PT|USA:WY Bighorn Co.|1993
og2hyciodes batesii apsaalooke|21026G05/USA:WY Bighorn Co.|1995
A peedes batesii apsaalooke|21067C01/USA:WY, Bighorn Co.[1995
34, Phyciodes batesil anasazi|22041G01 pea esa Co.|1993
Phyciodes batesii anasazi|20046B04|USA:UT,San Juan Co.|2020
Phyciodes cocyta apache|21026E02|PT|USA:NM, Otero Co.|1986
Phyciodes batesii maconensis|21067B08| EN aera Co.|1994
F fetid batesii Seren ,Onondaga Co.|1971
Phyciodes cocyta diminutor|2 204 1Go4|PTIUSA'WY, Biaho Co.|1995
sPhi ciodes tharos orantai
78
ga-hyciodes batesii apsaalooke|22041 T|USA:WY, Bighorn Co.|1993
oo— Phyciodes cocyta pascoensis|2102 PU ase tae dams Co.|1986
Phyciodes batesii ba ee neve USA:MI,Otsego Co.|1992
A eloRes cocyta diminutor|21067C06|PT|USA:MN, Freeborn Co.|1996
yciodes cocyta cocyta]22038F06|Canada:Nova Scotia|1983
Phyciodes batesii anaSazi|21067D06|PT|USA:CO,Mesa Co.|1993
“Ehyciodes cocyta elu ede 9|USA:MI,Emmet Co.|1978
ciodes cocyta Saeellel 059B05 Tee 971
{Phyciodes batesii lakota]21067C05|PT|USA:NE, Sioux mal 994
2 Phyciodes pulchella owimba ani SA:
oPhyciodes pulchella vallis|21059H12|U .[2000
too Phyciodes pulchella tutchone|21026HO5|USA:AK, nr. Fairbanks|1
Phyciodes pulchella shoshoni|21067G02|USA:NV, Elko Co.|197
Phyciodes pulchella montana|PAO84|USA:CA, Plumas Recue
Phyciodes cocyta arenacolor|21026E01|USA:NV,White Pine Co.|1983
°Phyciodes batesii anasazi|17115C06|USA:AZ,Coconino Co.|1991
hyciodes pulchella camillus|PAO261|USA:CO, Larimer Co.|2016
Phyciodes pulchella pulchella|21067F04|USA:CA,San Francisco Co.|1990
pycedés phaon jalapeno|3493|USA:TX, Hardin Co.|2015
; ; hyciodes picta pile 046A10|USA:UT,San Juan Co.|2020
Phyciodes mylitta my ue eae USA:CA,Placer Co.|2016
Phyciodes pallida pal
ida|PAO1412|USA:CO, Jefferson Co.|2020
romosome (left) and mitogenome (right) of eight Phyciodes
99
67
100
86
species in the tharos group: tharos (blue), incognitus (orange), diminutor (olive), cocyta (purple), anasazi (green), orantain
(red), batesii (cyan), and pulchella (magenta). Two specimens collected together shown in Fig. 27 are highlighted in yellow.
6 Pret Rpeeniendlielinst Rear Bat, SE
Sep7-S-19E 7
BARR Cake, ADAM
DNA sample ID:
NVG—21067C12 —
c/o Nick V. Grishin
TILS colln.
MGE€L Accession
# 2008-40
DNA sample ID:
NVG-—21067C11
c/o Nick V. Grishin
MGCL Accession
# 2008-40
Fig. 27. Paratypes of Phyciodes orantain with their labels: NVG-21067C12, which is Phyciodes tharos (top, black nudum);
and NVG-21067C11 (bottom, orange nudum). All images are to scale, except insets showing enlarged view of antenna club.
locality in USA: Georgia, Union Co.) (Fig. 26 orange) is not monophyletic with P. cocyta (Fig. 26
purple), but instead is sister to P. tharos (Fig. 26 blue
), and due to sympatry between P. tharos and P. c.
incognitus, we reinstate the latter as a species-level taxon: Phyciodes incognitus Gatrelle, 2004, stat. rest.
Second, Phyciodes tharos orantain J. Scott, 1998 (type locality USA: Colorado, Adams Co., Barr
Lake) (Fig. 26 red) is not monophyletic with P. tharos (Fig. 26 blue) and is quite distant from all other
taxa. A curious observation is that one of the specimens labeled as a paratype of P. t. orantain (NVG-
Z2
21067C12, Fig. 27 top) collected at its type locality was placed within P. tharos in the tree (Fig. 26,
highlighted yellow within blue clade). Puzzled about this placement, we inspected photographs of the
Specimen and found that it had black antenna nudum and not orange as in the namesake P. ¢. orantain
(Fig. 26 red). Another P. ¢. orantain paratype with the same locality and date (NVG-21067C11, Fig. 27
bottom), but with orange nudum was placed within all other P. t. orantain specimens (Fig. 26 highlighted
yellow within red clade). Thus, we demonstrate by genomic sequencing that P. t. orantain is sympatric
and synchronic with P. tharos (unless that specimen was mislabeled, which is not likely because its
mitogenome is that of P. t orantain, Fig. 26 right) and here propose that it is a species-level taxon:
Phyciodes orantain J. Scott, 1998 stat. nov. The paratypes illustrated in Fig. 27 are labeled in Gatrelle’s
hand, so it is possible that Scott simply didn’t notice the black antenna nudum when giving these
specimens to Gatrelle as “paratypes,” thus missing the opportunity to exclude this P. tharos specimen
from the type series of P. orantain, or some other mishap occurred, like specimen mislabeling.
Third, sisters Phyciodes batesii apsaalooke J. Scott, 1994 (type locality in USA: Wyoming,
Bighorn Co.) and Phyciodes batesii anasazi J. Scott, 1994 (type locality in USA: Colorado, Mesa Co.)
(Fig. 26 green) are not monophyletic with P. batesii (Fig. 26 cyan), but instead form a clade sister to P.
cocyta (Fig. 26 purple). Due to the genetic and morphological distinction of P. b. apsaalooke with P. b.
anasazi from P. cocyta, we propose to treat them as a distinct species Phyciodes anasazi J. Scott, 1994
stat. nov., with Phyciodes batesii apsaalooke J. Scott, 1994, comb. nov. as its subspecies. Here, acting as
the first reviser, we gave priority to the name anasazi over apsaalooke, because the name is shorter, and
the taxon has a wider distribution. The decision to elevate P. anasazi to the species level is largely
prompted by its apparent phenotypic similarity with P. batesii, rather than with a closer relative P. cocyta.
Genetic distinction of the former two similar species suggests hybrid origin of at least some species.
Fourth, Phyciodes cocyta diminutor J. Scott, 1998 (type locality in USA: Minnesota, Freeborn
Co.) (Fig. 26 olive) is sister to the clade consisting of P. cocyta and P. anasazi, and, therefore, we confirm
it as a species-level taxon: Phyciodes diminutor J. Scott, 1998. An alternative treatment may be to
consider P. cocyta, P. anasazi, and P. diminutor conspecific because they are closest to each other
genetically. However, each of the three species forms a distinct clade in the tree, and future studies will
address the complexities of their evolution and speciation.
We observe that Z chromosome proteins are quite similar between P. batesii and P. pulchella (Fig.
26 cyan and magenta), and the two species are sisters in the Z chromosome tree. Autosomal proteins (not
shown) separate these two species better, placing P. pulchella as sister to all other Phyciodes of the tharos
group, which seems more in agreement with their phenotypes. Thus, the evolutionary history of the tharos
group is riddled with irregularities such as hybridization and introgression.
Finally, the mitochondrial genome tree (Fig. 26 right) has an appearance of a partly scrambled
version of the nuclear Z chromosome tree (Fig. 26 left), but to the extent that on the current sample of
Specimens it is nearly impossible to assign ancestral haplotypes to all species, although major clades of P.
tharos, P. orantain, P. anasazi, and P. pulchella probably correspond to such. While it reflects to some
extent the relationships observed in the nuclear genome, mitogenome cannot be used with confidence in
taxonomic work and specimen identification due to extensive introgression. Apparently, the tharos group
Species are incipient, and they hybridize with a certain frequency, despite being mostly distinct.
Type locality of Junonia pacoma Grishin, 2020 is in Sinaloa, not Sonora
The type locality of Junonia pacoma Grishin, 2020 was incorrectly given in the text of the original
description as “Mexico: Sonora, Isla de la Piedra” (Cong et al. 2020), which is here corrected to “Mexico:
Sinaloa, Isla de la Piedra”. Furthermore, all references to “Sonora” in the description and illustrations of J.
pacoma in that work (Cong et al. 2020) are corrected to “Sinaloa”. We are grateful to Andrew D. Warren
for kindly informing us about this mistake. These localities were listed correctly in the Supporting
Information Table Sl (Cong et al. 2020). Junonia pacoma has also been recorded and genetically
confirmed from Sonora, e.g., a pair in UCDC collected by R. E. Wells south of San Carlos on beach
dunes: NVG-19065E05 & 26-Mar-2003 and NVG-19065E06 @ 5-Feb-2005.
23
Cercyonis incognita J. Emmel, T. Emmel & Mattoon, 2012 is a subspecies of
Cercyonis silvestris (W. H. Edwards, 1861), reinstated status
We find that the lectotype of Cercyonis sthenele silvestris (W. H. Edwards, 1861) (type locality USA:
California, suggested to be in Butte Co.) (Figs. 28 magenta, 29) is not conspecific with Cercyonis sthenele
(Boisduval, 1852) (type locality USA: California, San Francisco, paralectotype sequenced) (Fig. 28
green), but is in the same clade with Cercyonis oetus (Boisduval, 1869) (type locality in USA: California,
Placer Co.) and Cercyonis incognita J. Emmel, T. Emmel & Mattoon, 2012 (type locality in USA:
California, Mendocino Co.) (Fig. 28 blue and
red). Even the Z chromosome-based tree
(Fig. 28) did not reveal prominent genetic
differentiation between C. incognita and C.
oetus, Suggesting recent divergence of these
Species and posing questions about their
reproductive isolation to be addressed in
future work. We refrain from treating these
taxa as conspecific due to the difficulty in
rearing adults from crosses between them
(Emmel et al. 2012). The phylogenetic
analysis we performed differentiates species
diverged farther back in time than C. oetus
and C. incognita and may not be able to
handle recently diverged species. Regardless
of the status of C. oetus and C. incognita, the
lectotype of C. s. silvestris (Fig. 28 magenta),
together with a more recently collected
specimen identified by facies as a possible C.
s. silvestris (NVG-21095D08 USA: CA, El
Dorado Co.), are placed in the tree with C.
Cercyonis sthenele silvestris?|21095D08|USA:CA,E! Dorado Co.|1969
Cercyonis sthenele silvestris|20126E02|LT|USA:CA, Butte Co|CMNH
Cercyonis incognita|21095F02|USA:CA,Humboldt Co.|1980
Cercyonis incognita|21095F03|USA:CA, Humboldt Co.|1980
v5, _Cercyonis incognita|21027H11|USA:CA,Mendocino Co.|2013
<2 Cercyonis incognita|PAO435|USA:CA,Mendocino Co.|2017
5, Cercyonis incognita|21027H12|USA:CA,Mendocino Co.|2013
v. Ee scercyonis incognita|PAO436|USA:CA,Mendocino Co.|2017
Cercyonis incognita|21037E12|AT|USA:CA,Mendocino Co.|2000
Cercyonis incognita|21037E11|HT|USA:CA,Mendocino Co.|2000|MGCL
Cercyonis oetus oetus|PAO1094|USA:CA, Inyo Co.|2019
Cercyonis oetus oetus|PAO493|USA:CA,Mono Co.|2017
Cercyonis oetus pallescens|21036HO7|HT|NV,Lander Co.|1969|MGCL
4.18.4
g.66.97
0.08
daz Cercyonis oetus phocus|21057G09|Canada:BC|1977
Cercyonis oetus charon|9371|USA:WY, Park Co.|2017
= Cercyonis oetus phocus|21057G10|Canada:BC-BC border|1977
195, Cercyonis oetus alkalorum|21037E04|HT|USA:NV,Nye Co.|1984|MGCL
Cercyonis oetus pallescens|PAO814|USA:NV,Lander Co.|2018
Cercyonis oetus alkalorum|PAO1169|USA:NV,Nye Co.|2019
0.05
Cercyonis oetus charon|6417|USA:CO,Grand Co.|2016
Cercyonis sthenele sthenele|7259|PLT|USA:CA, San Francisco Co.
Cercyonis sthenele sineocellata|21036F08|HT|OR,Lake Co.|1986|MGCL
6%, Cercyonis sthenele sineocellata|21095D11|USA:OR,Harney Co.|1979
=> Cercyonis sthenele behriil21095D06|USA:CA,Marin Co.|1978
> Cercyonis sthenele behrii]21028A07|USA:CA, Stanislaus Co.|2007
=, Cercyonis sthenele paulus|21095D01|USA:CA,Mono Co.|1978
ae sthenele paulus]|PAO1121|USA:CA, Inyo Co.|2019
Cercyonis sthenele masoni|21095C10|USA:CO,Mesa Co.|1969
Cercyonis sthenele masoni|PAO567|USA:CO,Mesa Co.|2017
5 22 ereyonis meadii meadii|21027HO5|USA:CO,Douglas Co.|1967
zo Celcyonis meadii meadii|21027HO7|USA:CO, Douglas Co.|1968
7, Cercyonis meadii alamosa|21027H08|/USA:CO,Alamosa Co.|2006
Cercyonis meadii alamosa|21027HO9|USA:CO,Saguache Co.|1976
Cercyonis meadii melania|20059B03|USA:T X,Jeff Davis Co.|2002
° Cercyonis meadii melania|9708|USA:TX,Jeff Davis Co.|2017
incognita (Fig. 28 red), and therefore could | Fig. 28. Cercyonis silvestris (red, lectotype in magenta, incognita as
be conspecific with it. Because of wing subspecies), oetus (blue), sthenele (green), and meadii (purple).
pattern differences between C. s. silvestris (darker) and C. incognita (paler), we consider the latter to be a
subspecies of the former, rather than its synonym: Cercyonis silvestris incognita J. Emmel, T. Emmel &
Mattoon, 2012, stat. nov. implying that Cercyonis silvestris (W. H. Edwards, 1861), stat. rest. is
reinstated here as a species. Finally, we note that C. oetus is not monophyletic in the Z chromosome tree
(Fig. 28), and its nominotypical specimens are in the same clade with C. silvestris. Therefore, if C.
silvestris is a species distinct from C. oetus, it is conceivable that C. oetus consists of several species.
hecto type
Sa tyres > DNA sample ID:
; NVG—20126E02
c/o Nick V. Grishin
‘lyestrrs Oo
W.H. EDWARDS
designated
Lo... Edwards PCemsay
a 1 Cm
Fig. 29. Lectotype of Satyrs silvestris W. H. Edwards, 1861, NVG-20126E02, dorsal (left) and ventral (right) views, and its
labels. Labels are reduced relatively to the specimen: larger and smaller scale bars refer to specimen and labels, respectively.
24
Paramacera allyni L. Miller, 1972 and Paramacera rubrosuffusa L. Miller, 1972 are
species distinct from Paramacera xicaque (Reakirt, [1867])
Nuclear genomic tree partitions sequenced Paramacera A. Butler, 1868 (type species Neonympha xicaque
Reakirt, [1867]) specimens into three distinct clades corresponding to three named taxa (Fig. 30). Here,
we argue for species-level status of the three taxa: not only of Paramacera allyni L. Miller, 1972, stat.
rest. (type locality USA: Arizona, Cochise Co., Barfoot Park), but also of Paramacera rubrosuffusa L.
Miller, 1972, stat. nov. (type locality in Mexico: Oaxaca) initially proposed as a subspecies. COI
barcodes of P. allyni and P. rubrosuffusa differ from Paramacera xicaque (Reakirt, [1867]) (type locality
in Mexico: Veracruz) by 3.2% (21 bp)
and 3.8% (25 bp), respectively. This
level of barcode divergence (>3%), in
the presence of phenotypic differences
Paramacera xicaque allyni]21042D06|HT|USA:AZ,Cochise Co.|1970|MGCL
Paramacera xicaque allyni|17068E09|USA:AZ,Cochise Co.|2007
Paramacera xicaque allyni|17068E10|USA:AZ,Cochise Co.|1986
Paramacera xicaque allyni|21107HO8|Mexico:Chihuahua|1899
Paramacera xicaque allyni|21107HO9|Mexico:Chihuahua|1899
Paramacera xicaque xicaque|17118A04|Mexico:DF|1979
Paramacera xicaque xicaque|21107H11|Mexico:DF|1928
(which are apparent in Paramacera), Paramacera xicaque xicaque|17118A05|Mexico:DF|1979
has been suggested as sufficient to
substantiate even allopatric taxa as
distinct species (Lukhtanov et al. 2016).
Therefore, we propose to treat the three
Paramacera taxa as species.
Paramacera xicaque xicaque|21107H10|Mexico:Hidalgo|1969
Paramacera xicaque rubrosuffusa|21042D07|HT |Mexico:Oax|1967|MGCL
Paramacera xicaque rubrosuffusa|21107H05|PT |Mexico:Oax|1971|CMNH
Paramacera xicaque rubrosuffusa]21107H06|PT|Mexico:Oax|1971|CMNH
Paramacera xicaque rubrosuffusa|21107H07|Mexico:Guerrero|1986
Fig. 30. Paramacera allyni (red), P. xicaque (blue), and P. rubrosuffusa
(magenta). Primary types are labeled in corresponding colors.
Five Cissia rubricata group species, not subspecies, including a new one
Sequencing a sample of specimens representing all five available names currently referring to subspecies
of Cissia rubricata (W. H. Edwards, 1871) (type locality USA: TX, McLennan Co., nr. Waco) that
includes the primary types of all five names reveals prominent genetic differentiation among four of these
taxa (Fig. 31), which in addition to the nominotypical are: Euptychia rubricata cheneyorum R. Chermock,
1949 (type locality USA: AZ: Pima Co., Madera Canyon), Megisto rubricata pseudocleophes L. Miller,
1976 (type locality in Mexico: Guerrero), and Megisto rubricata anabelae L. Miller, 1976 (type locality
in Mexico: Chiapas). The COI barcode difference exceeds 6% for the closest pair of these taxa. Provided
phenotypic distinction, this barcode difference supported by consistent clustering in the nuclear genome
tree (Fig. 31 left) argue for the species, rather than subspecies, level of these taxa. Conversely, COI
difference between the holotype of C. rubricata smithorum (Wind, 1946) (type locality in USA: Texas,
Marfa-Alpine, NVG-1I5105E05) and the neotype of C. rubricata rubricata (NVG-20125F01) is 0.8% (5
Z chromosome mitochondrial genome
C. rubricata rubricata|20125F01 |NT|TX,McLennan Co. [oi 7|CMNH
Cissia rubricata rubricata|8382|USA:TX,Blanco Co.|201
Cissia rubricata rubricata|8387|USA:TX, Blanco Co. 017
Cissia rubricata rubricata|8384|USA:TX,Blanco Co.|2017
Cissia rubricata rubricata|8720|USA:TX, Randall Co.|2017
Cissia rubricata rubricata|20058HO6|USA:TX,Wise Co.|2001
Cissia rubricata rubricata|20059C04|USA:TX,Llano Co. ove
Cissia rubricata rubricata|20058HO7|USA:TX,Wise Co.|2001
C. rubricata smithorum|15105E05|HT|TX, Marfa-Alpine|1941|CAS
Cissia rubricata smithorum|21073A11|Mexico:Nuevo Leon|1940
Cissia rubricata smithorum|9734|USA:TX,Jeff Davis Co.|2017
Cissia rubricata smithorum|12288|USA: TX Jeff Davis Co. |2019
Cissia rubricata smithorum|9797|USA:TX,Jeff Davis Co.|2017
Cissia cheneyorum|21027E09|USA:AZ,Santa Cruz Co.|1968
Ce cheneyorum|SAMNO9745385|USA: AZ,Cochise Co.|2015
Cissia cheneyorum|21027E11|USA:AZ,Pima Co.|1991
Cissia cheneyorum|21027E10|USA:NM, Weg 0 Co.|2000
Cissia Uses ak i ea hes ae :AZ,Cochise Co.,Paradise|2017
Cissia anabelae|15022G11|HT|Mexico:Chia|1969|MGCL
Cissia anabelae|21073A06|PT|Mexico:Chia|1972
Cissia anabelae|14105D02|Mexico:Chia|1975
Cissia anabelae|21073B04|PT|Mexico: popeee
Cissia anabelae|14105D01|Mexico:Chia|197
Cissia anabelae]21074B05]PT Peale
Cissia anabelae|21073B06|PT|Mexico:Hid|1
Cissia anabelae|21073B07|Mexico: He Teenie
Cissia wahala|14105D03|HT|Mexico:Oax|1972|USNM
Cissia wahala|14105C12|PT|Mexico:Pue|1972
Cissia wahala|1924|PT|Mexico: aie
Cissia wahala|1922|PT|Mexico:Pue|1979
Cissia wahala|21073A08|PT&PT of FUSE Reienay! Oax|1971
Cissia wahala|21073B01|PT|Mexico:Oax|1956
Cissia pseudocleophes|21042F03|HT|Mexico: Succes
Cissia pseudocleophes|21073B02|Mexico:Gue|197
Cissia pseudocleophes|14105C11|PT|Mexico: due{1910
Cissia pseudocleophes|21073B03 peace: :Gue|1967
Cissia pseudocleophes|21027E12|Mexico:Son|2004
0.005
species:
pseudocleophes
Cissia rubricata rubricata|8720|USA:TX, Randall Co.|2017
C. rubricata rubricata| 20125F01|NT|TX,McLennan Co. ae
4issia rubricata rubricata|20059C04 USA:TX,Llano Co. |2003
Cissia rubricata rubricata|8382|USA:TX,Blanco Co.|2017
Eissia rubricata rubricata|8384|USA:TX,Blanco Co.|2017
Cissia rubricata rubricata|8387|USA:TX,Blanco Co.|2017
ip cieeta rubricata rubricata|20058H06|USA:TX,Wise Co.|2001
5 vissia rubricata rubricata|20058HO7/USA:TX,Wise Co.|2001
Cissia rubricata smithorum|12288|USA:TX, Jeff Davis Co.|2019
4 Cissia rubricata smithorum|21073A11|Mexico:Nuevo Leon|1940
eae abe Si Aan Mir ee Marfa- a ae |CAS
re jssia rubricata SE REE SaiGe TX,Jeff Davis Co.|2017
Cissia rubricata smithorum|9797|USA: TX, Jeff Davis Co. |2017
Cissia cheneyorum|21027E09|USA:AZ,Santa Cruz Co.|1968
9€issia cheneyorum|21027E10|USA:NM, Hidalgo Co.|2000
fe cheneyorum|SAMNO09745385|USA:AZ,Cochise Co.|2015
issia cheneyorum|9763|USA:AZ,Cochise Co.,Paradise|2017
Cissia cheneyorum|21027E11|USA: AZ,Pima Co.|1991
issia anabelae|15022G11 HT|Mexico: et aa
jssia anabelae|14105D02|Mexico: hig 5
rubricata
issia anabelae]14105D01|Mexico:Chia|1972
'Cissia anabelae|21073A06|PT|Mexico:Chia|1972
ooCissia anabelae|21073B04|PT|Mexico:Chia|1961
Cissia anabelae|21073B07|Mexico:Nuevo Leon|1940
aoe anabelae|21073B06|PT|Mexico:Hid|1939
issia anabelae|21073B05|PT|Mexico:Hid|1939
ss wahala|14105D03 Eee Oax|1972|USNM
issia wahala|21073A08|PT&PT of ape oa Nee. Oax|1971
jssia wahala]1922|PT|Mexico:Pue|1979
issia wahala|14105C12|PT|Mexico:Pue|1972
issia wahala]1924|PT|Mexico:Oax|1967
ee wahala|21073B01|PT|Mexico:Oax|1956
Cissia pseudocleophes|21042F03|HT|Mexico: Sas Hl
Cissia pseudocleophes|21027E12|Mexico:Son|200.
Cissia ia ane ces oe ae T|Mexico: Guel1967
oocissia pseudocleophes|14105C11|PT|Mexico:Gue|1910
Cissia pseudocleophes|21073B02|Mexico:Gue|1971
wahala
0.02
Fig. 31. Trees constructed from protein-coding regions in Z-chromosome (left) and mitogenome (right) of five Cissia
species: rubricata (green and olive) with smithorum as its subspecies (olive), cheneyorum (purple), anabelae (blue),
wahala sp. n. (red), and pseudocleophes (cyan). Specimens used as references for the names are labeled in magenta.
2S
bp), which, given large barcode divergence among species in the rubricata group, is comparatively small.
Therefore, we keep these two taxa as subspecies, but elevate others to species: Cissia cheneyorum (R.
Chermock, 1949), stat. nov., Cissia pseudocleophes (L. Miller, 1976), stat. nov., and Cissia anabelae (L.
Miller, 1976), stat. nov. Moreover, we find the fifth species-level clade in the tree that was not associated
with any name (Fig. 31, red) and is therefore new. It is described below as a species.
Cissia wahala Grishin, new species
http://zoobank. org/83981016-4965-4097-A3F5-4D8C37824DFF
(Figs. 31 part, 32, 33)
Definition and diagnosis. Considered by Miller (1976) within his concept of C. anabelae, but genetically
distinct from it and other rubricata group taxa at the species level. COI barcode sequence of the holotype
(NVG-14105D03) differs by 5.8% (38 bp), 6.2% (41 bp), 8.5% (56 bp), 5.9% (39 bp), and 6.7% (44 bp)
from the holotype of C. anabelae, topotype of C. cheneyorum (NVG-21027E09), the holotypes of C.
pseudocleophes (NVG-21042F03) and C. rubricata smithorum (NVG-15105E05), and the neotype of C.
rubricata rubricata (NVG-21096C03), respectively. Distinguished from its relatives by a combination of
the following characters: red patches on dorsal side of wings larger than in other species with developed
| rr ee er oo |
Fig. 32. Holotype of Cissia wahala sp. n. dorsal (left) and ventral (right) views, NVG-14105D03, data in text.
mottling on ventral hindwing: e.g., forewing patch occupies more than distal
posterior quarter of the forewing discal cell and extends into cells distad of it,
at least partly; small or absent eyespots on hindwing below, mostly without
silver pupils; mottled ventral hindwing as in C. anabelae; and colder, redder
and paler ventral surface compared to warmer, yellower and darker one in C.
anabelae. In COI barcode, diagnosed by a combination of the following base
pairs: A49T, C268T, A382G, T484C, T581C, and A622C.
Barcode sequence of the holotype: Sample NVG-14105D03, GenBank
OP23 1466, 658 base pairs:
AACTTTATATTTTATTTTCGGAATTTGAGCAGGTATAGTAGGTACATCTCTTAGTTTAATTATTCGAATAGAATTAGGAAACCCCGGAT
TTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACTGCTCACGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATT Fig. 33. Cissia wahala from
GGAGGATTCGGAAACTGACTAGTCCCCTTAATACTAGGAGCCCCTGATATAGCTTTCCCCCGTATAAATAATATAAGATTTTGATTACT
Mexico: Puebla, Ocoyucan.
iNaturalist observation 57699556.
© Bodo Nufiez Oberg, CC BY-NC 4.0
https://creativecommons.org/licenses/by-nc/4.0/
TCCCCCATCTTTAATTTTATTGATTTCAAGAAGTATCGTAGAAAAT GGAGCTGGAACAGGATGAACTGTTTATCCCCCCCTTTCATCTA
ATATTGCCCATAGAGGATCCTCTGTGGATTTAGCTATTTTCTCCCTTCATTTAGCTGGAATTTCCTCAATTTTAGGAGCTATTAATTTT
ATTACAACAATTATTAATATACGAAT TAATAGCATATCCTATGATCAAATACCCCTATTTGTCTGAGCTGTAGGGATCACAGCTCTCTT
ACTTCTTCTTTCTTTACCTGTTTTAGCTGGAGCAATTACTATACTTCTAACAGACCGAAATT TAAATACATCATTTTTTGACCCTGCCG
GAGGAGGAGATCCAATCTTATATCAACATTTATTT
Type material. Holotype: @ deposited in the National Museum of Natural History, Smithsonian
Institution, Washington, DC, USA (USNM), bears two white rectangular labels [ MEXICO: Oax., 6miN |
Huajuapan de Leon | 6 September 1972 | G.F. & S. Hevel | and [ DNA sample ID: | NVG-14105D03 | c/o
26
Nick V. Grishin ] and one red [ HOLOTYPE <2 | Cissia wahala | Grishin ]. Paratypes: 599 from
Mexico, 3 from Oaxaca, around Huajuapan de Leon (NVG-21073A08, 5-Sep-1971, also a paratype of C.
anabelae; NVG-1924, elev. 5900’, 10-Aug-1967, J. E. Hafernik) and 5 mi S of Matatlan on MX190
(NVG-21073B01, 24-Aug-1956, M. G. Douglas), and 2 from Puebla (NVG-14105C12, ca. 24 mi SE of
Acatlan, nr. Chila, 14-Aug-1972, C F. & S. Hevel; and NVG-1922, 6.4 mi E of Azumbilla, 15-Apr-1979,
T. P. Friedlander & J. C. Schaffner). Only sequenced specimens are included as paratypes.
Type locality. Mexico: Oaxaca, 6 mi north of Huajuapan de Leon.
Etymology. The name is a phonetic fusion of Oaxaca with Puebla: waha(1.e., Oaxa)[ca+Pueb]/a, and it
also stands for the difficulty of discovering this species and troubles in separating it from C. anabelae.
The name is a feminine noun in apposition.
Distribution. Currently known only from the states of Puebla and Oaxaca in Mexico.
Family Hesperiidae Latreille, 1809
Tarsoctenus gaudialis (Hewitson, 1876) is a species distinct
from Tarsoctenus corytus (Cramer, 1777)
Genomic analysis of Erycides gaudialis Hewitson, 1876 (type locality Panama: Chiriqui), currently a
subspecies of Tarsoctenus corytus (Cramer,
1777) (type locality in Suriname) reveals a
deep split between them (Fig. 34, the Z
chromosome tree) with Fs/Gmin statistics of
0.55/0.006 and COI barcode difference
between a syntype of Erycides gaudialis in
Tarsoctenus corytus gaudialis|15029C08|ST|Panama|MFNB
Tarsoctenus corytus gaudialis (=dubius)|18093A02|LT|Panama|SMF
Tarsoctenus corytus gaudialis|17099E02|Guatemala
Tarsoctenus corytus gaudialis|17099E04|Panama|1971
Tarsoctenus corytus gaudialis|17099E03|Panama|1978
Tarsoctenus corytus|17099E06|Guyana|1920
Tarsoctenus corytus|18054C03|Colombia|1921
Tarsoctenus corytus|17099E07|Ecuador|2000
Tarsoctenus corytus|17099E08|Brazil:RO|1991
Tarsoctenus corytus|18086G01|French Guiana|1910
Fig. 34. Tarsoctenus gaudialis (red, above) and Tarsoctenus corytus
(blue, below). Primary types are labeled in corresponding colors.
MFNB (NVG-15029C08) and a specimen
of nominotypical 7. corytus from French
Guiana (NVG-18086G01) of 4.6% (30 bp). Therefore, we reinstate Tarsoctenus gaudialis (Hewitson,
1876), stat. rest. as a species-level taxon.
;, Spicauda simplicius|19121E01|Suriname|1940
)Spicauda simplicius|17103C06|Peru|2012
S. simplicius (=pilatus)|15029F06|ST|Suriname|MFNB
Spicauda simplicius]19121C10|Brazil:RO|1991
FT 2picauda simplicius|17103C05|Peru|2013
- Spicauda simplicius|19121E04|Ecuador|1990
5, @picauda simplicius|19121C08|Brazil:RO|1991
>; Spicauda simplicius|19121E08|Bolivia|2003
Spicauda simplicius|19121D01|USA:TX,Cameron Co.|1922
>.2picauda simplicius|19121D02|Mexico:Tam|1977
:}Spicauda simplicius|19121D12|Venezuela|1989
Genetic uniformity of Spicauda simplicius
(Stoll, 1790) across its range
Inspection of genomic trees frequently reveals
prominent genetic splits (especially in the Z
chromosome) between geographically separated
1 1 1 ; Spicauda simplicius|19121D10|Panama|1977
populations, particularly along sO! suture zones Spicauda simplicius|19121C12|USA:TX,Cameron Co.|1944
We interpret these splits as speciation events and + Spicauda simplicius|19121E03|Ecuador|1988
‘ : ; F Spicauda simplicius|20057D02|Mexico:Chia
consider genetically differentiated groups of , Spicauda simplicius|19121D03|Mexico:Gue|1980
‘ A une ; sr Spicauda simplicius|19121D07|EI Salvador|1952
populations with limited gene exchange as species- Spicauda simplicius|19121D08|Honduras|1982
1 l l f h h hi Spicauda simplicius|19121D05|Mexico:Col|1953
evel taxa. Examples can be found throughout this 5" Spicauda simplicius|19121 D09|Nicaraqua|2003
work, such as the section just above about picauda simplicius|19121D11|Colombia|1972
Tarsoctenus gaudialis versus T. corytus. Here, we
show an example where we were not able to find
any splits or breaks in genetic differentiation across
the entire range of a species. Figure 35 shows the Z
chromosome tree of 28 specimens of Spicauda
simplicius (Stoll, 1790) (type locality in Suriname)
from USA: Texas through North, Central, and South
America to Bolivia and South Brazil, including a
5 >»picauda simplicius|18056E02|Brazil|1990
Spicauda simplicius|19121C09|Brazil:RJ|1995
Spicauda simplicius|19121E02|French Guiana|1993
, Spicauda simplicius|19121D04|Mexico:Ver|1979
Spicauda simplicius|19121E07|Brazil:MT|1992
0.01
5022. Simplicius (=pilatus)|15029E05|/ST|Brazil:BA|MFNB
Spicauda simplicius|19121F03|Venezuela|1981
Spicauda zagorus|15104G09|Brazil:RS|1957
Spicauda cindra|19121F11|Brazil:MT|1991
Spicauda teleus|19121B10|Brazil:RO|1993
Spicauda tanna|19121C02|Colombia|1992
Spicauda procne|3754|USA:TX, Hidalgo Co.|2015
Fig. 35. Spicauda simplicius (blue) among other members of
the genus. Primary type specimens are labeled in blue.
2
specimen from the type locality (NVG-19121E01), that, in the absence of primary type specimens which
are likely lost, is used here as a reference for this name. This vast distribution crosses several major suture
zones known to separate many Hesperiidae species. However, the S. simplicius tree has an appearance of
a comb and does not reveal any meaningful bifurcations, indicating the lack of genetic differentiation into
discrete groups of populations that may be treated as several distinct species. Therefore, for the lack of
evidence to the contrary, all these populations identified as S. simplicius represent a single species
distributed from South Texas (as a stray) to Brazil. Furthermore, sequencing of two syntypes of Goniurus
pilatus Pl6tz, 1881 (no. 5068 and 5069, type locality in Bahia, [Brazil] and Suriname) (Fig. 35) confirms
that this name is a junior subjective synonym of S. simplicius. Thus, not every morphospecies would be
dividable into several species after genomic analysis using our criteria of genetic differentiation and gene
exchange.
Epargyreus in northwestern North America
As we previously found (Zhang et al. 2020), resident Epargyreus Hubner, [1819] (type species Papilio
tityrus Fabricius, 1775, a junior homonym, valid name for this species is Papilio clarus Cramer, 1775) is
represented in the USA by two species: Epargyreus clarus (Cramer, 1775) (type locality "Suriname", later
corrected to USA: Virginia, Rockingham Co.) and Epargyreus huachuca Dixon, 1955 (type locality in
USA: Arizona, Cochise Co.). Here, we clarify the status of Epargyreus populations in northwestern North
America. We observed (Zhang et al. 2020) that genetic differentiation within Epargyreus clarus
californicus MacNeill, 1975 (type locality USA: CA, El Dorado Co., China Flat) was substantially lower
than that of the nominotypical Epargyreus clarus, suggesting a recent bottleneck and possible
Lindsay, 4 Collect 10n
C. M. Acé. No. 8584
DNA sample ID:
NVG-—21014C06
c/o Nick V. Grishin
Sonia a =
a os >
nt See - Yi .
: A \yf -
= “Te et *
.- é
eer a
See. BN.
on NR =
DNA sample ID:
NVG—21014C07
c/o Nick V. Grishin
Holland
Collection
‘ 1cm
Fig. 36. Epargyreus specimens from the northwestern US (dorsal: left, ventral: right) collected approximately one century ago
and their labels: Epargyreus clarus clarus from USA: Oregon (above the line) and Epargyreus clarus californicus from USA:
Washington (below the line). All images are to scale, including labels.
28
recolonization of the vast range of E.
Epargyreus clarus clarus|12420|USA:OK, Cleveland Co.|2019
J J 1 Epargyreus clarus clarus|4192|USA:TX, Dallas Co.|2015
c. californicus (Fig. 37, red vs. blue, j p 2 cporgyrs cn sate 2dF USA Tvs ecidte
argyreus clarus clarus ‘AR, Polk Co.
Z chromosome tree). To probe older p3r Epargyreus clarus cru asa0)USA Tx San pact igs! Go. 12016
1 1 1 1 argyreus Clarus clarus :VA,Rockbridge Co.
distribution of these taxa in the Epargyreus carus SS eee ee amery Co gos cose
ne argyreus Clarus clarus|1 1 :NY, Bronx Co.|1917
northwestern USA, we sequenced eaargyraus clarus alarus]191 2501 canada: Ontariol{ 986
: : Epargyreus clarus clarus|19124H12|USA:MT,Carbon Co.|1971
two specimens (in CMNH) collected pargyreus Clarus Ses 10 Oe Cee Brn Co.|1944
. Epargyreus clarus clarus|19039H03|USA:CO, Gunnison Co.|1980
more than a century ago 1n the States Epargyreus clarus clarus|21014C03|USA:IA,Johnson Co.|1910
: Z Epargyreus clarus See OS COMeE tatlee Lincoln Co.|1991
of Oregon and Washington (Fig. 36). Epargyreus clarus clarus|21014C04|USA:NE |old
Epargyreus clarus BEST parece ata! Co.|1922
SA:CO,Larimer Co.|2020
Consistent with their phenotypes
discussed by Warren (2005), one was
E. clarus clarus (Fig. 37 blue, NVG-
21014C06) and the other was E.
clarus californicus (Fig. 37 red,
NVG-21014C07), supporting the
hypothesis that eastern E. c. clarus
reaches Oregon, and Californian E. c.
californicus reaches Washington, and
they did so a century ago. We also
sequenced a piece of exuviae (no
specimen) from pupation (on 29 July
2018) of a larva reared from an egg Fig. 37. Epargyreus clarus clarus (blue, top), E. c. californicus (red, middle),
found on giant vetch (Vicia nigricans and E. huachuca (purple, below). Specimens discussed are labeled in color.
g g
var. gigantea (Hook.) Broich) by Christian Gronau in Canada: British Columbia, Cortes Island, Manson's
Landing, and it was E. clarus californicus (Fig. 37, red, NVG-22021G04). The Cortes Island population
(Fig. 38) extends the range of sub-species
californicus, which ranges from southern
California (Riverside Co., Fig. 37) to British
Columbia.
0)
0.78
The first record of E. clarus on Cortes
Island was a photograph of an adult taken in June
2014 by C. Gronau, and he and Barry Saxifrage
have thoroughly documented the use of giant
vetch as the larval foodplant (first record of it as
a foodplant for E. clarus), through oviposition
observations, finding many eggs and larvae, and
rearing larvae from eggs. Black locust occurs on
Cortes Island, but Gronau and Saxifrage have not
found any evidence it is used as a foodplant.
Cortes Island is about 320 km north of the Seattle
area, Washington where the nearest E. clarus
presently occur, and about 520 km from the
nearest extant FE. clarus clarus populations in
southeastern British Columbia. Most Seattle area
records are EL. clarus clarus, with some known to
be temporary introductions from larvae brought
in on nursery stock of black locust (Robinia
pseudoacacia L.) from eastern North America;
Fig. 38. Epargyreus clarus californicus nectaring on giant however, some records are of FE. clarus
vetch in Canada: British Columbia, Cortes Island, 50.0239N californicus that may be either migrants from the
124.9817W, 1-Jun-2019 © Christian Gronau (with permission). south or may reproduce locally on an unknown
29
foodplant (Jonathan P. Pelham, pers. comm.). Giant vetch is widespread in the Seattle area; hence, it (or
other vetch species) is a potential foodplant for resident populations of E. clarus californicus.
Monoca Grishin, new subgenus
http://zoobank.org/0986D5E 1-30DC-46DE-8E66-38F74DA35FD6
Type species. 7agiades monophthalma P\6étz, 1884.
Moneca Ocella monophthalma|14107B11|Brazil:RJ|1996
*4° : Ocella albata]14112G12|Peru
Definition. A distant member of the genus Ocella Evans, Ocella diophthalma|21054D 10|Brazil:RJ|1975
1953 (type species Cyclosemia albata Mabille, 1888) (Fig. Sophista aristoteles|14107C10|Peru|2013
: ; Pachyneuria obscura|15033D07|ST|Peru|MFNB
39), therefore is defined as a subgenus. Keys to E.26.3 in Austinus heros|18067C09|Brazil:PA|2009
Evans (1953). Differs from other Ocella species by its | Fig. 39. Subgenus Monoca subgen. n. (red) within
single (not double) forewing eyespot (i.e., eyespot only at L_ other Ocella (blue) and more distant relatives.
the end of discal cell and no eyespot in cell CuA;-CuA2), more produced hindwing tornus, straighter (not
convex) outer margin of both wings (Fig. 40), and uncus strongly downturned in lateral view.
Etymology. The name is a feminine noun in the nominative singular, | ~~
given for the single eyespot of the type species: Monot+|O]c[ell]a. =
Species included. Only the type species.
Parent taxon. Genus Ocella Evans, 1953.
Comment. Monophyly of this new subgenus with Ocella is weakly
supported (Fig. 39, 0.47) and it is possible that it may not hold, in a Sa
which case Monoca subgen. n. would become a genus-level taxon. | Fig. 40. Ocella (Monoca) monophthalma
Conservatively, due to its monotypy and phenotypic similarities with | {om Brazil: SP, Sao Bento do Sapucai.
aoe ; ; iNaturalist observation 104030146 © rick_costa. CC
Ocella, it 1s proposed asa subgenus In this work. BY-NC 4.0 https://creativecommons.org/licenses/by-ne/4.0/
» Se i
Pellicia brunneata Williams & Bell, 1939 is a junior subjective synonym of
Nisontades inca (Lindsey, 1925), reinstated status
Sequencing of the holotypes of Pellicia inca Lindsey, 1925 (type locality Peru: Puerto Bermudez, NVG-
22043E01), currently a junior subjective synonym of Nisoniades mimas (Cramer, 1775) (type locality in
Suriname) and of Pellicia brunneata Williams & a Nisoniades mimas (=inca)|22043E01|HT|Peru|1920|CUIC
: : : ~ Nisoniades brunneata|18059H1 2|Peru|1984
Bell, 1939 (type locality in French Guiana, Blaha ¢hdiaa )
Nisoniades brunneata|15097B04|HT|French Guiana}JCMNH
= 1 1 Nisoniades ephora|17108F08|Mexico:SLP|1981
, current y a Valid species O
: : ts ? 1M Nisoniades indistincta|18059H01|Peru|1989
Nisoniades Hiibner, [1819] (type species Papilio — Nisoniades bipuncta|18059G04|Brazil:SC|1945
bromius Stoll, 1787, a junior subjective synonym ES aes
LT | Nisoniades rubescens|21054H12|Guyana|1980
O apilio mimas Cramer, , reveals that
they are most likely conspecific, e.g., their COI Fig. 41. Nisoniades inca (red), N. mimas (blue) and relatives.
barcodes are 100% identical, but differ from their closest relatives, including N. mimas (Fig. 41).
Therefore, we reinstate Nisoniades inca (Lindsey, 1925), stat. rest. as a species and place Pellicia
brunneata Williams & Bell, 1939, syn. nov. as its junior subjective synonym.
Abdomen is excluded from the holotype of Staphylus ascalon (Staudinger, 1876)
Genomic sequencing of a leg from the holotype of Helias ascalon Staudinger, 1876 (type locality Brazil:
Rio de Janeiro, Nova Friburgo), male, currently in the genus Staphylus Godman and Salvin, 1896 (type
species Helias ascalaphus Staudinger, 1876) and a syntype of Staphylus anginus Schaus, 1902 (type
locality Brazil: Rio de Janeiro, Nova Friburgo) confirms their synonymy suggested by Mielke (1975).
Their COI barcodes are 100% identical and they are collected at the same locality. As Mielke (1975)
noted, he dissected an abdomen of a different species (larger size, asymmetrical genitalia) glued to the
30
body of the S. ascalon holotype. To preserve the current usage of the name ascalon and thus to stabilize
nomenclature, under ICZN Code Art. 73.1.5, we exclude the abdomen with all its content, including
genitalia (dissected by Mielke, in a vial pinned next to the specimen) from the holotype. The COI barcode
sequence of the S. ascalon holotype, DNA sample NVG-15033G04, GenBank OP23 1467, is:
AACTTTATATTTTAT1 1 akg 1
ATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTTGTACCACTTATATTAGGAGCTCCTGATATAGCTTTCCCTCGTA
TAAATAATATAAGTTTTTGATTATTACCCCCATCTTTAATACTTTTAATT TCAAGTAGTATT GTAGAAAATGGAGCAGGAACTGGATGAACTGTATATCCCCCACTTTCAGCTAATATTGC
CCATCAAGGATCATCAGTAGATTTAGCTATTTTTTCACTTCATTTAGCAGGTATTTCTTCAATTTTAGGAGCAATTAATTTCATTACAACTATTATTAATATACGAATTAATAATTTATCA
TTTGATCAAATACCTTTATTTGTATGAGCTGTAGGAATTACAGCATTACTTTTACTTTTATCTTTACCAGTATTAGCAGGTGCTATTACTATATTATTAACTGACCGGAATCTTAATACAT
CATTTTTTGATCCAGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
Xenophanes ruatanensis Godman & Salvin, 1895 is a species
distinct from Xenophanes tryxus (Stoll, 1780)
Genomic sequencing of Xenophanes
Xenophanes tryxus (=perplexus)|15104C08|HT|Mexico:Gue|AMNH
1 1 Xenophanes tryxus|15113F05|Mexico:Oax|1982
uy te (Stoll, 1780) (type locality ms 3 Xenophanes tryxus|20056F 08|Mexico:Chia
Suriname) specimens across its range Xenophanes tryxus|7906|Costa Rica|10-SRNP-103428
ww er Xenophanes tryxus|17116B08|USA:TX, Hidalgo Co.|1972
reveal a split into North and South Xenophanes tryxus|19088G01|Colombia:Meta|1972
: : : Xenophanes tryxus|19088G06| Trinidad|1982
American clades (Fig. 42, tree built X. tryxus (=euphemie)|15095C03|ST|Venezuela|1899|CMNH
PH ne Xenophanes tryxus|19088G05|Guyana|1983
from the Z chromosome). The two Xenophanes tryxus|19088G02|Ecuador|2002
1 1 1 Xenophanes tryxus|19088G03|Bolivia|2003
clades are differentiated genetically Re aaecnaeeeper
with Fst/Gmin of 0.26/0.048 and COI Xenophanes tryxus|19088G07|Brazil:Ro|1991
barcode difference between specimens Fig. 42. Xenophanes ruatanensis (red, above) and Xenophanes tryxus (blue,
; below). Primary type specimens are labeled in corresponding colors.
from Costa Rica (NVG-7906) and
Guyana (NVG-19088G05) of 1.7% (11 bp) and therefore represent two distinct species. The South
American species is X. tryxus, and the oldest name available for the North American populations is
Xenophanes ruatanensis Godman & Salvin, 1895, stat. rest. (type locality Honduras: Roatan Island),
which we reinstate from synonymy with X. tryxus as a species-level taxon. Genomic sequence of the
holotype of Xenophanes perplexus Bell, 1942 (type locality in Mexico: Guerrero) places it as a junior
subjective synonym of Xenophanes ruatanensis as expected from its locality, and sequencing of a syntype
of Leucochitonea euphemie Ehrmann, 1907 (type locality Venezuela: Suapure) supports its synonymy
with X. tryxus (Fig. 42). By default, we consider Hesperia salvianus Fabricius, 1793 (type locality
“Indiis”) to be a South American taxon and thus a junior subjective synonym of _X. tryxus.
Antina Grishin, new genus
http://zoobank. org/S DDOA8EC-EC80-469E-BFDB-1D1056D06623
Type species. Antigonus minor O. Mielke, 1980.
Andee rons mia 230 aoa raz RSLS
e4e ° . ntigonus minor razil:
Definition. Genomic sequencing of two paratypes . ina geometrina|7983|French Guianali993
. . : : staspes corrosus e€xico:Oax
of Antigonus minor O. Mielke, 1980 (type locality Celotes a ete Co.|2015
i . A : irgus limbata eru
in Brazil: Rio Grande do Sul) in ZSMC reveals Burnsius communis|7852 USASTX Bexar Co.|1977
: : ; Heliopetes arsalte|7558|Mexico:SLP|1980
that they are not monophyletic with Antigonus Pyrgus malvael7771|Greece|1992
Hs . Bralus albida|15033E0 Soll atau Sie
Htibner, [1819] (type species Urbanus erosus Zopyrion sandace|6998|Mexico:Oax|1981
ie : ae Anisochoria polysticta]79 eicasie Rica|04-SRNP-15751
Hiibner, [1812]), but instead form a distinct clade Carrhenes fuscescens|18014A02|Costa Rica|95-SRNP-6819
: . : F Santa santes|19088F08|Ecuador|2001 _
that is distant sister to Trina Evans, 1953 (type ) Paches loxus gloriosus|7899|Costa Rica|03-SRNP-30995
A : ; Plumbago Pavano 7982|Brazil:RO|1989
species Helias geometrina C. Felder & R. Felder, 7 Antigonus erosus|7907|Costa Rica|13-SRNP-56479
1867) (Fig. 43). Due to genetic differences and Xenophanes tryxus|7 906 costa Rical10-SRNP-103428
8. he : 8 Diaeus lacacrali Seo dO ani eo
morphological distinction, we do not place A. we _Zobera albopunctata|14101B03|PT|Mexico:Col
Onenses Mall ies he 1|Mexico:Tam|2003
minor in Trina, but erect a new genus for this Systasea zampa|6008|USA:TX,EI Paso Co.|2016
unique phylogenetic lineage. In wing pattern and Fig. 43. Antina gen. n. (ted), Antigonus (blue), Trina _
shape (Fig. 44) similar to some species formerly in (usps) janie reus (green) among valid generat Byram.
Antigonus, but currently in Systaspes Weeks, 1901 (type species Antigonus corrosus Mabille, 1878), and
subgenus Tiges Grishin, 2022 (type species Antigonus liborius Plétz, 1884) of Paches Godman & Salvin,
31
1895 (type species Pythonides loxus Westwood,
1852). The similarity is in the two concavities at
the outer margin near the hindwing apex, brown
wings crossed by two or three dark-brown bands,
and small hyaline spots in the middle of postdiscal
area of the forewing, valva with a long pro-
tuberance from the ampulla, which is particularly
bulky and large in this new genus, and not thin and |" | : ce
elongated, but thick-C-shaped, curved towards the Fig, 44 Artina minor rom Asgenin Mines, Candelaria.
ventral side of the harpe. Also differs in the paler © Patricio A. Mantinian. CC BY-NC 4.0 https://creativecommons.org/licenses/by-nc/4.0/
thin band from near the apex through the middle of the hindwing (Fig. 44). In DNA, a combination of the
following base pairs in the nuclear genome is diagnostic: aly2850.4.9:C216T, aly536.218.1:A99T,
aly88.17.3:A156G, aly1432.8.2:C101G, and aly4333.3.4:C133T.
Etymology. The name is a feminine noun in the nominative singular, a fusion of Antligonus] + [Tr]ina.
The type species is common in A[rge]ntina, where the photographs of live individuals were taken (Fig. 44).
Species included. Only the type species.
Parent taxon. Tribe Pyrgini Burmeister, 1878.
Nervia niveostriga (Trimen, 1864), new combination
Despite the lack of wing pattern
, Nervia mohozutza|21098B03|Kenya|1957
typical for Nervia Grishin, 2019 (type ' Nervia chaca|17091B01|Uganda|1953
. : Sue Nervia mohozutza|21098B05|South Africa
species Hesperia nerva_ Fabricius, Nervia protensa (=chacoides)|18074G02|ST|Cameroon|MFNB
Nervia protensa (=chacoides)|18074G01|ST|West AfricaJ|MFNB
1793), brown and rather humbly _ Nervia nancy|17091B07|Kenya|1958
: . : Nervia nancy|17091B06|Kenya|1960
patterned P amp hila? niveostr iga Kedestes niveostriga|21098B02|South Africa|1891
i i i Kedestes niveostriga|21098B01|South Africa|1891
eae 1864 (type ivcade! Wu ee -~ Kedestes niveostriga|21098A12|South Africa|1891
1 1 1 1 Nervia wallengrenii fenestratus|21098B06|Malawi|1926
A rica) Is not te pe eet etic wit Nervia wallengrenii wallengrenii|20126F09|South Africa
Kedestes Watson, 1893 (type species -“Nervia wallengrenii wallengrenii|17091B02|Rhodesia|1947
H aay ae Walleneren 08s 7) Tsitana tulbagha|21097H10|South Africa|1962
esperla tepenulia Tsitana tsita|18096G05|South Africa|1902
ie P oo: 'S ee : Trida barberae barberae|20126F 11|South Africa
and instead originates within Nervia Kedestes lepenula|17108F 10|South Atrica|1943
: 5 . Sk Go Kedestes lepenula|17108F 11|South Africa|1943
being sister to phenotypically similar ,Kedestes rogersi|17109E02|Kenya|1999
; oe : Kedestes rogersi|21098B11|South Africa|1947
Nervia walleng rent (Trimen, 1883 ) Kedestes macomo|21068F09|South Africa|1955
(type locality in South Africa) (Fig. Kedestes macomo|21098C04|Rhodesia|1943
45). Therefore, we propose Nervia Fig. 45. Nervia (red) including Nervia niveostriga, and Kedestes (blue).
niveostriga (Trimen, 1864) comb. nov.
Leona lota Evans, 1937, reinstated combination and
Leona pruna (Evans, 1937) with Leona reali (Berger, 1962), new combinations
Genomic sequencing of Lennia lota (Evans, 1937) (type locality in Cameroon) reveals that it is not
monophyletic with the pelle Lennia Grishin, Leona leonora leonora|18087A09|Gabon|1969
2022 (type species Leona lena Evans, 1937) } Leona stoehri]18075D01|HT|Togo|MFNB
F ; Pteroteinon reali (=na)|20124HO6|HT|Liberia|CMNH
where it was placed without DNA sequence Lennia lota|21101F02|Cameroon
: Mopala orma|18094H04|Cameroon
data (Zhang et al. 2022b), but instead belongs Lennia binoevatus|21101F04|Gabon
: : Lennia maracanda|21101F06|Gabon
to Leona Evans, 1937 (type species Hesperia Lennia lenal21101F07|Cameroon
leonora Pl6tz, 1879) as originally proposed, Lissia lissa lima|19043E01|Uganda|1954
implying Leona lota Evans, 1937, comb. rest. : ae 46. Leona (red, above) with Leona reali (represented by the
(Fig. 46). Furthermore, sequencing of the olotype of Caenides na) and Leona lota, and Lennia (blue, below).
holotype of Caenides na Lindsey & Miller, 1965 (type locality in Liberia), currently treated as a junior
subjective synonym of Pteroteinon reali Berger, 1962 (type locality in Ivory Coast), reveals that it
32
belongs to the genus Leona (Fig. 46). Therefore, and due to phenotypic similarities with Pteroteinon
pruna Evans, 1937 (type locality Cameroon), we propose Leona pruna (Evans, 1937), comb. nov. and
Leona reali (Berger, 1962), comb. nov.
Lotongus calathus (Hewitson, 1876) complex consists of five species-level taxa
Out of a total of 6 (including the nominal), 5 valid subspecies of Eudamus calathus Hewitson, 1876 (type
locality in Sumatra), the type Z chromosome mitochondrial genome
: : Lotongus calathus balta|7373|Myanmar|2003
species of and currently in the — Lotongus calathus balta|21106A04|Myanmar
genus Lotongus Distant, 1886, Lotongus calathus etal casa 118H10|ST|Nias|1883|MFNB
1 1 Lotongus calathus leila 118HO9|ST|Nias|1883|MFNB
alt differentiated from each Lotongus calathus parthenope|18096C02|Western New Guinea|MTD =
other genetically at the level Lotongus calathus calathus|18014E06|Thailand:Trang
. ig ‘A ‘ — Lotongus calathus calathus|18042A09|Malaysia:Perak|2018
typical for distinct species (Fig. Lotongus calathus zalates|21106A05|Java
: : Lotongus calathus shigeoi|18094A09|PT|Philippines|1994|SMF
47). Phenotypic differences Lotongus calathus taprobanus|18074B02|ST|Sulawesi|1882|MFNB
bet h h b ; Lotongus calathus taprobanus|18096C04|Sulawesi
: 3 Ldace them have been oe Fig. 47. Lotongus species: balta (green), calathus (red, its subspecies parthenope
in detail (Evans 1949) (Fig. labeled in magenta), za/ates (purple), shigeoi (orange), and taprobanus (blue). Z
48). Therefore, we propose that | chromosome (left) and mitogenome (right) trees are shown, leaf order is the same.
they are species-level taxa distinct from the nominotypical L. calathus: Lotongus shigeoi Treadaway &
Nuyda, 1994, stat. nov. (type locality in Philippines), Lotongus balta Evans, 1949, stat. nov. (type
locality Myanmar: Kanbauk), Lotongus zalates (Mabille, 1893), stat rest. (type locality in Java), and
Lotongus taprobanus (Pl6tz, 1885), stat rest. (type locality in Sulawesi). However, Hesperia parthenope
Pl6tz, 1886 (type locality in Nias), is more closely related to the nominotypical L. calathus (Fig. 47): e.g.,
COI barcode difference between them is 0.8% (5 bp) compared to 3.3% (22 bp) and 3.8% (25 bp)
difference between the nominotypical and the two closest to it species L. balta and L. zalates, respectively
(Fig. 47 mitogenome tree). Therefore, we keep Lotongus calathus parthenope (Plotz, 1886), confirmed
status, as a subspecies pending further investigations.
Fig. 48. Lotongus species: a, oF Ba ta, c. calathus, sand d. rae iNaturalist Beco a. 24122671 Thailand: Phetchabun, Khao;
b. 23269969 Thailand: Ranong, Kra Buri; ¢. 63226055 Indonesia, Bangka Is].; and d. 39632233 Indonesia: Sulawesi, Bolaang Mongondow.
c. © Yunita Lestari, others © Les Day. Several images are color-corrected, rotated, and/or flipped: CC BY-NC 4.0 https://creativecommons.org/licenses/by-nc/4.0/
Carystus tetragraphus Mabille, 1891 is confirmed as a junior subjective synonym of
Lotongus calathus parthenope (Pl6tz, 1886)
Sequencing its syntype, we tentatively placed Carystus tetragraphus Mabille, 1891 (type locality
‘“Amboine”’) as a junior subjective synonym of Lotongus calathus parthenope (Pl6tz, 1886) (type locality
Nias) without genomic data about the latter taxon (Zhang et al. 2022b). Here, we report sequencing of two
Hesperia parthenope syntypes confirming this hypothesis (Fig. 47). In the genomic tree, the syntypes of
the two taxa group closely together and with a female labeled from “Dutch New Guinea” (1.e., Indonesia:
Western New Guinea), and their COI barcodes are 100% identical. The two L. parthenope syntypes, both
females, we found in MFNB and sequenced are currently not labeled as types. However, they are from the
Weymer collection, labeled in Weymer’s handwriting, collected on Nias in 1883 (prior to the original
description in 1886), and one of them (NVG-21118H09), which matches the original description in every
detail, bears a label | parthenope Wm. i 1 | Pl6étz StettZeit 1886. |, the last line referring to the published
work (Pl6tz 1886). Therefore, we determine that these specimens are syntypes of L. parthenope.
33
Parnara bipunctata Elwes & J. Edwards, 1897 is a junior subjective synonym of
Borbo impar ceramica (Pl6tz, 1886), new status and new combination
Genomic analysis (Fig. 49) of a syntype of Hesperia ceramica P\6tz, 1886 (type locality in Indonesia:
Seram Island) (Fig. 50a) that was illustrated by Ribbe (1889) in his Fig. 6 on Taf. V, reveals that it is not
monophyletic with Pelopidas agna larika (Pagenstecher, 1884) (type locality in Indonesia: Ambon
Island) where it was placed by Evans (1949) as a junior subjective synonym, but instead is sister to the
Egopidas agna larika (=ceramica)|22016H12|LT|Seram IsI.|1884|ZSMC
holotype of Parnara bipunctata Elwes & J.
orbo impar bipunctata|20087C12|Seram Isl.|1984
Edwards, 1897 (type locality in Indonesia: Borbo impar bipunctatal18074H04|HT|Bacan IsI.|1893|MFNB
Bacan Island) (Fig. 50b), currently a subspecies Borbo berbonica[1 8054G08|Nambia|1993
of Borbo impar (Mabille, 1883) (type locality in Polopidss thrax|7768|Greccel 1983 nt
Australia or Oceania) (Zhang et al. 2022b). ee clopdas agna levika (ceatrianey|1807406|ST|Ambon Isl.|MFNB
Being phenotypically similar, originating from Fig. 49. Borbo impar ceramica (magenta and red, above) and
nearby localities, and having COI barcodes only Pelopidas agna (blue, below) among their relatives.
0.5% (3 bp) different, the two type specimens likely represent the same taxon that belongs to the genus
Borbo Evans, 1949 (type species Hesperia borbonica Boisduval, 1833). Therefore, by the priority of
names, we treat Borbo impar ceramica (P16tz, 1886), stat. nov., comb. nov. as a valid subspecies, and
propose that Parnara bipunctata Elwes & J. Edwards, 1897 is its junior subjective synonym.
Pl6tz (1886) referred to Ribbe in his original description of H. ceramica, and Ribbe (1889) later
wrote that he had collected only one specimen. Hence, this specimen (Fig. 50a) is the best name bearer of
the taxon and may be the only syntype. It is not the holotype, because the original description did not state
or imply that only one specimen was involved (ICZN Code Art. 73.1.2. and Recommendation 73F). To
enhance the stability of nomenclature, N.V.G. hereby designates the sequenced syntype NVG-22016H12
(Fig. 50a) in the Zoologische Staatssammlung Miinchen, Germany, bearing the following five rectangular
labels, the third purple and others white, the second label agrees with Pl6tz’s handwriting: [ Ceram | Jllo |
C.Ribbe 1884 ], [Hesperia | Ceramica Pl. ], [ Original ], [| 2 Parn. ceramica PI. | typ. (sec Mab=plebeia) |
Ceram |, and [ DNA sample ID: | NVG-22016H12 | c/o Nick V. Grishin | as the lectotype of Hesperia
ceramica Plétz, 1886. The specimen of P. bipunctata we sequenced (NVG-18074H04 in MFNB, Fig.
50b) is the holotype by monotypy, because the original description explicitly stated that this species was
described from one specimen (Elwes and Edwards 1897).
1cm
Geran {
fo Jie 4
{CRibbe 1284)
QTarn “rawica Pl
ign. ec abopeten
DNA sample ID:
NVG-22016H12
c/o Nick V. Grishin
Ve : SELES DNA sample ID:
Parnata bipunctata F pe 3 NCL iRCO ALOR
TYPE f c/o Nick V. Grishin
* ra : = aetrteiewaen
Coll.
J ff
ats f
Staudinger 273 /
a 7
Elaat.E)
oem & hitps/coll.min-berlin.de‘us
SEP: m4 126958
caytiteet
Fig. 50. Borbo impar ceramica: a. lectotype 2° of Hesperia ceramica (Taf. V Fig. 6 from Ribbe (1889) with this specimen
reproduced on the right, reduced) and b. holotype ¢ of Parnara bipunctata (Pl. XIX fig. 5 from Elwes & Edwards (1897) with
this specimen reproduced on the right, reduced) and their labels (larger scale bar for specimens and smaller one for labels).
34
Oxynthes martius (Mabille, 1889), reinstated status and
South America as a likely type locality of Oxynthes corusca (Herrich-Schiffer, 1869)
Genomic sequencing of a syntype of Goniloba corusca Herrich-Schaffer, 1869 (type locality not
specified), the type species of its current genus Oxynthes corusca (=martius)}15035C02|HT|Panama|MFNB
Oxynthes corusca|18119A12|Panama|1974
Oxynthes Godman, 1900, reveals that the Oxynthes corusca]18119A1 1|EI Salvador|1953
: : Oxynthes corusca|19013C02|Mexico: Tamaulipas|1975
syntype groups with specimens from South -Oxynthes corusea}iS035C03|LTIno data|MFNB
: g : . - ntnes corusca (=leucogaster razil:
America, including the holotype of Xeniades owithes orusealt67 S9BOtIPETuIsOKS pat |
leucogaster Rober, 1925 (type locality in Brazil: | Fig. 51. Oxynthes martius (red, above) and O. corusca (blue,
Rio Grande do Sul), currently considered a below). Primary types are labeled in corresponding colors.
junior subjective synonym of O. corusca following Evans (1955) (Fig. 51). These South American
Specimens are well-separated in the tree from North American specimens identified as O. corusca,
including the holotype of Proteides martius Mabille, 1889 (type locality Panama: Chiriqui) that is
currently treated as a junior subjective synonym of O. corusca. The COI barcode difference between the
syntype of O. corusca and the holotype of P. martius Mabille, 1889 is 3.6% (24 bp) suggesting that they
are distinct species. Furthermore, Fst/Gmin statistics between the two clades are 0.36/0.04. First, to ensure
nomenclatural stability and unambiguous identification of O. corusca, N.V.G. hereby designates its sole
syntype in MFNB bearing the following eight rectangular labels, the first one lilac-colored and others
white: | Origin. |, | corusca HS. ], [ Coll. H.—Sch. ]. [ Coll. Staudgr. | Kasten 671], [ Coll. | Staudinger ],
| Corusca | H-Sch. |, [ {QR code} http://coll.mfn-berlin.de/u/ | 3226be |, and [| DNA sample ID: | NVG-
: 15035C03 | c/o Nick V. Grishin | as the
lectotype of Goniloba corusca Herrich-
Schaffer, 1869. The lectotype is lacking
the abdomen and both antennae. Second,
because the lectotype is in the clade
consisting of South American specimens
(Figs. 51 blue, 52 right) that is separate
from the clade of North American
Fig. 52. Oxynthes martius (left) and O. corusca (right). iNaturalist : :
observations 124556487 Mexico: Oaxaca © John Kemner and 34915995 Brazil: Mato Grosso, Alta specimens (Figs. 5 I red, 52 left), We
Floresta, © belgianbirding, respectively, CC BY-NC 4.0 https://creativecommons.org/licenses/by-ne/4.0/ suggest that the type locality of O. corusca
is in South America. Third, due to genetic differentiation, we propose species-level status for Oxynthes
martius (Mabille, 1889), stat. rest.
Notamblyscirtes durango J. Scott, 2017, new status
Phylogenetic analysis of Notamblyscirtes Scott, 2006 (type and the only species Amblyscirtes simius W.
H. Edwards, 1881) from across the range reveals their partitioning into two well-separated clades (Fig.
53). The first clade (Fig. 53 blue) includes the lectotype of N. simius (type locality in USA: Colorado,
Pueblo Co.). The second clade (Fig. 53 red) contains the holotype of Notamblyscirtes simius durango J.
Scott, 2017 (type locality in Mexico: Durango), proposed as a subspecies. Specimens from southeastern
Arizona are in this red clade, however, Notamblyscirtes simius durango|1 9083F 0 HT |Mexico: Durango|1981|CSUC
1 1 — Notamblyscirtes simius durango|19042E06|Mexico:Durango|194
those from eastern Arizona (the White - precllid f see simius|21044B05|USA:AZ,Cochise Co.|1990
i i Notamblyscirtes simius|21057HO3|USA:AZ,Santa Cruz Co.|1992
Mountains) are in the blue clade. The two — Notamblyscirtes simius|21057HO4|USA:AZ,Santa Cruz Co.|1994
clades likely represent two distinct —— Notamblyscirtes simius|21057HOS5|USA:AZ,Santa Cruz Co.|1993
. Notamblyscirtes simius simius|15097A1 A ed eerie
species rather than subspecies due to Notamblyscirtes simius simius|17098F 12|USA: TX Jeff Davis Co.|1959
fi ki : ti diff ti i fl t 4 ‘ Notamblyscirtes simius simius|3203|USA: Tx,Brewster Co.|1977
ir neti ifferentiation r in Notamblyscirtes simius simius|17098F 11JUSA:CO Larimer Co.|1987
Seek 3 . ry a ene e Notamblystirtes simius simius|2 DS6EDS|USA.NM Sandoval Go il'984
Fs/Gmin Statistics of 0.49/0.009 and in 2% : Notamblyscirtes simius simius|21057HO6|USA:AZ Apache Co.|1984
j : Notamblyscirtes simius simius|21057HO8|USA:AZ,Apache Cagte
(13 bp) COI barcode difference between Notamblyscirtes simius simius|21057HO7|USA:AZ,Apache Co.|1978
the primary type specimens of the two Fig. 53. Notamblyscirtes durango (red, above) and N. simius (blue,
below). Primary types are labeled in corresponding colors.
taxa. Differences in their phenotypes,
such as the darker appearance and a different pattern of forewing apical spot in N. simius durango, agree
35
with this genetic differentiation. Therefore, we propose species-level status for Notamblyscirtes durango
J. Scott, 2017, stat. nov.
Rhinthon? zaba Strand, 1921 is a junior subjective synonym of
Conga chydaea (A. Butler, 1877), not of Cynea cynea (Hewitson, 1876)
Sequencing of the holotype of Rhinthon? zaba Conga chydaea (=binaria)|15036F 12|ST|Venezuela|MFNB
. . = Cynea cynea (=zaba)|20082H04|HT|Mexico:Ver|SDEI
Strand, 1921 (type locality Mexico: Veracruz, ) Gonga chydaea|18119D11|Ecuador|1992
: : : Gonga chydaea|18119D10}|Peru|2000|USNM
Orizaba, NVG-20082H04), currently a junior Conga chydaea|7963|Costa Rica|O9-SRNP-68418
i 1 1 Conga immaculata]18119E02|Brazil:RJ|1995|USNM
subjective py enya of Cy AS Ade (Hewitson, -*" Conga zela|18119E05|Brazil:RS|1962|USNM
1876) (type locality in Venezuela. subtribe Hesperia comma lena|18068A06|Russia:Yakutia|1990
M ’ A.W 2008) | th ‘cthoct Cynea cynea (=kasus)|15035C07|HT|Colombia|MFNB
oncina AX. arren reveals tha € two 'Cynea cynea|17108A02|Guatemala|1963
: iff ( a he fe : nea cynea|7960|Costa Rica|10-SRNP-35740
taxa are in different subtribes, and the former is Cynea melius|18119C04|Brazil:RJ|1996
7g Bi : Rhinthon osca|17116C08|USA:TX, Hidalgo Co.|1974
placed within specimens of Cong a chy daea (A. Monca crispinus|17092G12|Costa Rica|O6-SRNP-55847
Butler, 1877) (type locality Brazil: Amazonas, Fig. 54. Conga chydaea (red with Rhinthon zaba labeled in
Serpa, subtribe Hesperiina Latreille, 1809) (Fig. magenta) and Cynea cynea (blue) among their relatives.
54). COI barcodes of R. zaba and C. chydaea Primary types are labeled in corresponding colors.
(NVG-18119D10) are 100% identical and the specimens are phenotypically similar. Therefore, we
propose that Rhinthon zaba Strand, 1921 is a junior subjective synonym of Conga chydaea (A. Butler,
1877), a new synonym placement. This situation is the same as with Pamphila binaria Mabille, 1891
(type locality Venezuela) that we identified previously (Zhang et al. 2022b) as a junior subjective
synonym of C. chydaea and not of C. cynea.
Genomic revision of Hedone Scudder, 1872
A phylogenetic tree constructed
prhode: Read i reek vibex[> 1045013 Sa Ke Columbus C 11985
7 . 4 ; j| eaone vibex videx . ,COIUMDUS CO.
from protein-coding regions in vibex _ | { °."Hedone vibex brettoides|4117|/USA:T jTyler Co[2015
o.3 Hedone vibex ele 35 Sea er reel 5
the Z chromosome of Hedone vse Hedone vibex brettoides]15096F 02}. T]USA.1 X|CMINH
Scudder, 1872 (t ; ee aU ela
cudder, ( ype species ee HV. praeceps midalt983409|S1 Colombia) a7612MHE
; 1 ee eaone vibex praeceps uyana
Hesperia brettus Boisduval & Le . 1|praeceps| | 12:22 Hedone vibpx praeceps snail enezucla[1909 neteuSii
. : . . . V. praeceps (= ozona ‘GUe
Conte, [1837], which is a junior si Hedone vibex fraeceps 3438]USA:TX,Cameron Co.|2015
biective synonym of Hed. = Hedone vibex pracceps] 442]USAcTX Hidalgo Go 201
SUDJeECUYV y ye eaone at ¥ a V. pracceps (Bolena) 12/000 Colombalib761ZsMc
; ; eaone vibex praeceps enezuela
vibex vibex (Geyer, 1832)) . HedGne vibex praeceps|18115005 | rranidseh 933
. a : eaone vibex praeCeps riniaa
specimens across the Americas Hedone vibex praccone|2401 3868|Colombas |
ts that the genus consists Hedone vibes braeceps 1811 s00)|Panamalzo0y nl 876/28
SAG cH coeds els 2 Hee ve ab en eeeig
7 eaone vibex Calla Cuador
of eight species, judging by the d Hedone vibex calla|18115D09|Ecuador|1988
Hedone vibex calla|18115D10|]Ecuador|1976
number of strongly supported cae Hedone vibex calla|18115 O1)Peru Piura 2000
rominent clades. Each such MNedae Abies. sj2201 Feri Fre |Surinethe|1 964] RMNH
, Hicoj edone vibicoides uriname
P vibicoides | °° Wedone vibicoides|22011C10 Pr isunnanve (ealk NH
1 Hed ibicoides|18115D03/V la|1985
clade of more than one specimen Scone Coles ES: nese
ares Hedone vibex catilina|18
Hedone vibex praece a)|15039A0 X & NM"|FMNH
has an appearance of a comb Hedone vibex catiinafe 1013812 /Peru[1920
Hedone vibex coutinalt 8115E02|Brazil:MT|1990
rather than a well-resolved tree 5 Hedone vibex catilinal B11SEO5| olivia|1987
; } Bee ah Ale Se MEARS eae SOISCOT IST)"TX & NM"|CMNH
p04 eaone vibex praeceps (=stiqma
(Fig. 55). Such clade shape is a “Hedone vibe cating|21049A09| Guyane 1980
. id : bs ne vibex catiiin raZzil:
consistent with it representing a satilina || =, Hedone vibex canal 1811 3606 Argentina|2004
Species: a set of populations that Hedone vibex Catllina|21049A 16 Peru MD|198 1
4 eaone vibex cCatilina eru:
a es ° mira Hedone ex cael 1811 3E07/Agentne| 979
eaone mira eru: urimac
exchange genes across the range. ‘Seder done dictynna|2101 3604 eru:ApU
. edaone aictynna
Out of these eight clades, three Hedone alclyrnal18115C07)s
: 1edone bittiae|18033G08|Peru|2009
have been treated as_ species 212 Hedone bittiae|18115D07|Ecuador|2002
distinct f FT pa t — Hedonebitiae? OsgA0B|BeruLimapOul
Sea tee rae tie Lea a teeta a ecat
; . . ; ; eaone bpittlae eru
locality “West Indies”, likely in Hedone bittiae[21013C01[PT|Peru:Limal1920
error), namely, Hedone dictynna | Fig. 55. Clades for 8 species of Hedone are shown in different colors and labeled
(Godman & Salvin, 1896) (type with species names. Primary and secondary types are labeled in red and blue
: . respectively, except that the holotype of Hedone mira sp. n. is in magenta.
locality St. Vincent & Grenada), P uf E typ Pp g
36
Hedone bittiae (Lindsey, 1925) (type locality Peru: Matucana), and Hedone vibicoides (de Jong, 1983)
(type locality Suriname: Zanderij). Out of the remaining four clades, one corresponds to a new species
described below, and three correspond to taxa currently considered subspecies of H. vibex. Out of these,
Hesperia catilina Pl6tz, 1886 (type locality Brazil: Santa Catarina, Blumenau; syntype NVG-18052B01
sequenced) is the most distinct genetically and may not be monophyletic with H. vibex. Support for the
species-level distinction between H. vibex and Hedone praeceps Scudder, 1872 (type locality Mexico:
Oaxaca, Tehuantepec) (Fig. 56) is given in Cong et al. (2019a): Fst/Gmin statistics are 0.84/0.001 (Cong et
al. 2019a) and COI barcodes differ by 3.2% (21 bp). Finally, Polites vibex calla Evans, 1955 (type
locality Peru: Callao) is sister to H. praeceps and differs from it by 2.7% (18 bp) in the COI barcode.
Therefore, we reinstate two taxa as species: Hedone praeceps Scudder, 1872, stat. rest. and Hedone
catilina (Pl6tz, 1886), stat. rest., and propose to treat Hedone calla (Evans, 1955), stat. nov. as a species-
level taxon. We note that Hesperia catilina Pl6tz, 1886 is a junior primary homonym of Hesperia catilina
Fabricius, 1793, currently regarded as a valid subspecies of Leptotes cassius (Cramer, 1775). However,
because both names have not been considered congeneric after 1899, under Art. 23.9.5 of the ICZN Code
(1999), the case should be referred to the ICZN for a ruling under the plenary power. Therefore, in the
interest of the stability of nomenclature, we use Hedone catilina instead of proposing a new name.
The genomic tree reveals a curious genetic homogeneity of specimens within each species, even
over the vast ranges (Fig. 55). E.g., specimens of H. praeceps from Texas (Fig. 56c, d) and Guyana reveal
limited genetic differentiation, while Guyanese specimens of H. praeceps and H. catilina differ very
significantly from each other. Finally, as a surprise, we find that two syntypes of Pamphila stigma
Skinner, 1896 (type locality: USA: southern New Mexico and southwest Texas), one from FMNH and the
other from CMNH, are not monophyletic with H. praeceps, a synonym of which P. stigma currently is,
but belong to H. catilina, a South American taxon. Wing patterns agree with this placement. Provided that
P. stigma syntypes in two different collections are H. catilina, we place P. stigma as a junior subjective
synonym of H. catilina and deduce that these syntypes were mislabeled. The type locality of P. stigma
becomes “South America” and figuring it out more precisely by genomics will require additional
sequencing and analysis. This example illustrates that care needs to be taken when assigning synonymies
by reported type localities and not by the type specimens themselves, even if reported localities seem
believable. However, in this case, the locality does cause suspicions, because currently no Hedone species
is known from around “southern border of New Mexico and S.-W. Texas”.
Fig. 56. Females of the two USA Hedone species: a, b. vibex, and c, d. praeceps. iNaturalist observations: a. 133774978 GA, Liberty
Co. © Tom Austin; b. 109723959 FL, Charlotte Co. © Jay Horn; and TX: Hidalgo Co.: ec. 109408293 McAllen © ronthill and d. 103375027 Mission
© James Bailey. Several images are color-corrected, rotated, and/or flipped. CC BY-NC 4.0 https://creativecommons.org/licenses/by-nc/4.0/
Hedone mira Grishin and Lamas, new species
http://zoobank. org/365340C5-AF20-4B5F-975C-6F6975C25C0A
(Figs. 55 part, 57)
Definition and diagnosis. Genomic sequencing of Hedone Scudder, 1872 (type species Hesperia brettus
Boisduval & Le Conte, [1837], which is a junior subjective synonym of Hedone vibex vibex (Geyer,
1832)) specimens revealed one that didn’t group with any known taxa (Fig. 55 magenta) and therefore
37
ee Aem
Fig. 57. Holotype of Hedone mira sp. n. dorsal (left) and ventral (right) views, NVG-21049A07, data in text.
was probably a new species. Inspection of the phenotype of this specimen (Fig. 57) did not suggest a
possible match to species currently placed in other genera. This new species confidently belongs to
Hedone and has a unique appearance making its identification straightforward. It differs from all other
Hesperiidae species by a combination of the following characters: antenna about half of costa length, with
thick club; stigma broad, typical of Hedone, encircled by extensive patches of dark scales; ventral
forewing mostly orange-yellow, nearly not darkened in the middle, with brown band along outer margin,
two brown elongated spots near the apex, brown base and inner margin; ventral hindwing mostly rusty-
brown with broad orange-yellow ray along 1A+2A vein, cream-colored spot at the end of discal cell,
cream-orange spot in the middle of cell Sc+R1-RS, and a cream-orange postdiscal band of five spots
(separated by darker veins) between veins M; and 1A+2A. In summary, it looks very much like Hedone
bittiae (Lindsey, 1925) (type locality in Peru) on dorsal side, but ventrally the wing pattern is quite
different: the hindwing is mostly brown with orange spots rather than yellow with brown spots.
Barcode sequence of the holotype: Sample NVG-21049A07, GenBank OP231472, 658 base pairs:
AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAAC! ['TCTTTAAGTCTATTAATTCGAACAGAATTAGGTAATCCTGGCTCTTTAATTGGAGATGATCAAATTTATAATACT
ATTGTAACGGCTCATGCTTTTATTATAATTTTTTT TATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATAT TAGGAGCTCCTGATATAGCTTTTCCTCGAA
TAAATAATATAAGATTTTGAATATTACCCCCTTCACTAACATTATTAATT TCAAGAAGAATT GTAGAAAATGGTGCAGGAACAGGTTGAACAGTTTATCCACCTTTATCTTCTAATATTGC
TCATCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCTGGAATTTCTTCTATTTTAGGAGCCATTAACTTTATTACAACAATTATTAATATACGAATTAAAAATTTATCT
TTTGATCAAATACCTTTATTCGTATGATCTGTTGGAATTACAGCTCTATTATTATTATTATCTTTACCTGTTTTAGCTGGAGCTATTACTATATTACTTACAGATCGAAATTTAAATACTT
CTTTTTTTGATCCAGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
Type material. Holotype: 3 deposited in the McGuire Center for Lepidoptera and Biodiversity,
Gainesville, FL, USA (MGCL), bears four rectangular printed labels: three white [ SUDPERU, Apurimac
| Jarjatera, 30 km von | Abancay, 2800m | 5.XI.-22.XII.1995 | RAINER MARX leg. | EMEM, 8.X.19935 ],
| W. McGuire colln. | MGCL Accession | # 2008-43 |], [ DNA sample ID: | NVG-21049A07 | c/o Nick V.
Grishin ], and one red [ HOLOTYPE <2 | Hedone mira | Grishin and Lamas ]. Paratypes: 9 33’, 299, all
from Peru in MUSM, [Huancavelica department]: 1 3’, road [Nueva Esperanza de] Chonta [12° 37' S, 74°
29' W]| - Churcampa [12° 44' S, 74° 23' W], 3000 m, 3-Dec-2000, leg. V. Doroshkin; Apurimac
department: 1 4, 7 km NWW Chalhuanca, 14° 13' S, 73° 19' W, 2770 m, 16-Mar-1987, leg. O. Karsholt;
1 2, Quebrada Pacpapata, 13° 40' S, 72° 55' W, 1830 m, 2-Oct-2004, leg. J. Grados; Cuzco department: 2
3S, Calca, [13° 19' S, 71° 57! W], 2950 m, 5-Aug-1983, leg. J. L. Venero; 1 4, same data, but 8-Aug-
1983; 2 6, cerca [= near] Pisac [13° 25' S, 71° 51' W, 3100m], 22-Sep-1989, leg. N. Jara; 1 2, Chocco
[13° 33'S, 71° 59' W, 3450m], 25-Nov-1988, leg. G. Valencia; 1 3, Quebrada Uraca, SW of Limatambo,
13° 30'S, 72° 28' W, 2800 m, 21-Jun-2003, leg. G. Lamas; 1 d', same data, but leg. C. Pefia.
Type locality. Peru: Apurimac department, Carcatera area, 30 (road) km NW from Abancay, el. 2800 m.
Etymology. The name is given for the unexpected for the genus appearance of the ventral wing pattern of
this species: mira|culous], a Latin word for astonishing, extraordinary, wonderful. The name is a feminine
noun in the nominative singular.
Distribution. Recorded from Huancavelica, Apurimac, and Cuzco departments in southern Peru.
38
Hesperia peckius W. Kirby, 1837 is a junior subjective synonym
of Polites (Polites) coras (Cramer, 1775)
Here, we argue that information we assembled about Papilio coras Cramer, 1775 (type locality Suriname)
is sufficient to unambiguously associate this name with a known species. The illustrations and the
description of P. coras refer to female(s) of a North American species currently known as Polites
(Polites) peckius (W. Kirby, 1837), and we arrived at this conclusion with the following arguments.
Cramer volumes (1775—1780), where the original description of P. coras was published, contain
Dutch text in the left column and French text in the right column. The two texts are similar and differ only
in small details. The Dutch description of P. coras is: "Dit Dikkopje (Papilio Urbicola) is wederzyds van
dezelfde bruine kleur, met geelagtige vlakken. De sprieten der Kapellen, welken men gewoon is
Dikkoppen te noemen, eindigen aan den knop met een haakagtig puntje. Deze en de twee voorgaande
berusten in de verzameling van den Heer E. de Marre. Het is uit Surinamen." We translate it literally as
"This small thickhead [=skipper] (Papilio Urbicola) is on both sides of the same brown color, with
yellowish patches. The antennae of the butterflies, which one is accustomed to call thickheads, end in the
knob with a hook-like point. This and the previous
two [species] are in the collection of Mr. E. de
Marre. It is from Suriname." The French text and
its literal translation: "Le dessous de ce Plebejen
noble ou tétu (Pap. Pleb. Urbicolae) est de la
méme couleur brune, a taches jaundatres, que le
dessus. Les antennes des Papillons qu'on a
coutume de nommer tétus, finissent a la masse en
pointe crochue. Celui-ci & les deux precedents se
trouvent dans la Collection de Mr. E. de Marre. II
est de Suriname." "The underside of this
commoner [=Plebeian] urban [=noble] _ [i.e.,
Plebejus Urbicola] or stronghead [=skipper] (Pap.
Pleb. Urbicolae) is the same brown color, with
yellowish spots, as the upper surface. The
antennae of the butterflies, which we usually call
strongheads [=skippers], end in a hooked point on
the club. This one & the two preceding ones are in
the collection of Mr. E. de Marre. It is from
Suriname."
Importantly, both descriptions state that the
ventral side of wings is brown color (as dorsal)
and with yellow patches/spots. This information
complements the illustrations of the dorsal side,
both the published engraving (Fig. 58b right) and
the original drawing by G. W. Lambertz (Fig. 58b
left). The most unusual (for Hesperiidae) feature
‘ . ; Fig. 58. Specimens and original illustrations: a—e, h, i. Polites
of the dorsal illustration is the doublet of long, |coras: a. P. c. coras neotype, dorsal (left) and ventral (right)
perfectly aligned dash-like spots in hindwing cells | views; b. original drawing by Lambertz (left) and published
engraving (right); c—-e, h. variation in specimens that are
Mi-M2 and M2-M3. These spots are longer than the | <imilar to the original illustrations; i. P. coras peckius original
neighboring spots of the postdiscal row and illustration, dorsal (left) and ventral (right) views. f. Cantha
protrude farther from them towards the outer [7474 holotype. g. Vernia dares from Mexico: Oaxaca. All
specimens are females, except f. Photographs a are by Riley J. Gott, b
Margin than towards the base. First, we looked for (left), c-f and h are © The Trustees of the Natural History Museum
Hesperiinae species that would be expected from |London and are made available under Creative Commons License 4.0
Suriname and match both the illustrations and the (https://creativecommons.org/licenses/by/4.0/), and f is by Bernard Hermier.
39
description of P. coras. We critically inspected every known Hesperiinae species for P. coras characters.
Some Hylephila Billberg, 1820 (type species Papilio phyleus Drury, 1773) possess the doublet of
hindwing spots, but they also have an orange-yellow ray along hindwing vein 1A+2A, which is absent in
P. coras, and their ventral side is yellow-orange with brown spots rather than brown with yellow spots.
Cantha zara (E. Bell, 1941) (type locality in Bolivia) has the doublet of spots and its wings ventrally are
orange-brown with yellow spots, but the two spots in the hindwing doublet are not aligned with each
other, and the spot in M2-Ms3 1s offset basad (Fig. 58f). Finally, some females of Vernia dares (Pl6tz,
1883) (type locality not specified) match P. coras illustration very well, except that their forewing spots
are rounder and smaller (Fig. 58g), but they are ventrally yellow with brown spots, not brown with yellow
spots. Consistently with our studies, Olaf H. H. Mielke (2005: 1209), the foremost expert in American
Hesperiidae, is of an opinion that P. coras does not match any neotropical species.
Therefore, we suspected that the locality “Suriname” was erroneous. This is not without a
precedent: Rothschild and Jordan (1903) wrote “it is quite clear that ... the localities in E. de Marre’s
collection were not reliable.” For example, for the two species described by Cramer previous to P. coras,
also from the de Marre’s collection, the “Suriname” locality is apparently incorrect. One of these species
is currently regarded as Indomalayan Jamides celeno (Cramer, 1775), and the other is a nomen dubium,
Papilio arius Cramer, 1775 (could be either Lycaenidae or Riodinidae), which does not match any known
species. Thus, we analyzed all Old World Hesperiinae, in particular from the tribe Taractrocerini Voss,
1952, many of which are small brown, orange-spotted species in the genera 7aractrocera Butler, 1870
(type species Hesperia maevius Fabricius, 1793), Potanthus Scudder, 1872 (type species Hesperia omaha
W. H. Edwards, 1863), and 7elicota Moore, [1881] (type species Papilio colon Fabricius, 1775), among
others. Among them, we were not able to find a match to P. coras.
Out of the entire known worldwide Hesperiinae fauna, only some specimens identified as Polites
(Polites) peckius (W. Kirby, 1837) (type locality unclear, probably northeastern North America) fit what
is known about P. coras except its locality (Fig. 58a, c—e, h, 1). To test our suspicion about the P. coras
identity, we searched for its primary type specimens. We inspected collections that house possible Cramer
types: BMNH and RMNH, and failed to find candidate specimens. Assuming that they are lost, we
proceeded with the neotype designation. We believe that there is an exceptional need to designate the
neotype, because the identity of this taxon has been questionable for years since its description, essentially
resulting in a dual nomenclature, and its type locality is erroneous. Hereby, N.V.G. designates the
specimen, a female, shown in Fig. 58a as the neotype of Papilio coras Cramer, 1775.
Our neotype of P. coras satisfies all requirements set forth by the ICZN Article 75.3, namely:
75.3.1. It is designated to clarify the taxonomic identity of Papilio coras Cramer, 1775, which has been
questioned since its original description, and to define its type locality; 75.3.2. The characters for the
taxon have been quoted from the original description above and include the atypical (for Hesperiinae)
doublet of long orange dashes in the middle of the dorsal hindwing and the brown, yellow-spotted ventral
wing surface; 75.3.3. The neotype bears three rectangular labels: [ exeggex 9 | August 10 1987 |
Flourtown | Montgomery Co. Pa. | Coll. RW Boscoe // “grasses” | emerged | November 4 1987 ], [ FSCA |
Florida State Collection | of Arthropods |, and [ DNA sample ID: | NVG-22051H08 | c/o Nick V. Grishin
]; 75.3.4. Our search for syntypes is described above, was unsuccessful, therefore we believe that they
were lost; 75.3.5. The neotype is consistent with the original drawing, published engraving, and the
original description. It only differs from the illustrations by the presence of a yellow-orange spot in the
hindwing discal cell. However, this spot is variable, and is missing in some specimens (Fig. 58c, d);
75.3.6. The neotype is from USA: Pennsylvania, Montgomery Co., Flourtown, which becomes the type
locality of P. coras. The type locality was given as Suriname in the original description, likely by mistake,
and the original types could have been collected in the general New York City area, as for some other
species described by Cramer, e.g., Heraclides cresphontes (Cramer, 1777); 75.3.7. The neotype is in the
collection of the McGuire Center for Lepidoptera and Biodiversity, Gainesville, FL, USA (MGCL).
As a result of this neotype designation, P. coras belongs to the genus Polites Scudder, 1872 (type
species Hesperia peckius W. Kirby, 1837) and is likely conspecific with P. peckius. We note that the
40
original illustration of Polites peckius
syntype(s) reproduced here as Fig. 581
shows differences in wing patterns
from both the illustration and the
neotype of Polites coras. In P. peckius,
the orange spots are larger, and the
hindwing pattern differs. Instead of
separate narrow spots, there is a ae
yellow-orange blotch narrowly cut Fig. 59. Polites coras (peckius-like) from USA: upstate New York.
through by dark veins, The two long | <Niulstoberaton x tsen, sons Co, © Suen sues STIS NY: are Ca
dashes in cells Mi-M> and Mo>-Ms3 are color-corrected from the original. CC BY-NC 4.0 https://creativecommons.org/licenses/by-nc/4.0/
wider and do not sharply stand out from other spots, especially at the basal side of the discal band, which
is more even than in P. coras. Although particularly widespread in the upstate New York area (Fig. 59),
this phenotype occurs in all northeastern populations and may not be a reflection of geographic variation.
Therefore, we propose that Hesperia peckius W. Kirby, 1837, syn. rev. is a junior subjective synonym of
Polites (Polites) coras (Cramer, 1775). We keep the subspecies Polites coras surllano J. Scott, 2006
comb. nov. as valid but use the name in a new species-subspecies combination. More detailed analysis of
Specimens across the range of P. coras, including their phenotypes and genetics, will shed light on its
variation, population structure, and rigorous definition of subspecies.
The priority of P. coras over P. peckius may not be welcomed by some lepidopterists, but we
think that the evidence presented here is sufficiently strong to support it and to unambiguously identify
the Lambertz’s illustration augmented with the ventral side description by Cramer. If the resulting
reinstatement of the name coras used prior to 1981 (Draudt 1921—1924; Evans 1955), and used as valid in
the recent comprehensive catalogue of the Neotropical Hesperiidae (Mielke 2004; Mielke 2005), is not
desirable, ICZN could be requested to intervene.
Pompe Grishin and Lamas, new genus
http://zoobank.org/A5199A2E-BBAF-41B3-AD96-C87B5018AA84
Type species. Lerema postpuncta Draudt, 1923. Pompelus postpunctali81 171031822 'MT|1969
Pare ' ; ompeius postpuncta|21108G12|Bolivia
Definition. In the same clade with Serdis Cyclosma altama|8062|Brazil:PR|1991
; ‘ ; Tirynthoides lotana|8063|Peru|1990
Mabille, 1904 (type species Serdis flagrans Serdis statlis}18013£03 Peru [1994
. . : : Metrocles leucogaster|18013E04|Panama|1977
Mabille, 1904, a subspecies of Pamphila statius a Oxynthes isoqasal on cos eal
rors se Metron chrysogastra|7957|Costa Rica|13-SRNP-22628
Ménetriés, 1857) and Cyclosma Draudt, 1923 Euphyes vest PAOS44I A:CA, Plumas Co, 12017
: . Vernia verna]18014H01|USA:OH, Summit Co.|2012
(type species Cyclosma abdonides Draudt, Hesperia comma lena|18068A06|Russia:Y akutia|1990
Hylephila phyleus|5174|USA:TX, Hidalgo Co.|2015
Pompeius pompeius|17106B02|Costa Rica
Pompeius appia|18021B11|Brazil:RS|1961
Fig. 60. Pompe gen. n. (red, above) and Pompeius (blue, below).
1923), but far removed from Pompeius Evans,
1955 (type species Hesperia pompeius Latreille,
[1824]) where it was placed previously (Fig.
60). Keys to M.15.3. in Evans (1955). Distinguished from its relatives by a combination of the following
characters: stigma narrow, flanked with gleaming scales (Fig. 61); uncus divided, arms diverging, not
widely separated; gnathos arms converging, as long as uncus; harpe of valva dorsally expanded into a
lobe, distal margin concave, ventrally with a short spike directed posterodorsad; aedeagus terminally
enlarged. In DNA, a combination of the following base pairs in nuclear genome is diagnostic:
aly671.51.3:T45C, aly1838.49.3:A2211T, aly1222.14.14:
A5433G, aly1222.14.14:A5412G, aly1838.49.3:T1965G.
Etymology. The name is a feminine noun in the
nominative singular, derived from Pompeius, the
former genus name of the type species.
Species included. Only the type species. an
Fig. 61. Pompe oeinuiee NVG-18117H03, Brazil: MT.
Parent taxon. Subtribe Hesperiina Latreille, 1809.
4]
Atalopedes huron (W. H. Edwards, 1863) is a species distinct
from Atalopedes campestris (Boisduval, 1852)
A phylogenetic tree constructed from protein-coding genes in the Z chromosome reveals partitioning of
Atalopedes campestris (Boisduval, 1852) (type locality in USA: California, Sacramento Co.) into two
prominent clades (Fig. 62) that correspond to distinct species according to Fs/Gmin of 0.61/0.02 and COI
barcode difference of 1.4% (9 bp).
Atalopedes campestris huron|15097H11|NT|USA:IL,Cook Co.|1896|CMNH
Moreover genetic differentiation , Atalopedes campestris huron|6154|USA:VA, Rockbridge Co.|2016
ier ' : Atalopedes campestris huron|4279|USA:IN,Montgomery Co.|2015
between Californian specimens of 2Atalopedes campestris huron|8211|USA:FL,Miami-Dade Co.|2017
oAtalopedes campestris huron|3702|USA:TX, Dallas Co.|2015
nominotypical A. campestris and Atalopedes campestris huron|12292|USA:TX, Jeff Davis Co.|2019
Atalopedes campestris huron|18113A01|Mexico: Tamaulipas|1987
all others is comparatively much 33, Atalopedes campestris huron|18113A02|Honduras|1979
lareer than th ifferentiation — Atalopedes campestris huron|18113A04|Panama]|1963
phex tha the _differe t atlo 6 ha Atalopedes campestris huron|18113A03|Costa Rica|1980
between eastern USA Specimens *Atalopedes campestris huron|18113A05|Venezuela|1978
Atalopedes campestris huron|20062F 10|Mexico:Chiapas|1988
and those from Venezuela. The Atalopedes campestris huron|20063D04|Mexico:Baja California Sur|1974
; Atalopedes campestris campestris|20063D02|USA:CA, Kern Co.|2014
oldest available name for the non- Atalopedes campestris campestris|20063D03|USA:CA,Sonoma Co.|2013
1 1 1 1 Atalopedes campestris campestris] PAO665|USA:CA, Inyo Co.|2018
Californian clade (Fig. 62 red) - A. c. campestris (=tenebricosus)|21037G10|HT|USA:CA, Humboldt Co.|1989|MGCL
Hesperia huron W. H. Edwards, Atalopedes c. campestris (=tenebricosus)|21037G11|AT|USA:CA, Humboldt Co.|1989
1863 (type locality USA: Illinois, | Fig. 62. Atalopedes huron (red, above) and Atalopedes campestris (blue, below).
Primary type specimens are labeled in corresponding colors.
Cook Co., Evanston, neotype
NVG-15097H11 sequenced). Due to genetic differentiation, we reinstate Atalopedes huron (W. H.
Edwards, 1863), stat. rest. as a species-level taxon.
Putuma Grishin, new subgenus
http://zoobank.org/AB0279C1-S5BCE-4A91-A54A-D614A9EF33AF
Type species. 7isias putumayo Constantino and Salazar, 2013.
_ Xeniades (Xeniades) difficilis|18093D12|HT|Bolivia| SMF
Xeniades (Xeniades) difficilis]}18119B05|Peru:Cuzco|2015
Xeniades (Xeniades) orchamus|18119B04|Panama|1975
Definition. Tentatively placed in
the subgenus TJixe Grishin, 2022
(type species Cobalus quadrata
Herrich-Schaffer, 1869) without
genomic data, Tisias putumayo
Constantino and Salazar, 2013 is
not monophyletic with it and is
instead sister to all other Xeniades
Xeniades (Xeniades) orchamus|19024H09|Costa Rica|10-SRNP-75001
; Xeniades (Xeniades) pteras|18119B02|Panama|1977
Xeniades (Xeniades) pteras|7961|Costa Rica|13-SRNP-22562
Xeniades (Xeniades) victoria|18119B08|Brazil:RJ|1995
Xeniades (Xeniades) chalestra (=concors)|15035B01|ST|no data|MFNB
Xeniades (Xeniades) chalestra corna|18067H06|Brazil:SP|2007
~ Xeniades (Cravera) laureatus|18093D09|HT|Bolivia|SMF
Xeniades (Cravera) laureatus|18015B11|Brazil:MT|1991
Xeniades (Tixe) hermoda|18112A05|Colombia|1992
Xeniades (Tixe) quadrata|15036C04|ST|no data|MFNB
Xeniades Crixe) putumayo|22023D08|French Guiana|2003
Xeniades (Tixe) putumayo}21046B10|Brazil:RO|1994
Vacerra hermesia|18092C10|Ecuador|2015
Vacerra litana|17095C06|Venezuela|1975
Godman, 1900 (type species Oligoria maculata|8159|USA:FL,Miami-Dade Co.|2017
Oligoria argus|8005|Brazil:DF|1969
Papilio orchamus Cramer, 1777), Oligoria unica|18098F03|French Guiana|2000
including subgenera Cravera de Fig. 63. Genus Xeniades with subgenera Xeniades (blue), Cravera (magenta),
Jong, 1983 (type species Cravera Tixe (green), and Putuma subgen. n. (red) and genus Oligoria (olive).
rara de Jong, 1983) and Tixe (Fig. 63). Therefore, it is a subgenus of its own. Distinguished from its
relatives by ventral hindwing with a single transverse postdiscal white band from apex to about the
middle of cell CuA2-1A+2A, two framed with black bluish spots basad of
the band (Fig. 64), and the two hyaline spots in forewing discal cell (in
males) being farther from each other than in all other congeners. In DNA,
a combination of the following base pairs in nuclear genome is
diagnostic: aly420.34.2:C721A, aly1772.2.2:G63A, aly420.34.2:G258A,
aly420.34.2:A300C, and aly1931.9.21:G121A.
Etymology. The name is a feminine noun in the nominative singular, way!
formed from the type species name by removing the last two letters. Fig. 64. Xeniades putumayo from
Ecuador: Napo, Rio Pingullo.
° ° 7 iNaturalist observation 68121597.
Species included. Only the type species. © Ken Kertell, CC BY.NC 4.0
https://creatrvecommons.org/licenses/by-nc/4.0/
Parent taxon. Genus Xeniades Godman, 1900.
42
Lectotype designation for Pamphila trebius Mabille, 1891
To ensure identification of this name, and to stabilize nomenclature, N.V.G. hereby designates a specimen
in MFNB shown in Fig. 65 with the following eight rectangular labels, first purple, others white:
[| Origin. ], | Bogota | Nolcken |, [ P. trebitus Mb. ], [ Pamph. | Trebius | Mab. ], [ Coll. | Staudinger ],
| Trebius | Mab. ], [ {QR code} http://coll.mfn-berlin.de/u/ | 44a090 |, and [ DNA sample ID: | NVG-
15034E04 | c/o Nick V. Grishin | as the lectotype of Pamphila trebius Mabille, 1891 (type locality
Colombia: Bogota). The lectotype is a syntype (possibly the only one in existence, but we are avoiding an
assumption of the holotype), because it agrees with the original description (see below), was described in
a publication that mentions in the introduction that some of the specimens used were from the Staudinger
collection (the syntype is from this collection), one of its identification labels (“P. trebius Mb.”) matches
Mabille’s handwriting, and the syntype is curated as a type specimen (“Origin.”).
27mm 1cm
1 ™10 9
Bogota
Nolcken
Jn / 5
“Syebhiies eee CI
es ed . Ha, GREE ‘ DNA sample ID:
A : fo c ? AAAS ; —_ z pee fie is NVG—15034E04
fhe if oll. iste §=644a090 : ane
5 ui Mat, Staudiigan fay egtls c/o Nick V. Grishin
Fig. 65. Lectotype of Pamphila trebius Mabille, 1891 dorsal (left) and ventral (right) views, NVG-15034E04, details in text.
Wingspan is 27 mm per original description. Larger 1 cm scale bar is for the specimen and smaller one is for labels.
The original description of P. trebius can be (literally) translated as follows (numbers in curly
brackets are for the arrows pointing to these characters in Fig. 65): “Pale brown; three small apical dots
{1} and another [dot] in the 4th interval {2} white. Hindwings with yellowish hairs. Underside of the
forewings brown; veins tinted red {3}, the dots of the upperside a little larger: a small dot additionally in
the 3 interval {4}. Outer margin tinted with lilac gray {5}. Hindwings dusky with anterior portion darker
{6}, letting stand out two paler and indistinct square spots in intervals 7 {7} and 8 {8}. Body dusky with
red hairs. Palpi dark gray. Antennae with club yellowish below {9}. 27 mm {10} — ¢— Bogota” (Mabille
1891: CLXXIV). We note that Mabille used a different notation of wing cell numbers, presumably 7+ 1
for i> 1 compared to 7 in Evans (1953), thus numbering Evans’ forewing cells 1A and 1B as 1 and 2. The
apparent wingspan of the lectotype measures 26 mm, however, it is not mounted flat but with wings
angled downwards, thus decreasing the actual wingspan. The lectotype designation stabilizes the current
treatment of P. trebius as a junior subjective synonym of Cymaenes lumina (Herrich-Schaffer, 1869) (type
locality not specified, likely southern parts of South
America) (Zhang et al. 2022b). The type locality of
P. trebius is questionable because this phenotype is
not known from Colombia. As demonstrated by
Zhang et al. (2022b), Cymaenes lumina (that includes
P. trebius aS a synonym) is a South American .
species, not recorded from North America. A species |.) \& (ee -@
formerly known as “Cymaenes trebius” that enters Fig. 66. Cymaenes isus (left) and C. lumina (right).
th US : S th ce : C . es d iNaturalist observations 71267802, USA: TX, Hidalgo Co. © Rich Kostecke and
iS In Sou Cxas, IS Cymadaenes ISUs ( odman, 73322525 Argentina: Buenos Aires © Facundo Chieffo, respectively, color-
1900) (type locality Mexico: Guerrero) (Fig. 66). The corrected and rotated, CC BY-NC 4.0 https://creativecommons.org/licenses/by-nc/4.0/
43
two species can be distinguished from each other by wing patterns. In C. isus (and Cymaenes edata
(Plétz, 1882)), ventral hindwing typically has a pale postdiscal band of spots (separated by darker veins)
on brown background, the discal brown area is comparatively narrower, straighter, and the discal spot in
cell Sct+Ri-RS is usually connected with the basal pale area (Fig. 66 left). In C. /umina, ventral hindwing
is overall paler in appearance, with a broader, contrasting discal L-shaped brown patch, and the discal
spot in cell Sc+Ri-RS is separated from the basal pale area by this brown patch (Figs. 65, 66 right).
Methionopsis Godman, 1901 is a subgenus of Mnasinous Godman, 1900
Correcting a mistake made in Zhang et al. (2022b), we state that Methionopsis Godman, 1901 is a
subgenus of Mnasinous Godman, 1900. These two names were swapped in Zhang et al. (2022b), and this
error is corrected here to follow the priority of the two names (1901 vs. 1900). The arguments for their
synonymy are the same as presented previously (Zhang et al. 2022b), e.g., COI barcodes of Mnasinous
(Methionopsis) modestus (Godman, 1901) and Mnasinous (Mnasinous) patage Godman, 1900 differ by
9.1% (60 bp), while those of Methion melas Godman, 1900 (sister genus, monotypic) differ from them by
12.2-12.3% (80-81 bp).
Mnasinous (Methionopsis) phaeomelas (Hiibner, [1829]), new combination
Genomic sequencing of the holotype of Celaenorhinus |sic!| phaeomelas Hubner, [1829] (type locality in
Brazil) in MFNB reveals that it is sister . Papias ieee ever eee ana, Bartica|1933|AMNH
; ; ; Papias monus|19023F08|Guyana}1999
a eee me ane ry fppias ui al Pe ee
( odaman, ) ( ype locality Mvlexico Silas monus Le soombiall 969
(Gue, Ver, Tab), Guatemala, Honduras, php Deere ae veer a eo ee
i ; apias monus|21041HO03|Brazil:RO|1990
Panama, and South America to Brazil), Papias unicolor|21041F11|Brazil:SP|1961
: 1 > ,Papias phainis|21013E07|PLT|Guatemala|CMNH
the type species of the subgenus > Rapias phainis|21047GO6|EI Salvador|1972
bi , d 1901. i h oPapias phainis|21047G05|Costa Rica|1994
Methionopsis Godman, 1901, in the ,Papias pane OS ece Rea aN Oe
. : a} ais apias projectus|18026F03|HT|Ecuador|1941|AMNH
See a ead TAL ole ge ARR Ae CFE ay
therefore does not belong to Papias "Papias ae alabtatioi22coolprecie Rica|15-SRNP-45043
1 ; Papias allubita]19122C09|Brazil:Para|1964
shnomes < ee eo aia Papias Ta S038 2] T |Hondun Gilan| 2004
J Yr 1 in rl Papias integra|15035E12|LT|Honduras|1888|MFNB
neo Se ), the su tt ie . Papias integra|19093B07|Panama|1982
Moncina A. Warren, 2008, where it is - Papias subcostulata|15035E11|Suriname|1876
3 Papias subcostulata|18091D06|Ecuador|2012
currently placed (Fig. 67 magenta). The Moncina _ Papias latonia|18113G07|LT|Costa Rica|USNM
: : : Papias latonia|19021C11|Panama|1979
Specimen we sequenced (Fig. 68) is Cobalopsis suture 03808 STIR anetvalis7 IM Ne
: Lo : Cobalopsis valerius|15035E03|HT|Colombia|1876|MFNB
indeed the holotype: it agrees with the ib Sree valerius{1$021 B07 PLT of He el
ove Bh Pe : 5.34 Obalopsis valerius|19021D07|Panama|1973
original description and is a close match , 2s” Cobalopsis aie icmetal sea He dataJUSNM
107 1 1 “ Cobalopsis dictys|21013C10|Guatemala|CMNH
to the original illustrations of C. phae Monca odestuis|21 107 B06/ELTIM NCOTaDICMN
1 ich- 2) nasinous modestus|21107B06|PLT|Mexico: Tab|JCMNH
omelas, Cy from the Herrich-Schaffer o-Anasinous modestus|19012G01|Mexico:Tam|1974
collection that included a number of Mnasinous modestus|21046G08|Costa Rica|1987
fi i ( ca lalla modestus|21107B04|PLT|Mexico:Gue|CMNH
Hiibner types (now in MEFNB), is Mnasinous modestus|21107B05|Honduras|CMNH
2. : 5 ; Mnasinous modestus|/966|Costa Rica]O7-SRNP-23257
labeled as “Hb. Orign. : and, curiously, 5 vinasinous phaeomelas|18043D07|HT|Brazil|MFNB
: : ‘ es ‘Mnasinous phaeomelas|19017C03|Peru|1984
Oligoria lucifer (Hiibner, [1829]) that : Ulloa phacomels|20012608>era
: : os -88-¢-71Mnasinous phaeomelas|21046G10|Brazil:ES|1970
is illustrated by Hiibner ([1827]- omnaeinous P hasomelagi21718b04IColombig 1876
[1829]) on the same plate with C nasinous phaeomelas|21118D04|Colombia|1876
; Mnasinous cinnamomea|8043|Brazil:RJ|1995
Mnasinous purus|21046G09|Brazil:RO|1991
ee also has ee acd Falgina Mnasinous tagel21047¢05| Guatemala:
in rl1gin rom rrich- ; Mnasinous patage|21047C05|Guatemala|1993
a aoe : oe rh Tere 1 Methion me as|17108A04|Guatemala|1963
Schaffer collection. Because of the Falga jeconia jeconia|18012E10|Venezuela|1985
phylogenetic position of its holotype in Fig. 67. Papias monus (red), P. phainis (blue), P microsema (green),
the clade sister to the type species of Mnasinous modestus (cyan), and M. phaeomelas (magenta). The figured
syntype of P. microsema (olive, polytypic type series) from Panama is
the subgenus Methionopsis, we propose Cobalopsis valerius. The holotype of Celaenorhinus [sic! | phaeomelas is
Mnasinous (Methionopsis) phaeomelas highlighted in yellow. Names shown are those proposed in this work.
(Hiibner, [1829]), comb. nov.
Paso http://coll.mfn-berlin.de/u/
aa. fae
is 44a06f
Coll.
Staudinger
Coll, H.--Sch.
L,,, Briveilaan’
%
a
+ Ly pet ' DNA sample ID:
Lace A) = -NVG-18043D07
Prime vii sof od ake: | | 9 t! P re i | c/o Nick V. Grishin
eee eee BLIGHT
Fig. 68. Holotype of Mnasinous (Methionopsis) phaeomelas (Hubner, [1829]): a. dorsal (left), ventral (right), and labels
(below), larger scale bar refers to specimens, smaller one is for labels; and b. its original illustrations (Hubner [1827]|-[1829])
from the plate [100], figs. 581 (top) and 582 (bottom) rearranged and rotated, not to scale.
The type series of M. modestus included specimens from South America (Godman 1901) that are
probably M. phaeomelas. However, Godman (1901: 599) writes: “we figure a male insect from Teapa”
(Mexico: Tabasco), and, to define the identity of this name as suggested by the Recommendation 74B of
the ICZN Code, N.V.G. hereby designates the specimen illustrated in Godman (1901), in the BMNH
collection, that bears the following seven white labels, the first two round with a red circle, others
rectangular: ( Type ), (Type | H. T. ) [ Teapa, | Tabasco. | March. H.H.S. ], [3 ], [ Sp. figured. ],
| Godman-Salvin | Coll. 1913.—2.], [ B.C.A.Lep.Rhop. | Methionopsis | modestus, | Butl. | as the
lectotype of Methionopsis modestus Godman, 1901. This lectotype has left forewing with a tear at costa
and genitalia expanded for inspection. Its abdomen was at some point detached to open genitalia and
glued back. Finally, we note that VM. phaeomelas (South American species) and M. modestus (North
American species) are very close to each other genetically, e.g., their COI barcodes are basically identical
(1 bp difference between the type specimens). However, the nuclear genome tree confidently partitions
Specimens into two clades (Fig. 67 magenta and cyan) and we keep M. phaeomelas and M. modestus as
two distinct species pending further studies.
Papias microsema Godman, 1900, reinstated status
Currently treated as a junior subjective synonym of Celaenorhinus [sic!| phaeomelas Hiibner, [1829]
(type locality in Brazil), which in the section above we transferred from Papias Godman, 1900 (type
species Pamphila integra Mabille, 1891) to the subgenus Methionopsis Godman, 1901 (type species
Methionopsis modestus Godman, 1901), Papias microsema Godman, 1900 (type locality Mexico, (Tab),
Costa Rica, Panama, Brazil (MT)) does not belong to Mnasinous (type species Mnasinous patage
Godman, 1900) (Fig. 67) and therefore cannot be synonymous with Mnasinous (Methionopsis)
phaeomelas. We demonstrate that the type series of P. microsema is polytypic. A syntype from Mexico:
Tabasco, Teapa (NVG-21013E06 in CMNH) is indeed a distinct species of Papias (Fig. 67 green), and a
syntype from Panama: Chiriqui (NVG-15035F01 in MFNB) whose ventral side is illustrated by Godman
(1900) is Cobalopsis valerius (Moschler, 1879) (Fig. 67 olive). Although figured in the original
illustration, this specimen was among the two that Godman commented about in the original description
of P. microsema: “the spots ... are quite distinct in ... specimens ... from Chiriqui, which we are unable
... to dissect.” (Godman 1900). This phrase suggests that Godman considered these C. valerius specimens
to be variations of his P. microsema rather than typical representatives. Godman defined his concept of P.
45
microsema by genitalia: “P. microsema is exceedingly like P. phainis, but has differently formed
genitalia.” Godman figured genitalia of a male from Mexico: Tabasco, Teapa, and this specimen belongs
to Papias.
To define the identity of this name in a manner most consistent with the perceived intent of the
original author, N.V.G. hereby designates the specimen with genitalia illustrated in Godman (1900), in the
BMNH collection, that bears the following seven white labels, the first round with a red circle, others
rectangular: ( Type ), [ Teapa, | Tabasco. | Feb. H.H.S. ], [ 3 ], [ Sp. figured. ], [ 822 ], [ Godman-Salvin |
Coll. 1914.—5.], | B.C.A.Lep.Rhop. | Papias | microsema, | Godm. | and a microslide with genitalia no.
822 pinned to the specimen with its labels, as the lectotype of Papias microsema Godman, 1900, stat.
rest., which we reinstate as a species-level taxon. The lectotype has the anterior third of its left hindwing
broken off and glued back. At this point, we are not able to determine the identity of Cobalus
atramentarius Mabille, 1883 (type locality French Guiana: Cayenne), and for the lack of a better option,
keep this name as a junior subjective synonym of MM. phaeomelas while conducting research on this issue.
Papias unicolor (Hayward, 1938) and Papias monus Bell, 1942, reinstated status
Genomic sequencing of the holotype of Papias monus Bell, 1942 (type locality Guyana: Bartica) (Fig. 67
red) and a paralectotype of Papias phainis Godman, 1900 (type locality Mexico: Veracruz, Misantla)
from Guatemala together with other specimens of this species from Central America (Fig. 67 blue),
currently considered synonyms, reveals prominent genetic differentiation between them. E.g., their COI
barcodes differ by 6.3% (42 bp), which is a distance typical of species from different subgenera.
Moreover, a specimen from Brazil: SAo Paulo, NVG-21041F11, that we identified as Lerodea unicolor
Hayward, 1938 (type locality in Paraguay) that is currently treated as another junior subjective synonym
of P. phainis, is closely related, and yet separated in the genomic tree from compactly clustered Papias
monus specimens collected across the species range (Fig. 67). Therefore, we propose to reinstate these
taxa as species: Papias unicolor (Hayward, 1938), stat. rest. and Papias monus Bell, 1942, stat. rest. The
two species are very close to each other genetically (only 0.3%, 2 bp COI barcode difference) and may be
conspecific, but due to the genetic uniformity of P. monus across its wide range and the need to analyze
more specimens of P. unicolor, including the holotype, we resort to the two-species treatment.
We also note that South American Papias projectus Bell, 1942 (type locality in Ecuador) is
equally close to P. phainis: the same 0.3% (2 bp) COI barcode difference (Fig. 67). Likewise, additional
work is needed to better understand the relationship between these two taxa, and they are kept as species
pending further studies. Generally, we observe a marked genetic uniformity within species of Papias over
large geographic distances (Fig. 67) and therefore even small, but consistent genetic differentiation may
indicate speciation in this group of Hesperiidae.
Mnasilus guianae Lindsey, 1925 is confirmed as a junior subjective synonym
of Papias amyrna (Mabille, 1891)
Placing a recently obtained genomic sequence
of the holotype of Mnasilus guianae Lindsey,
1925 (type locality Guyana: Georgetown)
(Fig. 69 magenta) in a phylogenetic context
of specimens of Papias allubita (Butler,
1877) (type locality in Brazil: Para) and
Papias amyrna (Mabille, 1891) (type locality
> Papias amyrnaj1 Sensei DOpASPOSIET Pto Cabello|MFNB
= Papias amyrna (=guianae)|22043F08|HT|Guyana|1920|CUIC
;_Papias amyrna (= spelt EO a etd ie eer
~*Papias amyrna (=guianae)|22023D10|French Guiana|2004
Papias allubita (=penicillatus)|21108D01|ST|Guatemala]|CMNH
Papias allubita|7968|Costa Rica|O2-SRNP-13739
Papias allubita|19019D08|Panama|1974
Papias allubita|191 mol send are 969
Papias allubita|19122CO9|Brazil: alten
Papias allubita|19122C08|Ecuador|19
Papias allubita (=penicillatus)|21 108D02|ST|Brazill CNH
Venezuela: Porto Cabello) that include a | Fig. 69. Papias amyrna (red, above, Mnasilus guianae holotype is
syntype of Pamphila amyrna Mabille, 1891 labeled in magenta) and Papias allubita (blue, below).
(NVG-15036F04) confirms our previous identification of specimens from Guyana and French Guiana as
M. guianae and offers further support for Mnasilus guianae Lindsey, 1925 being treated as a junior
subjective synonym of Papias amyrna (Mabille, 1891).
46
Vidius pompeoides Grishin, new species
http://zoobank.org/SFA4FEDD-CCAD-4B2C-83 1A-46800F36442B
(Figs. 70, 71 part)
Definition and diagnosis. Inspection of a syntype of Cobalus catocala Herrich-Schaffer, 1869 (type
locality not given) in MFNB reveals that it is not the species Evans identified as such. The syntype has
pale postdiscal spots in cells RS-M; and Sc+Ri-RS on ventral hindwing aligned with each other, but in
the specimens Evans identified as “Cobalopsis catocala” the spot in cell RS-M; is closer aligned with the
spot in cell Mi-M>2 and away from the spot in cell Sc+Ri-RS (Evans 1955). We did not find an available
name for Evans’ misidentification of C. catocala and therefore it is a new species that is described here. It
keys to J.37.11 in Evans (1955) and is identified by the placement of spots on ventral hindwing as
detailed above; hindwing brown, most spots are joined into two pale bands: subbasal and postdiscal, but
the spot in cell Sct+Ri-RS is offset to the base from the posdiscal band while remaining closer to it than to
the subbasal band, and is separated from the subbasal band by a wide brown area; brown submarginal area
frosted with pale scales, more extensive around the cells Mj-M2 and M2-M3. Diagnosed by male genitalia
with elongated nearly triangular harpe distally narrowing to a point; tegumen with uncus broad in dorsal
view, approximately the same in width and length, uncus arms wide apart, hook-like. Differs from
Pompeius pompeius (Latreille, [1824]) by the costal cell with a pale spot only at the base and no spot next
to the postdiscal spot in cell Sct+Ri-RS, and the pale spots defined sharper, with some darker overscaling
inside the spots (Fig. 71); and from Vidius fraus (Godman, 1900) in having well-developed forewing
hyaline spots and narrower ventral hindwing bands. This new species is assigned to Vidius Evans, 1955
(type species Narga vidius Mabille, 1891) due to wing pattern and genitalic similarities with V. fraus
(Evans 1955), transferred from Cymaenes Scudder, 1872 to Vidius recently (Zhang et al. 2022b).
Fig. 70. Holotype of Vidius pompeoides sp. n. dorsal (left) and ventral (right) views, data in text. Photographs by Bernard Hermier,
© The Trustees of the Natural History Museum London and are made available under Creative Commons License 4.0 (https://creattvecommons.org/licenses/by/4.0/).
Type material. Holotype: < deposited in the
Natural History Museum, London, UK (BMNH),
illustrated in Fig. 70, bears five labels: a round
yellow (515 ), others rectangular, three white [ Sto.
Paulo | Amazones | M de Mathan | 8°°.9>.1879 ],
| PHOTO | AA ], [ R. Oberthtir Coll. | Brit. Mus.
1931-136 ], and one red [HOLOTYPE < | Vidius
pompeoides | Grishin ], and a small card pinned as a
label with genitalia glued to it. Paratypes: 2¢¢
Brazil: Para: Juruti (label data “Juhuty, Amazons’),
April-1905, leg. M. de Mathan, in BMNH.
Fig. 71. Vidius pompeoides sp.n., (left) and Pompeius
pompetus (right). iNaturalist observations 38437160, Suriname: Commewijne
Type locality. Brazil: Amazonas, S40 Paulo de © Teri and 87229810, Brazil: DF, Brasilia © Carlos A S Correia, respectively,
CC BY-NC 4.0 https://creativecommons.org/licenses/by-nc/4.0/
Olivenga.
47
Etymology. By adding the suffix —oides, the adjectival name reflects superficial similarity of this species
in its contrasting ventral wing pattern to frequently encountered and widely distributed Pompeius
pompeius (Fig. 71 right) that has been confused with it (despite not being a close relative). For instance,
the individual shown in Fig. 71 left was identified as P. pompeius on the iNaturalist website (2022) at the
time of this writing.
Distribution. Known from the Amazonian region: Brazil (Amazonas and Para) and Suriname.
Curva Grishin, new genus
http://zoobank. org/E623 E22 1-BD77-4ADE-A01D-5C34E79B443B
Type species. Voeris hyagnis Godman, 1900.
Definition. Sister to Halotus Godman, 1900 (type species Halotus saxula Godman, 1900, which is a
junior subjective synonym of Hesperia — Moeris hyagnis hyagnis|21041G07|Guatemala|1993
I] Plot 1886 d i imil to it i ; Moeris hyagnis hyagnis|21041G08|Costa Rica|1984
angetlus OZ, ) and 1S simular to it mM Psoralis darienensis|21041G04|Costa Rica|O7-SRNP-35407
Psoralis darienensis|22035F07|Panama:Darien|1983
the general shape of uncus and gnathos, but *“Psoralis darienensis|22035F09|Panama:Darien|1984
1 1 1 Halotus angellus|18013A12|Panama|1976
quite different in ap Peete and the shape of : Halotus jonaveriorum|8035|Mexico:Oaxaca|1990
valva to be readily associated with Halotus | Halotus rica|19021H12|Mexico:Puebla|1991
: Godmia chlorocephala|19023F01|Panama|1975
(Fig. 72). Therefore, proposed here as a Thoon modius|19022H10|Colombia|1969
a one é . ; Se Niconiades xanthaphes|18013B02|Guyana|2000
genus. Distinguished from its relatives by a Rhomba gertschi|18025H11|HT|Panama|1936|AMNH
: : o- Joanna joanna|7953|Costa Rica|04-SRNP-14377
unique shape of the valva with harpe concave eS Pares pares|18026E08|HT|Paraquay|AMNH
; ; : : Alerema simplex|18026G11|HT|Brazil:SC|AMNH
at the distal margin and its dorsal margin Gufa gulala|18113F02|ST|Brazil:Parana|USNM_
smoothly folded over towards the aedeagus, Chitta chittara (=alis)|18025D04|HT|Brazil:SC|AMNH
Species we place in this genus (Godman 1900; Gaviria et al. 2018). In DNA, a combination of the
following base pairs in nuclear genome is diagnostic: aly281.8.7:C389T, aly525.63.1:T1176C,
aly2532.10.1:A2013G, aly2258.4.17:T108C, and aly276558.21.5:A255G.
Etymology. The name is treated as a feminine noun in the
nominative singular, given for the shape of the valva: Latin for
curved, crooked, bent, or a fusion of Cur[ved] + [val]va, and,
maybe an unintended Russian meaning for the difficulty of
figuring these skippers out.
Species included. The type species (Fig. 73) and Psoralis
darienensis Gaviria, Siewert, Mielke & Casagrande, 2018 (Fig. 74).
Parent taxon. Subtribe Moncina A. Warren, 2008.
Fig. 73. Curva hyagnis from Belize: Cayo
District, Green Hills Butterfly Ranch.
C omment An alternativ e treatment c oul d b e to plac e this new iNaturalist observation 37801765, color-corrected, rotated, and
. cropped, © Jan Meerman, CC BY-NC 4.0
genus as a Subgenus of its sister Halotus, to which it is related bubs. pieativeen muons cre Meessrsipy neg
phylogenetically (Fig. 72), but seems rather distinct from in genitalia, especially in the diagnostic shape of
valva. Therefore, we treat the two as separate genera.
1cm
Fig. 74. Curva darienensis comb. nov. from Panama: Darien, Cana, 1550 m, leg. G. B. Small [USNM]. a. 4 NVG-22035F08,
10-Apr-1983; b. 9 NVG-22035F07, 11-Apr-1983. Dorsal and ventral views are shown to the left and right from each letter.
48
Nastra leuconoides (Lindsey, 1925), reinstated status
Genomic sequencing of its holotype reveals that Megistias leuconoides Lindsey, 1925 (type locality
Brazil: Amazonas, Porto America) 1s Nastra leucone leuconoides|22043G01|HT|Brazil:AM|1920|CUIC
: : Nastra leucone leuconoides|21047G12|Ecuador|1998
not conspecific with Nastra leucone Nastra subsordidal15035E09|HT|Honduras|1988|MFNB
(Godman, 1900) (type locality in
0.42
Nastra subsordida|21047H02|Costa Rica|1971
Nastra subsordida (=trimacula)|18026HO8|HT|Panama|1963|AMNH
Guatemala) and instead is a close sister = Nee Sree aoa ALI Sale
. . astra subsordida cuador
to Nastra subsordida (Mabille, 1891) Nastra leucone leucone|7567|Mexico:Tam|1975
: ; : ,eastra leucone leucone|17106A10|Costa Rica|12-SRNP-76600
(type locality in Honduras) (Fig. 75, Z 0.003 Nastra leucone leucone|19017G03|Panama|1962|USNM
chromosome tree). The COI barcodes Fig. 75. Nastra leuconoides (red), N. subsordida (blue), and N. leucone
of the two holotypes (IM. leuconoides (magenta). Primary type labels are highlighted in green.
and N. subsordida) differ by 2% (13 bp). Therefore, we reinstate it as a species-level taxon Nastra
leuconoides (Lindsey, 1925), stat. rest.
Rayia Grishin, new subgenus
http://zoobank.org/7EA724D4-4F7B-4809-A49E-DBD I DBCCECA5
Type species. Vastor perigenes Godman, 1900.
iti | 1 Nastra leucone|17106A10|Costa Rica|12-SRNP-76600
Definition. Currently included ee the genus Nastra subsorda (rmacula||€G26H0e}T/Panamajaun
; astra celeus uyana
Nastra Evans, 1955 (type PPECISs, Hesperia : Nastra ethologus|18063A1 Paraguay)2011
lherminier Latreille, [1824]), and is sister to Nastia nappalldOt7GoTioINayloo!
and more distant from other species in the Aes eatanrese FL Levy cojzo15.
f ° . . awastra neamatnia e 0
genus (Fig. 76). Due to its close relationship Nastra neamathlay47471USA EL Lewy Coy Bote. sy
: : oye ° astra inerminier usca Mi
with Nastra and monotypic composition, it Nastra julia}1511 (co HUSA TX, Pharr 1944)AMN
: . , Nastra juliaj3827|USA: TX,Kleberg Co
is proposed as a subgenus. Keys to J.24.6 in £2 Nastra julial7560|USA: TX, Galveston Co. 1972
one f : 7 Nastra julia|5211|USA: Tx,Starr Co.|2015
Evans (1955). Distinguished from __ its D hee julalb496)USA. Tx Bastrop Co |2009
0.26
herminier ee AR Montgomery Co|2015
Nastra Iherminier|4153|USA: TX,Hardin Co. 2015
Nastra Ihermenier|7254|USA:MD Baltimore Co.|1988
Nastra Ihermenier|7303|USA:SC Georgetown Co|1974
Nastra sed | 137|USA:FL Liberty Co.|2017
relatives by the following combination of
characters: in addition to pale veins on the
0.21
1 1 1 Nastra perigenes|17111E05|USA:TX,Cameraon Co.|1963
ventral hindwing, a pale ray from the wing ie : Serieresl Fan |EogUSA Ts Caner en Ga l3e3
astra perigenes exico lapas
base to near the outer margin along the | }. Lereaes I2 hrostictus| 1991 Sosferaz DFLN994
. 7 a a 2 erodeéa eufala allas Co.
anterior discal cell and vein Mi; (Fig. 77); Lerodea arabus|3384|U AT Hidalgo’ Co J2015
uncus with gnathos massive, nearly as | Fig. 76. Nastra (Rayia) perigenes (magenta), N. fusca (red, neamathla
broad as wide and tall; and valva nearly its synonym, primary types labeled in red), and N. /herminier (blue).
rectangular, harpe upturned, only slightly constricted in the middle, ending
with a dorsally serrated narrow margin, distal margin convex, without
prominent indentation. In DNA, a combination of the following base pairs
is diagnostic in nuclear genome: aly276558.30.2:T42C, aly322.14.2:
T418C, aly2379.9.2:A57G, aly1341.12.28:A8953C, and aly822.48.1:
T354G; and in COI barcode: T85C, A241T, T457C, T499A, and A628T.
Etymology. The name is a feminine noun in the nominative singular,
given for the pale ray on the ventral hindwing of the type species. Fig. 77. Nastra (Rayia) perigenes
a ; from USA: Texas, Cameron Co.
Species included. Only the type species. iNaturalist observation 8949490, brightened and
cropped, © jamesgiroux, CC BY-NC 4.0
https://creativecommons.org/licenses/by-nc/4.0/
Parent taxon. Genus Nastra Evans, 1955.
Lerodea neamathla Skinner & R. Williams, 1923 is a junior subjective synonym
of Nastra fusca (Grote & Robinson, 1867), reinstated status
Sequencing and comparative phylogenetic analysis of a syntype of Hesperia fusca Grote & Robinson,
1867 (type locality in USA: GA & FL), female in AMNH, currently a junior subjective synonym of
49
Nastra lherminier (Latreille, [1824]) (type locality in USA: Carolina) places it in the clade with the
holotype of Nastra neamathla (Skinner & R. Williams, 1923) (type locality in USA: Florida) (Fig. 76),
and we conclude that the two type specimens are conspecific. Being a nearly comme brown female,
this syntype is a challenge to identify as N. neamathla without genetic
comparison. Nevertheless, closer inspection reveals traces of at least 2 pale
small spots on each forewing in places characteristic of N. neamathla (Fig.
78) and almost never defined in females of N. /herminier. Because the name
fusca has priority over neamathla leading to an undesirable name change, we
looked for male syntypes (only one female syntype existed), hoping that, if
found, at least one (out of three in existence) may be conspecific with N.
lherminier as traditionally assumed. Nevertheless, it is also possible that all
three male syntypes were conspecific with N. neamathla, because paler
ventral hindwing veins characteristic of N. Jherminier were not mentioned in | Fig: 78. Nastra fusca, stat.
cy ie ; ; ; rest., formerly N. neamathla,
the original description. Inspection of every Nastra specimen from Georgia | USA: Florida, Alachua Co.
and Florida in AMNH did not reveal any candidate syntypes, because all the pp iets Se Rng it
specimens were either collected more recently, or, if the date was not given, _ |_htps//creativecommons org/licenses/by-ne/4.0/
there was nothing on their labels to associate them with the original description of H. fusca. We found a
series of specimens in MFNB labeled as fusca, and although most of them were indeed N. lherminier,
males from Georgia were collected by Morrison (and not Ridings or Linden as per description) and
therefore are not syntypes. Hence, we assumed that the male syntypes were lost or are unrecognizable.
First, to ensure nomenclatural stability and unambiguous identification of N. fusca, N.V.G. hereby
designates its sole extant syntype, female in AMNH (Fig. 79), bearing the following five rectangular
labels, the fourth one red and others white: [ Ga. |, [ No. 23113 | Grote & Robin |, [ Pamphila | fusca |
type. G&R ], [ TYPE| No. | A. M. N. H. ], and [ Overlooked by | Beut. in his | various lists | (Beut. is for
William Beutenmiller) as the lectotype of Hesperia fusca Grote & Robinson, 1867. Second, this
lectotype designation implies that Lerodea neamathla Skinner & R. Williams, 1923, syn. nov. is a junior
subjective synonym of Nastra fusca (Grote & Robinson, 1867), stat. rest. On the one hand, the name
change is not desirable, and the broader community of lepidopterists should decide whether to request
ICZN to set the lectotype of N. fusca aside and designate a neotype conspecific with N. [herminier. On the
other hand, the name fusca may be simpler than neamathla to remember.
Fig. 79. Lectotype of Nastra fusca (Grote & Robinson, 1867), stat. rest. with labels (not to scale), photos by Bernard Hermier.
Saturnus Jaguar (Steinhauser, 2008), new combination
Parphorus jaguar Steinhauser, 2008 (type locality in Guyana, holotype NVG-15041A03 sequenced) (Fig.
80 olive) is not monophyletic with Parphorus Godman, 1900 (type species Phlebodes storax Mabille,
1891) (Fig. 80 red) and instead is very closely related to Saturnus metonidia (Schaus, 1902) (type locality
in Brazil: Rio de Janeiro) within Saturnus Evans, 1955 (type species Papilio saturnus Fabricius, 1787)
(Fig. 80 blue). Therefore, we propose Saturnus jaguar (Steinhauser, 2008), comb. nov. Despite close
relationship between S. metonidia and S. jaguar as suggested by their 1.8% (12 bp) different COI
barcodes, they are likely distinct species inhabiting different biogeographic zones.
50
Parphorus harpe (Steinhauser, 2008), new combination
Saturnus harpe Steinhauser, 2008 (type locality in Peru: Madre de Dios, holotype NVG-15038D04
sequenced) (Fig. 80 green) is not monophyletic with Saturnus Evans, 1955 (type species Papilio saturnus
Fabricius, 1787) (Fig. 80 blue) and instead is siter to Parphorus Godman, 1900 (type species Phlebodes
storax Mabille, 1891) (Fig. 80 red). Not willing to erect a monotypic genus for S. harpe due to genetic
similarities: COI barcodes of its holotype and P. storax are 8.2% (54 bp) different, we propose to include
it in Parphorus to form Parphorus harpe (Steinhauser, 2008), comb. nov. The tree reveals that Parphorus
and Saturnus are closely related to each other, without long internal branches separating them, and P.
harpe 1s a species that contributes to this lack of separation, originating early in evolution of the genus.
Parphorus hermieri Grishin, new species
http://zoobank.org/E5 ADODFC-354C-442F-8A56-C6F989C38C0D
(Fig. 80 part)
Definition and diagnosis. A species (Fig. 80
top and magenta in the tree) with unique for
Parphorus Godman, 1900 (type species
Phlebodes storax Mabille, 1891) (Fig. 80 red)
predominantly yellow-orange wings, both
dorsally and ventrally, reminiscent of Lento
Evans, 1955 (type species Pamphila lento ie :
Mabille, 1878) (Fig. 80 orange) in color and | Pt om
Parphorus storax|19019F08|Panama|1973
pattern, | but not closely related to Lento, Parphorus hermieri|21046D03|HT|Brazil:RO|1995|MGCL
originating within Parphorus close to its type oF Papo aeeoral! ehh i ocaae ae Sees
: att ; arphorus pseudecorus razil:
species. Most similar to Lento kadeni Evans, Parphorus felta]19019G01|Ecuador|2002
. . . Saturnus harpe|15038D04|HT|Peru|1981|MGCL
1955 (type locality not specified) in general Saturnus harpe|21013G02|Bolivia|1915
: Saturnus metonidia|18116A01|ST|Brazil:RJJUSNM
appearance and wing patterns and therefore °Saturnus metonidia|19024A10|ST|Brazil:RJ|USNM
i y y Parphorus jaguar|15041A03|HT|Guyana|1980|MGCL
keys to 1.3.4. in Evans (1955) but differs in , *barphorus jaguar|21047D03/PT|Guyana|1980
1 1 Saturnus fartuga|]18113E07|ST|Brazil:RJ|USNM
being yellower rather than Oranoy and in Saturnus saturnus|18013C01|Guyana|2000
having brown-scaled areas narrower, e.g., Silas eee ree ate te Se
: ; udens ludens osta Rica|11- -
ventral forewing with well-separated dark- Virga virginius|8018|Brazil:RO|1990
: Lento lento|18012F03|Brazil:MT|1991
brown spots near tornus instead of a Rigga auristriga|19019G07|Bolivia|2003
continuous brown patch in L. kadeni; dorsal Fig. 80. Holotype of Parphorus hermieri sp. n. (inset shows
hindwing with yellow-orange ray along vein magnified stigma) and the tree: Parphorus (red) and Saturnus
(blue). Species discussed in the text are labeled in different colors.
1A+2A (only some orange scales, mostly
hair-like, around this vein in L. kadeni but not a ray). Androconial patch triangular, filling the base of cell
CuA-CuA2, plus a small dash just below it and vein CuA2 (Fig. 80 top, inset).
Barcode sequence of the holotype: Sample NVG-21046D03, GenBank OP231469, 658 base pairs:
AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACATCTTTAAGTTTATTAATTCGTACAGAATTAGGTAATCCTGGTTCTTTAATTGGGGATGATCAAATTTATAATACT
ATTGTAACAGCTCATGCATTTATCATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCCTTAATATTAGGAGCTCCTGATATAGCTTTCCCTCGAA
TAAATAATATAAGATTTTGAATACTACCCCCTTCTTTAATACTATTAATTTCTAGAAGAATTGTAGAAAATGGTGCAGGAACTGGATGAACTGTTTACCCTCCTTTATCTTCAAATATTGC
TCATCAGGGAGCTTCTGTTGATTTAGCAATTTTTTCTTTACACTTAGCAGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATCAATATACGAATTAGAAATTTATCA
TTTGATCAAATACCTTTATTTGTTTGATCAGTAGGAATTACAGCACTTTTATTACTCTTATCTTTACCAGTGTTAGCTGGTGCTATTACTATACTTTTAACTGATCGAAATTTAAATACTT
CATTTTTTGATCCTGCAGGAGGAGGAGATCCTATTTTATACCAACATTTATTT
Type material. Holotype: ¢ at the time of publication deposited in the McGuire Center for Lepidoptera
and Biodiversity, Gainesville, FL, USA (MGCL), bears four rectangular printed labels: three white
| BRASIL: Rondonia | 3 km W of Candeias | on BR 364, | km S | on dirt road to Rio | Preto | 6 November
1995 | leg. G. T. Austin |, [ G.T. Austin colln. | MGCL Accession | # 2004-5 |, [ DNA sample ID: | NVG-
21046D03 | c/o Nick V. Grishin ], and one red [HOLOTYPE © | Parphorus | hermieri Grishin ].
Paratype: @ Peru: Loreto, Castafia, —0.8037, —75.24, 150 m, 20-Oct-1993, leg. R. K. Robbins [MUSM].
Type locality. Brazil: Rond6nia, 3 km west of Candeias do Jamari on interstate BR-364, then 1 km south
on dirt road.
Etymology. The name honors Bernard Hermier (French Guiana), an expert on Neotropical Hesperiidae
51
generously sharing his vast knowledge and time discussing challenging aspects of nomenclature and
taxonomy, who encouraged to describe this species. Bernard’s kindness and generosity are unsurpassed
and much valued by naturalists across the world. The name is a masculine noun in the genitive case.
Distribution. Known only from two specimens from Brazil: Rond6nia and Peru: Loreto.
Comment. Due to superficial similarities of this new Parphorus species with Lento kadeni, we tentatively
suggest Parphorus kadeni (Evans, 1955), comb. nov., reasoning (without solid evidence) that it fits better
in Parphorus than in Lento. Sequencing of the P. kadeni holotype will test this taxonomic hypothesis.
Metiscus goth Grishin, 2022 confirmed as a species-level taxon by DNA
Proposed without DNA sequence data as a name for Evans’ concept of Enosis angularis infuscata (Pl6tz,
1882) (misidentification, Hesperia infuscata Pl6tz, 1882 is instead a junior subjective synonym of
Mnaseas derasa derasa (Herrich-Schaffer, 1870) (Zhang et al. 2022b)), Metiscus goth Grishin, 2022 (type
locality Costa Rica) is closely related to Metiscus Metiscus goth}22035G01)PT|Costa Rica] USNM
angularis (M6schler, 1877) (type locality Suriname). Metiscus goth|22035F12|PT|Costa Rica|USNM
: : Metiscus goth|22035G02|PT|Costa Rica|USNM
Genomic sequencing of three M. goth paratypes and —— Metiscus goth|21014B05|Costa Rica|CMNH
an additional specimen, and their comparison with og ais ee oat ee
} : z ! : M. angularis (=parvipuncta)|21114D05|ST|Suriname|1876|MFNB
M. angularis, including primary type specimens, Metiscus angularis (=astur)|15036F08|ST|Brazil:AM|MFNB
reveals prominent genetic differentiation (Fig. 81) Mie gua peo ORs L eicmnea bel wees
with Fs/Gmin statistics of 0.42/0.02, and their COI Wigs SE BUCS CUE GG), Greta eeS AOI):
barcodes differ by 2.4% (16 bp). Therefore, we confirm M. goth as a species-level taxon and provide the
COI barcode sequence of M. goth, identical in all four specimens (GenBank OP323 110—OP323113):
AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGTTTATTAATTCGAACAGAATTGGGGAATCCTGGCTCTTTAATCGGAGATGATCAAATTTATAATACT
ATTGTAACTGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTACCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCACGAA
TAAATAATATAAGTTTTTGAATATTACCTCCTTCATTAATATTATTAATT TCAAGAAGAATT GTTGAAAATGGT GCAGGAACAGGATGAACAGTTTACCCCCCACTTTCTTCTAACATTGC
CCATCAAGGATCTTCAGTAGATTTAGCAATTTTTTCTTTACATTTAGCAGGAATTTCCTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAAAAGATTATCA
TTTGACCAAATACCTTTATTTGTTTGATCAGTAGGTATTACAGCTTTATTATTATTACTATCTTTACCTGTATTAGCTGGAGCTATTACCATACTTCTTACTGACCGAAATTTAAATACTT
CATTTTTTGACCCAGCTGGTGGAGGAGATCCTATTTTATACCAACATTTATTT
Panoquina ocola distipuncta Johnson & Matusik, 1988 is a subspecies of
Panoquina lucas (Fabricius, 1793)
Genomic sequencing of a paratype of Panoquina ocola distipuncta Johnson & Matusik, 1988 (type
locality in Dominican Republic) (Fig. Panoquina ocola ocola|15097F07|NT|USA-FL|CMNH
: z7— Panoquina ocola ocola|5158|USA:TX, Hidalgo Co.|2015
82 green) reveals that it does not Panoquina ocola ocola|8225|USA:FL.Miami-Dade Co.|2017
: Panoquina ocola ocola| 10409|Jamaica|2017
belong to the clade with the neotype of Panoquina ocola ocola|21012G07|Puerto Rico|1964
; Panoquina ocola ocola|18112D06|Guyana|1999
Panoquina ocola ocola (W. H. Ed- Panoquina ocola ocolal21012HO4|Brazil-Para|1919
: . Panoquina ocola ocola|21012G10|Mexico:Oaxaca|1961
wards, 1863) (type locality in USA: 7 Panoquina ocola ocola|21012HO3|French Guiana|1917
: ; : nee Panoquina ocola ocola|21012H02|Trinidad|1932
Florida) (Fig. 82 blue), but instead is in Panoquina ocola ocolal21012H01|Colombia
i . Panoquina ocola ocola|21012G12|Costa Rica|1902
the clade with Panoquina lucas (Fab- Panoquina ocola ocola|21012HO07|Bolivia|1913
nae 1793 t 1 iF “South Seite el ae cool Aa 1 OSL] Cuba a
anoquina lucas (=sylvicola uba
Be US ) ( ype OCs ity pia : Pancquina lucas ( lvicola)|15034HO6|LT|Cuba|MFNB
American Islands”, meaning the West | ; set lhe te EST cuba 943
1 1 1 1 4° “Panoquina lucas (=woodrutfi)|18112E02|Puerto Rico|1962
Indies) (Fig. 82 olive). This placement Pajoqulna lucas 1411 Ol Bola| 2003 i eats
hof7 ithi . anoquina lucas razil:Sao Paulo
of P. ocola distipuncta within P. lucas | Ban Sate lcasf210 aoc cess ul ara 911961 ee
: : : ; : anoquina ocola distipuncta om. Rep.
is consistent with the wing patterns: 2 _ Panoquina cas 180, 7609 JUSACTX Hidalgo Co 2004
: : anoquina lucas uyana
both taxa possess a forewing discal cell Panoquina lucas|18112E04 Marinigue|19¢9]USNM
. . . : anoquina hecebolus exico:Chiapas
hyaline spot typically lacking in P. = “Panoquina hecebolus (=parlis)/18034H 10)ST|Panama|MFNB
ote : anoquina hecebolus exico: Tamaulipas
ocola. Hence, P. ocola distipuncta is P. 0.01 - Parloquine pecebousls 3 a¥iijVenezuel
: 7 anoquina hecebolus exico:Guerrero
lucas, and we propose a new species- o{100.19 : Panoguina 0, Ocola (cortyaa|21 1SAG8fH T Suiname|1874]MENE
; cas ; anoquina hecebolus rench Guiana
subspecies combination Panoquina ot eae pale hecebolusits112D06! razil:Mato Ciaesol1991
lucas distipuncta Johnson & Matusik, Fig. 82. Panoquina ocola (blue, above, neotype colored), P. /ucas (olive,
1988. comb. nov. As a result. P. ocolg middle) with P. /ucas distipuncta (green) as its subspecies, and Panoquina
: hecebolus (red, below) with Pamphila ortygia as its synonym (magenta).
becomes monotypic.
Pamphila ortygia Moschler, 1883 is a junior subjective synonym of
Panoquina hecebolus (Scudder, 1872)
Genomic sequencing of the holotype of Pamphila ortygia Mo6schler, 1883 (type locality in Suriname)
currently treated as a junior subjective synonym of Panoquina ocola ocola (W. H. Edwards, 1863) (type
locality in USA: Florida, neotype NVG-15097F07 sequenced) placed in the phylogenetic context of the
three Panoquina Hemming, 1934 (type species Hesperia panoquin Scudder, 1863) species from the ocola
group reveals that it is not associated with P. ocola (Fig. 82 blue) and instead belongs to Panoquina
hecebolus (Scudder, 1872) (type locality Mexico: Oaxaca, Tehuantepec) (Fig. 82 red). Specimens of P.
hecebolus do not show notable genetic differentiation across their range and we propose that Pamphila
ortygia Moschler, 1883 is a junior subjective synonym of Panoquina hecebolus (Scudder, 1872), new
synonym placement.
Zenis hemizona (Dyar, 1918) and Zenis janka Evans, 1955
are Species distinct from Zenis jebus (Plétz, 1882)
The LZ chromosome tree shows strong genetic Zenis par|18112F09|HT|Peru:Cuzco|2016|USNM
differentiation between taxa of Zenis Godman, " Zenis par|18092B10|PT|Ecuador|2012
. . . . Zenis jebus hemizona|18113F05|HT|Mexico| USNM
1900 (type species Hesperia minos Latreille, ; “Zenis jebus hemizona|19013B08|Mexico:SLP|1975
i Zenis jebus hemizona|19013B09|Mexico:Tam|1974
[1824]) . (Fig. 83) that have been treated as Zenis jebus janka|7932|Costa Rica|12-SRNP-20041
ae A jebus j
subspecies or synonyms of Hesperia jebus Plotz, Zenis jebus janka|17112A04|Venezuela|1993
1882 (t | litv in B 1): P h . Zenis jebus jebus|18112F10|Brazil:SP|1991
(type locality in Brazil): Prenes hemizona Zenis minos (=melaleuca)|18052A10|LT|Brazil:RJ|1872|MFNB
Dyar, 1918 (type locality in Mexico) and Zenis ‘Zenis minos|18112F 11|Brazil:RJ|1994 .
jebus janka Evans, 1955 (type locality Panama: | !% eee Lee tai par a x ae Hag eras ue)
Bugaba). First, we agree with Evans’ (1955) GES dg Ea eee eee
identification of the nominotypical Zenis jebus, which is the only taxon that has four semi-equal short
apical dashes on forewing, exactly as per original description. Second, compared to such a specimen from
Brazil (NVG-18112F10), COI barcodes of Z jebus hemizona holotype (NVG-18113F05) and Z. jebus
janka from Costa Rica (NVG-7932) differ by 6.4% (42 bp) and 6.2% (41 bp), respectively. Therefore, we
propose to reinstate Zenis hemizona (Dyar, 1918), stat. rest. and treat Zenis janka Evans, 1955, stat. nov.
as species. Comparison of wing patterns of these species confirms that they typically can be distinguished
by the number, relative size, and placement of forewing subapical hyaline spots. Furthermore, the tree
reveals a new species-level taxon (Fig. 83 red) that is described below.
Zenis par Grishin, new species
http://zoobank.org/3 19B5691-012A-42D5-8325-DF7D384333D9
(Figs. 83 part, 84, 85)
Definition and diagnosis. Sister to Zenis hemizona (Dyar, 1918) differing from it by 4.3% (28 bp) in the
COI barcode, which, in the presence of wing pattern differences described below and likely stemming
from notable nuclear genomic differentiation (Fig. 83) support species-level status of this taxon. This is
the species that Evans (1955) identified (incorrectly) as Zenis jebus melaleuca. However, not all
Specimens misidentified by Evans as Z. 7. melaleuca are this species: the female from “Espirito Santo” is
Zenis jebus beckeri O. Mielke & Casagrande, 2002 (type locality in Brazil: Espirito Santo) that differs in
the forewing apical spot pattern and has a white streak along ventral hindwing vein 1A+2A. This new
species keys to O.3.2.(b). in Evans (1955). Distinguished from other Zenis species by nearly equal in
length, strongly elongated apical hyaline spots in forewing cells Rs-M, (shorter spot) and M2-M3 (longer
spot), dash-like well-developed hyaline spots in cells R2-R3, R3-R4, and R4-Rs adjoined to each other and
separated by dark veins, the lack of a white streak along vein 1!A+2A on hindwing ventral (Figs. 84, 85),
and a combination of the following characters in the COI barcode: T38C, C235T, T478C, and T490C.
53
Fig. 84. Holotype of Zenis par sp. n. dorsal (left) and ventral (right) views, NVG-18112F09, data in text.
Barcode sequence of the holotype: Sample NVG-18112F09, GenBank OP23 1468, 658 base pairs:
AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATACTAGGTACTTCATTAAGTTTATTAATTCGAACAGAAT TAGGAAAT CCTGGTTCTTTAATCGGAGATGATCAAATTTATAACACT
ATTGTTACAGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCAGACATAGCTTTTCCTCGAA
TAAATAATATAAGATTTTGAATATTACCCCCTTCATTAACTTTATTAATT TCAAGAAGAATT GTAGAAAACGGT GCAGGAACAGGATGAACCGTTTACCCCCCTCTTTCTTCTAATATTGC
TCATCAAGGTGCATCTGTTGATTTAGCAATTTTTTCTTTACATTTAGCAGGAATTTCATCAATTTTAGGAGCCATTAATTTTATTACTACAATTATTAATATACGAATTAAAAACTTATCA
TTTGACCAAATACCTTTATTTGTTTGATCAGTAGGTATTACAGCTTTATTATTACTTTTATCTCTTCCTGTTTTAGCTGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACAT
CTTTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATACCAACATTTATTT
Type material. Holotype: ¢ in the National Museum of
Natural History, Washington, DC, USA, to be deposited in
the Museo de Historia Natural, Lima, Peru (MUSM), bears
four rectangular printed labels: three white [ PERU: Cuzco
1194 m. | Quebrada Santa Isabel | Cosfipata Valley 5048 |
24-X-2016 Kinyon ], [ DNA sample ID: | NVG-18112F09 |
c/o Nick V. Grishin |], [| USNMENT | {QR code} |
01531411 ], and one red [HOLOTYPE <¢ | Zenis par |
Grishin ]. Paratypes: 94.4, NVG-18092B10 from Ecuador:
Morona-Santiago, Méndez, GPS —2.42, —78.20, 800 m, |— .
leg. J.-C. Petit, 16-Nov-2012, others (one specimen per [Pare cene Par Poles orm tonne OoBENCKO
date, all in MUSM) from Peru: Amazonas: Quebrada SS AeA VECO OU Soe Crees ne
Chingaza, —5.367, —78.45, 500 m, 22-Sep-1999, leg. D. H. Ahrenholz; same data, but 24-Sep-1999, leg.
G. Lamas; Cuzco: Cosfiipata Valley: Quebrada Quitacalzon, —13.017, —71.50, 1050 m, 2-Apr-2015 & 1-
Nov-2016, leg. S. Kinyon, and Quebrada Santa Isabel, —13.033, —71.517, 1200 m, 26-Jan-2020, leg G.
Lamas; Madre de Dios: Puerto Maldonado, Lago Sandoval, [-12.583, —69.183], 200 m, 24-Oct-1990, leg.
J. R. Macdonald; Tambopata Reserve, —12.833, —69.283, 300 m, 29-Oct-1991, leg. O. Mielke; Alto Rio
Madre de Dios, Albergue Amazonia, —12.867, —71.383, 500 m, 1-May-2015, leg. G. Lamas.
Type locality. Peru: Cuzco, Cosfiipata Valley, Quebrada Santa Isabel, elevation 1194 m.
Etymology. The name, which is a Latin adjective for equal, stands for the two nearly equal in length
dashes in forewing cells Rs-M; and M2-Ms3 that remind of an equal sign =.
Distribution. Currently confirmed by DNA from Ecuador and Peru, but likely present in Colombia and
Amazonian region in Brazil.
Calpodes chocoensis (Salazar & Constantino, 2013), new combination
Placing genomic sequences of two specimens of Megaleas chocoensis Salazar & Constantino, 2013 (type
locality Colombia: Valle del Cauca) (Fig. 86) in the context of Hesperiidae revealed a surprise. Instead of
being close to Megaleas syrna (Godman & Salvin, 1879), the type species of Megaleas Godman, 1901,
they were positioned deep within Calpodes Hiibner, [1819] (type species Papilio ethlius Stoll, 1782)
54
Fig. 86. Sequenced specimens of Calpodes chocoensis from Colombia: Valle del Cauca, ~20 mi NW of Cali. a. 6 NVG-
21109C02, b. 2 NVG-21109C03. Dorsal and ventral views are shown to the left and right from the letter. © Pierre Boyer.
being a strongly supported sister to Calpodes ethlius|4914|USA:FL, Marion Co |2015
‘ . Calpodes triangularis|18112HO8|/Panama|1981
Calpodes severus (Mabille, 1895) (Fig. Calpodes fischer|18112G06|Guyana|2000
; : — Calpodes esperi]18112G04|Guyana|2000
87). Convergence with Megaleas in large Calpodes placens|18112H03|Costa Rical1977
: oH — Calpodes salius|18012E03|Guyana|2000
yellow or orange forewing spots and Calpodes longirostris|18119HO4|Costa Ricaj05-SRNP-55601
di f th ise Reali [7 Megaleas ehocoensis|21109¢02|colombia
a om ne a es ue a ! = ‘Megaleas chocoensis|21 198C03|Colombia
= HY alpodes saladin|18112H10|/Panama|1
Palen ys a vee 5 a rope Is the _Calpodes antoninus|7833\Costa Rical2009|09-SRNP-527
aipogdes cniomaraj1o1 | 1|braziliParana "
aan OF at C1assl ee a Galsades Te MUtpa ted EAC APreel Gerke Catarinal1 988
Calpodes salva|18112H04|Venezuelal]1984
Genita 1c morp ology and the shape o acapoies usta 2G08)8 2 Nato orossai190
rytonopsis aevaj 12262 “cocnise CO )2U'
forewing apical spots, however, support — Nocsiegs syrna|18081A12|HT|Costa RicalNHMUK 010432595
the relationship of M. chocoensis with Tisias myna|7926|Costa Rica|2008|07-SRNP-66 147
Calpodes, and we propose to place it in Fig. 87. Megaleas chocoensis (red) belongs to Calpodes (blue).
this genus as Calpodes chocoensis (Salazar & Constantino, 2013), comb. nov. The COI barcode sequences
of the two C. chocoensis specimens (Fig. 86) are identical (GenBank OP231470 & OP231471) and within
3% difference from some other Calpodes species, unambiguously indicating congeneric relationship:
AACTTTATACTTTATTTTTGGTATTTGAT a aaa TATTAGGTACTTCATTAAGTTTATTAATTCGTACTGAATTAGGTAATCCTGGTTCTCTAATTGGAGATGATCAAATTTATAATACT
ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTCGGAAATTGATTAGTTCCTTTAATATTAGGTGCCCCTGATATGGCTTTCCCTCGAA
TAAATAATATAAGATTTTGAATACTTCCCCCTTCATTAACTTTATTAATTTCAAGAAGAATTGTAGAAAAT GGTGCAGGAACAGGTTGAACAGTCTATCCCCCCCTTTCATCTAATATCGC
CCACCAAGGATCATCAGTTGATTTAGCAATTTTTTCTTTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACCACAATTATTAATATACGAATTAAAAATTTAATA
TTTGATCAAATACCATTATTTATTTGATCTGTAGGAATTACAGCATTATTATTATTATTATCTTTACCAGTTTTAGCAGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACAT
CTTTTTTTGACCCTGCAGGAGGAGGTGATCCTATTTTATACCAACATTTATTT
3
Carystus (Argon) argus Moschler, 1879, reinstated status,
and Argentina as a likely type locality of Hesperia lota Hewitson, 1877
Genomic sequencing of the lectotype of Hesperia lota Hewitson, 1877 (type locality not specified),
currently in the genus Carystus Hubner, Carystus lota (=argus)|15035D03|HT|Colombia|MFNB
i Gans - Carystus lotal21013C11|Trinidad
[1819] (type species Papilio jolus Stoll, Carystus lota|19043A12|Dominican Republic|1987
1782), and the holotype of Carystus —, Carystus lota|7921|Costa Rica|2007|07-SRNP-55877
: Oa od = Carystus lotal8004|Panama|1981
argus Moéschler, 1879 (type locality in Carystus lota|15036C09)LTIno data|MFNB
Carystus lota]17111B02|Argentina|1998
Colombia), currently a junior subjective
synonym of the former, together with Fig. 88. Carystus argus (ted, above) and Carystus lota (blue, below).
; ma Primary type specimens are labeled in corresponding colors.
specimens from other localities reveals
strong genetic differentiation between them (Fig. 88, Z chromosome tree). Carystus (Argon) lota is
closely grouped with a specimen from Argentina, suggesting that the type locality of C. Jota is in
southeastern South America, possibly in Argentina. Due to this locality, we leave Pamphila cerymicoides
Burmeister, 1878 (type locality Argentina: Misiones) as a junior subjective synonym of C. Jota. All other
Specimens we sequenced (from Costa Rica, Panama, Colombia, and Dominican Republic) are in a
different clade. COI barcodes of the two taxa differ by 2% (13 bp between their primary type specimens)
and their Fst/Gmin statistics are 0.52/0.008. Therefore, we reinstate Carystus (Argon) argus Moschler,
1879, stat. rest. as a species. This resurrection from synonymy brings back the argus in the subtribe
Carystina Mabille, 1878, and care should be taken not to confuse it with Oligoria (Cobaloides) argus
Hayward, 1939 (type locality in Paraguay), a species from the subtribe Hesperiina that looks superficially
similar to C. (4.) argus in wing shape, coloration, and the black-dotted pattern of ventral hindwing. A
XD
mnemonic to remember which argus is which may be that ‘O’ in Oligoria stands for a more rounded, arc-
like arrangement of black hindwing dots: *O for round’; and *C’ in Carystus stands for a cluster of dots,
1.e., several dots in the middle of the wing that do not form a long and smooth arc: ‘C for cluster’.
Lycas devanes (Herrich-Schiffer, 1869), reinstated status,
with the type locality in South America
Genomic sequencing of a syntype of Goniloba devanes Herrich-Schaffer, 1869 (type locality not
specified), currently a junior subjective synonym of Lycas argentea (Hewitson, 1866) (type locality in
Guatemala) (1955) places it in the clade of
Lycas argentea (=devanes)|15036C11|LT|no data|MFNB
: ; ; ; =" Lycas argentea|17109HO7|Argentina|1998
exclusively South American specimens that is 203 A cae argenteal a1 1 1809[Trinidad
1 1 222 Lycas argentea|18111B05|Brazil: Santa Catarina]1989
separate from the clade with North American tae anaentealhGO7/Arge tinal1990
Specimens including one from Guatemala (Fig. 89). Lycas argentea|18111B04|Perul2013 _
gry ee. —— Lycas argentea|18111A06|Colombia _
The two clades show strong genetic differentiation ——— Lycas argenteal18111B01|Panama|1978
“2 Lycas argentea|18111B02|Colombia
with Fst of 0.66 and undetectable gene exchange cay__Lyeas argenteal17109HO6|Mexico:SLP|1982_—
i Lycas argentea|19069A04|Mexico: Tamaulipas|1972
between them. COI barcodes differ by 3.8% (25 bp) Lycas argentea|18111A12|Guatemala
Fig. 89. Lycas devanes (red, above) and L. argentea (blue,
below). Name references are in corresponding colors.
between the specimens from Guatemala (NVG-
18111A12) and Argentina (NVG-17109H07) and by
3.6% (24 bp) between NVG-18111A12 and a specimen from Trinidad (NVG-18111B03). Therefore, the
North American (1.e., L. argentea) and South American clades represent two distinct species. First, to
ensure nomenclatural stability and unambiguous identification of G. devanes, N.V.G. hereby designates
its sole syntype in MFNB bearing the following five rectangular labels, the first one red and others white:
| Typus ]}, [ gonil. devanes | m ], [ Coll. | Staudinger ], [| {QR code} http://coll.mfn-berlin.de/u/ | 449f7e ],
and [| DNA sample ID: | NVG-15036C11 | c/o Nick V. Grishin | as the lectotype of Goniloba devanes
Herrich-Schaffer, 1869. The lectotype is missing the right antenna and scales are partly rubbed off the
right forewing apex. It is likely that the second label is in Herrich-Schaffer’s handwriting and ‘m’ stands
for ‘mihi’, which is Latin for ‘of me’, placed after a species name as an attribution of the new species to
the writer. This notation was frequently used more than a century ago: ‘m’ or ‘mihi’ instead of the
author’s name directly, as done nowadays. This ‘m’ further suggests that the label was written by Herrich-
Schaffer and offers additional evidence of authenticity of this specimen as a syntype. Second, because the
lectotype designated herein is in the clade consisting of South American specimens, we suggest that the
type locality of G. devanes is in South America. Third, the two clades represent two distinct species, and
therefore we propose species-level status for Lycas devanes (Herrich-Schaffer, 1869), stat. rest.
ACKNOWLEDGMENTS
We acknowledge Ping Chen and Ming Tang for excellent technical assistance. We are grateful to David
Grimaldi and Courtney Richenbacher (AMNH: American Museum of Natural History, New York, NY,
USA), Blanca Huertas, David Lees, and Geoff Martin (BMNH: Natural History Museum, London, UK),
Jonathan P. Pelham (BMUW: Burke Museum of Natural History and Culture, Seattle, WA, USA), Vince
Lee and the late Norm Penny (CAS: California Academy of Sciences, San Francisco, CA, USA), Jim
Fetzner, Bob Androw, Vanessa Verdecia, Cat Giles, and the late John Rawlins (CMNH: Carnegie
Museum of Natural History, Pittsburgh, PA, USA), Chris Schmidt and Christi Jaeger (CNC: Canadian
National Collection of Insects, Arachnids and Nematodes, Ottawa, Ontario, Canada), Chuck Harp and the
late Boris Kondratieff (CSUC: Colorado State University Collection, Fort Collins, CO, USA), Jason
Dombroskie (CUIC: Cornell University Insect Collection, Ithaca, NY, USA), Crystal Maier and Rebekah
Baquiran (FMNH: Field Museum of Natural History, Chicago, IL, USA), Weiping Xie (LACM: Los
Angeles County Museum of Natural History, Los Angeles, CA, USA), Théo Léger, Wolfram Mey, and
Viola Richter (MFNB: Museum fiir Naturkunde, Berlin, Germany), Andrei Sourakov, Andrew D.
Warren, Debbie Matthews-Lott, and Keith R. Willmott (MGCL: McGuire Center for Lepidoptera and
Biodiversity, Gainesville, FL, USA), Matthias Nuss and Manuela Bartel (MTD: Museum fiir Tierkunde,
56
Dresden, Germany), Rob de Vos (RMNH: Naturalis Biodiversity Center, Leiden, Netherlands), Martin
Wiemers and Christian Kutzscher (SDEI: Senckenberg Deutsches Entomologisches Institut, Miincheberg,
Germany), Wolfgang A. Nassig (SMF: Natural History Museum, Frankfurt, Germany), Edward G. Riley,
Karen Wright, and John Oswald (TAMU: Texas A&M University Insect Collection, College Station, TX,
USA), Alex Wild (TMMC: University of Texas Biodiversity Center, Austin, TX, USA), Jeff Smith and
Lynn Kimsey (UCDC: Bohart Museum of Entomology, University of California, Davis, CA, USA),
Robert K. Robbins, John M. Burns, and Brian Harris (USNM: National Museum of Natural History,
Smithsonian Institution, Washington, DC, USA), Ernst Brockmann (ZfBS: Zentrum fur
Biodokumentation des Saarlandes, Schiffweiler, Germany), and Axel Hausmann, Andreas Segerer, and
Ulf Buchsbaum (ZSMC: Zoologische Staatssammlung Miinchen, Germany), for granting access to the
collections under their care, sampling specimens, and stimulating discussions; to Ernst Brockmann, Jim P.
Brock, Bill R. Dempwolf, Bill Gendron, Howard Grisham, Bernard Hermier, Kiyoshi Maruyama, John
Pasko, Harry Pavulaan, Steve M. Spomer, and Mark Walker for specimens and leg samples, to Christian
Groneau and Bernard Hermier for photographs, to John V. Calhoun, Bernard Hermier, and Jonathan
Pelham for critical reviews of the manuscript and many helpful suggestions and corrections. Evi Buckner-
Opler assisted by providing emotional and logistic support and helped to collect specimens. We are
indebted to California Department of Fish and Game for collecting permit SC13645, Texas Parks and
Wildlife Department (Natural Resources Program Director David H. Riskind) for the research permit 08-
02Rev, to U. S. National Park Service for the research permits: Big Bend (Raymond Skiles) for BIBE-
2004-SCI-0011 and Yellowstone (Erik Oberg and Annie Carlson) for YELL-2017-SCI-7076, and to the
National Environment & Planning Agency of Jamaica for the permission to collect specimens. Please note
that photographs from iNaturalist (2022) reproduced in this work and photographs © The Trustees of the
Natural History Museum, London are made available under Creative Commons License 4.0
(https://creativecommons.org/licenses/by/4.0/), which means in particular that when using the images you
must give appropriate credit and provide a link to the license. We acknowledge the Texas Advanced
Computing Center (TACC) at The University of Texas at Austin for providing HPC resources. The study
has been supported in part by grants (to N.V.G.) from the National Institutes of Health GM127390 and
the Welch Foundation I-1505.
LITERATURE CITED
Calhoun, J. V. 2018. John Abbot, Jacob Hiibner and Oreas helicta (Nymphalidae: Satyrinae). News of the
Lepidopterists’ Society 60(4): 159-163.
Cong, Q., J. Shen, D. Borek, R. K. Robbins, Z. Otwinowski, and N. V. Grishin. 2016. Complete genomes of
hairstreak butterflies, their speciation, and nucleo-mitochondrial incongruence. Scientific Reports 6: 24863.
Cong, Q., J. Shen, J. Zhang, W. Li, L. N. Kinch, J. V. Calhoun, A. D. Warren, and N. V. Grishin. 2021.
Genomics reveals the origins of historical specimens. Molecular Biology and Evolution 38(5): 2166-2176.
Cong, Q., J. Zhang, and N. V. Grishin. 2019a. Genomic determinants of speciation. bioRxiv BIORXIV/2019/
837666.
Cong, Q., J. Zhang, J. Shen, X. Cao, C. Brevignon, and N. V. Grishin. 2020. Speciation in North American
Junonia from a genomic perspective. Systematic Entomology 45(4): 803-837.
Cong, Q., J. Zhang, J. Shen, and N. V. Grishin. 2019b. Fifty new genera of Hesperiidae (Lepidoptera). Insecta
Mundi 0731: 1—56.
Cramer, P. 1775-1780. De uitlandsche Kapellen voorkomende in de drie Waereld-Deelen Asia, Africa en
America. Papillons exotiques des trois parties du monde I'Asie, l'Afrique et l'Amérique. Amsteldam: S.J.
Baalde; Utrecht, Barthelemy Wild and J. Van Schoonhoven & Comp. Volumes 1-4.
Draudt, M. W. K. 1921-1924. B. Grypocera, breitkopfige Tagfalter. Jn: Seitz, A. (Ed.). Die Gross-Schmetterlinge
der Erde. Stuttgart: Alfred Kernen. 5: 833-1011, 1046-1139, pls 113B, 160-193.
Eliot, J. N. 1973. The higher classification of the Lycaenidae (Lepidoptera): a tentative Arrangement. Bulletin of
the British Museum of Natural History (Entomology) 28(6): 373-505.
Elwes, H. J., and J. Edwards. 1897. A revision of the Oriental Hesperiidae. Transactions of the Zoological
Society of London 14(4): 101-324.
ee
Emmel, J. F., T. C. Emmel, and S. O. Mattoon. 2012. A new species of Cercyonis (Lepidoptera: Satyridae) from
Northern California. Bulletin of the Allyn Museum 163: 1-12.
Evans, W. H. 1949. A catalogue of the Hesperiidae from Europe, Asia, and Australia in the British Museum
(Natural History). London: The Trustees of the British Museum (Natural History). xix + 502 pp., 53 pls.
Evans, W. H. 1953. A catalogue of the American Hesperiidae indicating the classification and nomenclature
adopted in the British Museum (Natural History). Part III. Pyrginae. Section 2. London: The Trustees of the
British Museum (Natural History). v + 246 pp., pls. 26-53.
Evans, W. H. 1955. A catalogue of the American Hesperiidae indicating the classification and nomenclature
adopted in the British Museum (Natural History). Part IV. Hesperiinae and Megathyminae. London: The
Trustees of the British Museum (Natural History). v + 499 pp., pls. 54-88.
Gaviria, F. G., R. R. Siewert, O. H. H. Mielke, and M. M. Casagrade. 2018. A new species of Psoralis Mabille,
1904 from Panama (Lepidoptera, Hesperiidae, Hesperiinae, Moncini). Tropical Lepidoptera Research
28(1): 32-34.
Godman, F. D. 1900. Biologia Centrali-Americana. Insecta. Lepidoptera-Rhopalocera. London: Dulau & Co.,
Bernard Quaritch. 2(160): 557-588, pls. 99-100.
Godman, F. D. 1901. Biologia Centrali-Americana. Insecta. Lepidoptera-Rhopalocera. London: Dulau & Co.,
Bernard Quaritch. (162): 597-620, pls. 101-102.
Haensch, R. 1909. 3. Familie: Danaidae. /n: Seitz, A. (Ed.). Die Gross-Schmetterlinge der Erde. Stuttgart: Alfred
Kernen. 5: 113—160.
Hebert, P. D., A. Cywinska, S. L. Ball, and J. R. deWaard. 2003. Biological identifications through DNA
barcodes. Proceedings of the Royal Society B: Biological Sciences 270(1512): 313-321.
Hemming, A. F. 1937. Hiibner. A bibliographical and systematic account of the entomological works of Jacob
Hiibner and of the supplements thereto by Carl Geyer, Gottfried Franz von Frohlich and Gottlieb August
Wilhelm Herrich-Schaffer. London: Royal Entomological Society. 1: xxxiv + 605 pp., frontisp.; 2: 1x + [1]
+ 270 pp.
Hiibner, J. [1825]. Sammlung exotischer Schmetterlinge. Augsburg: Jacob Hiibner. 2: pl. [120].
Hiibner, J. [1827|—[1829]. Zutrage zur Sammlung exotischer Schmettlinge, bestehend in Bekundigung einzelner
Fliegmuster neuer oder rarer nichteuropaischer Gattungen. Augsburg: Jacob Hiibner. 3: 1-48.
ICZN [International Commission on Zoological Nomenclature]. 1999. International code of zoological
nomenclature. Fourth edition. London: International Trust for Zoological Nomenclature. xxx + 306 pp.
iNaturalist. 2022. Available from https://www.inaturalist.org. Links to observations by observation number
reported in figure legends are <https://www.inaturalist.org/observations/xxx>, where xxx is the number.
Accessed from 25 August 2022 to 1 October 2022.
Lamas, G. 2004. Checklist: Part 4A. Hesperioidea - Papilionoidea. In: Heppner, J. B. (Ed.), Atlas of Neotropical
Lepidoptera. Volume 5A. Gainesville: Association for Tropical Lepidoptera / Scientific Publishers. 439 pp.
Li, W., Q. Cong, J. Shen, J. Zhang, W. Hallwachs, D. H. Janzen, and N. V. Grishin. 2019. Genomes of skipper
butterflies reveal extensive convergence of wing patterns. Proceedings of the National Academy of
Sciences of the United States of America 116(13): 6232-6237.
Lukhtanoy, V. A., A. Sourakov, and E. Zakharov. 2016. DNA barcodes as a tool in biodiversity research: testing
pre-existing taxonomic hypotheses in Delphic Apollo butterflies (Lepidoptera, Papilionidae). Systematics
and Biodiversity 14: 599-613.
Meérit, X., L. Manil, R. Vila, and M. Wiemers. 2017. Inter-island differentiation of Leptotes (Cyclyrius)
webbianus (Brullé, 1839) in the Canary Islands (Spain), with description of two new subspecies from La
Palma and Gran Canaria (Lepidoptera: Lycaenidae). SHILAP-Revista de Lepidopterologia 45(179): 513—
520.
Mielke, O. H. H. 1975. Sobre algumas espécies de Staphylus Godman & Salvin (Lepidoptera: Hesperiidae). Acta
biologica paranaense (Curitiba) 4(1/2): 25-34.
Mielke, O. H. H. 2004. Hesperiidea, pp. 25-86. Jn: Lamas, G. (Ed.). Checklist: Part 4A. Hesperioidea -
Papilionoidea. In: Heppner, J. B. (Ed.), Atlas of Neotropical Lepidoptera. Volume 5A. Gainesville:
Association for Tropical Lepidoptera / Scientific Publishers.
Mielke, O. H. H. 2005. Catalogue of the American Hesperioidea: Hesperiidae (Lepidoptera). Curitiba: Sociedade
Brasileira de Zoologia. 1: xii + 125 pp.; 2: [1] + 127-410; 3: [ui] + 411-771; 4: [11] + 773-1055; 5: [1] +
1057-1383; 6: [11] + 1385-1536.
Miller, L. D. 1976. Revision of the Euptychini (Satyridae) 3. Megisto Hitbner. Bulletin of the Allyn Museum 33:
1-23.
58
Pelham, J. P. 2008. Catalogue of the Butterflies of the United States and Canada. Journal of Research on the
Lepidoptera 40: 1-658.
Pelham, J. P. 2022. Catalogue of the Butterflies of the United States and Canada. Revised 2 February 2022.
<http://www. butterfliesofamerica.com/US-Can-Cat.htm> Accessed 25 August 2022.
Plétz, C. 1886. Nachtrag und Berichtigungen zu den Hesperiinen. Stettiner entomologische Zeitung 47(1/3): 83—
117.
Reuss, T. [1926]. Systematischer Uberblick der Dryadinae T. Rss. mit einigen Neubeschreibungen (Lep. Rhopal.).
Deutsche Entomologische Zeitschrift 1926(1): 65—70.
Ribbe, C. 1889. Beitrage zur Lepidopteren-Faun von Gross-Ceram. Deutsche entomologische Zeitschrift Iris 2(2):
187-265.
Robbins, R. K., Q. Cong, J. Zhang, J. Shen, R. C. Busby, C. Faynel, M. Duarte, A. R. P. Martins, C. Prieto,
G. Lamas, and N. V. Grishin. 2022. Genomics-based higher classification of the species-rich hairstreaks
(Lepidoptera: Lycaenidae: Eumaeini). Systematic Entomology 47(3): 445-469.
Rothschild, W., and K. Jordan. 1903. A Revision of the Lepidopterous Family Sphingidae, Part 1. London and
Aylesbury: Hazell, Watson & Viney, Limited. 813 pp.
Scott, J. A. 1994. Biology and systematics of Phyciodes (Phyciodes). Papilio (n.s.) (7): 1-120.
Scott, J. A. 1998. Phyciodes (Phyciodes): new discoveries, new subspecies, and convergence. Papilio (n.s.) 10: 1—
42.
Scott, J. A. 2006. Phyciodes (Phyciodes): more progress. Papilio (n.s.) 13: 1-34.
Scott, J. A. 2014. The identity of Coenonympha brenda W. Edwards 1870 (Nymphalidae). Papilio (n.s.) 22: 8-16.
Shen, J., Q. Cong, D. Borek, Z. Otwinowski, and N. V. Grishin. 2017. Complete genome of Achalarus lyciades,
the first representative of the Eudaminae subfamily of skippers. Current Genomics 18(4): 366-374.
Shen, J., Q. Cong, L. N. Kinch, D. Borek, Z. Otwinowski, and N. V. Grishin. 2016. Complete genome of Pieris
rapae, a resilient alien, a cabbage pest, and a source of anti-cancer proteins. F1000Research 5: 2631.
Warren, A. D. 2005. Butterflies of Oregon: Their Taxonomy, Distribution, and Biology. Lepidoptera of North
America 6: 1-408.
Zhang, J., Q. Cong, J. M. Burns, and N. V. Grishin. 2022a. Checking the checkered taxonomy of Pl6tz's
checkered skippers (Hesperiidae: Pyrgini). The Taxonomic Report of the International Lepidoptera Survey
10(5): 1-31.
Zhang, J., Q. Cong, J. Shen, E. Brockmann, and N. V. Grishin. 2019a. Genomes reveal drastic and recurrent
phenotypic divergence in firetip skipper butterflies (Hesperiidae: Pyrrhopyginae). Proceedings of the Royal
Society B: Biological Sciences 286(1903): 20190609.
Zhang, J., Q. Cong, J. Shen, and N. V. Grishin. 2022b. Taxonomic changes suggested by the genomic analysis
of Hesperiidae (Lepidoptera). Insecta Mundi 0921: 1-135.
Zhang, J., Q. Cong, J. Shen, P. A. Opler, and N. V. Grishin. 2019b. Changes to North American butterfly
names. The Taxonomic Report of the International Lepidoptera Survey 8(2): I-11.
Zhang, J., Q. Cong, J. Shen, P. A. Opler, and N. V. Grishin. 2019c. Genomics of a complete butterfly continent.
bioRxiv BIORXIV/2019/829887.
Zhang, J., Q. Cong, J. Shen, P. A. Opler, and N. V. Grishin. 2020. Genomic evidence suggests further changes
of butterfly names. The Taxonomic Report of the International Lepidoptera Survey 8(7): 140.
Zhang, J., Q. Cong, J. Shen, P. A. Opler, and N. V. Grishin. 2021. Genomics-guided refinement of butterfly
taxonomy. The Taxonomic Report of the International Lepidoptera Survey 9(3): 1-54.
Zhang, J., Q. Cong, J. Shen, L. Song, and N. V. Grishin. 2022¢c. Genomic DNA sequencing reveals two new
North American species of Staphylus (Hesperiidae: Pyrginae: Carcharodini). The Taxonomic Report of the
International Lepidoptera Survey 10(4): I-13.
Zhang, J., J. Shen, Q. Cong, and N. V. Grishin. 2019d. Genomic analysis of the tribe Emesidini (Lepidoptera:
Riodinidae). Zootaxa 4668(4): 475-488.
59
The Taxonomic Report
is a platinum open access peer-reviewed publication of
The International Lepidoptera Survey (TILS)
The International Lepidoptera Survey is registered as a non-profit Limited Liability Company (LLC) in
the state of Virginia, U.S.A. The Taxonomic Report (TTR), ISSN 2643-4776 (print) / ISSN 2643-4806
(online), is published for the purpose of providing a public and permanent scientific record. Articles are
peer-reviewed but not necessarily through the anonymous editor-mediated review process. Typically, the
authors are encouraged to solicit reviews of their manuscripts from knowledgeable lepidopterists before
submission. TTR appears in digital, open-access form, is disseminated as a hardcopy to select institutional
repositories, and is available as printed copy upon request at the discretion of authors and/or the editor.
Printing and postage charges may apply. An initial run of 25 copies is printed on paper to meet the ICZN
Code recommendation 8B. All published TTR articles are freely available at the archival TTR website
(http:/lepsurvey.carolinanature.com/report.html) and via the following digital repositories:
Internet Archive (https://archive.org/)
Biodiversity Heritage Library (https://www.biodiversitylibrary.org)
Zobodat (https://www.zobodat.at/)
Zenodo (https://zenodo.org)
TILS Purpose
TILS is devoted to the worldwide collection of Lepidoptera for the purpose of scientific discovery,
determination, and documentation, without which there can be no preservation.
TILS Motto
“As a world community, we cannot protect that which we do not know”
Articles for publication are sought
Manuscripts may deal with any area of research on Lepidoptera, including faunal surveys, conservation
topics, life histories and foodplant records, matters of nomenclature, descriptions of new taxa, methods,
etc. Taxonomic papers are particularly welcome. There are no publication charges for authors. Before
submitting a manuscript, email TTR editor, Harry Pavulaan, 606 Hunton Place NE, Leesburg, VA,
20176, USA at
[email protected] (cc: to
[email protected] if you do not receive a reply
within one week) to initiate discussion on how to best handle your material for publication, and to discuss
peer review options.
Visit The International Lepidoptera Survey on the World Wide Web at:
http://lepsurvey.carolinanature.com
&
Join the discussion at our list serve on Groups.1io at:
https://groups.io/g/TILS
You can subscribe by sending an email to: [
[email protected]
&
Join The International Lepidoptera Survey on Facebook at:
https://www.facebook.com/groups/1072292259768446
60