Volume 10 Number 8 1 November 2022
\ /
\/
The Taxonomic Report
OF THE INTERNATIONAL LEPIDOPTERA SURVEY
ISSN 2643-4776 (print) / ISSN 2643-4806 (online)
Neotype designation for Papilio fulgerator Walch, 1775
(Hesperiidae: Eudaminae)
Jing Zhang'23, Qian Cong'*, Gerardo Lamas‘, and Nick V. Grishin’
Departments of 'Biophysics, 7Biochemistry, and 7Eugene McDermott Center For Human Growth & Development, University
of Texas Southwestern Medical Center, 5323 Harry Hines Blvd., Dallas, TX 75390-9050, USA; *Museo de Historia Natural,
Universidad Nacional Mayor de San Marcos, Lima, Peru; “Corresponding author: [email protected]
ABSTRACT. The discovery that a skipper butterfly Telegonus fulgerator (Walch, 1775), previously placed in the
genus Astraptes Hubner, [1819], is a complex of many similar-looking species-level taxa with different COI barcodes,
caterpillar foodplants and body patterns, and subtle differences in adult phenotypes raised a question about which species is the
original 7. fulgerator. To answer this question, being unable to locate its holotype, we designate the neotype of Papilio
fulgerator Walch, 1775, a female specimen from Suriname in the Zoological State Collection, Munich, Germany. This neotype
will form the foundation for a comprehensive revision of the 7: fulgerator complex based on genomic sequencing and analysis
augmented with phenotypic considerations.
Key words: two-barred flasher, ICZN Code, nomenclature, taxonomy, genomics, biodiversity.
ZooBank registration: http://zoobank.org/90B7916F-146A-477E-9F7D-3432F95FOBF4
INTRODUCTION
One of the influential studies that popularized the value of mitochondrial DNA COI barcode sequences
for species discovery (Hebert et al. 2004), suggested that a widespread Neotropical skipper butterfly
Astraptes fulgerator (Walch, 1775) may be a complex of no less than 10 distinct species based on their
barcodes, caterpillar foodplants and color patterns, and subtle differences in adult phenotypes. Recently,
based on genomic analysis (Li et al. 2019), these species have been assigned to the genus Te/egonus
Hiibner, [1819] in the subtribe Eudamina Mabille, 1877. Despite all the ensued controversies (Brower
2006; Brower 2010), we still do not know which one of these species, if any, is Telegonus fulgerator,
originally proposed by Walch (1775b) in the genus Papilio Linnaeus, 1758, where all butterflies were
placed at that time. In the absence of primary name-bearing type specimen(s), only the designation of a
neotype will define the taxonomic identity of T. fulgerator.
Recent work by Pfeiler and Nazario-Yepiz (2020) did not result in a valid neotype designation for
Papilio fulgerator, because some of the qualifying conditions given in the article 75.3. of the ICZN Code
(1999) were not satisfied, most importantly, 75.3.4. failed, because any mention of “the steps that had
been taken to trace” the original type series was lacking. Moreover, a statement to satisfy 75.3.1. that the
neotype was “designated with the express purpose of clarifying the taxonomic status or the type locality”
of P. fulgerator was not given and “evidence that the neotype is consistent with what is known of the
former name-bearing type from the original description and from other sources” (Art. 75.3.5.) was not
provided. In fact, judging from the photograph of the proposed “neotype” (Pfeiler and Nazario-Yepiz
2020: Fig. 2.5), quite the opposite is the case: the original description (and illustration, reproduced here as
Fig. la) of P. fulgerator states (and shows) that there are 3 subapical hyaline spots on the forewing
1
(Walch 1775b), but the proposed neotype has four. The original illustration of P. fulgerator dorsal side
(Fig. la above) shows that the spot in forewing cell M3-CuA1 is offset distad from the discal band (and
the original description mentions the offset spot), but this spot is merged with the band in the proposed
neotype.
Furthermore, the Art. 75.3.6. implies that the neotype should come “as nearly as practicable from
the original type locality.” Although the type locality was not stated in the original description, both the
description (Table 1) and illustrations (Fig. la) agree best with the South American phenotype. The
nominotypical P. fulgerator has been treated as a South American taxon in nearly every publication that
followed (Mielke 2005), starting from 1780 (Cramer 1780) that describes and illustrates P. fulgerator
Specimen(s) from Suriname, just five years after the name was proposed (Walch 1775b). Therefore, the
choice of a specimen from Mexico as the “neotype” of P. fulgerator is at odds with Art. 75.3.6 and goes
against the fundamental principle of stability in how names apply to animals (ICZN, 1999). Here, in the
interest of nomenclatural stability, we consider that the neotype by Pfeiler and Nazario-Yepiz (2020) was
not validly designated, and thus we designate herein a neotype in a manner that satisfies all the
requirements set forth by the ICZN Article 75.3, among others, and agrees with the universally accepted
and mostly consistent usage of this name during the last 240 years.
The original description and illustrations of Papilio fulgerator
The name Papilio fulgerator was proposed by Walch (1775b) from a single specimen, the holotype by
monotypy (ICZN Code Art. 73.1.2.), accompanied by a one-sentence summary in Latin and a long, nearly
two-page description in German. To facilitate future studies of the original description by English
speakers, we provide its interpretation in German (the 2™ sentence is in Latin) as text and a literal
Fig. 1. Telegonus fulgerator (Walch, 1775): a. illustrations from Walch (1775b), rotated from the original, labels (2.a. and 2.b.)
repositioned; b. neotype 9 from Suriname in ZSMC, designated herein; dorsal (above) and ventral (below) views of both.
2
Table 1. The original description of Papilio fulgerator from Walch (1775b: 115-116)
and its literal translation. See text for an interpretive translation.
“a V. Fulgerator, der blaue Strahl Taf. |. N. 2.
a. und b. Eques alis fuscis area cyaneo - viridi
radiata, linea primorum albida interrupta, tri-
bus albidis punctis.
Images of the original Interpretation of the original
Ein Tagvogel der vierten GeschlechtsgrdRe, halt
, nicht vollige drey Zoll.
Bey der vordern Seite ist die Grundfarbe der
Ober- und Unterfliigel braun, und zwar etwas dunkler,
als in der Zeichnung.
In der Mitte der Oberfliigel zieht sich etwas
schiefwarts die Lange herunter ein Streif, der aus vier
weissen unbefederten und folglich halb durchsichtigen vier-
| eckigten Flecken zusammengesetzt ist, neben ihm, nach
| der Seitenkante zu, ist ein langlich runder Flecken von
| gleicher Beschaffenheit. In einiger Entferung nach
dem obern Rande der Fliigel zu, stehen drey kleine,
gleichfalls von weisser Farbe und halb durchsichtig. Von
ire | der Wurzel beyder Fltige!l an, fast rings um den Kér-
per, hat er eine sehr schéne silbergriine Farbe von ei-
nem ausnehmenden Glanz. Diese wird nicht durch
| Federn, sondern durch ziemlich starke Haare hervorge-
| bracht, die Uber den braunen Federn liegen, und un-
ter welchen die braune Farbe hervorschimmert. Mit
gleichen Haaren muf& der Riicken dieses Vogels, wie
es scheint, besetzt gewesen seyn, wenigstens zeigen sich
oben unter dem Kopf beym Anfang des Ruckens eben
dergleichen Haare. Dieser aber ist bey diesem Exem-
plar glatt, unbehaart, glanzend und gleicht einer Horn-
haut, die bey diesem Schmetterling ungleich starker ist
als bey andern Tagevégeln eben derselben Gréfe.
Auf der hintern Seite ist die Grundfarbe beyder
Fltigel, der obern und untern, hellbrauner als auf der
vordern. An der Wurzel der Oberfltigel zeigen sich
ebenfalls stilbergriine sehr glanzende Haare, aber in
weit geringerer Anzahl, massen sie nur einige Striche
hielten. Die Unterfltigel sind deren ganzlich beraubt.
Die weissen durchsichtigen Flecken sind nattirlicherweise
eben dieselben, die wir auf der vordern Seite dieser
Fliigel bereits bemerkt haben, nur mit dem Unter-
schied, da& der untere Flecken noch einen andern weis-
sen befederten und folglich undurchsichtigen Flecken ne-
ben sich hat, und mit ihm ein Ganzes macht. Daher
ist von ihm, wenn man ihn gegen das Licht halt, nur
| etwa der dritte Theil halo durchsichtig.
Word-to-word, literal translation
V. Fulgerator, the blue glimmer PI. |. N. 2.
a. and b. Knight wings brown area cyano-green
radiant, band of forewings white interrupted,
three white dots.
A diurnal bird of the fourth size-group, holds
not complete three inches.
On the dorsal side is the ground color of the
fore- and hindwings brown, and actually a little darker
than in the drawing.
In the middle of forewing stretches itself somewhat
obliquely [to] the length down a stripe, which from four
white unscaled and therefore half transparent quad-
rangular spots composed is, besides it, towards
the side edge of, is an elongated round spot of
the same nature. In some distance towards
the upper margin the wing of, there are three little,
likewhise [spots] of white color and half transparent. At
the base both wings of, virtually around the bo-
dy, has it a very beautiful silver-green color of an
exceptional — shine. This comes not through
scales, but brought about quite intense hairs spawn-
ed, that above the brown scales lie, and un-
der which the brown color through shines. With
the same hairs must the back of this bird, as
it seems, occupied have been, at least show themselves
above under the head at beginning of back even
suchlike hair. This [back] however is in this speci-
men smooth, hairless, shiny and resembles a cormn-
ea, that in this butterfly incomparably stronger is
than in other diurnal birds even [of] the same size.
On the ventral side is the ground color [of] both
wings, the fore and hind, paler brown than on the
dorsal. At the base of forewings reveals itself
likewise silver-green very shiny hairs, but in
far lesser number, amassed them only some streaks
held. The hindwings are of which entirely devoid.
The white hyaline spots are naturally
even the same, that they on the dorsal side of this
wing already noticed having, only with the differ-
ence, that the lower spots yet one another white
scaled and consequently opaque spots next
[to] itself has, and with it a whole makes. Hence
is from it, if someone it against the light holds, only
about the third part [is] half transparent.
translation to match with German (Latin) words (Tab. 1). Our interpretive translation of the description 1s:
“V [Fifth species]. Fulgerator [Latin name], the blue glimmer [German name] Pl{ate]. I [One]. N[umber].
2. a. and b. [A summary in Latin is next.] A Knight [1.e., Papilio Eques of Linnaeus (1758)| with brown
wings, a cyano-green radiant area, a broken white band on forewings, and three white dots. [A detailed
description in German follows.| A diurnal butterfly from the fourth size group [i.e., with a wingspan
between 2 and 4 inches (Walch 1775a)], the wingspan is a little less than three inches. On the dorsal side,
the ground color of the forewing and hindwings is brown, and actually slightly darker than in the drawing
[2. a.]. In the middle of the forewing, there is an oblique discal band composed of four unscaled and
therefore hyaline quadrangular spots; besides the band, towards the outer margin, there is an oval spot of
the same kind [as in the band]. Away from the band, near the costal margin, there are three little spots of
the same [as the band] white color and hyaline. At the base of both wings, virtually around the body, it
[the butterfly] is of a very beautiful silver-green color of an exceptional shine. This shine comes not from
3
[regular] scales, but from quite dense hair-like scales that are on top of [regular] brown scales, and below
which [hairs] the brown color is seen through. The thorax of this butterfly must have been covered with
the same hairs on the dorsal side, at least they are still present by the head at the beginning of thorax.
However, in this specimen, the thorax is smooth, hairless, shiny and resembles a cornea, and the thorax
in this butterfly is incomparably stronger than in other diurnal butterflies of the same size. On the ventral
side, the ground color of both wings, the fore- and hind[wing], is paler brown than on the dorsal side. At
the base of the forewings similar silver-green very shiny hairs are present, but in far smaller number,
amassed in streaks. The hindwings are entirely devoid of these hairs. The white hyaline spots are
expectedly the same as described for the dorsal side of the wing, only with the difference that the lower
spot has yet another spot, white scaled and consequently opaque, next to it and they form a single spot
together. Because of this, if one holds it [the butterfly] against the light, only about a third part [of the
white spot] is semi-transparent.”
Several critical points are highlighted in the description above (underline and bold) and in Tab. 1
(red). First, a mention of “this specimen” (shown in bold font above) and no others followed by the
description of its defect (scales rubbed off the thorax dorsal side) and merely a hypothesis that the thorax
should be covered with “silver-green” hairlike-scales, suggesting that Walch did not have any other
Specimens with less damage, implies that this specimen is the holotype by monotypy. The holotype was
likely a female, judging by the wing shape from the original illustration (Fig. la): rounder wings, convex
forewing costal margin. However, these illustrations are not particularly accurate (see below), as judged at
least by the differences from one copy to another. Second, the characters that differ between the taxa in
the 7. fulgerator complex are underlined above. Per the original description augmented with illustrations
(Fig. la), Papilio fulgerator differs from other taxa by the following three characters. We regard these
characters as differentiating 7. fulgerator from other taxa. First, the shiny overscaling over the dorsal side
of the thorax, abdomen and wing bases is greenish rather than blue. This is the major character used by
Evans (1952) to distinguish nominotypical and exclusively South American 7. fulgerator from Telegonus
azul (Reakirt, [1867]) that he placed as a subspecies of his Astraptes fulgerator. Second, T. fulgerator has
3 subapical hyaline spots, not four or five as in other species. The lack of the 4" spot is characteristic of
South American specimens, although some specimens from Central America also lack this spot. Third,
the spot in the forewing cell M3-CuA1 is offset distad from the discal band in 7. fulgerator. This character
is unusual among 7. fulgerator complex specimens and therefore is important in differentiating of 7.
fulgerator from other taxa.
The type locality of Papilio fulgerator
The original description did not provide any data for the holotype of P. fulgerator. Its provenance and
therefore the type locality are unknown. However, the characters given in the description (see above), in
particular, the greenish rather than blue overscaling of the wing bases, suggest a South American origin of
the holotype (Evans 1952). The only other species described by Walch in the same publication with P.
fulgerator is Papilio luctuosus currently regarded as a junior subjective synonym of Archaeoprepona
demophon demophon (Linnaeus, 1758), also a South American taxon, mostly from the Guianas. Two
other Neotropical butterfly species ever proposed by Walch (1775a) are Papilio capucinus, a valid species
in the genus Adelpha Hibner, [1819], and Papilio simplex, currently a junior subjective synonym of
Panthiades aeolus (Fabricius, 1775), and both are South American.
Furthermore, according to his other publication, Walch received his specimens from a certain Mr.
Giinther, who may have acquired them at auction in the Netherlands (Walch 1775a: 123). On page 127 of
the same work Walch states that the specimens were mostly from the “East Indies”, but some were also
from the “West Indies”, the last meaning most probably Suriname. In those times, “West Indies” were not
restricted to the islands, but more broadly meant “West Indian territories” that included also the mainland,
e.g., Suriname and Guyana (Muhlenfeld 1944). Providers of specimens sold at auction in the Netherlands
in the second half of the 18th century most likely acquired them from the Dutch possessions in America,
4
like Aruba, Bonaire, Curacao, etc. and especially, Suriname and what later became Guyana (“Berbice”,
“Demerara” and “Essequibo”). For instance, Cramer and Stoll described numerous taxa coming from
Suriname and what later became Guyana (Cramer 1775-1780; Stoll 1780-1782). For P. capucinus,
Walch gives “East Indies” as its locality, whereas for P. simplex he states it came “probably” from the
East Indies, although he couldn’t be sure because the specimen had been in a box with specimens from
both the East and West “Indies.”
Just five years after Walch’s description of P. fulgerator, this name was applied by Cramer (1780)
to specimen(s) from Suriname. While it is uncertain that Cramer’s P. fulgerator is conspecific with
Walch’s holotype, the name P. fulgerator has been used for a South American taxon in nearly all
publications that followed (Mielke 2005). For all these reasons, it is most likely that the type locality of P.
fulgerator is in South America, possibly in Suriname. The application of the name to South American
specimens has been stable for over 240 years, which is an important consideration because nomenclatural
stability is one of the underlying principles laid out in the Introduction to the ICZN Code (1999).
Possible issues with the original illustrations of Papilio fulgerator
While the dorsal illustration truthfully depicts the lack of greenish overscaling on the thorax of the
holotype, as mentioned in the description with the hypothesis that it was simply rubbed off but was there
to begin with, even the original description of P. fulgerator pointed out one inaccuracy of the
accompanying illustration: the actual color of the holotype dorsal side of the wings is darker than
illustrated (Fig. la above, Tab. 1). Inspection of both illustrations (dorsal and ventral) that are of the same
specimen (holotype by monotypy) reveals differences between them. For instance, the forewing subapical
spots differ in shape, size, and relative placement. Importantly, the pale spot near the base of the forewing
cell M3-CuA1 so clearly shown on the dorsal image, mentioned in the original description, and used as
one of the diagnostic characters for P. fulgerator, is integrated into the discal band on the ventral image.
The merge of the spot with the band is possible due to the framing of hyaline spots with white scales (as
mentioned in the description) present only on the ventral side. Seemingly, the offset spot is simply
connected to the discal band by white scales missing on the dorsal side. Even if this is so, the distance
from the distal end of this spot to the basal margin of the band appears much larger on the dorsal image
than on the ventral one, suggesting that the spot may be removed unrealistically far from the band on the
dorsal illustration, or placed too close to the band on the ventral illustration, or both. In either case, the
drawings are likely to be inaccurate. For instance, the dorsal image shows two pale streaks near the
margin of forewing cell CuA1-CuA2 (Fig. la, not present in all copies of the work). There are no currently
known species with such character, and it does not fit the wing pattern ground plan of Eudaminae.
Therefore, we suspect that these spots, pictured on both the left and right forewings on the dorsal, but not
ventral, views refer to a scale loss due to damage.
The ventral side illustration is either inaccurate or does not depict an immediate member of the 7.
fulgerator complex. The pale stripe at the hindwing base by the humeral area and near the costa is
lacking, and the only currently known species that would agree with this character and resemble the rest
of the drawing is Telegonus fulgor Hayward, 1939. Therefore, it is possible that the image shows T.
fulgor. It is exceedingly difficult to separate 7. fulgerator complex species from T. fulgor in dorsal view,
and the original illustration does not distinguish between the two species. It is also possible that the basal
white area existed in the holotype, but it was either not illustrated by mistake, depicted as a narrow rim by
the costa (which actually seems to be on the forewing instead), rubbed off when the specimen was spread,
or the hindwings were attached from a different species during specimen repairs. It is well known that a
number of 18" century specimens were “repaired” by adding “patches” of wings or even entire wings
from other specimens or even species; 1n some extreme cases, wing edges were “clipped off’, as they
were possibly ragged. As an example, see the images of the holotype of Siderone galanthis (Cramer,
1775) on the Butterflies of America website (Warren et al. 2016). Moreover, the illustrated hindwing
shape with the angled apex is not known for any Eudaminae. A very similar hindwing shape is depicted in
5
other species proposed by Walch (1775a): A. capucinus and P. aeolus (=simplex), not known to have the
angled apex either, revealing inaccuracies in all these illustrations.
Neotype designation for Papilio fulgerator Walch, 1775
Because taxonomic research on the 7. fulgerator complex requires DNA analysis, genomic sequencing of
the P. fulgerator holotype is necessary. We undertook the following steps to find the holotype of P.
fulgerator. First, we searched the literature for its whereabouts and information about primary types of
other taxa described by Walch (1775a, b). We were not able to find a report of a specimen curated as the
holotype of P. fulgerator, and information we found suggested that the Walch types of butterfly names
were lost (Steinhauser 1987; Pelham 2008). Second, we contacted the Institute of Zoology and
Evolutionary Research in Jena, Germany, a city where Johann Ernst Immanuel Walch [1725-1778] was
educated, lived, and died (Wikipedia contributors 2022). Gunnar Brehm and Bernhard Bock searched the
Jena collections and were not able to find the holotype. The former curator Dietrich von Knorre said that
over his tenue he has not came across any information about the specimens used by Walch is his works
(Walch 1775a, b). Third, N.V.G. visited the following collections that contain many historical specimens
and inspected their Hesperiidae holdings looking for old specimens that match the information we
gathered about the holotype: Natural History Museum, London, UK (BMNH), Museum fiir Naturkunde,
Berlin, Germany (MFNB), Muséum National d'Histoire Naturelle, Paris, France (MNHP), Naturalis
Biodiversity Center, Leiden, Netherlands (RMNH), and Zoologische Staatssammlung Miinchen, Germany
(ZSMC). The search failed and the holotype was not found. Therefore, we believe that the holotype is
lost. The same conclusion has been also reached by others (Steinhauser 1987; Pelham 2008).
In the absence of the holotype, we proceed below with the neotype designation, because there is an
exceptional need to clarify the taxonomic identity of P. fulgerator and define this species objectively by a
single specimen due to cryptic species in the P. fulgerator complex (Hebert et al. 2004; Brower 2010).
Currently, it remains unclear which one (if any) of these species is P. fulgerator, and DNA information
from the neotype specimen is critical for future studies of the complex, because the cryptic diversity has
been revealed by DNA analysis. Papilio fulgerator is the oldest name of the namesake complex, and the
lack of clarity about which species it applies to impedes any meaningful taxonomic work on the group.
Moreover, to confuse the matters even further, an invalid neotype has been proposed recently (Pfeiler and
Nazario- Yepiz 2020). For all these reasons, we believe that this situation qualifies as an exceptional need.
We looked for candidate neotype specimens in several collections across the world to find one that
fits best what we know about P. fulgerator. Importantly, the specimen should be from Suriname or
Guyana and should match as closely as possible the original description and illustrations. After these
investigations, we hereby designate the specimen shown in Fig.1b, a female, bearing the following two
labels, one green [ Surinam | ex coll. Fruhstorfer | and the other white [DNA sample ID: | NVG-
18057D11 | c/o Nick V. Grishin | as the neotype of Papilio fulgerator Walch, 1775. The neotype has
scales rubbed off the thorax above (as the holotype!) and a pale streak from some scale loss distad of the
left forewing subapical hyaline spots. The neotype is in the Zoological State Collection, Munich,
Germany (Zoologische Staatssammlung Miinchen, ZSMC) and is designated to clarify the taxonomic
status and the type locality of P. fulgerator. According to the label of the neotype, the type locality of
Telegonus fulgerator becomes Suriname, which is consistent with nearly all the literature about this taxon
(Mielke 2005) and deduced to be in South America from its phenotype, although no data were given for
the holotype in the original publication (Walch 1775b). The neotype was collected prior to 1923, because
Hans Fruhstorfer died in 1922. If the neotype was collected by Fruhstorfer himself, it is possible that it
was in 1886-1888, when Fruhstorfer lived in Brazil (Lamas 2005). However, it is more likely that the
Specimen was collected by Julius Michaelis, who supplied Fruhstorfer with entomological specimens
from Suriname in 1898-1899.
While mostly agreeing with the original description/illustrations of P. fulgerator (greenish wing
bases, three subapical forewing spots, and a spot in cell M3-CuA: protruding distad from the forewing
6
discal band: Fig. 1 and Tab. | provided as the evidence), the neotype differs in the following three
characters. First, it has the base of the ventral hindwing at costa white, as all known members of the 7.
fulgerator complex, and not brown, as in the illustration (Fig. la below), a character not mentioned in the
description and not figured. Second, its hindwing shape is typical for Telegonus, and not angled at the
apex as in the illustration (Fig. la), a shape not known in any Eudaminae species. Third, the neotype lacks
a doublet of pale streaks by the outer margin in the dorsal forewing cell CuAi-CuA2, unknown in
Hesperiidae and not mentioned in the description but shown in at least one copy of the illustration (Fig. la
above), while not apparent in some other copies. Despite these differences, even if the holotype, now lost,
was not conspecific with the neotype, then, in the interest of stability of nomenclature, the P. fulgerator
neotype should still be a member of the 7. fulgerator complex from South America, preferably from
Suriname. The name fu/gerator has been stably applied to South American specimens of this complex
(Mielke 2005) since Cramer (1780), just five years after the original description (Walch 1775b), and
preserving this stability by the neotype is desirable.
Furthermore, to stimulate DNA-based studies of the 7. fulgerator complex, we obtained whole
genome shotgun sequence of the neotype from its leg sample using our previously developed protocols
(Li et al. 2019; Cong et al. 2021), and deposited the resulting sequence reads in the NCBI database
<https://www.ncbi.nlm.nih.gov/> under BioSample SAMN31509877. The COI barcode sequence of the
NEQUE, sampi< NVG-18057D11, GenBank accession OP740376, 658 base pairs 1s:
AACTTTATATT TTTGGAATTTGAGCAGGATTAATTGGAACTTCACTAAGATTACTTATTCGAACTGAAT TAGGAACTCCAGGATCTTTAATTGGAGATGACCAAATTTATAATACA
TPC RITAta SEH CnC acad Traian man ame HTT Tanta Chiari Nclou a HMTRAITG GLACE a te SEAT ARCH TAGTCCCATTAATAATAGGTGCCCCAGATATAGCTTTCCCCCGTA
TAAATAATATAAGATTTTGATTATTGCCCCCATCTTTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGGGCTGGTACAGGATGAACAGTTTATCCCCCTCTTTCATCCAACATTGC
CCATCAAGGAGCTTCTGTTGATTTAGCAATTTTTTCTCTTCATCTTGCCGGTATTTCATCAATTCTTGGGGCTATTAATTTTATTACAACAATTATTAATATGCGAATTAATAATTTATCT
TTTGATCAAATACCATTATTTGTTTGAGCTGTAGGAATTACAGCATTATTATTATTACTTTCATTACCTGTCTTAGCAGGTGCTATCACTATATTACTAACAGACCGAAATTTAAATACTT
CTITTTMTGATCCTECAGGTGGAGGAGATCCAATTTTATATCAACATTTATTT
Finally, this neotype is not designated as an end in itself, but as the first and necessary step in a
comprehensive revision of the 7. fulgerator complex based on genomic sequence analysis augmented
with phenotypic considerations. Our neotype designation will enable rigorous taxonomic studies of this
taxonomic group, not possible before.
ACKNOWLEDGMENTS
We acknowledge Jinhui Shen, Leina Song, Ping Chen, and Ming Tang for excellent technical assistance.
We are grateful to Blanca Huertas, David Lees, and Geoff Martin (Natural History Museum, London,
UK), Théo Léger, Wolfram Mey, and Viola Richter (Museum fiir Naturkunde, Berlin, Germany),
Rodolphe Rougerie (MNHP: Muséum National d'Histoire Naturelle, Paris, France), Rob de Vos
(Naturalis Biodiversity Center, Leiden, Netherlands), and Axel Hausmann, Andreas Segerer, and Ulf
Buchsbaum (Zoologische Staatssammlung Minchen, Germany), for granting access to the collections
under their care, help, and discussions, to Bernhard Bock, Gunnar Brehm, Dietrich von Knorre, and
Manuela Schmidt (Phyletisches Museum, Jena, Germany) for checking the collections and information, to
Ed Pfeiler for discussions that resulted in strengthening of the arguments, to Crispin S. Guppy and
Bernard Hermier for critical reviews of the manuscript and helpful suggestions. The study has been
supported in part by grants (to N.V.G.) from the National Institutes of Health GM127390 and the Welch
Foundation I-1505.
LITERATURE CITED
Brower, A. V. Z. 2006. Problems with DNA barcodes for species delimitation: “Ten species’ of Astraptes
fulgerator reassessed (Lepidoptera: Hesperiidae). Systematics and Biodiversity 4(2): 127-132.
Brower, A. V. Z. 2010. Alleviating the taxonomic impediment of DNA barcoding and setting a bad
precedent: names for ten species of ‘Astraptes fulgerator’ (Lepidoptera: Hesperiidae: Eudaminae)
with DNA-based diagnoses. Systematics and Biodiversity 8(4): 485-491.
Cong, Q., J. Shen, J. Zhang, W. Li, L. N. Kinch, J. V. Calhoun, A. D. Warren, and N. V. Grishin.
2021. Genomics reveals the origins of historical specimens. Molecular Biology and Evolution
38(5): 2166-2176.
Cramer, P. 1775-1780. De uitlandsche Kapellen voorkomende in de drie Waereld-Deelen Asia, Africa
en America. Papillons exotiques des trois parties du monde I'Asie, l'Afrique et l'Amérique.
Amsteldam: S.J. Baalde; Utrecht, Barthelemy Wild and J. Van Schoonhoven & Comp. Volumes
1-4.
Cramer, P. 1780. De uitlandsche Kapellen voorkomende in de drie Waereld-Deelen Asia, Africa en
America. Papillons exotiques des trois parties du monde I'Asie, l'Afrique et l'Amérique.
Amsteldam: S.J. Baalde; Utrecht, Barthelemy Wild and J. Van Schoonhoven & Comp. 3(23/24):
129-176, pls. 265-288.
Evans, W. H. 1952. A catalogue of the American Hesperiidae indicating the classification and
nomenclature adopted in the British Museum (Natural History). Part II. Pyrginae. Section I.
London: The Trustees of the British Museum (Natural History). v + 178 pp., pls. 10-25.
Hebert, P. D., E. H. Penton, J. M. Burns, D. H. Janzen, and W. Hallwachs. 2004. Ten species in one:
DNA barcoding reveals cryptic species in the neotropical skipper butterfly Astraptes fulgerator.
Proceedings of the National Academy of Sciences of the United States of America 101(41):
14812-14817.
ICZN [International Commission on Zoological Nomenclature]. 1999. International code of zoological
nomenclature. Fourth edition. London: International Trust for Zoological Nomenclature. xxx +
306 pp.
Lamas, G. 2005. A bibliography of the zoological publications of Hans Fruhstorfer (1866*-19227).
Entomofauna 26(6): 57—100.
Li, W., Q. Cong, J. Shen, J. Zhang, W. Hallwachs, D. H. Janzen, and N. V. Grishin. 2019. Genomes
of skipper butterflies reveal extensive convergence of wing patterns. Proceedings of the National
Academy of Sciences of the United States of America 116(13): 6232-6237.
Linnaeus, C. 1758. Systema naturae per regna tria naturae, secundum classes, ordines, genera, species,
cum characteribus, differentiis, synomymis, locis. Editio Decima, reformata. Holmiae: Laurentius
Salvius. 1: 1v + 823 + [1] pp.
Mielke, O. H. H. 2005. Catalogue of the American Hesperioidea: Hesperiidae (Lepidoptera). Curitiba,
Parana, Brazil: Sociedade Brasileira de Zoologia. xiii + 1536 pp.
Muhlenfeld, A. 1944. The Dutch West Indies in Peace and War. International Affairs 20(1): 81-93.
Pelham, J. P. 2008. Catalogue of the Butterflies of the United States and Canada. Journal of Research on
the Lepidoptera 40: 1-658.
Pfeiler, E., and N. O. Nazario-Yepiz. 2020. DNA-based taxonomy and potential suppression of long-
established names: the case of Telegonus fulgerator (Lepidoptera: Hesperiidae). Systematics and
Biodiversity 18(4): 338-346.
Steinhauser, S. R. 1987. Notes on the identity of the species-group names in the genera Urbanus and
Astraptes (sensu Evans). Bulletin of the Allyn Museum 111: 1-16.
Stoll, C. 1780-1782. Jn: Cramer, P. (Ed.). De uitlandsche Kapellen voorkomende in de drie Waereld-
Deelen Asia, Africa en America. Papillons exotiques des trois parties du monde I'Asie, l'Afrique et
l'Amérique. Amsteldam: J. S. Baalde; Utrecht, Barthelemy Wild. 4(26/28): 29-90, pls. 305-336,
(29/31): 91-164, pls. 337-372, (32/34): 165-252, pls. 373-400.
Walch, J. E. I. 1775a. Beytrage zur Insecten-Geschichte. Naturforscher (Halle) 6: 123-131.
Walch, J. E. I. 1775b. Beytrége zur Insecten-Geschichte. Naturforscher (Halle) 7: 113-116.
Warren, A. D., K. J. Davis, E. M. Stangeland, J. P. Pelham, K. R. Willmott, and N. V. Grishin.
2016. Illustrated Lists of American Butterflies. [21-XI-2017] [accessed 31 October 2022].
Wikipedia contributors. 2022. Johann Ernst Immanuel Walch. Wikipedia, The Free Encyclopedia, 26
January 2022 21:07 UTC, <https://en.wikipedia.org/w/index.php?title=Johann_ Ernst Immanuel_
Walch&oldid=1068141087> [accessed 28 October 2022]
8
The Taxonomic Report
is a platinum open access peer-reviewed publication of
The International Lepidoptera Survey (TILS)
The International Lepidoptera Survey is registered as a non-profit Limited Liability Company (LLC) in
the state of Virginia, U.S.A. The Taxonomic Report (TTR), ISSN 2643-4776 (print) / ISSN 2643-4806
(online), is published for the purpose of providing a public and permanent scientific record. Articles are
peer-reviewed but not necessarily through the anonymous editor-mediated review process. Typically, the
authors are encouraged to solicit reviews of their manuscripts from knowledgeable lepidopterists before
submission. TTR appears in digital, open-access form, is disseminated as a hardcopy to select institutional
repositories, and is available as printed copy upon request at the discretion of authors and/or the editor.
Printing and postage charges may apply. An initial run of 25 copies is printed on paper to meet the ICZN
Code recommendation 8B. All published TTR articles are freely available at the archival TTR website
(http:/lepsurvey.carolinanature.com/report.html) and via the following digital repositories:
Internet Archive (https://archive.org/)
Biodiversity Heritage Library (https://www.biodiversitylibrary.org)
Zobodat (https://www.zobodat.at/)
Zenodo (https://zenodo.org)
TILS Purpose
TILS is devoted to the worldwide collection of Lepidoptera for the purpose of scientific discovery,
determination, and documentation, without which there can be no preservation.
TILS Motto
“As a world community, we cannot protect that which we do not know”
Articles for publication are sought
Manuscripts may deal with any area of research on Lepidoptera, including faunal surveys, conservation
topics, life histories and foodplant records, matters of nomenclature, descriptions of new taxa, methods,
etc. Taxonomic papers are particularly welcome. There are no publication charges for authors. Before
submitting a manuscript, email TTR editor, Harry Pavulaan, 606 Hunton Place NE, Leesburg, VA,
20176, USA at [email protected] (cc: to [email protected] if you do not receive a reply
within one week) to initiate discussion on how to best handle your material for publication, and to discuss
peer review options.
Visit The International Lepidoptera Survey on the World Wide Web at:
http://lepsurvey.carolinanature.com
&
Join the discussion at our list serve on Groups.1o at:
https://groups.io/g/TILS
You can subscribe by sending an email to: [email protected]
&
Join The International Lepidoptera Survey on Facebook at:
https://www.facebook.com/groups/1072292259768446