Volume 11 Number 1 3 February 2023
The Taxonomic Report
OF THE INTERNATIONAL LEPIDOPTERA SURVEY
ISSN 2643-4776 (print) / ISSN 2643-4806 (online)
Additional taxonomic refinements suggested by
genomic analysis of butterflies
Jing Zhang'*°, Qian Cong'*, Jinhui Shen'’, Leina Song'’, Paul A. Opler’, and Nick V. Grishin!”
Departments of 'Biophysics, 7Biochemistry, and 7Eugene McDermott Center For Human Growth & Development, University
of Texas Southwestern Medical Center, 5323 Harry Hines Blvd., Dallas, TX 75390-9050, USA; *Department of Agricultural
Biology, Colorado State University, Fort Collins, CO 80523-1177, USA; “Corresponding author:
[email protected]
ABSTRACT. Comparative analyses of genomic data reveal further insights into the phylogeny and taxonomic
classification of butterflies presented here. As a result, 2 new subgenera and 2 new species of Hesperiidae are described: Borna
Grishin, subgen. n. (type species Godmania borincona Watson, 1937) and Lilla Grishin, subgen. n. (type species Choranthus
lilliae Bell, 1931) of Choranthus Scudder, 1872, Cecropterus (Murgaria) markwalkeri Grishin, sp. n. (type locality in Mexico:
Sonora), and Hedone yunga Grishin, sp. n. (type locality in Bolivia: Yungas, La Paz). The lectotype is designated for Aethilla
toxeus Plotz, 1882. The type locality of Dion uza (Hewitson, 1877) is likely in southern Brazil. A number of taxonomic
changes are proposed. The following taxa are subgenera, not genera: Plebulina Nabokov, 1945 of Icaricia Nabokov, 1945;
Sinia Forster, 1940 of Glaucopsyche Scudder, 1872; Pseudophilotes Beuret, 1958 of Palaeophilotes Forster, 1938; and
Agraulis Boisduval & Le Conte, [1835] of Dione Hubner, [1819]. Asbolis Mabille, 1904 is a subgenus of Choranthus Scudder,
1872 rather than its synonym. The following are species, not subspecies or synonyms: Glaucopsyche algirica (Heyne, 1895)
(not Glaucopsyche melanops (Boisduval, 1829)), Chlosyne flavula (W. Barnes & McDunnough, 1918) (not Chlosyne palla
(Boisduval, 1852)), Cercyonis hypoleuca Hawks & J. Emmel, 1998 (not Cercyonis sthenele (Boisduval, 1852)), Cecropterus
coyote (Skinner, 1892) and Cecropterus nigrociliata (Mabille & Boullet, 1912) (not Aethilla toxeus Plotz, 1882), Aguna malia
Evans, 1952 (not Aguna megaeles (Mabille, 1888)), Polygonus arizonensis (Skinner, 1911), Polygonus histrio Rober, 1925,
Polygonus pallida Rober, 1925, and Polygonus hagar Evans, 1952 (not Polygonus leo (Gmelin, [1790])), Viola kuma (Bell,
1942), comb. nov. (not Pachyneuria helena (Hayward, 1939)), Tamela maura (Snellen, 1886) (not Tamela_ othonias
(Hewitson, 1878)), Tamela diocles (Moore, [1866]) (not Tamela nigrita (Latreille, [1824])), Vinius phellus (Mabille, 1883)
(not Vinius exilis (Pl6tz, 1883)), Vinius sophistes (Dyar, 1918) (not Vinius tryhana (Kaye, 1914)), and Rhinthon andricus
(Mabille, 1895) and Rhinthon aqua (Evans, 1955) (not Rhinthon braesia (Hewitson, 1867)). The following are new and revised
species-subspecies combinations: Cercyonis sthenele damei W. Barnes & Benjamin, 1926 (not Cercyonis meadii (W. H.
Edwards, 1872)) and Chlosyne flavula blackmorei Pelham, 2008 and Chlosyne flavula calydon (W. Holland, 1931) (not
Chlosyne palla). The following are valid subspecies resurrected from synonymy in new and reinstated species-subspecies
combinations: Chlosyne palla pola (Boisduval, 1869) (not Chlosyne gabbii gabbii (Behr, 1863)) and Cercyonis meadii
mexicana R. Chermock, 1949 (not Cercyonis sthenele damei W. Barnes & Benjamin, 1926, comb. rev.). The following are
new junior subjective synonyms: Aethilla toxeus Pl6tz, 1882 of Cecropterus albociliatus (Mabille, 1877) and Viola dagamba
Steinhauser, 1989 of Viola kuma (Bell, 1942), comb. nov., stat. rest. Leucochitonea janice Ehrmann, 1907 is a junior
subjective synonym of Heliopetes alana (Reakirt, 1868) and not of Heliopetes petrus (Hubner, [1819]). The holotype of
Hermeuptychia sinuosa Grishin, 2021 is illustrated after being spread.
Keywords: taxonomy, classification, genomics, phylogeny, biodiversity.
ZooBank registration: http://zoobank.org/0782F3E3-1EC3-4CB5-B548-1F9DCF6C7917
This report is a direct continuation of our previous publications (Zhang et al. 2019, 2020, 2021, 2022a,
2022b, 2022c), and the general philosophy employed is best summarized in the introduction to Zhang et
al. (2023). Details of experimental and computational protocols are provided in the Appendix to Li et al.
(2019). We sequence specimens of any age, with collection year specified in illustrated trees, “old” means
1
that the specimen comes from old collections, and no date is given on its labels, probably collected more
than 100 years ago, around the turn of the 20" century (most specimens) or before. Phylogenetic tree
construction was carried out as described in the Materials and Methods section by Zhang et al. (2022a).
For each set of specimens, we illustrate at least two trees: constructed from nuclear genomic
regions (either Z chromosome or autosomes) and from the mitogenome DNA. While the two trees
frequently agree, we see instances of confident (i.e., with strong statistical support and therefore unlikely
caused by insufficient or internally inconsistent data) incongruence between nuclear and mitochondrial
genomic trees. Comparing the two trees highlights the pitfalls of relying exclusively on mitochondrial
DNA (and COI barcodes alone) in classification decisions. Even more, including a larger fraction of
mitochondrial genes in a gene marker set used in the PCR amplification approach may bias the tree
toward a mitogenomic signal and thus deviate from the nuclear DNA evolution scenario. In some cases,
we show all three trees: autosomes, Z chromosome, and mitogenome. Their comparison may be most
instructive for the analysis of evolutionary peculiarities.
It is important to note that we do not use specific gene markers. We sequence the whole genomic
shotgun and assemble all protein-coding genes present in the sample by mapping them to a complete set
of genes from a reference genome. This representation gives an unbiased view of the genomic content of
an organism. For computing efficiency, the trees are constructed from a random sample of 100,000
codons (3 bp each) from the entire gene set, which is approximately 6 million codons. Statistical support
is computed on 100 random samples of 10,000 codons each from the original pool of genes. All protein-
coding genes are used in mitochondrial DNA trees, and their statistical support is computed using
ultrafast bootstrap (Hoang et al. 2018).
In addition to phenotypic diagnoses of new taxa, we provide diagnostic DNA characters, both in
the nuclear genome and COI barcode. DNA characters are found in nuclear protein-coding regions using
our previously developed procedure (see SI Appendix to Li et al. 2019). The logic behind the character
selection was detailed in Cong et al. (2019b). The character states are provided in species diagnoses as
abbreviations. E.g., aly728.44.1:G672C means position 672 in exon | of gene 44 from scaffold 728 of the
Cecropterus lyciades (Geyer, 1832) (formerly in Achalarus Scudder, 1872, thus aly) reference genome
(Shen et al. 2017) is C, changed from G in the ancestor. When characters are given for the sister clade of
the diagnosed taxon, the following notation is used: aly5294.20.2:A548A (not C), which means that
position 548 in exon 2 of gene 20 on scaffold 5294 is occupied by the ancestral base pair A, which was
changed to C in the sister clade (so it is not C in the diagnosed taxon). The same notation is used for COI
barcode characters, but without a prefix ending with ‘:’. The sequences of exons from the reference
genome with the positions used as character states highlighted in green are in the supplemental file
deposited at < https://osf.io/nxd5y// >. Linking to these DNA sequences from this publication ensures that
the numbers given in the diagnoses can be readily associated with actual sequences. Whole genome
shotgun datasets we obtained and used in this work are available from the NCBI database
< https://www.ncbi.nlm.nih.gov/ > as BioProject PRJNA927657, and BioSample entries of the project
contain the locality and other collection data of the sequenced specimens shown in the trees. COI barcode
sequences have been deposited in GenBank with accessions O0Q311404—0Q311413. Several photographs
shown in this work are taken from iNaturalist (2022). Links to observations by observation number
reported in figure legends are < https://www. inaturalist.org/observations/xxx >, where xxx 1s the number.
Family Lycaenidae [Leach], [1815]
Plebulina Nabokov, 1945 is a subgenus of [caricia Nabokov, 1945
Genomic sequencing and comparison of the crown group of Polyommatina Swainson, 1827 with a focus
on species found in North America, confirm that the monotypic genus Plebulina Nabokov, 1945 (type
species Lycaena emigdionis F. Grinnell, 1905) is closely related to Icaricia Nabokov, 1945 (type species
Lycaena icarioides Boisduval, 1852) (Fig. la—c). In their pioneering work, Talavera et al. (2012)
2
proposed to treat Plebulina as a distinct genus because in their time-calibrated tree constructed from
several gene markers, Plebulina was at a larger distance from Icaricia than their (somewhat flexible)
cutoff for congeneric relationship.
a_ nuclear (autosome) tree
7 Wearicia (Icaricia) neurona|18014D01|USA:CA,Los Angeles Co.|1981
; Icaricia (Icaricia) acmon|PAO78|USA:CA, Sierra Co.|2016
glgaricia (Icaricia) lupini lupini|PAO75|USA:CA,Plumas Co.|2016 4
Icaricia (Icaricia) cotundra|19083EQ05|HT|USA:CO,Park Co.|1968 *
Icaricia (Icaricia) shasta pitkinensis|PAO161|USA:CO,Clear Creek Co.|2016
Icaricia (Icaricia) icarioides pembina|6351|USA:CO, Summit Co.|2016
Icaricia (Icaricia) saepiolus|PAO50|USA:CA, Placer Co.|2016
Icaricia (Plebulina) emigdionis [Plebulina emigdionis]|6697|USA:CA,LA Co.|2000
Agriades (Agriades) luana|20124A01|China|2007
Agriades (Agriades) pyrenaica ergane|20071H11|Ukraine|2010
Agriades (Agriades) glandon rustica|6409|USA:CO,Grand Co,.|2016 —
Agriades (Agriades) podarce podarce|PAO94|USA:CA, Sierra Co.|2016 Icaricia emigdionis»
; Agriades (Albulina) optilete|20061H05|Denmark|1940 7 me
Agriades (Albulina) optilete yukona|16107C04|Canada:Yukon|2016_— ’ .
Rueckbeilia fergana|22037H10|Tajikistan|1963 ._ 2
Rueckbeilia fergana|22037H11|"Tura"|old
Plebejus (Plebejus) argus|20066H02|Sweden|1995
Plebejus (Lycaeides) idas alaskensis|16107B12|Canada:Yukon|2016
> blebejus (Lycaeides) anna anna|PAO455|USA:CA, Plumas Co.|2017
5 ab lebejus (Lycaeides) fridayi|17114G12|USA:CA, Alpine Co.|2009
> plebejus (Lycaeides) melissa melissa|6544|USA:CO,Park Co.|2016
Plebejus (Lycaeides) samuelis|7627|USA:NY,Albany Co.|1963
Patricius felicis|22037HO8|Chinalold
Cyaniris semiargus|20058E 12|Russia:South Ural|2020
Aricia agestis]21015A05|India: Uttar Pradesh|1961
Polyommatus icarus|PAOE03|France|2017
Freyeria trochylus|20064E02|Tajikistan|2001
Freyeria trochylus|20064E03|Tajikistan|2001
0.01
Rueckbeilia fergana
b Zchromosome tree C mitochondrial genome tree
> dcaricia (Icaricia) neurona|18014D01|USA:CA,Los Angeles Co.|1981
, }caricia (Icaricia) lupini lupini[PAO75|USA:CA,Plumas Co.|2016 __
ae > caricia (Icaricia) acmon|PAO78|USA:CA, Sierra Co.|2016 0.02
: Icaricia (Icaricia) cotundra|19083E05|HT|USA:CO,Park Co.|1968
1 Icaricia (Icaricia) shasta pitkinensis|PAO161|USA:CO,Clear Creek Co.|2016
Icaricia (Icaricia) icarioides pembina|6351|USA:CO, Summit Co.|2016
Icaricia (Icaricia) saepiolus|PAOQ50|USA:CA, Placer Co.|2016
Icaricia (Plebulina) emigdionis[Plebulina emigdionis]|6697|USA:CA,LA Co.|2000
Agriades (Agriades) luana|20124A01|China|2007
Agriades (Agriades) pyrenaica ergane|20071H11|Ukraine|2010
; Agriades (Agriades) glandon rustica]6409|USA:CO,Grand Co.|2016
“ie Agriades (Agriades) podarce podarce|PAO94|USA:CA, Sierra Co.|2016
; Agriades (Albulina) optilete|20061HO5|Denmark|1940
Agriades (Albulina) optilete yukona|16107C04|Canada:Yukon|2016
1 ; Rueckbeilia fergana|22037H10|Tajikistan|1963
Rueckbeilia fergana|22037H11|"Tura"|old
Plebejus (Plebejus) argus|20066H02|Sweden|1995
1 Plebejus (Lycaeides) idas alaskensis|16107B12|Canada:Yukon|2016
ip plebejus (Lycaeides) anna anna|PAO455|USA:CA,Plumas Co.|2017
1 ; Plebejus (Lycaeides) fridayi]/17114G12|USA:CA, Alpine Co.|2009
,Plebejus (Lycaeides) melissa melissa|6544|USA:CO,Park Co.|2016
Plebejus (Lycaeides) samuelis|7627|USA:NY,Albany Co.|1963
Patricius felicis|22037H0O8|Chinalold
: Cyaniris semiargus|20058E12|Russia:South Ural|2020
" Aricia agestis|21015A05|India:Uttar Pradesh|1961
Polyommatus icarus|PAOE03|France|2017
, Freyeria trochylus|20064E02|Tajikistan|2001
Freyeria trochylus|20064E03|Tajikistan|2001
Icaricia (Icaricia) neurona|18014D01|USA:CA,Los Angeles Co.
ogcaricia (Icaricia) lupini lupini/PAO75|USA:CA,Plumas Co.
golcaricia (Icaricia) cotundra|19083E05|HT|USA:CO,Park Co.
Icaricia (Icaricia) acmon|PAO78|USA:CA, Sierra Co.|2016
Icaricia (Icaricia) icarioides pembina|6351|USA:CO,Summit Co.
Icaricia (Icaricia) shasta pitkinensis|PAO161|USA:CO,Clear Creek Co.
Icaricia (Icaricia) saepiolus|PAO50|USA:CA, Placer Co.|2016
Icaricia (Plebulina) emigdionis [Plebulina emigdionis]|6697
Agriades (Agriades) luana|20124A01|China|2007
Agriades (Agriades) pyrenaica ergane|20071H11|Ukraine
Agriades (Agriades) glandon rustica|6409|USA:CO,Grand Co.
Agriades (Agriades) podarce podarce|PAO94|USA:CA, Sierra Co.
wigriades (Albulina) optilete|20061H05|Denmark|1940
Agriades (Albulina) optilete yukona|16107C04|Canada: Yukon
Cyaniris semiargus|20058E12|Russia:South Ural|2020
Aricia agestis|21015A05|India:Uttar Pradesh|1961
Polyommatus icarus|PAOE03|France|2017
Go Rueckbeilia fergana|22037H11|"Tura"|old
Rueckbeilia fergana|22037H10|Tajikistan|1963
Plebejus (Plebejus) argus|20066H02|Sweden|1995
iPjebejus (Lycaeides) anna anna|PAO455|USA:CA,Plumas Co.
Plebejus (Lycaeides) fridayi|17114G12|USA:CA, Alpine Co.
'y? Plebejus (Lycaeides) idas alaskensis|16107B12|Canada:Yukon
ioplebejus (Lycaeides) melissa melissa|6544|USA:CO,Park Co.
Plebejus (Lycaeides) samuelis|7627|USA:NY,Albany Co.|1963
Patricius felicis|22037H08|China|old
Fpeyeria trochylus|20064E03|Tajikistan|2001
Freyeria trochylus|20064E02|Tajikistan|2001
100
Fig. 1. Plebulina as a subgenus of Jcaricia. a—c. Phylogenetic trees constructed from protein-coding regions in autosomes (a),
Z chromosome (b), and mitochondrial genome (c): /caricia (red, with Icaricia (Plebulina) emigdionis comb. nov. name shown
in magenta), Agriades (blue), Rueckbeilia (green), and Plebejus (purple). Magenta dots mark diversification nodes of genera
Icaricia, Agriades, and Plebejus. For each specimen, the name adopted in this work 1s given first, and a previously used name
is listed in square brackets (if different), supplemented with the DNA sample number, type status (HT holotype, LT lectotype,
NT neotype, ST syntype, PT paratype, and PLT paralectotype), general locality, and year. NCBI database entries in BioProject
PRJNA927657 give additional data about these specimens. Synonyms are given in parentheses preceded by “=”. The type
status refers to this synonym if the synonym name is provided. The same notations are used throughout this work in figures
showing phylogenetic trees. d—e. Live females of Jcaricia from USA: California, iNaturalist observations (data “obscured”): d.
I. (Plebulina) emigdionis 26900315 Kern Co., May-2007 © Nature Ali; e. 1. Ucaricia) neurona 53685349 Ventura Co., Jul-
2020 © Chris. Images are rotated and cropped. CC BY-NC 4.0 https://creativecommons.org/licenses/by-nc/4.0/. f. Rueckbeilia
fergana 2 NVG-22037H11 “Tura”, B. Neumégen collection [USNM], dorsal (left) and ventral (right) views.
In our genome-level phylogeny that includes all known species of /caricia, the clade consisting of
Icaricia and Plebulina taken together is well separated from all others by a prominent branch (Fig. 1 red)
in both nuclear genome trees (autosomes Fig. la and Z chromosome Fig. 1b). However, /caricia 1s not
separated from Plebulina by a prominent branch, and the branch from the last common ancestor of
Icaricia + Plebulina to the last common ancestor of /caricia is shorter compared to the previous branch.
3
Furthermore, in the nuclear genome trees (Fig. la, b), the distance from the root to the last common
ancestor of Icaricia + Plebulina is larger than that to the last common ancestors of genera Agriades
Hiibner, [1819] (type species Papilio glandon de Prunner, 1798) (Fig. 1 blue) and Plebejus Kluk, 1780
(type species Papilio argus Linnaeus, 1758) (Fig. 1 purple) (nodes marked with magenta dots in Fig 1)
suggesting that the divergence between /caricia and Plebulina might have occurred more recently than
that within Agriades and Plebejus. Finally, the average distances from the leaves to the last common
ancestors of /caricia+ Plebulina, Agriades, and Plebejus are approximately the same, implying that
genetic differentiation in the nuclear genome is similar in the genera Agriades, Plebejus, and a group
consisting of both /caricia and Plebulina. Therefore, due to these genetic similarities and the phylogenetic
tree structure, we propose to treat Plebulina Nabokov, 1945, stat. nov. as a subgenus of Jcaricia
Nabokov, 1945. Plebulina and Icaricia were proposed as genera in the same work issued on the same
date. Being the first reviser, here we give precedence to /caricia because more species are currently
included in /caricia than monotypic Plebulina, resulting in fewer name changes.
Despite a number of morphological differences, including a unique caterpillar foodplant of
Plebulina (Nabokov 1945; Talavera et al. 2012; Ballmer 2022), phenotypic similarities between Plebulina
and /caricia are also notable. For instance, females of both species may have orange streaks along veins
on the dorsal forewing wing surface (Fig. Id, e). Furthermore, we hold an opinion that monotypic genera
(such as Plebulina) should be reserved for species without apparent close relatives. In the presence of
such relatives, it seems more instructive to indicate this relationship with the generic name. In contrast to
Plebulina, genomic analysis supports the distinctness of (nearly monotypic) Rueckbeilia Lukhtanov,
Talavera, Pierce & Vila, 2013 (type species Lycaena loewii var.? fergana Staudinger, 1881, Fig. If) (Fig.
1 green), because, while the statistical support for its placement in the same clade with Agriades and
Icaricia + Plebulina is strong in the Z chromosome tree (1, 1.e., 100%, Fig. 1b), it is not strongly
associated with either of the two genera (less than 0.5). Therefore, if Jcaricia and Agriades are treated as
distinct genera, Rueckbeilia would also be distinct.
Finally, we offer a hypothesis about why Plebulina was more distinct from Jcaricia in the
phylogeny obtained by Talavera et al. (2012) than in our nuclear genome trees. In the mitochondrial
genome tree (Fig. Ic), we observe this more distant relationship: the magenta dot for the red clade
Ucaricia + Plebulina) is closer to the root (left) and farther from the leaves (which are at about the same
level) than the magenta dots for the blue (Agriades) and purple (Plebejus) clades. Because a significant
number of base pairs in the gene markers used by Talavera et al. (2012) came from mitochondrial genes,
we suspect that these genes might have biased the branch lengths around Plebulina in their tree. The
evolution of mitochondrial genomes experiences irregularities such as introgression and may not represent
the organism as well as its nuclear genome. Therefore, we default to nuclear genome results (with an
emphasis on the Z chromosome) for taxonomic classification.
Sinia Forster, 1940 is a subgenus of Glaucopsyche Scudder, 1872
Sinia Forster, 1940 (type species Glaucopsyche (Sinia) leechi Forster, 1940) was originally proposed as a
subgenus of Glaucopsyche Scudder, 1872 (type species Polyommatus lygdamus E. Doubleday, 1841) that
also included Lycaena lanty Oberthiir, 1886 (type locality China: Sichuan Prov., Kangding) and Lycaena
divina Fixsen, 1887 (type locality in North Korea). Recently, Sinia has been treated as a valid genus
(Lukhtanov and Gagarina 2022). However, Lycaena divina has been segregated into a separate genus,
Shijimiaeoides Beuret, 1958 (type species Lycaena barine Leech, [1893], which is a synonym or
subspecies of L. divina). Based on the genomic comparison, we placed Shijimiaeoides as a junior
subjective synonym of Glaucopsyche (Zhang et al. 2022b). Here, we analyze genomic data on Sinia (Fig.
2 red) and find that it originates within Glaucopsyche (Fig. 2 blue), being sister to all others except the
subgenus Phaedrotes Scudder, 1876 (type species Lycaena catalina Reakirt, 1866, which is a junior
subjective synonym of Lycaena piasus Boisduval, 1852) in all three trees (Fig, 2a—c). Therefore, Sinia is a
subgenus unless Phaedrotes is treated as a genus. Hence, we propose to regard Sinia Forster, 1940 a
4
subgenus of Glaucopsyche Scudder, 1872 as originally described. We also note wing pattern similarities
between the type species of Sinia, G. leechi comb. rest. from China (Fig. 2d) and North American G.
piasus (Fig. 2e): e.g., in the placement of white “arrowheads” on the ventral hindwing.
a_ nuclear (autosome) tree Glaucopsyche
er Glaucopsyche (Glaucopsyche) lygdamus|16106E04|USA:MN,Lake Co,.|2016 piasus
0.4 Glaucopsyche (Glaucopsyche) lycormas|20061G06|Japan|1956
0: Glaucopsyche (Glaucopsyche) alexis|20058D08|Sweden|2007
arse Glaucopsyche (Glaucopsyche) paphos|22027H01|Cyprus|1931
1 Glaucopsyche (Glaucopsyche) divina|22027G10|Japan|1972
, Glaucopsyche (Apelles) melanops|22027HO2|France|1914
1 Glaucopsyche (Apelles) algerica [G. (A.) melanops algerica]|22027G12|Algeria|1928
5 Glaucopsyche (Sinia) lanty [Sinia lanty]]22027G03|China|1928
1 1 Glaucopsyche (Sinia) lanty [Sinia lanty]|22027G02|Chinal|old
Glaucopsyche (Sinia) leechi [Sinia leechi]|22027G01|PT|Chinal|old
Glaucopsyche (Phaedrotes) piasus daunia|9559|USA:UT,Davis Co.|2017
TEA Praephilotes anthracias|22027F07|Turkmenistan|1965
Scolitantides orion|20062A01|Bohemia|1958
Philotes sonorensis|17114F05|USA:CA, Tulare Co.|2015 ; -
lolana iolas|22027F08|Greece|1959 ; @
: Palaeophilotes (Pseudophilotes) baton [Pseudophilotes (P.) baton|22028A12|Germany|1975
0.94 1 Palaeophilotes (Pseudophilotes) sinaicus [Pseudophilotes (P.) s.]|22028A10|PT|Egypt:Sinai|1974
1 Palaeophilotes (Palaeophilotes) triphysina [Palaeophilotes t.]|22028B12|Kazakhstan|1913
Palaeophilotes (Rubrapterus) bavius [Pseudophilotes (Rubrapterus) b.]|22028B07|Macedonia|1956
D.96
Turanana cytis|22027F01|Afghanistan|1963 :
' a Turanana anisophtalma|22028B08|Iran|old Glaucopsyche leechi
tame O68 Turanana ariana|22027F03|Afghanistan|1973
1 Turanana panaegides|22028C04|Central Asia|old
Turanana panagaea|22028C05|Central Asia|old
. Phengaris arion|20061G10|Bohemia|1957
! 1 Phengaris alcon|22028C12|Italy|1972
Caerulea coelestis|22027F11|China|1935
; Euphilotes (Euphilotes) enoptes|PAO65|USA:CA, Sierra Co.|2016
Euphilotes (Euphilotes) bernardino|PAQ378|USA:CA,San Benito Co.|2017
Euphilotes (Euphilotes) rita]7628|USA:TX,Brewster Co.|1971
Euphilotes (Philotiella) speciosa|6698|USA:CA, Imperial Co.|2013
0.007
b Zchromosome tree C_ mitochondrial genome tree
lcm
- Glaucopsyche (Glaucopsyche) lygdamus|16106E04|USA:MN,Lake Co.|2016 Glaucopsyche (Glaucopsyche) lygdamus|16106E04
‘ Glaucopsyche (Glaucopsyche) lycormas|20061G06|Japan|1956 ‘oo Glaucopsyche (Glaucopsyche) lycormas|20061G06
0.007 oa > Glaucopsyche (Glaucopsyche) alexis|20058D08|Sweden|2007 0.02 100 Glaucopsyche (Glaucopsyche) divina|22027G10
0.7% Glaucopsyche (Glaucopsyche) paphos|22027H01|Cyprus|1931 ¥ Glaucopsyche (Glaucopsyche) paphos|22027H01
- ; Glaucopsyche (Apelles) melanops|22027H02|France|1914 ie Glaucopsyche (Glaucopsyche) alexis|20058D08
Glaucopsyche (Apelles) algerica[G. (A.) melanops algerica]|22027G12|Algeria|1928 wo _Glaucopsyche (Apelles) melanops|22027H02
7 Glaucopsyche (Glaucopsyche) divina|22027G10|Japan|1972 100 Glaucopsyche (Apelles) algerica|22027G12
7 Glaucopsyche (Sinia) lanty [Sinia lanty]|22027G03|China|1928 {Glaucopsyche (Sinia) lanty [Sinia lanty]|22027G03
1 1 Glaucopsyche (Sinia) lanty [Sinia lanty]|22027G02|Chinalold api 100 laucopsyche (Sinia) lanty [Sinia lanty]|22027G02
ala Glaucopsyche (Sinia) leechi [Sinia leechi]|22027G01|PT|Chinalold Glaucopsyche (Sinia) leechi [Sinia leechi]|22027G01
Glaucopsyche (Phaedrotes) piasus daunia|9559|USA:UT,Davis Co.|2017 7 Glaucopsyche (Phaedrotes) piasus daunia|9559
O96 lolana iolas|22027F08|Greece|1959 ik oF Praephilotes anthracias|22027F07|Turkmenistan|1965
aoa Enaapilotes SECC CHD GORMSAOLIECHGREOLER a1 A ra ntides CHAMDOOECROAIBORCNGIIOSS.
1 colitantides orion ohemia colitantides orion ohemia
hr Philotes sonorensis|17114F05|USA:CA, Tulare Co.|2015 lolana iolas|22027F08|Greece|1959
; Phengaris arion|20061G10|Bohemia|1957 $Y fe eae (Pseudophilotes) baton|22028A12
1 Phengaris Suis o2027F11(Cnie 1896 100 3 Tena Hier eat sex pH APE
Caerulea coelestis|22027F11|China]1935 100 alaeophilotes (Palaeophilotes) triphysina|2 1
0.92 ; Palaeophilotes (Pseudophilotes) baton [Pseudophilotes (P.) baton|22028A12|Germany|1975 Palaeophilotes (Rubrapterus) bavius [Pseudophilotes|22028B07
1 Palaeophilotes (Pseudophilotes) sinaicus [Pseudophilotes (P.) s.]|22028A10|PT|Eqypt:Sinai]1974-4 100 oe -«CTuranana cytis|22027F01|Afghanistan|1963
1 Palaeophilotes (Palaeophilotes) triphysina[Palaeophilotes t.]|22028B12|Kazakhstan|1913 35 Turanana anisophtalma|22028B08|Iran|old
Palaeophilotes (Rubrapterus) bavius [Pseudophilotes(Rubrapterus) b.]|22028B07|Macedonia|1956 8 Turanana panaegides|22028C04|Central Asialold
F on Turanana cytis|22027F01|Afghanistan|1963 of Turanana ariana|22027F03|Afghanistan|1973
TS Turanana ariana|22027F03|Afghanistan|1973 Turanana panagaea|22028C05|Central Asialold
' os Turanana anisophtalma|22028B08|Iran|old bs ao EUphilotes (Euphilotes) enoptes|PAO65|USA:CA, Sierra Co.
Turanana panaegides|22028C04|Central Asialold
**Euphilotes (Euphilotes) bernardino|PAQ378|USA:CA
Turanana panagaea|22028C05|Central Asialold
Euphilotes (Euphilotes) rita]7628|USA:TX,Brewster Co.
a “100
33, Euphilotes (Euphilotes) enoptes|PAO65|USA:CA, Sierra Co,|2016 — Euphilotes (Philotiella) speciosa|6698|USA:CA, Imperial Co.
qe Euphilotes (Euphilotes) bernardino|PAQ378|USA:CA,San Benito Co.|2017 aaa Phengaris arion|20061G10|Bohemia|1957
a ae Euphilotes (Euphilotes) rita]7628|USA:TX, Brewster Co.|1971 52 Phengaris alcon|22028C12|Italy|1972
Euphilotes (Philotiella) speciosa|6698|USA: CA, Imperial Co.|2013 Caerulea coelestis|22027F11|China
Fig. 2. Trees of Scolitantidina species constructed from protein-coding regions in a. autosomes, b. Z chromosome, and c.
mitochondrial genome: Glaucopsyche (blue) with subgenera Apelles (cyan) and Sinia (red), Palaeophilotes (green,
nominotypical subgenus in magenta), and Euphilotes (purple) with its subgenus Philotiella (orange). Yellow highlights a case
of strongly supported incongruence between nuclear and mitochondrial genome trees. d. Glaucopsyche (Sinia) leechi comb.
rest. 2 paratype ventral view, NVG-22027G01 China: Sichuan Prov., Songpan Co. [ZSMC]. e. Glaucopsyche (Phaedrotes)
piasus iNaturalist observation 125272854 USA: California, Modoc Co., Modoc, 25-Jun-2022 © Paul G. Johnson. The image is
rotated and cropped. CC BY-NC 4.0 https://creativecommons.org/licenses/by-nc/4.0/.
Finally, we note incongruence between the three trees (Fig. 2a—c). While Glaucopsyche is most
confidently monophyletic in both nuclear genome trees (support 1, 1.e., 100%, Fig. 2a, b), subgenus
Phaedrotes is not in the same clade with the rest of Glaucopsyche in the mitogenome tree (Fig. 2c),
cautioning about the reliance on mitochondrial DNA for organism-level phylogenies or a set of gene
markers that may be dominated by mitochondrial genes. More weakly supported incongruence is in the
relative position of Apelles Hemming, 1931 (type species Polyommatus melanops Boisduval, [1828}]),
treated as a valid subgenus by Lukhtanov and Gagarina (2022) and G. divina. Regardless of these
incongruences that would be interesting to understand further, the position of Sinia is the same in all three
trees. Therefore, our conclusion about its placement within Glaucopsyche is strongly supported.
5
Glaucopsyche algirica (Heyne, 1895), stat. nov. is a species distinct
from Glaucopsyche melanops (Boisduval, 1829)
Genomic sequencing of Glaucopsyche melanops (Boisduval, 1829) (type locality in France) and Lycaena
melanops var. algirica Heyne, 1895 (type locality in Algeria), currently a valid subspecies of G.
melanops, reveals genetic differentiation between them more in line with that known for distinct species
among its relatives (Fig. 2 cyan): e.g., their COI barcodes differ by 1.8% (12 bp), and the genetic distance
between them in the mitogenome ts similar to that between Glaucopsyche paphos Chapman, 1920 (type
locality in Cyprus) and Glaucopsyche alexis (Poda, 1761) (type locality in Austria), or between
Glaucopsyche lygdamus (Doubleday, 1841) (type locality in USA) and Glaucopsyche lycormas (Butler,
1866) (type locality in Japan) (Fig. 2c). Therefore, we propose that Glaucopsyche algirica (Heyne, 1895),
stat. nov. is a species-level taxon.
Pseudophilotes Beuret, 1958 is a subgenus of Palaeophilotes Forster, 1938
Genomic sequencing of Palaeophilotes Forster, 1938 (type species Lycaena triphysina Staudinger, 1892,
Fig. 3a) (Fig. 2 magenta) treated as a distinct genus by Lukhtanov and Gagarina (2022) due to the lack of
its DNA sequences and pronounced phenotypic differences from other genera reveals that it is sister to the
nominotypical subgenus of Pseudophilotes Beuret, 1958 (type species Papilio baton Bergstrasser, 1779,
Fig. 3b) and is much closer to it genetically than the two subgenera of Pseudophilotes—nominotypical
and Rubrapterus Korshunov, 1987 (type species Lycaena bavius Eversmann, 1832)—are to each other
(Fig. 2). This was a surprise given the differences in the appearance of these species (Fig. 3a, b).
Fig. 3. Ultrafast phenotypic evolution in Palaeophilotes. Dorsal view of males, all in ZSMC. a. P. (Palaeophilotes) triphysina
NVG-22028C01 Central Asia, old, coll. Erhardt. b. P. (Pseudophilotes) baton NVG-22028A12 Germany: Bavaria, vic. Jura,
17-May-1975, W. Schatz leg. c. P. (Pseudophilotes) sinaicus paratype NVG-22028A 10 Egypt: Sinai, Wadi Jibal, 1900 m, 26-
May-1974, I. Nakamura leg. COI barcodes differ between (a) and (b) by 2.1% and between (b) and (c) by 0% (probably not a
result of introgression, but the actual lack of genetic differentiation).
We observe that the tree branches in nuclear genome trees (Fig. 2a, b) leading to Palaeophilotes
and the subgenus Pseudophilotes are longer (=reach farther to the right) than for all other Scolitantidina
Tutt, 1907 we sequenced, indicating accelerated evolution. This elevated evolutionary rate in the group is
likely the cause of the observed phenotypic disparity. Notably, the mitochondrial genome tree does not
show elevated rates in this group: branches reach about the same level on the right (Fig. 2c). In accord
with this mitogenome conservation, COI barcodes of Pseudophilotes (Pseudophilotes) baton (Fig. 3b) and
Pseudophilotes (Pseudophilotes) sinaicus Nakamura, 1976 (Fig. 3c) are 100% identical (despite visually
apparent differences in facies) and those of Palaeophilotes triphysina (Fig. 3a) and Pseudophilotes
(Pseudophilotes) baton (Fig. 3b) differ by only 2.1% (14 bp), which is in the range typical for the closest
congeners. To confirm these unexpected results, we sequenced four specimens of P. triphysina (NVG-
22027F04, NVG-22027F05, NVG-22028B12, and NVG-22028C01), and their COI barcodes were 100%
identical (Genbank 0Q311404—0Q3 11407):
AACTTTATATTTTATTTTCGGAAT TTGAGCAGGAATATTAGGAACATCTTTAAGAATTTTAATTCGTATAGAAT TAGGAACACCTGGATCTTTAATTGGAGATGATCAAATTTATAACACT
ATTGTAACAGCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTACCCTTAATAT TAGGAGCACCTGATATAGCATTTCCACGAA
TAAATAATATAAGATTTTGATTATTACCTCCATCATTAATATTATTAATTTCAAGTAGAAT CGTAGAAAAT GGAGCAGGAACAGGAT GAACAGTGTACCCCCCACTTTCATCTAATATTGC
TCATAGAGGTTCATCTGTTGATTTAGCAATTTTTTCACTTCATTTAGCAGGAATTTCATCAATTTTAGGAGCAATTAATTTTATTACTACAATTATTAATATACGAGTAAATAATATATCA
TTTGATCAAATATCATTATTTATTTGAGCAGTAGGTATTACAGCATTACTATTATTATTATCTTTACCTGTTTTAGCAGGTGCAATTACTATATTATTAACAGATCGAAATCTTAATACCT
CTTTTTTTGACCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
Therefore, we propose to treat species of Palaeophilotes and Pseudophilotes as congeneric.
However, due to the elevated rate of evolution in the nuclear genome that resulted in significant
phenotypic differences, we conservatively place Pseudophilotes Beuret, 1958 as a subgenus of
Palaeophilotes Forster, 1938 instead of synonymizing it. Due to the priority of names based on their
dates, this action results in many name changes: we place all species of Pseudophilotes in the genus
Palaeophilotes. However, if Pseudophilotes is kept as a genus, the classification of the group becomes
genetically inconsistent and would require the elevation of Rubrapterus to the genus level (Fig. 2), which
seems unwarranted provided its genetic and phenotypic similarities with Pseudophilotes.
In summary, the variability of evolutionary rates between taxa and rapid phenotypic evolution in
some lineages pose challenges for taxonomic classification because recently diverged species can look
very different from each other (Fig. 3). As a solution, we propose to keep the classification of genera
largely consistent with the estimated divergence times and genetic differentiation, but to use subgenus as
an indicator of phenotypic differences. This approach generally results in a smaller number of genera,
frequently due to the elimination of monotypic genera, which in our opinion, should be used only to
indicate the genetic uniqueness of taxa in the absence of close relatives.
Subgenus Euphilotes Mattoni, [1978] is paraphyletic in mitochondrial DNA
Zhang et al. (2019) placed Philotiella Mattoni, [1978] (type species Lycaena speciosa Hy. Edwards,
1877) as a subgenus of Euphilotes Mattoni, [1978] (type species Lycaena enoptes Boisduval, 1852) due to
their genetic similarity, as recently confirmed by Lukhtanov and Gagarina (2022). Adding to these results,
here we show that Philotiella and Euphilotes are not only very close to each other genetically (Fig. 2a, b
yellow highlight) but also that Philotiella renders Euphilotes paraphyletic in the mitochondrial genome
tree with confident statistical support (Fig. 2c yellow highlight), suggesting introgression of mitochondrial
DNA between the subgenera and a possibility of future synonymization of these two names. Even
phenotypically, some populations of Euphilotes pallescens (Yilden & Downey, 1955) may be
superficially more similar to Philotiella than to Euphilotes species due to reduced spotting and the lack of
orange spots on ventral hindwing. Finally, our current and more comprehensive trees (Fig. 2) strongly
support the distinction of the genus Euphilotes (that includes Philotiella as a subgenus) from other genera
in the subtribe Scolitantidina Tutt, 1907: nuclear genome trees place Euphilotes as sister to all other
sequenced members of the subtribe, with higher confidence (0.92) in the Z chromosome tree (Fig. 2b).
Although members of the New World genus Euphilotes have been placed within some of the Old World
genera in the past, we show that unless the entire subtribe Scolitantidina is unified under a single genus
(Scolitantides Hiibner, 1819), Euphilotes cannot be combined with any other genus to keep it
monophyletic.
Family Nymphalidae Rafinesque, 1815
Agraulis Boisduval & Le Conte, [1835] as a subgenus of Dione Hiibner, [1819]
From the position of consistency and uniformity of taxonomic classification, based on the genetic
closeness of Agraulis Boisduval & Le Conte, [1835] (type species Papilio vanillae Linnaeus, 1758) and
Dione Hibner, [1819] (type species Papilio juno Cramer, 1779) we proposed to regard the former as a
subgenus of the latter, rather than keeping the two as separate genera (Zhang et al. 2019). Treating
Agraulis and Dione as congeneric was not a novel concept (Scott 1986). Recent publications are divided
between the two options: some argue for keeping Agraulis as a genus (Nutfiez et al. 2022; Penz 2022),
while others use Agraulis as a subgenus of Dione (Farfan et al. 2022a; Farfan et al. 2022b; Pelham 2022).
7
In our opinion, this argument reflects lumping vs. splitting viewpoints. For every monophyletic
lineage, one may find a sufficient number of characters, be it morphological or molecular, to “support”
the distinction of the lineage at the taxonomic rank deemed appropriate. It seems impossible to formulate
criteria for which morphological character differentiates between genera and which refers to subgenera.
Therefore, it is not likely that genus/subgenus disagreement will be resolved by additional studies of
Agraulis morphology. It seems equally unlikely that additional genomic sequencing of Agraulis and
Dione will bring us closer to resolution because the data we have at hand (Zhang et al. 2020; Nufiez et al.
2022) confidently resolve the phylogeny of the group and provide reliable estimates of evolutionary
distances within the group and among their relatives.
While experts in their phylogenetic groups usually find it more aesthetically appealing to split
them into many smaller genera (i.e., the more you study something, the more significant seem the
differences), we think that a more inclusive treatment with a smaller number of distinctive and confidently
monophyletic genera is more practical, both for general biologists (who do not have to learn additional
names) and newcomers. While genetic similarity may be harder to relate to, similarity in facies between
North American species of Agraulis and Dione is illustrated here in Fig. 4 and needs no explanation.
Provided these species are closely related (as judged by genomic analysis), 1t seems meaningful to treat
them as congeneric. From a broader perspective, we do not see an imperative reason to place in different
genera two closely related species that can sometimes be misidentified for each other. We think that
genera are for broader use, and subgenera could be for specialists.
Fig. 4. Two species of Dione, iNaturalist observations: a. Dione (Agraulis) incarnata 140735334 USA: Texas, Cameron Co.
31-Oct-2022 © Jeff Chapman; b. Dione (Dione) moneta 131933192 Mexico: Oaxaca, Tepelmeme Villa de Morelos, 6-Sep-
2017 © Tepelmeme Villa de Morelos. Images are color-corrected, rotated, cropped, and/or flipped. CC BY-NC 4.0
https://creativecommons.org/licenses/by-nc/4.0/.
Genomics-based arguments for Agraulis as a subgenus of Dione from the position of internal
consistency and uniformity of taxonomic classification were stated by Zhang et al. (2019). COI barcodes
of Agraulis and Dione differ by less than 8%. From an even broader perspective of consistent application
of ranks to clades depending on their evolutionary distance, humans (Homo sapiens Linnaeus, 1758) and
chimps (Pan troglodytes (Blumenbach, 1775)), currently attributed to different genera, are 9.6% (63 bp)
different in their barcodes (GenBank accessions MF479728 and HM068586), not 2% as specified by Penz
(2022). Finally, subgenera Agraulis and Dione consist of a small number of species. Unifying them in one
genus does not cause much inconvenience by creating a large genus that is difficult to navigate. On the
contrary, the unification results in a more conveniently sized genus and emphasizes closer evolutionary
connections within it. For all these reasons, we still support the treatment of Agraulis as a subgenus of
Dione; however, placing them in separate genera is not obviously incorrect either.
8
Chlosyne flavula (W. Barnes & McDunnough, 1918), stat. rest.
is a Species distinct from Chlosyne palla (Boisduval, 1852)
Our recent finding that Melitaea sterope W. H. Edwards, 1870 (type locality in USA: Oregon, Wasco
Co.) is not conspecific with Chlosyne acastus (W. H. Edwards, 1874) (type locality in USA: Utah,
probably Utah Co.) and instead is a subspecies of Chlosyne palla (Boisduval, 1852) (type locality in
USA: California, Plumas Co.) (Zhang et al. 2022b) prompted further discussions and investigations.
Genomic sequencing of all C. palla subspecies partitions them into two clades in the tree constructed
from protein-coding regions in autosomes (Fig. 5a blue and red). While not strongly different in
mitogenomes (Fig. 5b), the two clades are genetically differentiated in the Z chromosome with Fst/Gmin of
0.2/0.016. This differentiation is approximately the same as in the following pairs of species (Fig. 5a):
Chlosyne whitneyi (Behr, 1863) and Chlosyne damoetas (Skinner, 1902), Chlosyne gabbii (Behr, 1863)
and C. acastus, and Chlosyne hoffmanni (Behr, 1863) and Chlosyne harrisii (Scudder, 1863). Therefore,
the two clades represent two distinct species possibly coming in contact at least in Washington state as C.
palla sterope (formerly C. acastus) and Chlosyne palla blackmorei Pelham, 2008 (type locality Canada:
British Columbia, Lytton). The blue clade (Fig. 5) includes the lectotypes of C. palla palla and C. palla
sterope. The oldest name in the red clade (Fig. 5) is Melitaea flavula W. Barnes & McDunnough, 1918
(type locality USA: Colorado, Garfield Co., Glenwood Springs, a syntype sequenced as NVG-22036E05).
Therefore, we propose that Chlosyne flavula (W. Barnes & McDunnough, 1918), stat. rest. is a species
distinct from Chlosyne palla (Boisduval, 1852). We place the following valid taxa (and their synonyms)
as subspecies of Chlosyne flavula: Chlosyne palla blackmorei Pelham, 2008 and Melitaea calydon W.
Holland, 1931 (type locality in USA: Colorado, Jefferson Co.). Other subspecies listed by Pelham (2022)
remain with C. palla.
a_ nuclear (autosomes) tree b mitochondrial genome tree
aan Chlosyne palla palla|18069BO09|LT|USA:CA,Plumas Co.|old C palla pola [C. g. gabbii (=pola)]|21011D02|HT|USA:CA
0.02 Chlosyne palla palla|PAQ335|USA:CA, Stanislaus Co.|2017 fe palla australomontana|17109C07|HT|USA:CA, Tulare Co.
Chlosyne palla pola [C. g. gabbii (=pola)]|21011D02|HT|USA:CAl|old C palla australomontana|21026B03|USA:CA, Tulare Co.|2013
0.002 ame Chlosyne palla sterope|21026A09|USA:WA,Adams Co.|1986 0.02 1G Palla palla]18069B09|LT|USA:CA, Plumas Co.|old
Chlosyne palla altasierrajPAO970|USA:CA,EI Dorado Co.|2019
Chlosyne palla sterope|21011C0O1|LT|USA:ORJold
Chlosyne palla eremita|21026C04|USA:CA,Santa Clara Co.|2002
Chlosyne palla eremita|21026C06|USA:CA, Santa Clara Co.|1963
Chlosyne palla altasierra|17109CO8|HT|USA:CA,EI Dorado Co.|1961
Chlosyne palla australomontana|17109CO7|HT|USA:CA, Tulare Co.|1977
Chlosyne palla australomontana|21026B03|USA:CA, Tulare Co.|2013
Chlosyne flavula blackmorei [C. palla blackmorei]|22022A09|Canada:BC|1970
Chlosyne flavula blackmorei [C. palla blackmorei]|22021H04|Canada:BC|2003
0.86 Chlosyne flavula flavula [C. palla flavula]|22036E05|ST|USA:CO, Garfield Co.|old
Chlosyne flavula flavula [C. palla flavula]|6371|USA:CO,Grand Co.|2016
Chlosyne flavula calydon [C. palla calydon]|PAQ1416|USA:CO, Jefferson Co,|2020
Chlosyne flavula calydon [C. palla calydon]|21026B02|USA:WY, Laramie Co.|1985
Chlosyne whitneyi (=malcolmi)|17109D05|HT|USA:CA,Mono Co.|1921
Chlosyne whitneyi|21084G06|USA:CA,Mono Co.|1974
0.64 Chlosyne damoetas damoetas|21096E07|LT|USA:CO, South Park|1902
Chlosyne damoetas|17115C02|USA:CO, Gilpin Co.|1997
Chlosyne gabbii gabbii|22046A08|USA:CA,Los Angeles Co.|1928
Chlosyne gabbii gabbii]21026C05|USA:CA,Monterey Co.|2003
Chlosyne gabbii gabbii (=sonorae)|22036HO9|LT|USA:CA,Los Angeles Co.|old
C palla pallaJPAO335|USA:CA, Stanislaus Co.|2017
G,palla eremita|21026C06|USA:CA, Santa Clara Co.|1963
C palla eremita|21026C04|USA:CA,Santa Clara Co.|2002
3 ¢ palla altasierra|17109CO8|HT|USA:CA,EI Dorado Co.
qs© Palla altasierra|PAO970|USA:CA,E! Dorado Co.|2019
G palla sterope|21011C01|LT|USA:ORJ|old
oC palla sterope|21026A09|USA:WA,Adams Co.|1986
G, flavula blackmorei [C. palla blackmorei]|22021H04/Can
C flavula blackmorei [C. palla blackmorei]|22022A09|Can
7 flavula flavula [C. palla flavula]|22036E05|ST|USA:CO
¢ flavula flavula [C. palla flavula]|6371|USA:CO,Grand Co.
© flavula calydon [C. palla calydon]|21026B02|USA:WY
C flavula calydon [C. palla calydon]|PAO1416|USA:CO
, damoetas damoetas|21096E07|LT|USA:CO,South Park|1902
damoetas|17115C02|USA:CO, Gilpin Co.|1997
C gabbii gabbii|22046A08|USA:CA,Los Angeles Co.|1928
i gabbii gabbii (=sonorae)|22036HO9|LT|USA:CA,Los Ang
&3 gabbii gabbii]/21026C05|USA:CA,Monterey Co.|2003
C gabbii gabbii|PAO375|USA:CA,San Benito Co.|2017
i% Whitneyi (=malcolmi)|17109D05|HT|USA:CA,Mono Co.
1 Oae Chlosyne gabbii gabbii|PAO375|USA:CA,San Benito Co,|2017 C whitneyi|21084G06|USA:CA,Mono Co.|1974
a Chlosyne acastus acastus|21011A04|LT|USA:UT,Utah Co.|old oO” acastus acastus|21011A04|LT|USA:UT, Utah Co.|old
aaa Chlosyne acastus acastus|21026B10|USA:NV,Humboldt Co.|2006 13 acastus acastus|21026B08|USA:UT,Juab Co.|2008
Chlosyne acastus acastus|21026B08|USA:UT,Juab Co.|2008
Chlosyne hoffmanni|PAO971|USA:CA,EI Dorado Co.|2019
Chlosyne hoffmanni|PAO795|USA:CA,Plumas Co.|2018
Chlosyne harrisii|21067F10|USA:NH,Belknap Co.|1957
Chlosyne harrisii|21025G12|USA:ME,Cumberland Co.|1982
C acastus acastus|21026B10|USA:NV,Humboldt Co.|2006
& hoffmanni|PAO795|USA:CA,Plumas Co.|2018
C hoffmanni|PAO971|USA:CA,EI Dorado Co.|2019
7 © harrisiij/21067F10|USA:NH, Belknap Co.|1957
C harrisii]/21025G12|USA:ME,Cumberland Co.|1982
Fig. 5. Trees of Chlosyne species constructed from protein-coding regions in a. autosomes and b. mitochondrial genome: C.
palla (blue), C. flavula stat. rest. (red), C. whitneyi (green), C. damoetas (purple), C. gabbii (olive), C. acastus (orange), C.
hofjmanni (cyan), and C. harrisii (brown). Primary type specimens are labeled in magenta.
Chlosyne palla pola (Boisduval, 1869), comb. nov., stat. rev. is not a junior subjective
synonym of Chlosyne gabbii gabbii (Behr, 1863)
Genomic sequencing of the holotype of Melitaea pola Boisduval, 1869 (type locality “Sonora”,
hypothesized to be USA: California, Los Angeles Co., La Tuna Canyon) currently regarded as a junior
subjective synonym of Chlosyne gabbii gabbii (Behr, 1863) (type locality USA: California, Los Angeles
9
Co., La Tuna Canyon) is not in the same clade with it, but instead is a specimen of Chlosyne palla
(Boisduval, 1852) (type locality in USA: California, Plumas Co.) (Fig. 5). Therefore, the hypothesized
type locality of M. pola, which is the same as that of C. gabbii, is most likely incorrect. Could it be that
the original type locality stated as “Sonora” was accurate, but instead of Sonora, Mexico, it represents a
homonymous town currently in Tuolumne Co., California? While genomic sequencing of additional
Specimens is necessary to solve this problem confidently, we see that the holotype of M. pola shares
mitochondrial DNA with Chlosyne palla australomontana J. Emmel, T. Emmel & Mattoon, 1998 (type
locality in USA: California, Tulare Co., holotype sequenced as NVG-17109C07) (Fig. 5b), and specimens
of similar appearance are known from Tuolumne Co., suggesting possible synonymy. Until a confidently
supported synonymization solution is found, we conservatively propose to treat M. pola as a valid
subspecies Chlosyne palla pola (Boisduval, 1869), comb. nov., stat. rev.
Cercyonis hypoleuca Hawks & J. Emmel, 1998, stat. nov. is a species distinct from
Cercyonts sthenele (Boisduval, 1852)
Genomic sequencing of Cercyonis Scudder, 1875 (type species Papilio alope Fabricius, 1793, which is a
subspecies of Papilio pegala Fabricius, 1775) specimens reveals that Cercyonis sthenele hypoleuca
Hawks & J. Emmel, 1998 (type locality USA: California, Santa Barbara Co., Santa Cruz Island) is sister
to both Cercyonis sthenele (Boisduval, 1852) (type locality USA: California, San Francisco, lectotype
sequenced as NVG-22036H10) and Cercyonis meadii (W. H. Edwards, 1872) (type locality USA:
Colorado, Park Co. Bailey, lectotype sequenced as NVG-21011E01) in all three trees (Fig. 6). Thus, C.
meadii renders C. sthenele that includes C. sthenele hypoleuca paraphyletic. Moreover, C. sthenele
hypoleuca is genetically differentiated from C. sthenele at the level characteristic of distinct species: e.g.,
COI barcodes of C. sthenele lectotype and C. hypoleuca differ by 3.3% (22 bp). Therefore, we propose
that Cercyonis hypoleuca Hawks & J. Emmel, 1998, stat. nov. is a species-level taxon. Interestingly, the
ventral hindwing with a contrasting whitish pattern of C. hypoleuca (Fig. 6e) is superficially like that of
nominotypical C. sthenele, which is genetically different from it. Instead, C. sthenele sthenele 1s
genetically most similar to its geographical neighbor Cercyonis sthenele behrii (F. Grinnell, 1905) (type
locality in USA: California, Marin Co.) that generally lacks the white pattern.
Cercyonts sthenele damei W. Barnes & Benjamin, 1926, comb. rev. is not a subspecies
of Cercyonis meadii (W. H. Edwards, 1872)
Genomic sequencing of the holotype of Cercyonis damei W. Barnes & Benjamin, 1926 (type locality
USA: Arizona: Coconino Co., Grand Canyon) a taxon treated as a valid subspecies of Cercyonis meadii
(W. H. Edwards, 1872) (type locality USA: Colorado, Park Co. Bailey, lectotype sequenced as NVG-
21011E01) is not conspecific with it and instead is placed among specimens of Cercyonis sthenele
(Boisduval, 1852) (type locality USA: California, San Francisco, lectotype sequenced as NVG-
22036H10) in nuclear genome trees (Fig. 6a, b). Two more recently collected specimens from the general
vicinity of the type locality of C. damei (e.g., Fig. 6d) are in the same clade with the holotype in the Z
chromosome tree (Fig. 6b), which usually agrees well with speciation scenarios (Cong et al. 2019a).
These specimens, including the C. damei holotype, are dark and lack reddish patches of C. meadii, being
more similar phenotypically to C. sthenele. Therefore, from both its nuclear genomic sequences and
superficial appearance, Cercyonis damei is not a subspecies of C. meadii but a subspecies of C. sthenele:
Cercyonis sthenele damei W. Barnes & Benjamin, 1926, comb. rev. However, in the tree constructed
from the protein-coding regions of autosomes (which usually harbor a larger number of introgressed
genes), the three sequences specimens of C. sthenele damei do not form a clade. They are placed at the
base of the C. sthenele clade (Fig. 6a), suggesting some introgression from C. meadii. These introgressed
genomic regions “pull” these specimens closer to C. meadii in the tree and, thus, closer to the base of the
clade. Nevertheless, the amount of introgression is insufficient to “move” any of these specimens into the
C. meadii clade. Furthermore, two C. sthenele damei specimens, including the holotype, possess
10
mitochondrial DNA of C. meadii and not C. sthenele (Fig. 6c green-labeled in the magenta clade), directly
indicating introgression from C. meadii. The third specimen (Fig. 6c green-labeled in the blue clade) has
mitochondrial DNA of C. sthenele. This polyphyly of C. sthenele damei in the mitochondrial DNA tree
indicates a varying extent of limited hybridization and introgression with C. meadii in its various genomic
regions rather than supporting this taxon’s hybrid origin.
a nuclear (autosome) tree
Cercyonis sthenele sineocellata|21036F08|HT|USA:OR,Lake Co.|1986
Cercyonis sthenele sineocellata|21028A10|USA:OR,Lake Co.|1986
ion ~Cercyonis sthenele behrii|21095D06|USA:CA,Marin Co.|1978
0.004 Cercyonis sthenele sthenele|22036H10|LT|USA:CA,San Francisco Co.|old
ara ~ Cercyonis sthenele sthenele|7259|PLT|USA:CA,San Francisco Co.|old
Cercyonis sthenele behrii|/21028A05|USA:CA,Santa Barbara Co.|2009
da Cercyonis sthenele paulus|20125E10|NT|USA:NV,Storey Co.|1963
— Cercyonis sthenele paulus|PAQO517|USA:NV,Esmeralda Co.|2017
Cercyonis sthenele masoni|20046C11|USA:UT,Grand Co.|2020
Cercyonis sthenele masoni|PAOQ567|USA:CO,Mesa Co.|2017
: Be Cercyonis sthenele damei [C. meadii damei]|22039B03|USA:AZ,Coconino Co.|1980
Coreen suena damel IC. meadii PETE UTES AZ, Coconino Co. |1980
NVG-22039B03
damei
sthenele
0.66
Cercyonis
Bis Cercyonis mesar alamosa|21036HOS|HT|USA: eee Saguache Co.|1964
O74 | OOD Cercyonis meadii alamosa|21027HO8|USA:CO,Alamosa Co.|2006
v.06 Cercyonis meadii meadii|21011E01|LT|USA:CO,Park Co.|old
0.04 Cercyonis meadii meadii|21027HO6|USA:CO,Douglas Co.|1968
1 ore Cercyonis meadii melania|20059B03|USA:TX,Jeff Davis Co.|2002
i Cercyonis meadii melania|9708|USA:TX,Jeff Davis Co|2017
Cercyonis meadii mexicana [C. meadii damei (=mexicana)]|22039B05|USA:AZ,Pima Co.|1910
ties Cercyonis hypoleuca [C. sthenele hypoleuca]|22039B01|USA:CA, Santa Cruz Isl.]1981
Cercyonis hypoleuca [C. sthenele hypoleuca]|22039B02|USA:CA, Santa Cruz Is!.|1981
: Cercyonis oetus|PAQ112|USA:NV,Elko Co.[2016
Cercyonis silvestris incognita|PAO435|USA:CA,Mendocino Co.|2017
Cercyonis pegala texana|4506|USA:TX,Wise Co.|2015
b Zchromosome tree C mitochondrial genome tree
Cercyonis sthenele sineocellata|21028A10|USA:OR,Lake Co.|1986 ,Gsthenele sineocellata|21036F08|HT|USA:OR,Lake Co
* Cercyonis sthenele sthenele|7259|PLT|USA:CA,San Francisco Co.|old Csthenele sineocellata]21028A10|USA:OR,Lake Co.
Cercyonis sthenele sineocellata|21036F08|HT|USA:OR,Lake Co.|1986 0.02 sf sthenele behrii]21095D06|USA:CA,Marin Co.
Cercyonis sthenele behrii/21095D06|USA:CA,Marin Co.|1978 9,0 sthenele behrii]21028A05|USA:CA, Santa Barbara Co.
Ce evonls step ele behri PALACES eas Santa palpate oo. BIZOOS G nele sthenele|22036H10|LT|USA:CA,SF Co.
onis sthe thene 6b CA, isco Co.|o Csthenele sthenele|7259|PLT|USA:CA,SF Co.|old
toy sthenele masoni|PAO567|USA:CO,Mesa Co.
Csthenele masoni|20046C11|USA:UT,Grand Co.
Csthenele paulus|20125E10|NT|USA:NV, Storey Co.
750 Csthenele paulus|PAQO517|USA:NV,Esmeralda Co.
Csthenele damei [C. meadii damei]|22039B04
Csthenele damei [C. meadii damei]|22039B03
: chi T
ePrc y | >t Siteic 5 if e SOF | bee ein Tne Dan SCO Ul
=“ Gaveyents sthenele paulus|2012 O|NT|USA:NV, Ss rey Lory 11963
Cercyonis sthenele paulus|PAO517|USA:NV,Esmeralda Co.|2017
7, Cercyonis sthenele masoni|20046C11|USA:UT,Grand Co.|2020
Cercyonis sthenele mason A OSS 7 US s. CO. Mesa Co. ol
0.005
Cercyonis ehenele nae Ic. meadii dameil|22039B03|/USA: AZ,Coconino Co.|1980
Cercyonis sthenele damei [C. meadii damei]|22039B04|USA:AZ,Coconino Co.|1980
Cercyonis meadii alamosa|21036HO5|HT|USA:CO,Saguache Co.|1964
Cercyonis meadii alamosa|21027HO8|USA:CO,Alamosa Co.|2006
Cercyonis meadii meadii|21011E01|LT|USA:CO,Park Co.|old
Cercyonis meadii meadii|21027HO6|USA:CO,Douglas Co.|1968
8 le damei[C. meadii i
vo meadii alamosa|21027HO8|USA:CO, Alamosa Co.
Cmeadii alamosa|21036HO5|HT|USA:CO
Cmeadii meadii|21027H06|USA:CO,Douglas Co.
Cmeadii meadii[21011E01|LTJUSA:CO,Park Co.
oGMmeadii melania|20059B03|USA:TX, Jeff Davis Co.
Cmeadii melania|9708|USA:TX, Jeff Davis Co
C meadii mexicana [C. m damei (=mexicana)]|22039B05
Cercyonis meadii melania|20059B03|USA:TX,Jeff Davis Co.|2002
* Cercyonis meadii melania|9708|USA:TX,Jeff Davis Co|2017
Cercyonis meadii mexicana [C. meadii damei (=mexicana)]|22039B05|USA:AZ,Pima Co,.|1910 7 719°
Cercyonis hypoleuca[C. sthenele hypoleuca]|22039B01|USA:CA,Santa Cruz Isl.|1981 hypoleuca [C. sthenele hypoleuca]|22039B02
Cercyonis hypoleuca[C. sthenele hypoleuca]|22039B02|USA:CA,Santa Cruz Isl.|1981 8 hypoleuca [C. sthenele hypoleuca]|22039B01
Cercyonis oetus|PAOQ112|USA:NV,Elko Co.|2016 “| [7a C oetus|PAO112|USA:NV,Elko Co.|2016
Cercyonis silvestris incognita|PAO435|USA:CA,Mendocino Co.|2017 C silvestris incognita|PAO435|USA:CA,Mendocino Co.|2017
Cercyonis pegala texana|4506|USA:TX,Wise Co.|2015 3 C pegala texana|4506|USA:TX,Wise Co.|2015
Fig. 6. Trees of Cercyonis species constructed from protein-coding regions in a. autosomes, b. Z chromosome, and c.
mitochondrial genome: C. sthenele (blue) with C. sthenele damei comb. rev. labeled in green, C. meadii (magenta) with C.
meadii mexicana stat. rest. labeled in purple, and C. hypoleuca stat. nov. (red). The lectotype of C. sthenele sthenele and the
holotype of C. sthenele damei are highlighted in yellow. Gaps in branches in (c) indicate where vertical slices of the tree were
removed to reduce its horizontal dimension (to allow an increase of the font size), 1.e., branches with gaps are longer than
shown. d. C. sthenele damei & dorsal (left) and ventral (right) views, NVG-22039B03 USA: Arizona, Coconino Co., 17-Aug-
1980, J. A. Scott leg. e. C. hypoleuca stat. nov., iNaturalist observation 4540707 USA: California, Santa Barbara Co., Santa
Cruz Island, Channel Islands National Park, 3-Jul-2013 © Nature Ali. The image is color-corrected and cropped. CC BY-NC
4.0 https://creativecommons.org/licenses/by-nc/4.0/.
Cercyonis meadti mexicana R. Chermock, 1949, stat. rest.
is a valid subspecies and not a junior subjective synonym
of Cercyonis sthenele damei W. Barnes & Benjamin, 1926, comb. rev.
Genomic sequencing of a specimen from southeastern Arizona identified as Cercyonis meadii mexicana
R. Chermock, 1949 (type locality in Mexico: Chihuahua) (Fig. 6 labeled in purple), a taxon treated as a
junior subjective synonym of “Cercyonis meadii damei’” W. Barnes & Benjamin, 1926 (type locality
USA: Arizona: Coconino Co., Grand Canyon) by Pelham (2022) reveals that it is in a clade different from
the holotype of Cercyonis damei (Fig. 6), which, as we have shown above, is a subspecies of Cercyonis
11
sthenele (Boisduval, 1852) (type locality USA: California, San Francisco, lectotype sequenced as NVG-
22036H10) and instead belongs to Cercyonis meadii (W. H. Edwards, 1872) (type locality USA:
Colorado, Park Co. Bailey, lectotype sequenced as NVG-21011E01), being sister to all its other
subspecies in all three trees (Fig. 6 magenta) and thus is distinct from them. Therefore, we reinstate it as a
valid subspecies Cercyonis meadii mexicana R. Chermock, 1949, stat. rest.
The holotype of Hermeuptychia sinuosa Grishin, 2021
The original description illustrated the holotype of Hermeuptychia sinuosa Grishin, 2021 (type locality
Guatemala: El Progreso, Morazan) that was pinned through its side, unspread (Cong et al. 2021). Here,
we use this opportunity and publish photographs of the holotype after it has been spread (Fig. 7). Its
genitalia vial is pinned on the same pin as the specimen. The holotype is in the University of Texas Insect
Collection, Austin, TX, USA.
lee eee le ee ker .
Fig. 7. Holotype of Hermeuptychia sinuosa Grishin, 2021 dorsal (left) and ventral (right) views, data in text.
Family Hesperiidae Latreille, 1809
Aethilla toxeus Pl6tz, 1882, syn. nov. is a junior subjective synonym
of Cecropterus albociliatus (Mabille, 1877)
Genomic sequencing of the syntype of Aethilla toxeus Plotz, 1882 (NVG-15032A10, type locality in
Mexico) in MFNB reveals that it is clustered with Cecropterus albociliatus (Mabille, 1877) (type locality
in Colombia, Panama, and Guatemala) (Fig. 8 blue) and not within a species currently called Cecropterus
toxeus (Fig. 8 green and purple). The sequenced specimen is a syntype (possibly the only one ever in
existence) because it matches the original description and carries a label with the number 5054, as stated
in the description. In the interest of stability of nomenclature, N.V.G. hereby designates this specimen in
MENB, a female, bearing the following six rectangular labels, the first is red, the third is green, and others
are white: [ Typus ], [ 5054 |, [ Mexico Deppe ], [ toxeus | PI. | type 5054. |, [| {QR code} http://coll.mfn-
berlin.de/u/ | 940b65 |, and [ DNA sample ID: | NVG-15032A10 | c/o Nick V. Grishin | as the lectotype
of Aethilla toxeus Plétz, 1882. Because Ferdinand Deppe collected in Mexico in 1824—1829 (Stresemann
1954), the lectotype was likely collected during that time period. The lectotype is missing nearly all its
fringes (the white portion is represented literally by a couple of remaining scales), and all its wings except
the right forewing are chipped at the margins. However, paler postdiscal spots in forewing cells M3-CuA1
and CuAi-CuA2 overlap; therefore, this specimen keys out to Achalarus albociliatus in Evans (1952), and
not to Evans’ “Achalarus toxeus.” Therefore, Aethilla toxeus Pl6tz, 1882, syn. nov. is a junior subjective
synonym of Cecropterus albociliatus (Mabille, 1877).
12
a Zchromosome tree b mitochondrial genome tree
-CrOpleruS Markwalker [U. d. all
& a. albociliatus (=toxeus) [Cecropterus toxeus]|15032A10|LT|Mexico|MFNB
ecropterus albociliatus albociliatus|19013H04|Mexico:Tam|1974
"Becropterus albociliatus albociliatus|17113H10|Mexico:Tam|1974
ecropterus ar aIKe \,. a, alDOcilatus OUSS UI F EXICO: SON! ZU 10
C. a. albociliatus (=toxeus) [Cecropterus toxeus]|15032A10|LT|Mexico|MFNB
Cecropterus albociliatus albociliatus|19013H04|Mexico:Tam|1974
Cecropterus albociliatus albociliatus|17113H10|Mexico:Tam|1974
, Cecropterus albociliatus albociliatus|5749|07-SRNP-12984|Costa Rica|2007
Cecropterus albociliatus albociliatus|15032A09|?ST|"Hond."|MFNB
33 Cecropterus albociliatus nocera|15031H12|5053|ST|Colombia|MFNB
Cecropterus albociliatus nocera (=mithras)|15031C07|ST|Venezuela|MFNB
sar Cecropterus coyote [Cecropterus toxeus (=coyote)]|15095E12|ST|USA:TX|CMNH
sis Cecropterus coyote [Cecropterus toxeus]|19013G09|Mexico:NL|1979
Cecropterus coyote [Cecropterus toxeus]|19124A10|Mexico:Tam|1965
Cecropterus coyote [Cecropterus toxeus]|19013G10|Mexico:SLP|1980
bap, C&Cropterus coyote [Cecropterus toxeus]|13385A03|USA:TX, Brewster Co.|2004
Cecropterus coyote [Cecropterus toxeus]|3830|USA:TX, Starr Co,|2015
aaa CeCropterus nigrociliata[C. toxeus (=nigrociliata)]|18086A11|HT|Mexico|1905|MNHP
37 Cecropterus nigrociliata [Cecropterus toxeus]|14108E06|Mexico:Col|1953
Cecropterus nigrociliata [Cecropterus toxeus]|14108E05|Mexico:Col|1952
Cecropterus nigrociliata [Cecropterus toxeus]|14108E10|Mexico:Oax|1972
Cecropterus jalapus|17113H11|USA:TX,Hidalgo Co,|1973
Cecropterus jalapus|15032A11|ST|Mexico:Ver|MFNB
Cecropterus jalapus (=xerxes)|15104A07|HT |Belize|1906|AMNH
Cecropterus athesis|13386B08|Panama|1978
Cecropterus athesis (=motilones)|15095B01|HT|Venezuela|CMNH
Cecropterus athesis|13382E09|Venezuela|1989
ecropterus albociliatus albociliatus|15032A09|?ST|"Hond."|MFNB
ecropterus albociliatus albociliatus|5749|07-SRNP-12984|Costa Rica|2007
cbacbelieae albociliatus nocera|15031H12|5053|ST|Colombia|MFNB
ecropterus albociliatus nocera (=mithras)|15031C07|ST|Venezuela|MFNB
Cecropterus coyote [Cecropterus toxeus (=coyote)]|15095E 12|ST|USA:TX|CMNH
ecropterus coyote [Cecropterus toxeus]|3830|USA:TX, Starr Co.|2015
Gecropterus coyote [Cecropterus toxeus]|19013G10|/Mexico:SLP|1980
Gecropterus coyote [Cecropterus toxeus]|13385A03|USA:TX, Brewster Co.|2004
eat ieee coyote [Cecropterus toxeus]|19124A10|Mexico:Tam|1965
ecropterus coyote [Cecropterus toxeus]|19013G09|Mexico:NL|1979
DB eatin nigrociliata [C. toxeus (=nigrociliata)]|18086A11|HT|Mexico|1905|MNHP
ecropterus nigrociliata [Cecropterus toxeus]|14108E06|Mexico:Col|1953
tcecropterus nigrociliata [Cecropterus toxeus]|14108E05|Mexico:Col|1952
Cecropterus nigrociliata [Cecropterus toxeus]|14108E10|Mexico:Oax|1972
Cecropterus jalapus|17113H11|USA:TX,Hidalgo Co.|1973
yal seo St aa 5032A11|ST|Mexico:Ver|MFNB
noc ecropterus jalapus (=xerxes)|15104A07|HT|Belize|1906|AMNH
Cecropterus athesis|13386B08|Panama|1978
gecropterus athesis (=motilones)|15095B01|HT|Venezuela|CMNH
Cecropterus athesis|13382E09|Venezuela|1989
0.006 0.01
Fig. 8. Trees of selected Cecropterus species constructed from protein-coding regions in a. Z chromosome and b.
mitochondrial genome: C. markwalkeri sp. n. (red, highlighted in yellow), C. a/bociliatus (blue), C. coyote stat. rest. (green),
C. nigrociliata stat. rest. (purple), C. jalapus (cyan), and C. athesis (olive). Primary type specimens are labeled in magenta,
and a specimen curated as a possible syntype is labeled in plum color.
Cecropterus coyote (Skinner, 1892), stat. rest. and Cecropterus nigrociliata (Mabille &
Boullet, 1912), stat. nov. are species distinct from Aethilla toxeus Pl6tz, 1882
As shown above, a species currently known as Cecropterus toxeus (P16tz, 1882) (type locality in Mexico)
loses its name to Cecropterus albociliatus (Mabille, 1877) (type locality in Colombia, Panama, and
Guatemala) because the lectotype of the former is conspecific with the latter. The next oldest name for the
Species currently misidentified as C. toxeus 1s Cecropterus coyote (Skinner, 1892) (type locality in USA:
Southern Texas). Genomic sequencing of a syntype of Eudamus coyote places it in the clade with
specimens from the US and eastern Mexico that constitute a species distinct from others (Fig. 8 green).
Moreover, we find that the holotype of Murgaria albociliata var. nigrociliata Mabille & Boullet, 1912
(type locality in Mexico), a taxon currently regarded as a junior subjective synonym of Cecropterus
toxeus (Pl6tz, 1882) and, therefore, given our findings, possibly conspecific with C. coyote, is in the clade
sister to C. coyote, together with several specimens from southwestern Mexico (Fig. 8 purple). The two
clades differ genetically at the level characteristic of distinct species alike genetic differentiation between
sisters Cecropterus jalapus (Pl6tz, 1881) (Fig. 8 cyan) and Cecropterus athesis (Hewitson, 1867) (Fig. 8
olive). COI barcodes of the primary types of E. coyote and M. albociliata var. nigrociliata differ by 1.8%
(12 bp). Hence, we propose that Cecropterus coyote (Skinner, 1892), stat. rest. and Cecropterus
nigrociliata (Mabille & Boullet, 1912), stat. nov. are species-level taxa.
Cecropterus (Murgaria) markwalkeri Grishin, new species
http://zoobank.org/F 1805F4A-DB94-47C9-A 148-82B20B46BA6E
(Figs. 8 part, 9, 10a—b, 11)
Definition and diagnosis. Genomic sequencing of the subgenus Murgaria E. Watson, 1893 (type species
Telegonus albociliatus Mabille, 1877) reveals that two specimens from Sonora, Mexico are sister to a
compact clade of Cecropterus albociliatus (Mabille, 1877) (type locality in Colombia, Panama,
Guatemala) (Fig. 8). The latter clade included a specimen identified by Mabille as “Teleg. albociliatus”
and curated as a type, in addition to the lectotype of Aethilla toxeus Plotz, 1882 (type locality in Mexico)
and syntypes of Aethilla nocera Pl6tz, 1882 (type locality in Colombia) and Telegonus mithras Mabille,
1888 (type locality in Venezuela), the latter being a junior subjective synonym of the former, which is
regarded as a subspecies of C. albociliatus. The two specimens from Sonora (Fig. 8 red) show prominent
genetic differentiation from C. albociliatus (Fig. 8 blue) in the Z chromosome (Fsi/Gmin 0.61/0.001),
which is larger than that between Cecropterus jalapus (Pl6tz, 1881) (Fig. 8 cyan) and Cecropterus athesis
(Hewitson, 1867) (Fig. 8 olive). Therefore, the Sonoran specimens represent a species distinct from C.
13
albociliatus, and because no available name applies to this species, it is new. Curiously this new species
shares COI barcodes with its sister C. albociliatus (100% identical) but differs from it in male genitalia
morphology (Fig. 10). The new species keys to “Achalarus albociliatus albociliatus” C.17.3(a) in Evans
(1952) sharing with it the lack of costal fold, white (with a gray tint and some scales are more translucent)
hindwing and brownish forewing fringes, but differing in the shape of valva in male genitalia: the valva is
broader, ampulla is less developed, and is more in line with costa, separated from it by a slight concavity
(Fig. 10a), instead of ampulla strongly bulging posterodorsad, separated from costa by a large concavity
in C. albociliatus (Fig. 10c—e); harpe enlarged posteriad and broader, but relatively shorter compared to a
narrower and longer harpe of C. albociliatus. A diagnostic combination of nuclear genome characters is:
aly 1651.25.1:T210C, aly1539.8.1:C888T, aly1089.5.3:G91A, aly1089.5.3:G1I21A, aly1222.33.2:T630C.
eS & het Z >»
b : , d
Fig. 10. Genitalia of Cecropterus (Murgaria). a, b. C. markwalkeri sp. n. holotype in left lateral (a) and dorsal (b) views. c—e.
C. albociliatus albociliatus from Mexico: Veracruz, BMNH(E) 1717074, Godman’s mini-slide preparation [BMNH]: genital
capsule in left lateral view with left valva removed (c), left valva in right lateral view (d), and genitalia illustration from
Godman & Salvin (1894: pl. 80, fig. 14), not to scale (e). Photographs c and d are © The Trustees of the Natural History
Museum London and are made available under Creative Commons License 4.0 (https://creativecommons.org/licenses/by/4.0/).
14
Fig. 11. Possible Cecropterus markwalkeri sp. n. from Mexico: Sonora, La Aduana near Alamos, 27-Aug-2017, dorsal (left)
and ventral (right) views of the same individual, iNaturalist observation 105683875 © Ken Kertell, color-corrected. CC BY-
NC 4.0 https://creativecommons.org/licenses/by-nc/4.0/.
Barcode sequence of the holotype: Sample NVG-18033E11, GenBank 00311409, 658 base pairs:
AACCTTATATTTTATTTTTGGAATTTGAGCAGGATTAGTAGGAACTTCTTTAAGTTTACTTATTCGAACTGAAT TAGGAACTCCAGGATCTTTAATTGGAGATGATCAAATT TATAATACT
ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATGCCTATTATAAT TGGAGGATT TGGAAATTGACTAGTTCCCCTTATATTAGGAGCCCCTGACATAGCTTTCCCTCGTA
TAAATAATATAAGATTTTGATTATTACCCCCATCTTTAACTCTTTTAATT TCAAGAAGAAT TGTAGAAAATGGTGCAGGTACTGGATGAACAGTTTATCCCCCTTTATCCTCTAATATTGC
CCACCAAGGAGCATCAGTAGATTTAGCAATTTTTTCTTTACATTTAGCTGGAATTTCTTCTATTCTTGGAGCTATTAACTTTATTACAACTATTATTAATATACGAATTAATAATTTATCA
TTTGATCAAATACCATTATTTATTTGAGCTGTCGGAATTACAGCCTTATTATTATTACTT TCTTTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTT
CATTTTTTGATCCTGCCGGTGGAGGAGATCCTATTTTATATCAACATTTATTT
Type material. Holotype: & deposited in the National Museum of Natural History, Washington, DC,
USA [USNM], illustrated in Fig. 9, bears four printed labels: three white [ Palm Canyon | 19-IX-05
Mexico | Sonora | Lush habitat on | Ruta 16 at km 196 | Mark Walker leg. ], [ DNA sample ID: | NVG-
18033EI11 | c/o Nick V. Grishin |, [ DNA sample ID: | NVG-22031H04 | c/o Nick V. Grishin |, and one
red [| HOLOTYPE ¢@ | Cecropterus | markwalkeri Grishin |. The first NVG number corresponds to a
sampled leg, and the second is for the abdomen DNA extraction followed by genitalia dissection.
Paratype: lo NVG-18033E10 and NVG-22031H03, the same data as the holotype, but 17-Sep-2010.
Type locality. Mexico: Sonora, Rutal6 at km 196, elevation 896 m, approximate GPS 28.4856,
—109.3605.
Etymology. The name honors Mark Walker, who collected the type series on expeditions with and under
research permits to Paul A. Opler. Mark is a dedicated butterfly explorer who sampled specimens at many
points across the globe, contributing to our knowledge of Lepidoptera by discovering new localities and
range extensions. Mark passionately shares his adventures in words skillfully woven into lepisodes
(essays about field adventures in Lepidoptera) that many of us eagerly await and, more recently, in
pictures. Mark’s kindness in sharing his knowledge and field time with other enthusiasts is unsurpassed.
The name is a noun in the genitive case.
Distribution. Currently known only from the type locality in east-central Sonora, Mexico, but similar in
appearance specimens have been photographed at other places in Sonora (Fig. 11).
Nectaring plant of Epargyreus clarus californicus MacNeill, 1975
in British Columbia, Canada
The caption to figure 38 in Zhang et al. (2022b) stated that Epargyreus clarus californicus MacNeill,
1975 was “nectaring on giant vetch in Canada: British Columbia, Cortes Island”. Instead, the plant shown
is a native Fringed Bleeding Heart, Dicentra eximia (Ker-Gawl.) Torr. We thank Christian Gronau for
kindly informing us about this error.
15
Aguna malia Evans, 1952, stat. nov. is a species distinct
from Aguna megaeles (Mabille, 1888)
Genomic sequencing of Aguna megaeles (Mabille, 1888) (type locality in Brazil: Santa Catarina)
Specimens, including its lectotype (NVG-15029D11) reveals that Aguna megaeles malia Evans, 1952
(type locality in Venezuela) (Fig. 12 red) is genetically differentiated from the nominotypical subspecies
(Fig. 12 blue) at the level characteristic of species: e.g., their COI barcodes differ by 5.3% (35 bp).
Therefore, we propose that it is a species-level taxon Aguna malia Evans, 1952, stat. nov.
a Zchromosome tree b mitochondrial genome tree
ss,~«CAguna megaeles [A. megaeles megaeles]|15029D11|LT|Brazil:SC|old Aguna megaeles [A. megaeles megaeles]|15029D11|LT|Brazil:SC|old
7 Aguna megaeles [A. megaeles megaeles]|18016D02|Brazil:RJ|1995 | ‘Aguna megaeles [A. megaeles megaeles]|18016D01|Brazil:RJ|1995
; Aguna megaeles [A. megaeles megaeles]|18016D01|Brazil:RJ|1995 100 Aguna megaeles [A. megaeles megaeles]|18016D02|Brazil:RJ|1995
- Aguna malia [A. megaeles malia]|22018A04|Venezuela|old Aguna malia [A. megaeles malia]|22018A04|Venezuela|old
Aguna malia [A. megaeles malia]|17887G06|Venezuela
0,005 0.02
Aguna malia [A. megaeles malia]|17887G06|Venezuela
Fig. 12. Trees of Aguna species constructed from protein-coding regions in a. Z chromosome and b. mitochondrial genome: A.
megaeles (blue) and A. malia stat. nov. (red).
Polygonus arizonensis (Skinner, 1911), stat. nov., Polygonus histrio Rober, 1925, stat.
rest., Polygonus pallida Rober, 1925, stat. nov., and Polygonus hagar Evans, 1952,
Stat. nov. are species distinct from Polygonus leo (Gmelin, [1790])
Genomic sequencing and analysis of Polygonus leo (Gmelin, [1790]) (type locality America, likely in
Hispaniola) specimens from across the range reveal that all five subspecies of P. leo are genetically
differentiated at the species level in both nuclear (Fig. 13a) and mitochondrial (Fig. 13b) DNA. E.g., COI
barcodes of the closest taxa, 1.e., the nominotypical P. /eo (Fig. 13 purple) and Polygonus (Acolastus)
histrio Réber, 1925 (type locality “vermutlich aus Panama”, but likely Cuba as suggested by DNA
comparison) (Fig. 13 green) differ by 2.1% (14 bp). Therefore, we propose that Polygonus arizonensis
(Skinner, 1911), stat. nov., Polygonus histrio Rober, 1925, stat. rest., Polygonus pallida Rober, 1925,
stat. nov., and Polygonus hagar Evans, 1952, stat. nov. are species, not subspecies.
a Zchromosome tree b mitochondrial genome tree
Polygonus arizonensis [P. leo arizonensis]|15095E11|ST|USA:AZ,Pima Co.|old
Polygonus arizonensis [P. leo arizonensis]|19126F10|USA:TX,Presidio Co.|2019
Polygonus arizonensis [P. leo arizonensis]|17101G05|USA:AZ,Gila Co.|1960
Polygonus arizonensis [P. leo arizonensis]|17098B06|14-SRNP-55424|Costa Rica
Polygonus pallida [P. leo pallida]|18094F02|LT|Perulold
Polygonus pallida [P. leo pallida]|18094F03|PLT|Peru:Lima|old
Polygonus pallida [P. leo pallida]|17101G09|Venezuela|1985
Polygonus histrio [P. leo histrio]|18094E04|HT|"Panama"|old
Polygonus histrio [P. leo histrio]|17101HO2|Cuba|1943
Polygonus histrio [P. leo histrio]|5338|USA:FL,Monroe Co.
Polygonus leo [P. leo leoj|17101H07|Dominican Republic|1981
, Polygonus leo [P. leo leo]|17101HO9|British Virgin Islands|1986
Polygonus leo [P. leo leo]|17101H10|St. Eustatius|1981
3, Polygonus hagar [P. leo hagar]|17101H04|Jamaica|1986
Polygonus hagar [P. leo hagar]|10342|Jamaica|2017
Polygonus hagar [P. leo hagar]|10473|Jamaica|2017
ef olygonus arizonensis [P. leo arizonensis]|15095E11|ST|USA:AZ,Pima Co.
,Polygonus arizonensis [P. leo arizonensis]|17098B06|Costa Rica|2014
sPolygonus arizonensis [P. leo arizonensis]|19126F10|USA:TX, Presidio Co.
Polygonus arizonensis [P. leo arizonensis]|17101GO05|USA:AZ,Gila Co.
Rolygonus pallida [P. leo pallida]|18094F02|LT|Perulold
Polygonus pallida [P. leo pallida]|18094F03|PLT|Peru:Lima|old
Polygonus pallida [P. leo pallida]|17101G09|Venezuela|1985
Polygonus histrio [P. leo histrio]|18094E04|HT|"Panama" |old
ikolygonus histrio [P. leo histrio]]17101HO2|Cuba|1943
Polygonus histrio [P. leo histrio]|5338|USA:FL,Monroe Co.
Polygonus leo [P. leo leo]|17101HO7|Dominican Republic|1981
“’Polygonus leo [P. leo leo]|17101HO9|British Virgin Islands|1986
Polygonus leo [P. leo leo]|17101H10|St. Eustatius|1981
Polygonus hagar [P. leo hagar]|17101H04|Jamaica|1986
Polygonus hagar [P. leo hagar]|10342|Jamaica|2017
Polygonus hagar [P. leo hagar]|10473|Jamaica|2017
0.008
Fig. 13. Trees of Polygonus leo species complex constructed from protein-coding regions in a. Z chromosome and b.
mitochondrial genome: P. arizonensis stat. nov. (red), P. pallida stat. nov. (blue), P. histrio stat. rest. (green), P. /eo (purple),
and P. hagar stat. nov. (cyan). Primary type specimens are labeled in magenta.
Viola dagamba Steinhauser, 1989 is a new junior subjective synonym
of Viola kuma (Bell, 1942), comb. nov., stat. rest.
Sequencing of the holotypes of Viola dagamba Steinhauser, 1989 (type locality in Guyana), currently a
valid species, and Pellicia kuma Bell, 1942 (type locality in Venezuela), currently a junior subjective
synonym of Pachyneuria helena (Hayward, 1939) (type locality in Ecuador: Rio Topo) reveals that they
are conspecific (e.g., their COI barcodes are 100% identical) and belong to the genus Viola Evans, 1953
(type species Staphylus alicus Schaus, 1902), not Pachyneuria Mabille, 1888 (type species Pachyneuria
obscura Mabille, 1888) (Fig. 14). Therefore, we reinstate Viola kuma (Bell, 1942), comb. nov., stat. rest.
as a species and treat Viola dagamba Steinhauser, 1989, syn. nov. as its junior subjective synonym.
16
a Zchromosome tree b mitochondrial genome tree
Njola kuma [Pachyneuria helena (=kuma)]|18024HO7|HT|Venez
Viola kuma (=dagamba) [Viola dagamba]|15038E10|HT|Guyana
Viola egra|18061D03|Colombia|1969
Viola egra|20086A09|Colombia
{¥iola minor|18061D04|Brazil:RJ|1995
Viola minor|22042F11|Paraguaylold
Mjola violella|15098C05|Brazil:RO|1995
Viola violella|7973|Brazil:MT|1991
Viola olla|18061D06|Colombia|1969
Viola olla}18061D07|Colombia|1969
Pachyneuria obscura|15033D07|HT|Peru:Chanchamayolold
Pachyneuria duidae duidae|17105G03|Brazil:MT|1991
, Viola kuma [Pachyneuria helena (=kuma)]|18024HO7|HT|Venezuela|old
Viola kuma (=dagamba) [Viola dagamba]|15038E10|HT|Guyana|1980
Viola egra|18061D03|Colombia|1969 —
Viola egra|20086A09|Colombia 0.02
Viola minor|18061D04|Brazil:RJ|1995
Viola minor|22042F11|Paraguay|old
Viola violella]15098C05|Brazil:RO|1995
Viola violella|7973|Brazil:MT|1991
Viola olla}18061D06|Colombia|1969
Viola olla|18061D07|Colombia|1969
Pachyneuria obscura|15033D07|HT|Peru:Chanchamayolold
Pachyneuria duidae duidae|17105G03|Brazil:MT|1991
Fig. 14. Trees of Viola and Pachyneuria species constructed from protein-coding regions in a. Z chromosome and b.
mitochondrial genome: V. kuma comb. nov., stat. rest. (red) and Pachyneuria (blue).
Leucochitonea janice Ehrmann, 1907 is a junior subjective synonym of
Helitopetes alana (Reakirt, 1868) and not of Heliopetes petrus (Hiibner, [1819])
Genomic sequencing of the holotype of Leucochitonea janice Ehrmann, 1907 (NVG-15095C05, type
locality Venezuela: Suapure) (Fig. 15 magenta) in CMNH, a taxon treated by Mielke (2005) as a junior
subjective synonym of Heliopetes petrus (Htibner, [1819]) (type locality not given) (Fig. 15 red), reveals
that it is not conspecific with it and instead is placed among specimens of Heliopetes alana (Reakirt,
1868) (type locality in Colombia) (Fig. 15 blue) in both nuclear (Fig. 15a) and mitochondrial (Fig. 15b)
DNA trees. Therefore, we conclude that Leucochitonea janice Ehrmann, 1907 is a junior subjective
synonym of Heliopetes alana (Reakirt, 1868) and not of Heliopetes petrus (Hiibner, [1819]).
a Zchromosome tree b mitochondrial genome tree
Heliopetes alana|19091E06|Colombia|1977 Heliopetes alana|19091E06|Colombia|1977
Heliopetes alana|19091E08|French Guiana|1993 idleliopetes alana|19091E08|French Guiana|1993
Heliopetes alana|13383A03|Guyana|1999 atleliopetes alana|13383A03|Guyana|1999
Heliopetes alana (=janice) [H. petrus (=janice)]|15095C05|HT|Venezuela|1899 ,feliopetes alana (=janice) [H. petrus (=janice)]|15095C05|HT|Venez
Heliopetes alana|19091E07|Venezuela|1981 ,bleliopetes alana|19091E07|Venezuela|1981
Heliopetes chimbo|15092D10|Ecuador|1976 Heliopetes chimbo|15092D10|Ecuador|1976
Heliopetes chimbo|19091E02|Ecuador|1984 Heliopetes chimbo|19091E02|Ecuador|1984
Heliopetes chimbo|20017A05|Peru:Piura|2000 Heliopetes chimbo|20017A05|Peru:Piura|2000
Heliopetes ochroleuca|19041H12|Brazil:SP|old Heliopetes ochroleuca|19041H12|Brazil:SPlold
Heliopetes ochroleuca|19042A01|Argentina|1928 Heliopetes ochroleuca|19042A01|Argentina|1928
Heliopetes ochroleuca|19091E01|Brazil:MG|old fieliopetes ochroleuca|19091E01|Brazil:MG|old
Heliopetes petrus|17109G06|Bolivia|2003 Heliopetes petrus|17109G06|Bolivia|2003
Heliopetes petrus|19042A02|Brazil:PA|1919 ‘Heliopetes petrus|19042A02|Brazil:PA|1919
Heliopetes petrus|13383A01|Ecuador|2002 Heliopetes petrus|13383A01|Ecuador|2002
0.002
Fig. 15. Trees of Heliopetes species constructed from protein-coding regions in a. Z chromosome and b. mitochondrial
genome: H. alana (blue) with the holotype of Leucochitonea janice Ehrmann, 1907 (magenta), H. chimbo Evans, 1953 (green),
H. ochroleuca J. Zikan, 1938 (cyan), and H. petrus (red).
Tamela maura (Snellen, 1886), stat. rest., and Tamela diocles (Moore, [1866]), stat.
rest., are species distinct from Tamela othonias (Hewitson, 1878)
and Tamela nigrita (Latreille, [1824]), respectively
Based on COI barcodes and morphological evidence, Xue et al. (2022) suggested recently that Tamela
othonias (Hewitson, 1878) (type locality in Borneo) (Fig. 16 purple) and Tamela fumatus (Mabille, 1876)
(type locality in the Philippines) (Fig. 16 cyan) are species distinct from Tamela nigrita (Latreille, [1824])
a Zchromosome tree b mitochondrial genome tree
Tamela fumatus|21105A12|Philippines|old amela fumatus|21105B02|Philippines|old
Tamela fumatus|22048A01|Philippines|1945 iobamela fumatus|21105A12|Philippines|old
Tamela fumatus|21105B02|Philippines|old Tamela fumatus|22048A01|Philippines|1945
Tamela nigrita [T. nigrita nigrita]}18101C12|Javaljold Tamela nigrita [T. nigrita nigrita]|21105B04|Javalold
Tamela nigrita [T. nigrita nigrita]|21105B03|Java|old °Tamela nigrita [T. nigrita nigrita]|21105B03|Javalold
Tamela nigrita [T. nigrita nigrita]|21105B04|Java|old Tamela nigrita [T. nigrita nigrita]|18101C12|Javalold
Tamela othonias|18053B10|Borneo|1894 iamela othonias|18053B10|Borneo|1894
Tamela othonias|18053B11|Borneo|1889 Tamela othonias|18053B11|Borneo|1889
Tamela maura [T. othonias (=maura)]|17118G04|Malaya|1989 jJamela maura [T. othonias (=maura)]|17118G04|Malaya|1989
Tamela maura [T. othonias (=maura)]|19067B02|Malaysia|1992 Tamela maura [T. othonias (=maura)]|19067B02|Malaysia|1992
Tamela maura [T. othonias (=maura)]|22011F02|HT|Sumatra|1877 Tamela maura [T. othonias (=maura)]|22011F02|HT|Sumatra|1877
Tamela diocles [T. nigrita diocles]|18101C10|Indialold s,amela diocles [T. nigrita diocles]|21105A08|India:Sikkim|old
Tamela diocles [T. nigrita diocles]|21105A09|Northern India|old ihamela diocles [T. nigrita diocles]|21105A09|Northern Indialold
Tamela diocles [T. nigrita diocles]|21105A08|India:Sikkim|old Tamela diocles [T. nigrita diocles]|18101C10|India|old
0.007 0.03
Fig. 16. Trees of Tamela species constructed from protein-coding regions in a. Z chromosome and b. mitochondrial genome:
T. fumatus (cyan), T: nigrita (blue), T. othonias (purple), T; maura stat. rest. (red), and T. diocles stat. rest. (green).
17
(type locality in Java) (Fig. 16 blue). Our genomic results confirm that but also reveal that Tamela nigrita
diocles (Moore, [1866]) (type locality in Bengal) (Fig. 16 green) is not monophyletic with T. nigrita, but
instead is sister to Tagiades maura Snellen, 1886 (type locality in Sumatra) (Fig. 16 red), which Xue et al.
(2022) regarded as a junior subjective synonym of T. othonias. While the association of T. n. diocles with
T. nigrita is clearly wrong (Fig. 16), it is conceivable to place both 7. maura and T. n. diocles in T.
othonias as subspecies or synonyms. However, both taxa show genetic distinction from T. othonias, so we
propose treating them as distinct species: Tamela maura (Snellen, 1886), stat. rest. and Tamela diocles
(Moore, [1866]), stat. rest., separate from either 7. othonias or T. nigrita.
Hedone yunga Grishin, new species
http://zoobank.org/8575DF83-2451-49B 1-B6C4-AA4F9CS595FF 1
(Figs. 17 part, 18)
Definition and diagnosis. Genomic sequencing of Hedone Scudder, 1872 (type species Hesperia brettus
Boisduval & Le Conte, [1837]) reveals that one specimen from Bolivia was placed in the trees separately
from all others, being sister to Hedone catilina (Pl6tz, 1886) (type locality Brazil: Santa Catarina,
Blumenau; syntype NVG-18052B01 sequenced), but genetically differentiated from it at the level
characteristic of species (Fig. 17). E.g., its COI barcode differs from that of the H. catilina syntype by
3.3% (22 bp). Therefore, this specimen represents a new species. This new species keys to “Polites vibex
catilina”’ M.13.1(d) in Evans (1955) that is also known from Bolivia (Fig. 17) at a lower elevation but
differs from it in females (male unknown) by the pattern of the ventral hindwing, which is whiter (instead
a Zchromosome tree b mitochondrial genome tree
ton ~0 Heddone_vibex brettoides|15096FO2|LT|USA:TX Hedone vibex brettoides|15096FO2|LT|USA:TX
; o.2Hedone vibex brettoides|4117|USA:TX, Tyler Ca.|2015 edone vibex brettoides|4117|USA:TX, Tyler Co.|2015
9 species: o34Hedone vibex brettoides|4135|USA:TX,Tyler Co./2015 edone vibex brettoides|4135|USA:TX, Tyler Co.|2015
vibex «sz Hedone vibex brettoides|21049A11|USA:TX,Freestone Co.|1975 ®Hedone vibex brettoides|21049A11|USA:TX, Freestone Co.
Hedone vibex vibex|4784|USA:FL,Levy Co.|2015 Hedone vibex vibex|4784|USA:FL,Levy Co.|2015
Hedone vibex vibex|21049A12|USA:NC,Columbus Co.|1985 Hedone vibex vibex|21049A12|USA:NC,Columbus Co.
Hedone praeceps|4942|USA:TX,Hidalgo Co.|2015 Hedone catilina (=stigma)|15039A04|ST|"TX & NM"
Hedone praeceps|4476|USA:TX,San Patricio Co.|2015 100 | -Hedone catilina]21049A06|Guyana|1993
Hedone praeceps|3438|USA:TX,Cameron Co.|2015 edone catilina|18115E03|Brazil:MT|1990
Hedone praeceps (=hypozona)|15101C02|ST|Mexico:Gue|1916 Hedone catilina|18115E07|Argentina|1979
Hedone praeceps (=lumida)|15034G05|ST|Colombia|1876 sof Hedone catilina|18115E04|Brazil:RJ|1994
1 Hedone praeceps (=lumida)|15034G06|ST|Colombia|1876 edone catilina (=stigma)|15095GO01|ST|"TX & NM"
Hedone praeceps|18115D04|Venezuela|1988 58 Hedone catilina|18115E06|Argentina|2004
Hedone praeceps (=golenia)|18057D06|LT|Colombia|1876 °Hedone catilina|18115E05|Bolivia:Beni|1987
praeceps Hedone praeceps|18115D05|Trinidad|2000 Hedone catilina]21049A09|Guyana|1980
Hedone praeceps|21013B10|Trinidad|1933 Hedone catilina|21013B12|Peru|1920
Hedone praeceps|21013B08|Colombia Hedone vibicoides|22011C10|PT|Suriname|1964
Hedone praeceps|21013B09|Venezuela|1929 too Hedone vibicoides|22011F11|HT|Suriname|1964
Ay Hedone praeceps|18115D02|Panama|2007 Hedone vibicoides|18115D03|Venezuela|1985
Hedone praeceps|18115D06|Guyana|2000 }jedone praeceps|4476|USA:TX,San Patricio Co.|2015
: ——— Hedone praeceps|18013C10|Guyana|1999 ibbedone praeceps|3438|USA:TX,Cameron Co.|2015
Hedone calla|18115D08|Ecuador|1976 Hedone praeceps|4942|USA:TX,Hidalgo Co.|2015
TBD Hedone calla|21013B11|Ecuador|1964 Hedone praeceps|21013B10|Trinidad|1933
calla cae, Hedone calla|18115D09|Ecuador|1988 100 dledone praeceps|21013B09|Venezuela|1929
ee Hedone calla|21013C03|Peru:Lima|1920 4dedone praeceps (=golenia)|18057D06|LT|Colombia|1876
rer Hedone calla|18115D10|Ecuador|1976 *sHedone praeceps|18115D05|Trinidad|2000
Hedone calla|18115E01|Peru:Piura|2000 ‘Hedone praeceps (=lumida)|15034G06|ST|Colombia|1876
ibicoid a Hedone vibicoides|22011F11|HT|Suriname|1964 wledone praeceps|21013B08|Colombia
vibicoldes '—— Hedone vibicoides|22011C10|PT|Suriname|1964 _Hedone praeceps|18115D02|Panama|2007
Hedone vibicoides|18115D03|Venezuela|1985 pedene praeceps/18115D04|Venezuela|1988
Hedone catilina|18052B01|ST|Brazil:SC|1881 edone praeceps|18115D06|Guyana|2000
mites “37 ~«Hedone catilina|18115E04|Brazil:RJ|1994 Hedone praeceps (=lumida)|15034G05|ST|Colombia|1876
0 Hedone catilina (=stigma)|15039A04|ST|"TX & NM" Hedone praeceps (=hypozona)|15101C02|ST|Mexico:Gue
Hedone catilina|18115E05|Bolivia: Beni|1987 n *Hedone praeceps|18013C10|Guyana|1999
oyz, Hedone catilina|18115E02|Brazil:MT|1990 oo! 1obledone catilina|18052B01|ST|Brazil:SC|1881
Hedone catilina|18115E03|Brazil:MT|1990 Hedone catilina|21049A10|Peru:MD|1981
Hedone catilina|21013B12|Peru|1920 Hedone catilina/18115E02|Brazil:MT|1990
0.06 Hedone catilina|18115E06|Argentina|2004 Hedone calla|18115D10|Ecuador|1976
“s29-«Hedone catilina|21049A06|Guyana|1993 iMedone calla]18115D09|Ecuador|1988
7 1B Hedone catilina]21049A09|Guyana|1980 00 } Medone calla|21013B11|Ecuador|1964
catilina : Hedone catilina|18115E07|Argentina|1979 Hedone calla|18115E01|Peru:Piura|2000
1 Hedone catilina|21049A10|Peru:MD|1981 *Hedone calla|21013C03|Peru:Lima|1920
vunga Hedone catilina (=stigma)|15095GO1|ST|"TX & NM" Hedone calla|18115D08|Ecuador|1976
2. — — Hedone 127C i 9 Hedone yunga
: dictynna Hedone dictynna]/18115C07|St Vincent|1975 eee a dictynna|18115C07|St Vincent|1975
pa, Hedone dictynna|18115C08|Grenada|1986 iddedone dictynna|18115C08|Grenada|1986
ae Hedone dictynna|21013C04|Grenada Hedone dictynna|21013C04|Grenada
Hedone mira|21049A07|HT|Peru:Apurimac|1995 Hedone mira|21049A07|HT|Peru:Apurimac|1995
Hedone bittiae|18115D12|Ecuador|1975 ais pesone bittiae|21049A08|Peru:Lima|2011
bittiae| tou Hedone bittiae|18115D11|Ecuador|1975 edone bittiae|21013C02|PT|Peru|1920
aa Hedone bittiae|18115D07|Ecuador|2002 deledone bittiae|18115D11|Ecuador|1975
op Hedone bittiae|21013C02|PT|Peru|1920 ibbedone bittiae|18033G08|Peru|2009
ote Hedone bittiae|18033G08|Peru|2009 100 Hedone bittiae|21013C01|PT|Peru:Lima|1920
0.005 ne Hedone bittiae|21013C01|PT|Peru:Lima|1920 ee ap orene bittiae|18115D12|Ecuador|1975
Hedone bittiae|21049A08|Peru:Lima|2011 0.009 edone bittiae|18115D07|Ecuador|2002
Fig. 17. Trees of nine Hedone species constructed from protein-coding regions in a. Z chromosome and b. mitochondrial
genome: H. vibex (Geyer, 1832) (blue), H. praeceps Scudder, 1872 (red), H. calla (Evans, 1955) (green), H. vibicoides (de
Jong, 1983) (olive), H. catilina (Plotz, 1886) (cyan), H. yunga sp. n. (highlighted in lime color), H. dictynna (Godman &
Salvin, 1896) (orange), H. mira Grishin & Lamas, 2022 (magenta), and H. bittiae (Lindsey, 1925) (purple).
18
of yellower) overscaling, with more contrasty and better defined (rather than more diffuse) brown spots
and a darker area by the end of the discal cell. In the absence of known males and without probing female
variation, the most reliable identification is achieved by DNA, and a combination of the following base
pairs is diagnostic in the nuclear genome: aly86.14.2:A4695C, aly23605.1.46:T819C, aly23605.1.46:
G3606A, aly23605.1.46:T9O0A, aly23605.1.46:T2070G, aly127.52.1:T621T (not C), aly671.3.4:A189A
(not G), aly1139.42.1:C165C (not T), aly1060.6.1:C1050C (not T), aly1042.7.1:A2148A (not G), and
COI barcode: T4C, T412C, T406C, T547T, T646C.
be] Lm
Fig. 18. Holotype of Hedone yunga sp. n. dorsal (left) and ventral (right) views, data in text.
Barcode sequence of the holotype: Sample NVG-21127C12, GenBank OQ311411, 658 base pairs:
AACCTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGTTTATTAATTCGAACAGAAT TAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT
ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCTCCTGATATAGCTTTCCCTCGAA
TAAATAATATAAGATTTTGAATAT TACCCCCCTCAT TAACATTAT TAAT TTCAAGAAGAAT TGTAGAAAATGGT GCAGGAACAGGTTGAACAGTTTATCCTCCTTTATCTTCAAATATTGC
TCACCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTCTTCACTTAGCCGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAAT TAAAAATTTATCT
TTTGATCAAATACCTTTATTTGTATGATCTGTTGGAATTACAGCTCTTTTATTATTATTATCTTTACCTGTTTTAGCTGGAGCTATTACTATATTACTTACAGATCGAAATTTAAATACTT
CATTTTTTGATCCAGCAGGTGGAGGAGATCCAATTTTATACCAACATTTATTT
Type material. Holotype: 2 deposited in the Museum fiir Naturkunde, Berlin, Germany (MFNB),
illustrated in Fig. 18, bears the following five rectangular labels, four white: [San Antonio (1800) |
Bolivia (Yungas) | 1895—6. Garlepp |, [ Coll. | Staudinger |, [ | (no text on this label), [ DNA sample
ID: | NVG-21127C12 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ? | Hedone | yunga Grishin ].
Type locality. Bolivia: Yungas Region, La Paz Department, San Antonio.
Etymology. The name is given for the type locality. The name is a feminine noun in apposition.
Distribution. Currently known only from the holotype collected in the Yungas Region of Bolivia.
Comments. Without genomic sequencing that confidently supports the distinctness of this species based
on a single female specimen, it would have been a challenge to describe this species without finding other
Specimens, including its male. Although wing patterns of the female holotype are recognizably different
from other Hedone species, it is conceivable to hypothesize that it could have beeen an individual
variation or aberration. On another note, a comparison of nuclear (Fig. 17a) and mitochondrial (Fig. 17b)
DNA trees reveals incongruence typical for many species complexes in Lepidoptera and non-trivial
evolutionary scenarios of mitogenome evolution that is likely riddled with introgression: Hedone catilina
(Plétz, 1886) is polyphyletic (Fig. 17b cyan), and H. catilina with Hedone bittiae (Lindsey, 1925) (Fig.
17b purple) show several distinct mitogenome clusters that are not evident in nuclear DNA (Fig. 17a).
Similar scenarios have been documented in other species groups (Zakharov et al. 2009; Cong et al. 2017).
Vinuus phellus (Mabille, 1883), stat. rest. is a species distinct
from Vinius exilis (Pl6tz, 1883)
Genomic sequencing reveals prominent genetic differentiation between Hesperia exilis Plétz, 1883 (type
locality “Californien’, in error, a possible (as hypothesized by G. Lamas) syntype in MFNB from Brazil:
19
Santa Catarina sequenced as NVG-21116A10) (Fig. 19 blue), currently a valid species in the genus Vinius
Godman, 1900 (type species Vinius arignote Godman, 1900, which is a junior subjective synonym of #7.
exilis) and Pamphila phellus Mabille, 1883 (type locality “Malaisie”, in error, probably French Guiana:
Cayenne) (Fig. 19 red), currently a subspecies of the former species: e.g., their COI barcodes differ by 4%
(26 bp). Therefore, we propose that Vinius phellus (Mabille, 1883), stat. rest. is a species-level taxon.
a Zchromosome tree
Vinius exilis exilis]21116A10|?ST|Brazil:SC|old
.28
Vinius sophistes [V. t. tryhana]|19012F04|Mexico:SLP|1976
0.26
Vinius sophistes [V. t. tryhana]|19016E01|Mexico:SLP|1981
>, Vinius tryhana tryhana|19016E02|Suriname|1982
Vinius tryhana tryhana|21013G09|Guyanal|old
, Vinius phellus [V. exilis phellus]|21013G08|French Guiana|1917
" Vinius phellus [V. exilis phellus]|21046E04|French Guiana|1997
Vinius exilis exilis (=arignote)|21118D10|ST|Brazil:SClold
Vinius exilis exilis (=arignote)|21108C09|ST|Brazil:PA|old
Vinius sophistes [V. t. tryhana (=sophistes)]|18116D06|HT|Mexico:Ver|1908
Vinius sophistes [V. t. tryhana]|17111F04|Mexico:SLP|1981
* Vinius sophistes [V. t. tryhana]|19012F05|Mexico:Tam|1974
b mitochondrial genome tree
Vinius phellus [V. exilis phellus]|21013G08|French Guiana
Vinius phellus [V. exilis phellus]|21046E04|French Guiana
Ae Vinius exilis exilis}21116A10|?ST|Brazil:SC|old
Minius exilis exilis (=arignote)|21118D10|ST|Brazil:SClold
Vinius exilis exilis (=arignote)|21108C09|ST|Brazil:PA|old
Vinius sophistes[V. t. tryhana (=sophistes)]|18116D06|HT|Mex
Vinius sophistes [V. t. tryhana]|19016E01|Mexico:SLP|1981
“inius sophistes [V. t. tryhana]|17111F04|Mexico:SLP|1981
ToWinius sophistes [V. t. tryhana]]19012F04|Mexico:SLP|1976
Vinius sophistes [V. t. tryhana]]19012F05|Mexico:Tam
Minius tryhana tryhana|19016E02|Suriname|1982
Minius tryhana tryhana|21013G09|Guyanalold
0.008 Vinius tryhana tryhana|22023G05|French Guiana|2013 002 Vinius tryhana tryhana|22023G05|French Guiana|2013
Fig. 19. Trees of Vinius species constructed from protein-coding regions in a. Z chromosome and b. mitochondrial genome: V.
phellus (red), V. exilis (blue), V. sophistes (green), and V. tryhana (purple). Gaps in branches indicate where vertical slices of
the tree were removed to reduce its horizontal dimension (to allow an increase of the font size), 1.e., branches with gaps are
longer than shown.
Vinus sophistes (Dyar, 1918), stat. rest. is a species distinct
from Vinius tryhana (Kaye, 1914)
Genomic sequencing reveals prominent genetic differentiation between Padraona tryhana Kaye, 1914
(type locality in Trinidad) (Fig. 19 green), currently a valid species in the genus Vinius Godman, 1900
(type species Vinius arignote Godman, 1900, which is a junior subjective synonym of Hesperia exilis
Pl6tz, 1883) and Padraona sophistes Dyar, 1918 (type locality in Mexico: Veracruz) (Fig. 19 purple),
currently a junior subjective synonym of the former species: e.g., their COI barcodes differ by 3.6% (24
bp). Therefore, we propose that Vinius sophistes (Dyar, 1918), stat. rest. is a species-level taxon.
Rhinthon andricus (Mabille, 1895), stat. rest. and Rhinthon aqua (Evans, 1955),
Stat. nov. are Species distinct from Rhinthon braesia (Hewitson, 1867)
Genomic analysis of Rhinthon Godman, 1900 (type species Proteides chiriquensis Mabille, 1889, a junior
subjective synonym of Hesperia osca Pl6tz, 1882) specimens reveals that Proteides andricus Mabille,
1895 (type locality in Brazil: Santa Catarina) (Fig. 20 red) currently treated as a subspecies of Rhinthon
braesia (Hewitson, 1867) (type locality in Brazil: Para) (Fig. 20 blue) is not monophyletic with it and is
distinct from other species. Therefore, we reinstate it as a species-level taxon Rhinthon andricus (Mabille,
1895), stat. rest. Furthermore, Neoxeniades braesia aqua Evans, 1955 (type locality Colombia: Rio
Dagua) is genetically differentiated from the nominotypical R. braesia at the level characteristic of
distinct species (Fig. 20a, Fst/Gmin 0.48/0.003): e.g., compare with the pair Rhinthon molion (Godman,
1901) and Rhinthon bajula (Schaus, 1902). Therefore, we propose to treat Rhinthon aqua (Evans, 1955),
a. nuclear (autosomes) tree b mitochondrial genome tree
Rhinthon cubana|18013C05|Cubalold
Rhinthon osca|19024C08|Panama|1975
Rhinthon andricus [R. braesia andricus]|18119F12|Brazil:SC|old
Rhinthon andricus [R. braesia andricus]|21045HO7|Brazil:SC|1963
ighinthon osca|19024C08|Panama|1975
Rhinthon cubana|18013C05|Cuba|old
Rhinthon andricus [R. braesia andricus]|18119F12|Brazil:SClold
Rhinthon andricus [R. braesia andricus]|21045HO7|Brazil:SC|1963
Rhinthon molion|19024C11|Honduras|1980
Rhinthon molion|18119F05|08-SRNP-40405|Costa Rica|2008
Rhinthon bajula|19024D03|Peru|2001
Rhinthon bajula]18111D08|ST|Brazil:RJ|old
Rhinthon aqua [R. braesia aqua]|18119G01|Panama|1984
Rhinthon aqua [R. braesia aqua]|18119G02|Colombia|1972
Rhinthon braesia [R. braesia braesia]|18119F09|Peru|2002
0.005 Rhinthon braesia [R. braesia braesia]|18119F08|Brazil:RO|1995
Rhinthon molion|19024C11|Honduras|1980
Rhinthon molion|18119F05|08-SRNP-40405|Costa Rica|2008
MRhinthon bajula]18111D08|ST|Brazil:RJ|old
fehinthon bajula|19024D03|Peru|2001
sgninthon aqua [R. braesia aqua]|18119G01|Panama|1984
Rhinthon aqua [R. braesia aqua]|18119G02|Colombia|1972
RRhinthon braesia [R. braesia braesia]|18119F09|Peru|2002
Rhinthon braesia [R. braesia braesia]]18119F08|Brazil:RO|1995
Fig. 20. Trees of Rhinthon species constructed from protein-coding regions in a. autosomes and b. mitochondrial genome: R.
andricus stat. rest. (red), R. molion (green), R. bajula (olive), R. aqua stat. nov. (magenta), and R. braesia (blue).
stat. nov. as a species-level taxon. As a result of this analysis, R. braesia becomes monotypic. The taxon
originally proposed as Neoxeniades bajula peri (Evans, 1955) (type locality in Brazil: Para) has been
regarded as a valid species of Niconiades Hiibner, [1821] (type species Niconiades xanthaphes Hiibner,
[1821]) by Zhang et al. (2022a). Finally, we note that mitochondrial DNA is largely shared among four
species of Rhinthon (Fig. 20b), likely due to introgression.
The type locality of Dion uza (Hewitson, 1877) is likely in southern Brazil,
and Dion agassus (Mabille, 1891) is confirmed as a valid species
The lectotype of Hesperia uza Hewitson, 1877 (type locality not stated) in MFNB designated by Mielke
and Casagrande (2002) sequenced as NVG-18052D10 was subsequently designated as the neotype of
Hesperia pruinosa Plotz, 1882 (type locality South America) in Zhang et al. (2022a), and this species was
placed in the genus Dion Godman, 1901 (type species Carystus gemmatus Butler, 1872). The provenance
of this specimen is unknown: no locality data were given on its labels or in the original description.
Here, we report genomic sequencing of several Dion specimens we found in MFNB that were
collected at about the same time period as the D. uza lectotype. Although none of these specimens is as
uniformly blue on the ventral hindwing as the lectotype, three of them cluster closely with the lectotype in
both nuclear (Fig. 21a) and mitochondrial (Fig. 21b) DNA trees and therefore are conspecific with it.
According to their labels, all three specimens are from southern Brazil: Espirito Santo (Southeast region
of Brazil) and Santa Catarina (South region of Brazil). While it is not possible to pinpoint the type locality
of D. uza with better precision using these specimens due to their genetic similarities, it is most likely that
the lectotype was collected in southern Brazil, possibly in the states of Santa Catarina, Rio de Janeiro, or
Espirito Santo.
a Zchromosome tree
0,003
Dion uza|21127C07|Brazil:ES|old
Dion uza]21127C05|Brazil:SC|old
Dion uza|21127C01|Brazil:ES|old
Dion agassus|15036E10|LT|Brazil:AM|old
Dion agassus|21127C04|Brazil:PA|old
Dion agassus|19023G02|Brazil:AM|1993
Dion agassus|19023G01|French Guiana|1903
b mitochondrial genome tree
Dion uza (& =pruinosa)|18052D10|LT&NT|no data
wWion uza|21127C07|Brazil:ES|old
sa Dion uza|21127C05|Brazil:SC|old
Dion uza]21127C01|Brazil:ES|old
Dion uza (& =pruinosa)|18052D10|LT&NT|no data
0.02
4
Dion agassus|15036E 10|LT|Brazil:AM|old
Dion agassus|19023G01|French Guiana]1903
Dion agassus|21127C04|Brazil:PA|old
Dion agassus|19023G02|Brazil:AM|1993
Fig. 21. Trees of Dion species constructed from protein-coding regions in a. Z chromosome and b. mitochondrial genome: D.
za (red) and D. agassus (blue). Primary type specimens are labeled in magenta.
Furthermore, Zhang et al. (2022a) treated Dion agassus (Mabille, 1891) (type locality Brazil:
Amazonas, Massauary) as a species distinct from D. uza based on COI barcodes differences and
phenotypic comparison of their lectotypes. Here, we confirm this treatment based on genomic sequencing
of four specimens of each species (including their lectotypes) that support genetic distinction between the
two species (Fig. 21) and report that COI barcodes of lectotypes of Dion uza (Hewitson, 1877) and Dion
agassus (Mabille, 1891) differ by 2.9% (19 bp) (not 2.3% as stated in Zhang et al. (2022a) by mistake).
The COI barcode sequence of the lectotype/neotype of D. uza/H. pruinosa, sample NVG-18052D10,
GenBank accession 0Q311412, 658 base pairs is:
AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTCTAAGTTTATTAATTCGAACAGAATTAGGTAATCCTGGCTCTTTAATTGGAGATGATCAAATTTATAATACT
ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTCTAATACTAGGAGCACCTGATATAGCTTTCCCCCGAA
TAAATAATATAAGATTTTGAATACTGCCACCCTCCCTTATACTATTAACTTTTAGTAGAATTGTAGAAAGTGGAGCAGGTACTGGATGAACAGTTTATCCCCCTCTTTCTTCTAACATTGC
TCATCAAGGTTCTTCAGTTGATTTAGCAATTTTTTCATTACATTTAGCAGGAATTTCTTCTATTTTAGGTGCTATTAATTTTATTACAACAATTATTAACATACGAATTAAAAACTTATCA
TTTGATCAAATACCTTTATTTGTGTGATCTGTAGGTATTACAGCCTTATTATTACTATTATCTTTACCAGTATTAGCAGGAGCTATTACAATACTTCTTACTGATCGAAATTTAAATACTT
CTTTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
The COI barcode sequence of the lectotype of D.
OQ31 west 3099: base pairs is:
AACTTTATATTTTAT TATTTGAGCAGGAATAT
ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCTATT
TAAATAATATAAGATTTTGAATACTACCACCCTCCCTTATACTATT
TOATCAAGGTTCLTCAGTTGATTTAGCAATTTTTICATTACATTT
TTTGATCAAATACCTTTATTTGTGTGATCTGTAGGTATTACAGCCTT
CTTTTTTTGACCCAGCAGGAGGAGGAGATCCAATTTTATACCAACAT
TTAGGAACT TTACTAATTCGAACAGAATTAGGTAAT
TTEGAGGATTIGGTAATTGATTAGTOCCCTIT
TAGAAAATGGAGCAGGAACTGGAT
TTTAGGCGCTATTAATTTTAT
TACCAGTATTAGCAGGAGCTATT
TTAATTGGAGACGAT
TAGGAGCACCTGATAT
TACCCCCCTCTTT
TTAATATACGAAT
TTCTCACTGATCGAAATTT
Borna Grishin, new subgenus
http://zoobank. org/C86F2094-5A 1C-417C-AAC4-A9985ED28EDA
Type species. Godmania borincona Watson, 1937.
Definition. This subgenus is represented in all trees by a clade sister to all other known Choranthus
Scudder, 1872 (type species Hesperia radians Lucas, 1857) species (Fig. 22). Keys to M.24.6 in Evans
(1955). Distinguished from its relatives by the following combination of characters: mid-tibiae smooth,
ventral hindwing with dark, brownish (not bright orange) scales, in females uniformly colored, not much
paler by the anal margin, dorsal hindwing in females brown with orange overscaling; in males, subapical
orange spots on forewing form a nearly continuous orange band with other postdiscal spots; valva
terminally deeply indented, shaped like a crab-claw. In DNA, a combination of the following base pairs is
diagnostic in the nuclear genome: aly235.7.6:T37C, aly525.48.6:A129G, aly54.29.3:C201T, aly1022.
3.14:A90G, aly904.12.5:A78T, and COI barcode: GIOIA, T112C, T115C, A376C, C483T, T568C.
a. nuclear (autosomes) tree b mitochondrial genome tree
Borna subgen. n. Choranthus (Borna) borincona|18025E08|HT|Puerto Rico|1915
Choranthus (Borna) borincona|18117E11|Puerto Rico|1982
—— Choranthus (Lilla) lilliae|18026B09/HT|Jamaica|1931
Choranthus (Lilla) lilliae|18021FO05|Jamaica|1959
Choranthus (Choranthus) vitellius]18033G06|Puerto Rico|2015
Choranthus (Choranthus) haitensis|15095HO5|HT|Haiti|1917
Choranthus (Choranthus) melissa|19044C12|Dominican Republic|1990
Choranthus (Choranthus) richmondi|15096F11|HT|Bahamas
Choranthus (Choranthus) radians|18117F01|Cuba|2010
Choranthus (Asbolis) orientis orientis|21012F07|Cuba|1930
Choranthus (Asbolis) orientis eleutherae|18117D02|Bahamas|1978
Borna subgen. n. Choranthus (Borna) borincona|18025E08|HT|Puerto Rico|1915
Choranthus (Borna) borincona|18117E11|Puerto Rico|1982
Lilla subgen. 1.) Choranthus (Lilla) lilliae|18026B09|HT |Jamaica|1931
Choranthus (Lilla) lilliae|18021FO05|Jamaica|1959
Choranthus (Choranthus) vitellius|18033G06|Puerto Rico|2015
Choranthus (Choranthus) haitensis|15095HO5|HT|Haiti|1917
Choranthus (Choranthus) melissa|19044C12|Dominican Rep
Choranthus (Choranthus) richmondi|15096F11|HT|Bahamas
wa Choranthus (Choranthus) radians|18117F01|Cuba|2010
,Choranthus (Asbolis) orientis orientis|21012F07|Cuba|1930
7ooChoranthus (Asbolis) orientis eleutherae|18117D02|Bahamas|1978
Choranthus (Asbolis) antiqua|8060|Dominican Republic|1994 59 Choranthus (Asbolis) antiqua|8060|Dominican Republic|1994
Choranthus (Asbolis) jamaicensis|10491|Jamaica|2017 76 Choranthus (Asbolis) jamaicensis|10491|Jamaica|2017
Choranthus (Asbolis) capucinus|4881|USA:FL,Monroe Co.|2015 Choranthus (Asbolis) capucinus|4881|USA:FL,Monroe Co,|2015
007 Choranthus (Asbolis) capucinus|18057A05|Cuba|2013 a Choranthus (Asbolis) capucinus|18057A05|Cuba|2013
Fig. 22. Trees of Choranthus species constructed from protein-coding regions in a. autosomes and b. mitochondrial genome
colored by subgenus: Borna subgen. n. (green), Lilla subgen. n. (red), Choranthus (blue), and Asbolis (purple).
Etymology. The name is a feminine noun in the nominative singular formed from the type species name
Bor|inco]na.
Species included. Only the type species.
Parent taxon. Genus Choranthus Scudder, 1872.
Lilla Grishin, new subgenus
http://zoobank.org/7AAEDCAD-E796-4E4E-B3F8-3 7ZEFEDSBCF15
Type species. Choranthus lilliae Bell, 1931.
Definition. This subgenus is represented in the autosome genes tree by a clade sister to all other known
Choranthus Scudder, 1872 (type species Hesperia radians Lucas, 1857) species except those in the sub-
genus Borna subgen. n. (Fig. 22). Keys to M.24.5 in Evans (1955). Distinguished from its relatives by the
following combination of characters: mid-tibiae smooth, ventral hindwing with dark, brownish (not bright
orange) scales, in females uniformly colored, not much paler by the anal margin, dorsal hindwing in
females brown with a weak orange postdiscal band; in males, subapical orange spots on forewing clearly
separated from other orange spots; uncus undivided, rounded, valva nearly elliptical in shape, terminally
rounded, harpe not separated from the ampulla. In DNA, a combination of the following base pairs is
diagnostic in the nuclear genome: aly1449.3.1:G59C, aly1603.21.2:C96T, aly145.9.4:GI1OISA, aly2487.
37.1:A115T, aly274.10.13:C109T, and COI barcode: A43T, T121C, A274T, T367C, A430G, T533C.
Etymology. The name is a feminine noun in the nominative singular formed from the type species name
Lillfija{e].
Species included. Only the type species.
Parent taxon. Genus Choranthus Scudder, 1872.
age
Asbolis Mabille, 1904 is a subgenus of Choranthus Scudder, 1872
Both Asbolis Mabille, 1904-[IV]| (type and the only species Goniloba sandarac Herrich-Schaffer, 1865, a
junior subjective synonym of Eudamus capucinus Lucas, 1857) and Pyrrhocalles Mabille, 1904-[V] (type
species Pamphila antiqua Herrich-Schaffer, 1863) were regarded by Zhang et al. (2022a) as junior
subjective synonyms of Choranthus Scudder, 1872 (type species Hesperia radians Lucas, 1857) due to
their genetic similarities. Nevertheless, while being very closely related to each other (COI barcodes differ
by 5.6%, 37 bp), contrasting with their difference in appearance, Asbolis and Pyrrhocalles show larger
genetic differentiation from Choranthus in the nuclear genome (Fig. 22). Treating Asbolis combined with
Pyrrhocalles as a subgenus would mean that the clades of C. borincona and C. lilliae should be
considered subgenera as well, because Asbolis is closer related to Choranthus than Choranthus to C.
borincona and C. lilliae. Presently, because these two clades have been defined as subgenera Borna
subgen. n. and Lil/a subgen. n., it is meaningful to propose that Asbolis Mabille, 1904 is a subgenus of
Choranthus Scudder, 1872 rather than its synonym (Fig. 22). Then, due to genetic similarities, we treat
Pyrrhocalles as a junior (by about a month) subjective synonym of Asbolis. As a result, the subgenus
Asbolis consists of all taxa listed by Mielke (2005) under Pyrrhocalles and Asbolis.
ACKNOWLEDGMENTS
We acknowledge Ping Chen and Ming Tang for their excellent technical assistance. We are grateful to
David Grimaldi and Courtney Richenbacher (AMNH: American Museum of Natural History, New York,
NY, USA), Jason Weintraub (ANSP: The Academy of Natural Sciences of Drexel University,
Philadelphia, PA, USA), Blanca Huertas, David Lees, and Geoff Martin (BMNH: Natural History
Museum, London, UK), Jim Fetzner, Bob Androw, Vanessa Verdecia, Cat Giles, and the late John
Rawlins (CMNH: Carnegie Museum of Natural History, Pittsburgh, PA, USA), Chuck Harp, and the late
Boris Kondratieff (CSUC: C.P. Gillette Museum of Arthropod Diversity, Department of Agricultural
Biology, Colorado State University, Fort Collins, CO, USA), Jason Dombroskie (CUIC: Cornell
University Insect Collection, Ithaca, New York, USA), Crystal Maier and Rebekah Baquiran (FMNH:
Field Museum of Natural History, Chicago, IL, USA), Weiping Xie (LACM: Los Angeles County
Museum of Natural History, Los Angeles, CA, USA), Théo Léger, Wolfram Mey, and Viola Richter
(MFNB: Museum fiir Naturkunde, Berlin, Germany), Andrei Sourakov, Andrew D. Warren, Debbie
Matthews-Lott, Riley J. Gott, and Keith R. Willmott (MGCL: McGuire Center for Lepidoptera and
Biodiversity, Gainesville, FL, USA), Rodolphe Rougerie (MNHP: Muséum National d'Histoire Naturelle,
Paris, France), Matthias Nuss (MTD: Museum fiir Tierkunde, Dresden, Germany), Gerardo Lamas
(MUSM: Museo de Historia Natural, Lima, Peru), Rob de Vos (RMNH: Naturalis Biodiversity Center,
Leiden, Netherlands), Edward G. Riley, Karen Wright, and John Oswald (TAMU: Texas A&M
University Insect Collection, College Station, TX, USA), Alex Wild (TMMC: University of Texas
Biodiversity Center, Austin, TX, USA), Jeff Smith and Lynn Kimsey (UCDC: Bohart Museum of
Entomology, University of California, Davis, CA, USA), Robert K. Robbins, John M. Burns, and Brian
Harris (USNM: National Museum of Natural History, Smithsonian Institution, Washington, DC, USA),
Axel Hausmann, Andreas Segerer, and Ulf Buchsbaum (ZSMC: Zoologische Staatssammlung Miinchen,
Germany), for granting access to the collections under their care, sampling specimens, and stimulating
discussions; to Bill R. Dempwolf, Howard Grisham, Crispin S. Guppy, Robb Hannawacker, Bernard
Hermier, Steve Kohler, Kiyoshi Maruyama, and Mark Walker for specimens and leg samples, to Bernard
Hermier and Jonathan Pelham for critical review of the manuscript and discussions. Evi Buckner-Opler
assisted by providing emotional and logistic support and helped to collect specimens. We are indebted to
the California Department of Fish and Game for collecting permit SC13645, Texas Parks and Wildlife
Department (Natural Resources Program Director David H. Riskind) for the research permit 08-02Rev, to
U. S. National Park Service for the research permits: Big Bend (Raymond Skiles) for BIBE-2004-SCI-
0011 and Yellowstone (Erik Oberg and Annie Carlson) for YELL-2017-SCI-7076, and to the National
23
Environment & Planning Agency of Jamaica for the permission to collect specimens. Please note that
photographs from iNaturalist (2022) reproduced in this work and photographs ©The Trustees of the
Natural History Museum, London are made available under Creative Commons License 4.0
(https://creativecommons.org/licenses/by/4.0/), which means in particular that when using the images you
must give appropriate credit and provide a link to the license. We acknowledge the Texas Advanced
Computing Center (TACC) at The University of Texas at Austin for providing HPC resources. This study
was supported in part by the HHMI Investigator funds and by grants from the National Institutes of
Health GM127390 and the Welch Foundation I-1505.
LITERATURE CITED
Ballmer, G. R. 2022. Life History and Ecology of the San Emigdio Blue Butterfly (Lepidoptera:
Lycaenidae). The Taxonomic Report of the International Lepidoptera Survey 10(9): 1-16.
Cong, Q., E. P. Barbosa, M. A. Marin, A. V. L. Freitas, G. Lamas, and N. V. Grishin. 2021. Two
new species of Hermeuptychia from North America and three neotype designations
(Nymphalidae: Satyrinae). The Taxonomic Report of the International Lepidoptera Survey 9(7):
1-20.
Cong, Q., J. Shen, D. Borek, R. K. Robbins, P. A. Opler, Z. Otwinowski, and N. V. Grishin. 2017.
When COI barcodes deceive: complete genomes reveal introgression in hairstreaks. Proceedings
of the Royal Society B: Biological Sciences 284(1848): 20161735.
Cong, Q., J. Zhang, and N. V. Grishin. 2019a. Genomic determinants of speciation. bioRxiv
BIORXIV/2019/83 7666.
Cong, Q., J. Zhang, J. Shen, and N. V. Grishin. 2019b. Fifty new genera of Hesperiidae (Lepidoptera).
Insecta Mundi 0731: 1—56.
Evans, W. H. 1952. A catalogue of the American Hesperiidae indicating the classification and
nomenclature adopted in the British Museum (Natural History). Part II. Pyrginae. Section I. The
Trustees of the British Museum (Natural History); London. v + 178 pp., pls. 10—25.
Evans, W. H. 1955. A catalogue of the American Hesperiidae indicating the classification and
nomenclature adopted in the British Museum (Natural History). Part IV. Hesperiinae and
Megathyminae. The Trustees of the British Museum (Natural History); London. v + 499 pp., pls.
54-88.
Farfan, J., J. Cerdefia, W. Huanca-Mamani, H. A. Vargas, G. L. Goncalves, and G. R. P. Moreira.
2022a. Host plant variation and lack of genetic differentiation in populations of Dione (Agraulis)
dodona Lamas & Farfan (Lepidoptera: Nymphalidae). Insects 13(819): 1-14.
Farfan, J., J. Cerdefia, H. A. Vargas, G. L. Goncalves, G. Lamas, and G. R. P. Moreira. 2022b. A
peculiar new species of Dione (Agraulis) Boisduval & Le Conte (Lepidoptera: Nymphalidae:
Heliconiinae) associated with Malesherbia Ruiz & Pavon (Passifloraceae) in xeric western slopes
of the Andes. Zookeys 1113: 199-227.
Godman, F. D., and O. Salvin. 1894. Pl. 80 in Biologia Centrali-Americana. Insecta. Lepidoptera-
Rhopalocera. Dulau & Co., Bernard Quaritch; London. v. 3 (plates).
Hoang, D. T., O. Chernomor, A. von Haeseler, B. Q. Minh, and L. S. Vinh. 2018. UFBoot2:
Improving the Ultrafast Bootstrap Approximation. Molecular Biology and Evolution 35(2): 518—
522.
iNaturalist. 2022. A Community for Naturalists — 1Naturalist. Available from https://www.inaturalist.org.
Accessed 30 January 2023.
Li, W., Q. Cong, J. Shen, J. Zhang, W. Hallwachs, D. H. Janzen, and N. V. Grishin. 2019. Genomes
of skipper butterflies reveal extensive convergence of wing patterns. Proceedings of the National
Academy of Sciences of the United States of America 116(13): 6232-6237.
24
Lukhtanov, V. A., and A. V. Gagarina. 2022. Molecular Phylogeny and Taxonomy of the Butterfly
Subtribe Scolitantidina with Special Focus on the Genera Pseudophilotes, Glaucopsyche and
Iolana (Lepidoptera, Lycaenidae). Insects 13(12): 1110.
Mielke, O. H. H. 2005. Catalogue of the American Hesperioidea: Hesperiidae (Lepidoptera). Sociedade
Brasileira de Zoologia; Curitiba, Parana, Brazil. xiii + 1536 pp.
Mielke, O. H. H., and M. M. Casagrande. 2002. Notas taxonédmicas em Hesperiidae neotropicais, com
descricdes de novos taxa (Lepidoptera). Revista brasileira de Zoologia 19(Suplemento 1): 27—76.
Nabokov, V. 1945. Notes on the Morphology of the Genus Lyceides (Lycenide, Lepidoptera). Psyche:
A Journal of Entomology 51(3/4): 104-138.
Nunez, R., K. R. Willmott, Y. Alvarez, J. A. Genaro, A. R. Pérez-Asso, M. Quejereta, T. Turner, J.
Y. Miller, C. Brévignon, G. Lamas, and A. Hausmann. 2022. Integrative taxonomy clarifies
species limits in the hitherto monotypic passion-vine butterfly genera Agraulis and Dryas
(Lepidoptera, Nymphalidae, Helicontinae). Systematic Entomology 47(1): 152-178.
Pelham, J. P. 2022. Catalogue of the Butterflies of the United States and Canada. Revised 2 February
2022. <http://www. butterfliesofamerica.com/US-Can-Cat.htm> Accessed 30 January 2023.
Penz, C. M. 2022. Reinstated status of the butterfly genus Agraulis (Lepidoptera, Nymphalidae,
Heliconiinae). Zootaxa 5209(3): 394-398.
Scott, J. A. 1986. The Butterflies of North America: A Natural History and Field Guide. Standford
University Press; Stanford, CA. xiii + 583 pp
Shen, J., Q. Cong, D. Borek, Z. Otwinowski, and N. V. Grishin. 2017. Complete genome of Achalarus
lyciades, the first representative of the Eudaminae subfamily of skippers. Current Genomics 18(4):
366-374.
Stresemann, E. 1954. Ferdinand Deppe's travels in Mexico, 1824-1829. Condor 56(2): 86—92.
Talavera, G., V. A. Lukhtanovy, N. E. Pierce, and R. Vila. 2012. Establishing criteria for higher-level
classification using molecular data: the systematics of Polyommatus blue butterflies (Lepidoptera,
Lycaenidae). Cladistics 29: 166-192.
Xue, G., P. Qu, M. Li, H. Chiba, and W. Li. 2022. Molecular and morphological evidences confirm the
statuses of Ancistroides othonias (Hewitson, 1878) and the subspecies of A. nigrita (Latreille,
[1824]), sensu Evans 1949 (Lepidoptera, Hesperiidae). Zootaxa 5205(5): 481—490.
Zakharov, E. V., N. F. Lobo, C. Nowak, and J. J. Hellmann. 2009. Introgression as a likely cause of
mtDNA paraphyly in two allopatric skippers (Lepidoptera: Hesperiidae). Heredity (Edinb) 102(6):
590-599.
Zhang, J., Q. Cong, and N. V. Grishin. 2023. Thirteen new species of butterflies (Lepidoptera:
Hesperiidae) from Texas. Insecta Mundi 0969: 1-58.
Zhang, J., Q. Cong, J. Shen, and N. V. Grishin. 2022a. Taxonomic changes suggested by the genomic
analysis of Hesperiidae (Lepidoptera). Insecta Mundi 0921: 1-135.
Zhang, J., Q. Cong, J. Shen, P. A. Opler, and N. V. Grishin. 2019. Changes to North American
butterfly names. The Taxonomic Report of the International Lepidoptera Survey 8(2): 1-11.
Zhang, J., Q. Cong, J. Shen, P. A. Opler, and N. V. Grishin. 2020. Genomic evidence suggests further
changes of butterfly names. The Taxonomic Report of the International Lepidoptera Survey 8(7):
1-40.
Zhang, J., Q. Cong, J. Shen, P. A. Opler, and N. V. Grishin. 2021. Genomics-guided refinement of
butterfly taxonomy. The Taxonomic Report of the International Lepidoptera Survey 9(3): 1—54.
Zhang, J., Q. Cong, J. Shen, L. Song, R. Gott, J., P. Boyer, C. S. Guppy, S. Kohler, G. Lamas, P. A.
Opler, and N. V. Grishin. 2022b. Taxonomic discoveries enabled by genomic analysis of
butterflies. The Taxonomic Report of the International Lepidoptera Survey 10(7): 1-59.
Zhang, J., Q. Cong, J. Shen, L. Song, and N. V. Grishin. 2022¢c. Genomic DNA sequencing reveals
two new North American species of Staphylus (Hesperiidae: Pyrginae: Carcharodini). The
Taxonomic Report of the International Lepidoptera Survey 10(4): I-13.
25
The Taxonomic Report
is a platinum open access peer-reviewed publication of
The International Lepidoptera Survey (TILS)
The International Lepidoptera Survey is registered as a non-profit Limited Liability Company (LLC) in
the state of Virginia, U.S.A. The Taxonomic Report (TTR), ISSN 2643-4776 (print) / ISSN 2643-4806
(online) is published for the purpose of providing a public and permanent scientific record. Articles are
peer-reviewed but not necessarily through the anonymous editor-mediated review process. Typically, the
authors are encouraged to solicit reviews of their manuscripts from knowledgeable lepidopterists before
submission. TTR appears in digital, open-access form, is disseminated as a hardcopy to select institutional
repositories, and is available as printed copy upon request at the discretion of authors and/or the editor.
Printing and postage charges may apply. An initial run of 25 copies is printed on paper to meet ICZN
Code recommendation 8B. All published TTR articles are freely available at the archival TTR website
(http:/lepsurvey.carolinanature.com/report.html) and via the following digital repositories:
Internet Archive (https://archive.org/)
Biodiversity Heritage Library (https://www.biodiversitylibrary.org)
Zobodat (https://www.zobodat.at/)
Zenodo (https://zenodo.org)
Digital Commons (https://digitalcommons.unl.edu)
TILS Purpose
TILS is devoted to the worldwide collection of Lepidoptera for the purpose of scientific discovery,
determination, and documentation, without which there can be no preservation.
TILS Motto
“As a world community, we cannot protect that which we do not know”
Articles for publication are sought
Manuscripts may deal with any area of research on Lepidoptera, including faunal surveys, conservation
topics, life histories and foodplant records, matters of nomenclature, descriptions of new taxa, methods,
etc. Taxonomic papers are particularly welcome. There are no publication charges for authors. Before
submitting a manuscript, email TTR editor, Harry Pavulaan, 606 Hunton Place NE, Leesburg, VA,
20176, USA at
[email protected] (cc: to
[email protected] if you do not receive a reply
within one week) to initiate discussion on how to best handle your material for publication, and to discuss
peer review options.
Visit The International Lepidoptera Survey on the World Wide Web at:
http://lepsurvey.carolinanature.com
&
Join the discussion at our list serve on Groups.1o at:
https://groups.io/g/TILS
You can subscribe by sending an email to:
[email protected]
&
Join The International Lepidoptera Survey on Facebook at:
https://www.facebook.com/groups/1072292259768446
26